Novel microorganisms of the genus Kinneretia, compositions containing the microorganisms, and devices using the microorganisms

Abstract

To search for a microorganism having highly functionalized purification performance of waste water, and provide a highly functionalized technique of a purification apparatus by using the microorganism while using an existing apparatus as it is.SOLUTION: An isolated microorganism has the following characteristic (1) or (2): (1) a base sequence of 16S rDNA includes a base sequence shown by sequence number 1; (2) a base sequence of 16S rDNA has 90% or more of homology with the base sequence shown by sequence number 1, the microorganism belongs to the genus Kinneretia, and has organic substance reduction activity and microorganism coagulation activity.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a novel microorganism of the genus Kinneretia (Accession No. NITE P-03538) having high organic matter reduction activity and high microbial aggregation activity, a composition containing the microorganism, and an apparatus using the microorganism.

Background Art

[0002] Currently, most of the organic wastewater discharged from food factories, sewage treatment facilities, etc. is treated by microorganisms. In particular, many food factories enhance production efficiency by conducting cooking intensively in one place, and there is a strong trend towards large-scale manufacturing facilities and 24-hour operation. Along with this, the load on wastewater treatment facilities has increased dramatically, and since the discharge regulation values are also tending to be revised to stricter values by laws and regulations, there is a need for larger and more highly functional wastewater treatment facilities. However, since expanding or adding wastewater treatment facilities incurs significant costs, another means has been sought. One of the alternative means is to use bacteria with highly functional wastewater treatment capabilities.

[0003] Previously, attempts have been made to search for beneficial microorganisms for efficiently treating organic matter by microorganisms. For example, Patent Document 1 discloses microorganisms belonging to the genus Candida for decomposing oil-containing substances such as wastewater containing oil such as fats and oils and mineral oils. However, in many cases, it is necessary to agglomerate suspended solids contained in the wastewater with a flocculant before decomposition by microorganisms and separately treat them as sludge, and problems in terms of cost remain. To date, practical microorganisms capable of treating wastewater containing organic matter and treatment methods using them have not yet reached a satisfactory level.

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Summary of the Invention

[0005] In view of the above situation, an object of the present invention is to search for microorganisms with highly functionalized processing capabilities, and to develop a microbial wastewater treatment technology that realizes the high functionality of treatment facilities by using these microorganisms while keeping existing facilities as they are. [Means for Solving the Problems]

[0006] In order to solve the above problems, the present inventors conducted intensive research, isolated microorganisms from rivers in Japan, and succeeded in isolating novel microorganisms having a high treatment capacity equivalent to that of existing wastewater treatment materials in meat processing wastewater. Furthermore, the microorganism had aggregability not found in the microorganisms contained in existing wastewater treatment materials. In addition, as a result of analyzing the nucleotide sequence of the 16S rDNA of the microorganism, it was found that the microorganism is a novel microorganism of the genus Kinneretia. Furthermore, when a wastewater treatment test was attempted using meat processing wastewater in an existing facility using the microorganism, more wastewater could be treated than before while satisfying the discharge standard value. As a result, due to the amazing high efficiency of the microorganism, the running cost of the wastewater treatment facility could be reduced to about 1 / 4 of the conventional level.

[0007] Based on the above findings, the present invention has been completed. That is, the present invention is as follows: [1] An isolated microorganism having the following characteristic (1) or (2): (1) The nucleotide sequence of 16S rDNA contains the nucleotide sequence represented by SEQ ID NO: 1. (2) The nucleotide sequence of 16S rDNA has 90% or more homology with the nucleotide sequence represented by SEQ ID NO: 1, and the microorganism belongs to the genus Kinneretia and has organic matter reducing activity and microbial aggregating activity. [2] The microorganism according to [1], which exhibits the following mycological properties. (1) Colony morphology Diameter: less than 1 mm Color tone: cream Shape: circular Bulging state: Central depression Periphery: Entire margin Surface shape: Smooth Transparency: Opaque Viscosity: Butter-like (2) Growth temperature: 20 - 45 °C (3) Cell morphology: Bacillus (4) Gram stainability: - (5) Presence or absence of spore formation: - (6) Motility: + (7) Catalase reaction: + (8) Oxidase reaction: + (9) Acid / gas production from glucose: - / - (10) Oxidation / fermentation test of glucose: - / - (In the above, "+" indicates positive and "-" indicates negative respectively.) [3] Isolated Kinneretia microorganism with deposit number NITE P - 03538 [4] An organic matter reducer containing the microorganism described in any one of [1] to [3] [5] A microbial aggregating agent containing the microorganism described in any one of [1] to [3] [6] A method for reducing organic matter, comprising contacting the microorganism described in any one of [1] to [3] with a sample containing organic matter [7] A method for aggregating microorganisms, comprising contacting the microorganism described in any one of [1] to [3] with a sample containing microorganisms [8] A wastewater purification device comprising the following: (1) The microorganism described in any one of [1] to [3], and (2) A microbial treatment tank for reducing organic matter and / or aggregating microorganisms in wastewater by treating the wastewater with the microorganism in (1) [9] The device according to [8], further comprising at least one selected from the following: (A) A pump tank for storing wastewater and sending it to other tanks (B) A culture tank for pre-growing the microorganism described in any one of [1] to [3] (C) A solid-liquid separation tank for separating aggregated microorganisms from the wastewater treated by microorganisms (D) A settling tank that stores and discharges the wastewater treated with the aggregated microorganisms, (E) A sludge storage tank that stores the separated aggregated microorganisms, (F) A reaction tank that aggregates the suspended substances and n-Hex in the wastewater by treating the wastewater with a flocculant, and (G) A dissolved air flotation device that separates the aggregated suspended substances and aggregated n-Hex from the wastewater treated with the flocculant.

[10] The apparatus according to [8], further comprising: (A) A pump tank that stores the wastewater and sends water to other tanks, (B) A culture tank that pre-grows the microorganism according to any one of [1] to [3], (C) A solid-liquid separation tank that separates the aggregated microorganisms from the wastewater treated with the microorganisms, (D) A settling tank that stores and discharges the wastewater treated with the microorganisms from which the aggregated microorganisms have been separated, and (E) A sludge storage tank that stores the separated aggregated microorganisms. [Advantages of the Invention]

[0008] The isolated Kinneretia microorganism with accession number NITE P-03538 has a wastewater treatment capacity equivalent to that of existing wastewater treatment materials. Moreover, surprisingly, it can aggregate other types of microorganisms and solid components together, so there is no need to pre-treat the wastewater with a flocculant before performing treatment with the microorganism. As a result, by using this microorganism, the cost of wastewater treatment can be significantly reduced without omitting the pretreatment and without modifying the existing drainage facilities. This microorganism contributes to the sustainable development goals (SDGs: Sustainable Development Goals), and in particular, it can contribute to the 6th goal "Ensure availability and sustainable management of water and sanitation for all" and the 12th goal "Ensure sustainable production and consumption patterns" listed as SDG global indicators. [Brief Description of the Drawings]

[0009]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

MODE FOR CARRYING OUT THE INVENTION

[0010] Provided is an isolated microorganism (the microorganism of the present invention) having the following characteristic (1) or (2). (1) The nucleotide sequence of 16S rDNA contains the nucleotide sequence represented by SEQ ID NO: 1. (2) The nucleotide sequence of 16S rDNA has 90% or more homology with the nucleotide sequence represented by SEQ ID NO: 1, and the microorganism belongs to the genus Kinneretia and has organic matter reducing activity and microbial aggregation activity.

[0011] The microorganism of the present invention is a microorganism (the microorganism I of the present invention) in which the nucleotide sequence of 16S rDNA contains the nucleotide sequence represented by SEQ ID NO: 1.

[0012] The preparation of the 16S rDNA fraction can be carried out using a known method such as the ethanol precipitation method. However, using a commercially available DNA extraction kit (e.g., achromopeptidase; manufactured by FUJIFILM Wako Pure Chemical Industries, Ltd., etc.), high-purity total DNA can be prepared quickly and easily from a small amount of sample. The nucleotide sequence of the obtained DNA can be determined by known means.

[0013] As described above, using the nucleotide sequence represented by SEQ ID NO: 1 obtained from the 16S rDNA of the microorganism I of the present invention as a query sequence, and as a result of performing a BLAST homology search against the international nucleotide sequence database (DDBJ / ENA (EMBL) / GenBank), the nucleotide sequence of the 16S rDNA of the microorganism I of the present invention is the reference strain KIN192 of Kinneretia asaccharophila TIt was found that the 16S rDNA nucleotide sequence of (accession number AY136099) showed 99.6% homology. Furthermore, in the molecular phylogenetic tree analyzed based on the nucleotide sequence obtained from a homology search against DB-BA 15.0 (TechnoSuruga Laboratory) using a microbial identification system (analysis software: ENKI), the microorganism I of the present invention was found to be included within the cluster formed by the Comamonadaceae family. Microorganisms included in the Comamonadaceae family include microorganisms belonging to the genus Kinneretia (1 genus, 1 species), the genus Mitsuaria, the genus Pelomonas, the genus Roseteles, and the like. From the above results, the microorganism I of the present invention is a novel microorganism belonging to the genus Kinneretia, which is closely related to K. asaccharophila.

[0014] The inventors of the present invention deposited the microorganism I of the present invention on September 24, 2021, at the Patent Microorganisms Depositary, National Institute of Technology and Evaluation (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) under the accession number NITE P-03538.

[0015] The microorganism of the present invention may also be a microorganism (microorganism II of the present invention) having a nucleotide sequence of 16S rDNA with 90% or more homology to the nucleotide sequence represented by SEQ ID NO: 1, belonging to the genus Kinneretia, and having an activity of reducing organic matter and an activity of aggregating microorganisms.

[0016] The microorganism II of the present invention has a nucleotide sequence of 16S rDNA that usually has homology of about 90% or more, preferably about 95% or more, more preferably about 98% or more, to the nucleotide sequence represented by SEQ ID NO: 1 and belongs to the genus Kinneretia.

[0017] The homology of the nucleotide sequences in this specification can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; allowing gaps; filtering = ON; match score = 1; mismatch score = -3).

[0018] As other algorithms for determining the homology of nucleotide sequences, for example, the algorithms described in Karlin et al., Proc. Natl. Acad. Sci. USA, 90: 5873-5877 (1993) [this algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997))], the algorithm described in Needleman et al., J. Mol. Biol., 48: 444-453 (1970) [this algorithm is incorporated into the GAP program in the GCG software package], the algorithm described in Myers and Miller, CABIOS, 4: 11-17 (1988) [this algorithm is incorporated into the ALIGN program (version 2.0) which is part of the CGC sequence alignment software package], the algorithm described in Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444-2448 (1988) [this algorithm is incorporated into the FASTA program in the GCG software package], etc. can be mentioned, but are not limited thereto.

[0019] The microorganism of the present invention has an activity of reducing organic substances. Examples of the organic substances reduced by the microorganism of the present invention include lipids, proteins, organic acids, carbohydrates, sugar alcohols, etc. Examples of carbohydrates include D-glucose, etc. Examples of organic acids include potassium gluconate, etc.

[0020] The microorganism of the present invention also has microbial aggregation activity. The microorganism of the present invention secretes a biopolymer outside the microorganism in the growth environment, adsorbs to each other through the biopolymer, forms aggregates, and can adsorb and precipitate other surrounding microorganisms and solids. Other microorganisms are not particularly limited, but include microorganisms that are preferably removed for hygiene reasons. Such microorganisms include, for example, Microorganisms of the genus Bacillus (e.g., Bacillus cereus, etc.), Microorganisms of the genus Candida (e.g., Candida spp., etc.), Microorganisms of the genus Campylobacter (e.g., Campylobacter jejuni, etc.), Microorganisms of the genus Clostridioides (e.g., Clostridioides difficile, etc.), Microorganisms of the genus Clostridium (e.g., Clostridium welchii, etc.), Microorganisms of the genus Cutibacterium (e.g., Cutibacterium acnes, etc.), Microorganisms of the genus Enterococcus (e.g., Enterococcus spp., etc.), Microorganisms of the genus Escherichia (e.g., Escherichia coli, etc.), Microorganisms of the genus Helicobacter (e.g., Helicobacter pylori, etc.), Microorganisms of the genus Pseudomonas (e.g., Pseudomonas aeruginosa, etc.), Microorganisms of the genus Salmonella (e.g., Salmonella enteritidis, etc.), Microorganisms of the genus Staphylococcus (e.g., Staphylococcus spp., etc.), Microorganisms of the genus Streptococcus (e.g., Streptococcus spp., etc.), Microorganisms of the genus Trichophyton (e.g., Trichophyton rubrum, etc.), Microorganisms of the genus Vibrio (e.g., Vibrio parahaemolyticus, etc.), etc., but are not limited thereto.

[0021] The microorganism of the present invention also exhibits the following mycological properties. (1) Colony morphology When the microorganism of the present invention is cultured on New Entrient agar at 30 °C for 48 hours, the colonies formed exhibit the following characteristics under observation with a stereomicroscope. Diameter: less than 1 mm Color tone: cream color Shape: circular Raised state: sunken in the center Periphery: entire edge Surface shape: smooth Transparency: opaque Viscosity: butter-like (2) Growth temperature The microorganism of the present invention can grow at 15 to 50°C. (3) Cell morphology Under morphological observation with an optical microscope, the cell morphology of the microorganism of the present invention is bacillus. (4) Gram stainability The microorganism of the present invention is a Gram-negative microorganism. (5) Spore formation The microorganism of the present invention does not form spores. (6) Motility The microorganism of the present invention has motility. (7) Catalase reaction The microorganism of the present invention shows a catalase reaction. (8) Oxidase reaction The microorganism of the present invention shows an oxidase reaction. (9) Acid / gas production from glucose The microorganism of the present invention does not produce acid or gas from glucose. (10) Oxidation / fermentation test of glucose The microorganism of the present invention does not oxidize or ferment glucose.

[0022] The microorganism of the present invention further shows the following biochemical properties. (1) Nitrate reduction reaction The microorganism of the present invention shows a nitrate reduction reaction. (2) Indole production reaction The microorganism of the present invention does not show an indole production reaction. (3) D-glucose acidification reaction The microorganism of the present invention does not show a D-glucose acidification reaction. (4) Arginine dihydrolase The microorganism of the present invention does not show arginine dihydrolase activity. (5) Urease The microorganism of the present invention does not show urease activity. (6) Esculin hydrolysis reaction The microorganism of the present invention does not show an esculin hydrolysis reaction. (7) Gelatin hydrolysis reaction The microorganism of the present invention does not show gelatin hydrolysis reaction. (8) Cytochrome oxidase The microorganism of the present invention shows cytochrome oxidase activity. (9) Alkaline phosphatase The microorganism of the present invention shows alkaline phosphatase activity. (10) Esterase (C4) The microorganism of the present invention shows esterase (C4) activity. (11) Esterase (C8) The microorganism of the present invention does not show esterase (C8) activity. (12) Lipase (C14) The microorganism of the present invention does not show lipase (C14) activity. (13) Leucine arylamidase The microorganism of the present invention shows leucine arylamidase activity. (14) Valine arylamidase The microorganism of the present invention shows valine arylamidase activity. (15) Cystine arylamidase The microorganism of the present invention does not show cystine arylamidase activity. (16) Trypsin The microorganism of the present invention shows trypsin activity. (17) α-Chymotrypsin The microorganism of the present invention does not show α-chymotrypsin activity. (18) Acid phosphatase The microorganism of the present invention shows acid phosphatase activity. (19) Naphthol-AS-BI-phosphohydrolase The microorganism of the present invention shows naphthol-AS-BI-phosphohydrolase activity. (20) α-Galactosidase The microorganism of the present invention does not show α-galactosidase activity. (21) β-Galactosidase The microorganism of the present invention does not show β-galactosidase activity. (22) β-Glucuronidase The microorganism of the present invention does not exhibit β-glucuronidase activity. (23) α-Glucosidase The microorganism of the present invention does not exhibit α-glucosidase activity. (24) β-Glucosidase The microorganism of the present invention does not exhibit β-glucosidase activity. (25) N-Acetyl-β-glucosaminidase The microorganism of the present invention does not exhibit N-acetyl-β-glucosaminidase activity. (26) α-Mannosidase The microorganism of the present invention does not exhibit α-mannosidase activity. (27) α-Fucosidase The microorganism of the present invention does not exhibit α-fucosidase activity.

[0023] The microorganism of the present invention further exhibits the following assimilation properties. (1) D-Glucose The microorganism of the present invention exhibits D-glucose assimilation property. (2) L-Arabinose The microorganism of the present invention does not exhibit L-arabinose assimilation property. (3) D-Mannose The microorganism of the present invention does not exhibit D-mannose assimilation property. (4) D-Mannitol The microorganism of the present invention does not exhibit D-mannitol assimilation property. (5) N-Acetyl-D-glucosamine The microorganism of the present invention does not exhibit N-acetyl-D-glucosamine assimilation property. (6) Maltose The microorganism of the present invention does not exhibit maltose assimilation property. (7) Potassium gluconate The microorganism of the present invention exhibits potassium gluconate assimilation property. (8) n-Capric acid The microorganism of the present invention does not exhibit n-capric acid assimilation property. (9) Adipic acid The microorganism of the present invention does not exhibit adipic acid-assimilating ability. (10) dl-Malic acid The microorganism of the present invention does not exhibit dl-malic acid-assimilating ability. (11) Sodium citrate The microorganism of the present invention does not exhibit sodium citrate-assimilating ability. (12) Phenyl acetate The microorganism of the present invention does not exhibit phenyl acetate-assimilating ability.

[0024] The microorganism of the present invention can be a variant of the microorganism of the present invention (the variant of the present invention). The variant is not particularly limited as long as it is a strain derived from the microorganism of the present invention. For example, in terms of morphological characteristics, stainability, growth ability, nutritional requirements, genetic characteristics, physiological characteristics, and biochemical characteristics, etc., it can show one or more similar properties to the microorganism of the present invention and can be a strain that retains the desired properties of the microorganism of the present invention. Examples of the desired properties include organic matter reduction activity, microbial aggregation activity, catalase reactivity, oxidase reactivity, nitrate reduction reactivity, cytochrome oxidase activity, alkaline phosphatase activity, esterase (C4) activity, leucine arylamidase activity, valine arylamidase activity, proteolytic activity, acid phosphatase activity, naphthol-AS-BI-phosphohydrolase activity, carbohydrate-assimilating ability, organic acid-assimilating ability, lipid-assimilating ability, etc.

[0025] The variant of the present invention can be obtained by subjecting the microorganism of the present invention to a mutagenesis treatment known per se and selecting a strain having an equivalent or more desired effect than the parent strain. The organic matter reduction activity can be tested, for example, using total organic carbon, biochemical oxygen demand or chemical oxygen demand as an index, but is not limited thereto, and any method known per se may be used.

[0026] The variant of the present invention can be prepared, for example, by modifying the microorganism of the present invention. Examples of such modification treatments include culturing in the presence of a mutagenic substance, etc., disruption of genes possessed by the microorganism of the present invention, and combinations of these operations.

[0027] Here, examples of mutagens include, but are not limited to, alkylating agents (such as N-methyl-N'-nitro-N-nitrosoguanidine (NTG), ethyl methanesulfonate (EMS), etc.), nucleotide base analogs (such as bromouracil, etc.), nitroso compounds, DNA intercalators, DNA cross-linking agents, radiation, ultraviolet rays, etc. Preferably, the mutant has an increased desired effect compared to the parent strain, or their effects are equivalent, but it is, for example, a strain that has other advantageous effects such as being able to grow in a wide pH range, having a fast growth rate, being able to grow even at low temperatures, etc.

[0028] The microorganism of the present invention or its mutant can be cultured by a method known per se used for culturing microorganisms belonging to the genus Kinneretia in general. Those skilled in the art can appropriately select the medium to be used for culturing. Examples of the medium include M9 medium (minimal medium), KL medium, BHI medium, 2YT medium, YPD medium, AM3 medium, LB medium, etc. The culture time, culture scale, etc. can be appropriately set according to the use of the culture. The culture temperature is usually about 15 to about 50 °C, preferably about 20 to about 45 °C, more preferably about 25 to about 40 °C, and even more preferably about 25 to about 35 °C. Also, the medium is usually adjusted to pH 3 to 10.

[0029] The culture of the microorganism of the present invention or its mutant can be carried out, for example, by putting a certain amount of medium into a culture vessel such as a test tube or a culture flask, inoculating the microorganism of the present invention or its mutant, and using a test tube shaker, a Simpro shaker, a rotary shaker, etc. to perform shaking culture at about 15 to about 50 °C under aerobic conditions. Larger-scale culture can be carried out by aeration and agitation culture using a large-scale culture tank such as a several-liter jar fermenter or an industrial tank on the scale of several hundred liters to several hundred tons. The culture time is not particularly limited.

[0030] As described above, since the microorganism of the present invention has an organic matter reducing activity and a microorganism aggregating activity, it can be used for the purpose of reducing organic matter and / or aggregating microorganisms from a sample containing organic matter and / or microorganisms. Therefore, the present invention also provides an organic matter reducing agent (the organic matter reducing agent of the present invention) or a microorganism aggregating agent (the microorganism aggregating agent of the present invention) containing the microorganism of the present invention.

[0031] The organic matter reducing agent of the present invention or the microorganism aggregating agent of the present invention can be obtained by preparing the culture solution obtained as described above as it is or after appropriate treatment into any appropriate dosage form as the organic matter reducing agent of the present invention or the microorganism aggregating agent of the present invention. As a method for treating the culture solution, for example, the culture solution can be diluted with water or an appropriate diluent (for example, an isotonic buffer solution, a medium, etc.) until an appropriate microorganism concentration is obtained. Alternatively, the culture solution can be filtered or centrifuged to recover the microorganisms and resuspended in an appropriate dispersion medium (for example, an isotonic buffer solution, a fresh medium, etc.). Furthermore, the recovered microorganisms can be lyophilized by a conventional method. Alternatively, 10-20% glycerol can be added to the culture solution, frozen and stored at -80°C, thawed at the time of use, and resuspended in a medium or the like for use.

[0032] The dosage form of the organic matter reducing agent of the present invention or the microorganism aggregating agent of the present invention may be various dosage forms such as a liquid agent, a powder agent, a granule agent, a wettable powder, a granule wettable powder (dry flowable), a flowable agent (suspension agent), an emulsion, an emulsion, a microcapsule agent, etc., as long as the desired effect is not impaired.

[0033] The organic matter reducing agent of the present invention or the microorganism aggregating agent of the present invention may contain a carrier in addition to the microorganism of the present invention or its mutant strain, as long as the desired effect is not impaired. As a carrier that can be used, any solid or liquid can be used as long as it is commonly used when treating a sample containing organic matter and microorganisms, and it is not limited to a specific one.

[0034] Examples of the solid carrier include mineral carriers (such as clay, talc, calcium carbonate, diatomaceous earth, zeolite, bentonite, acid clay, activated clay, attapulgite clay, vermiculite, perlite, pumice, silica sand, silica, white carbon, titanium dioxide, etc.), plant carriers (such as wood powder, corn stalk (cob), walnut shell (nut husk), fruit pit, sawdust, wood chips, bran, soybean powder, powdered cellulose, starch, dextrin, saccharides (such as glucose, maltose, lactose, sucrose, etc.), etc. of inert powders or granular substances, water-soluble polymer gels such as agar, etc. and various polymer powders such as chlorinated polyethylene, chlorinated polypropylene, polyvinyl acetate, polyvinyl chloride, ethylene-vinyl acetate copolymer, urea-aldehyde resin, etc.).

[0035] Examples of the liquid carrier include water, alcohols, polyhydric alcohols, polyhydric alcohol derivatives, ketones, esters, nitrogen-containing carriers, oils and fats, etc. Specifically, ethanol, isopropanol, cyclohexanol, ethylene glycol, diethylene glycol, propylene glycol, hexylene glycol, polyethylene glycol, polypropylene glycol, propylene-based glycol ethers, cyclohexanone, γ-butyrolactone, fatty acid methyl esters (methyl ester of coconut oil fatty acid), dibasic acid methyl esters (dimethyl succinate, dimethyl glutamate, dimethyl adipate), N-alkylpyrrolidone, coconut oil, soybean oil, rapeseed oil, etc. are included.

[0036] In addition to the microorganism of the present invention or its mutant strain, the organic matter reducing agent or the microbial flocculant of the present invention may contain other organic matter reducing agents or microbial flocculants.

[0037] The sample containing organic matter and / or microorganisms may be a solid sample or a liquid sample. Examples of the solid sample containing organic matter and / or microorganisms include, for example, garbage, compost, manure, etc. Examples of the liquid sample containing organic matter and / or microorganisms include, for example, industrial wastewater, agricultural wastewater, domestic wastewater, water in the ocean, river, lake, etc.

[0038] The organic matter reducing agent or the microbial aggregating agent of the present invention obtained as described above can reduce the organic matter in a sample and aggregate the microorganisms by contacting with a sample containing organic matter and / or microorganisms. Therefore, the present invention also provides a method for reducing organic matter (the organic matter reducing method of the present invention) including contacting the microorganism of the present invention with a sample containing organic matter. Further, the present invention provides a method for aggregating microorganisms (the microbial aggregating method of the present invention) including contacting the microorganism of the present invention with a sample containing microorganisms.

[0039] As long as the desired effect is achieved, the method of contacting the microorganism of the present invention with a sample containing organic matter and / or microorganisms is not particularly limited. For example, when the target sample is a solid sample containing organic matter and / or microorganisms, the organic matter reducing agent or the microbial aggregating agent of the present invention may be directly sprayed onto the solid sample using a sprayer or the like, or the solid sample may be suspended in water or the like and mixed with the organic matter reducing agent or the microbial aggregating agent of the invention. When the target sample is a liquid sample containing organic matter and / or microorganisms, the organic matter reducing agent or the microbial aggregating agent of the present invention may be directly added to the liquid sample and mixed.

[0040] When treating a liquid sample, for example, with the organic matter reducing agent or the microbial aggregating agent of the present invention, the microbial concentration contained in the amount of the organic matter reducing agent or the microbial aggregating agent of the present invention is usually 1.0 x 10 6 cells / mL~1.0 x 10 8 cells / mL.

[0041] The timing of treating the sample with the organic matter reducing agent or the microbial aggregating agent of the present invention is not particularly limited as long as the desired effect is achieved, and it can be used at any timing.

[0042] There is no particular limitation on the frequency of use of the organic matter reducing agent or the microbial aggregating agent of the present invention.

[0043] The present invention also provides a wastewater purification apparatus (the wastewater purification apparatus of the present invention) using the microorganism of the present invention. Examples of the wastewater containing organic substances and / or microorganisms to be treated by the wastewater purification apparatus of the present invention include industrial wastewater, agricultural wastewater, domestic wastewater, water in the ocean, rivers, lakes, etc. Purification means that the amount of organic substances and / or microorganisms contained in the wastewater is completely or partially decomposed or removed.

[0044] The wastewater purification apparatus of the present invention includes the following. (1) The microorganism of the present invention. (2) A microbial treatment tank that reduces the organic substances in the wastewater and / or aggregates the microorganisms by treating the wastewater with the microorganism of the present invention.

[0045] The wastewater purification apparatus of the present invention includes a microbial treatment tank (the microbial treatment tank of the present invention) that reduces the organic substances in the wastewater and / or aggregates the microorganisms by treating the wastewater (microbial treatment) with the microorganism of the present invention. The microorganism of the present invention can be reduced by assimilating the organic substances contained in the wastewater, and can also aggregate other microorganisms contained in the wastewater as aggregated microorganisms by the aggregation of the microorganism of the present invention itself. Therefore, the microorganism of the present invention can purify the wastewater. The wastewater purified by the microbial treatment tank of the present invention is sent to the solid-liquid separation tank described later or can be discharged into the sewage as long as it meets the environmental standards. Examples of the environmental standards include biochemical oxygen demand (BOD), suspended solids (SS), normal hexane extract content (n-Hex), coliform count, etc.

[0046] The microbial treatment tank of the present invention may include a diffuser device connected to an air agitation blower. By spraying the air sent from the air agitation blower from the diffuser device, the microorganism of the present invention and the wastewater are agitated, and the treatment efficiency of the wastewater by the microorganism of the present invention is increased.

[0047] The microbial treatment tank of the present invention is classified into a carrier flow tank, an aeration tank, and a contact oxidation tank according to its form. When the microbial treatment tank of the present invention is a carrier flow tank, it may contain a floating solid carrier. The solid carrier that can be used is not particularly limited as long as it is a floating solid carrier capable of supporting the microorganisms of the present invention. Examples include mineral carriers (clay, talc, calcium carbonate, diatomaceous earth, zeolite, bentonite, acid clay, activated clay, attapulgite clay, vermiculite, perlite, pumice, silica sand, silica, white carbon, titanium dioxide, etc.), plant carriers (inert powders or granules such as wood powder, corn stalk (cob), walnut shell (nut husk), fruit stone, sawdust, wood chips, bran, soybean powder, powdered cellulose, starch, dextrin, saccharides (such as glucose, maltose, lactose, sucrose), etc.), water-soluble polymer gels such as agar, and various polymer powders such as chlorinated polyethylene, chlorinated polypropylene, polyvinyl acetate, polyvinyl chloride, ethylene-vinyl acetate copolymer, urea-aldehyde resin, etc.). When the microbial treatment tank of the present invention is an aeration tank, instead of the above carrier, a part of the aggregated microorganisms precipitated or captured in the solid-liquid separation tank described later can be used as a carrier supporting the microorganisms of the present invention. When the microbial treatment tank of the present invention is a contact oxidation tank, it may include a fixed bed. The fixed bed that can be used is not particularly limited as long as it is a fixed carrier capable of supporting the microorganisms of the present invention, and examples include the same as the floating carrier.

[0048] The wastewater purification device of the present invention further includes at least one selected from the following. (A) A pump tank for storing wastewater and supplying water to other tanks. (B) A culture tank for pre-growing the microorganisms of the present invention. (C) A solid-liquid separation tank for separating aggregated microorganisms from the wastewater treated by microorganisms. (D) A discharge tank for storing and discharging the wastewater treated by microorganisms from which the aggregated microorganisms have been separated. (E) A sludge storage tank for storing the separated aggregated microorganisms. (F) A reaction tank for aggregating suspended substances and n-Hex in the wastewater by treating the wastewater with a flocculant. (G) A pressurized flotation device that separates aggregated suspended matter and aggregated n-Hex from the wastewater treated with the flocculant. Further, the wastewater purification device of the present invention preferably includes the following among the above: (A) A pump tank that stores wastewater and sends water to other tanks. (B) A culture tank that pre-grows the microorganisms of the present invention. (C) A solid-liquid separation tank that separates the aggregated microorganisms from the wastewater treated with microorganisms. (D) A discharge tank that stores and discharges the wastewater treated with microorganisms from which the aggregated microorganisms have been separated. (E) A sludge storage tank that stores the separated aggregated microorganisms.

[0049] The wastewater purification device of the present invention may include a pump tank (the pump tank of the present invention) that stores wastewater and sends water to other tanks. The pump tank of the present invention can store a certain amount of wastewater to be treated by the microorganisms of the present invention, homogenize it, and then send water to other tanks. The pump tank of the present invention may include a stirrer to homogenize the wastewater. Further, it may include a pump for sending the homogenized wastewater. The number of pumps may be the same as the number of other tanks as the water supply destination. Examples of the other tanks to which water is sent from the pump tank of the present invention include the tanks or devices from (A) to (G) above. Among them, a culture tank, a microorganism treatment tank, a reaction tank, etc. are preferably mentioned. Furthermore, the pump tank of the present invention may be equipped with a wastewater metering function (the flow rate adjustment tank of the present invention).

[0050] The wastewater purification device of the present invention may include a culture tank (the culture tank of the present invention) for preliminarily growing the microorganisms of the present invention. In the culture tank of the present invention, since the microorganisms of the present invention can assimilate the organic substances contained in the wastewater, they can grow until they reach the logarithmic growth phase while decomposing the organic substances in the wastewater. Therefore, the culture tank of the present invention can use the wastewater sent from other tanks as a culture solution and grow the microorganisms of the present invention therein. Similarly to the microorganism treatment tank of the present invention, the culture tank of the present invention may include a diffuser device connected to an air agitation blower. By spraying the air sent from the air agitation blower from the diffuser device, the microorganisms and the wastewater of the present invention are agitated, and the microorganisms of the present invention can be efficiently grown. Furthermore, for the purpose of increasing the contact efficiency between the microorganisms and the wastewater of the present invention, the culture tank of the present invention may include a floating solid carrier capable of supporting the microorganisms of the present invention. The solid carrier may be the same as those usable in the microorganism treatment tank of the present invention. Alternatively, the microorganisms of the present invention cultured in the culture tank of the present invention may be the organic substance reducing agent or the microorganism aggregating agent of the present invention that preliminarily contains a solid carrier. The initial concentration of the microorganisms of the present invention cultured in the culture tank of the present invention is usually 1.0x 10 6 cells / mL to 1.0 x 10 8 cells / mL. The timing for administering the microorganisms of the present invention to the culture tank of the present invention is not particularly limited as long as it has the desired effect, and it can be administered at any timing. There is no particular limitation on the administration frequency of the microorganisms of the present invention. However, since the number of cells of the microorganisms of the present invention is stably maintained as long as the wastewater containing organic substances is continuously supplied, it is not necessary to perform multiple inputs. The microorganisms of the present invention grown in the culture tank of the present invention as described above are sent to other tanks. Therefore, the culture tank of the present invention may include a pump for sending the cultured microorganisms of the present invention. Examples of the other tank to which water is sent from the culture tank of the present invention include the microorganism treatment tank of the present invention.

[0051] The wastewater purification device of the present invention may include a solid-liquid separation tank (the solid-liquid separation tank of the present invention) that separates aggregated microorganisms from the wastewater treated by microorganisms. The solid-liquid separation tank of the present invention can separate the microorganisms of the present invention aggregated from the wastewater treated by the microorganisms of the present invention and other microorganisms in the microorganism treatment tank of the present invention.

[0052] The solid-liquid separation tank of the present invention is classified into a sedimentation tank and a membrane separation tank according to its form. When the solid-liquid separation tank of the present invention is a sedimentation tank (the sedimentation tank of the present invention), the wastewater treated by the microorganisms of the present invention is allowed to stand in the sedimentation tank of the present invention for a certain period of time, so that the aggregated microorganisms floating in the wastewater settle to the bottom of the sedimentation tank of the present invention. To exhibit such a function, for example, the sedimentation tank of the present invention is a hopper having an angle of 60 degrees or more, and its surface area loading satisfies that it is 8 m 3 / m 2 ·day or less. The time for which the wastewater is allowed to stand is not particularly limited as long as it is a time during which the aggregated microorganisms can settle. For example, it may be about 1.5 hours to about 4 hours. When the solid-liquid separation tank of the present invention is a membrane separation tank (the membrane separation tank of the present invention), by permeating the wastewater treated by the microorganisms of the present invention through a separation membrane having pores provided in the membrane separation tank, only the aggregated microorganisms can be trapped by the separation membrane. Examples of the material of the separation membrane that can be used include, but are not limited to, polytetrafluoroethylene (PTFE), polyvinylidene fluoride (PVDF), and polyethersulfone (PES). The pore size of the separation membrane is not limited as long as it is a pore size such that the aggregated microorganisms cannot permeate. For example, it may be about 0.01 μm to about 2 μm.

[0053] In the solid-liquid separation tank of the present invention, the wastewater from which the aggregated microorganisms have been separated is temporarily stored in a discharge tank and then discharged. Therefore, when the wastewater purification device of the present invention includes the solid-liquid separation tank of the present invention, the wastewater purification device of the present invention may further include a discharge tank (the discharge tank of the present invention) that holds and discharges the microorganism-treated wastewater from which the aggregated microorganisms have been separated. The wastewater from which the aggregated microorganisms have been separated and stored in the discharge tank of the present invention can be discharged into sewage as long as it meets the environmental standards. Examples of the environmental standards include biochemical oxygen demand (BOD), suspended solids (SS), normal hexane extract content (n-Hex), and coliform count. The discharge tank of the present invention may include a pump (the discharge pump tank of the present invention) for discharging the wastewater temporarily stored in the discharge tank of the present invention into sewage.

[0054] The aggregated microorganisms precipitated or captured in the solid-liquid separation tank of the present invention are temporarily stored in a sludge storage tank and then disposed of. Therefore, when the wastewater purification device of the present invention includes the solid-liquid separation tank of the present invention, the wastewater purification device of the present invention may further include a sludge storage tank (the sludge storage tank of the present invention) that stores the aggregated microorganisms separated from the microorganism-treated wastewater.

[0055] The wastewater purification device of the present invention may include a reaction tank (the reaction tank of the present invention) that aggregates suspended solids and n-Hex in the wastewater by treating the wastewater with a flocculant (flocculant treatment). The wastewater before microorganism treatment contains suspended solids and n-Hex in addition to organic substances and microorganisms, and can be removed from the wastewater by aggregating the suspended solids and n-Hex in advance before microorganism treatment. The flocculant used in the reaction tank of the present invention is not particularly limited as long as it can aggregate suspended solids and n-Hex. Examples thereof include polyaluminum chloride, aluminum sulfate, ferric chloride, polyferric sulfate, and polysilicate iron. The reaction tank of the present invention may include a stirrer. The flocculant and the wastewater are stirred by the stirrer, and the aggregation of suspended solids and n-Hex proceeds.

[0056] When the wastewater purification device of the present invention includes the reaction tank of the present invention, the wastewater purification device of the present invention may further include a pressurized flotation device (the pressurized flotation device of the present invention) that separates aggregated suspended substances and aggregated n-Hex from the wastewater treated with a flocculant. In the pressurized flotation device of the present invention, the aggregated suspended substances and aggregated n-Hex contained in the wastewater are removed by adhering to and floating by fine bubbles generated by pressurized air.

[0057] An example of an embodiment of the wastewater purification device of the present invention is shown in FIG. 1. An example of the wastewater purification device of the present invention includes the following. (1) Microorganism 1 of the present invention, (2) A carrier flow tank 2 that reduces organic substances in the wastewater and / or aggregates microorganisms by treating the wastewater with microorganism 1 of the present invention.

[0058] Wastewater 3 containing organic substances and / or microorganisms is fed into the carrier flow tank 2, and microorganism 1 of the present invention is introduced. In the carrier flow tank 2, the air blown from the air blower 2a for air agitation is ejected from the air diffuser 2b, so that microorganism 1 of the present invention attached to the solid carrier 2c grows, organic substances are decomposed, all microorganisms are aggregated, and wastewater 3 is treated. The microorganism-treated wastewater 4 is discharged into the sewage.

[0059] Another example of an embodiment of the wastewater purification device of the present invention is shown in FIG. 2. An example of the wastewater purification device of the present invention includes the following. (1) Microorganism 5 of the present invention, (2) A carrier flow tank 6 that reduces organic substances in the wastewater and / or aggregates microorganisms by treating the wastewater with microorganism 5 of the present invention, (A) A pump tank 7 that stores wastewater and feeds it into the reaction tank 8, (B) A culture tank 11 that pre-grows microorganism 5 of the present invention, (C) A sedimentation tank 12 that separates aggregated microorganisms from the microorganism-treated wastewater, (D) A discharge pump tank 13 that stores and discharges the microorganism-treated wastewater from which the aggregated microorganisms have been separated, (E) A sludge storage tank 14 that stores the separated aggregated microorganisms, (F) A reaction tank 8 that aggregates suspended substances and n-Hex in wastewater by treating the wastewater with a flocculant 9, and (G) A pressurized flotation device 10 that separates the aggregated suspended substances and aggregated n-Hex from the wastewater treated with the flocculant.

[0060] The pump tank 7 stores a certain amount of wastewater 15 containing organic substances, microorganisms, suspended substances, and n-Hex, homogenizes it with a stirrer 7a, and then sends the water to the reaction tank 8 with a pump 7b.

[0061] The reaction tank 8 injects a flocculant 9 into the wastewater sent from the pump tank 7, and agitates the flocculant 9 and the wastewater with a stirrer 8a to aggregate the suspended substances and n-Hex. Then, the reaction tank 8 sends the wastewater treated with the flocculant to the pressurized flotation device 10.

[0062] The pressurized flotation device 10 attaches fine bubbles to the aggregated suspended substances and aggregated n-Hex contained in the wastewater treated with the flocculant to float them and removes them as excess sludge 16. Then, the pressurized flotation device 10 sends the wastewater containing organic substances and microorganisms from which the suspended substances and n-Hex have been removed to the culture tank 11.

[0063] In the culture tank 11, in the wastewater sent from the pressurized flotation device 10, the air sent from an air stirring blower 11a is ejected from a diffuser device 11b, so that the introduced microorganism 5 of the present invention and the wastewater are agitated, and the microorganism 5 of the present invention attached to the solid carrier 11c is efficiently propagated. Then, the culture tank 11 sends the microorganism 5 of the present invention together with the wastewater to the carrier flow tank 6.

[0064] In the carrier flow tank 6, wastewater containing organic substances and microorganisms is sent together with the microorganism 5 of the present invention, and the air sent from the air stirring blower 11a is ejected from the diffuser device 6a, so that the microorganism 5 of the present invention attached to the solid carrier 6b grows, the organic substances are decomposed, and all the microorganisms including the microorganism 5 of the present invention are aggregated. Then, the carrier flow tank 6 sends the wastewater treated with microorganisms to the sedimentation tank 12.

[0065] The microbially treated wastewater is allowed to stand in the sedimentation tank 12, so that the aggregated microorganisms floating in the wastewater settle to the bottom of the sedimentation tank 12. Thereafter, the sedimentation tank 12 sends the wastewater from which the aggregated microorganisms have been separated to the discharge pump tank 13, and stores the settled aggregated microorganisms in the sludge storage tank 14.

[0066] The discharge pump tank 13 temporarily stores the wastewater from which the aggregated microorganisms have been separated, and then discharges the wastewater 17 with the pump 13a.

[0067] The sludge storage tank 14 temporarily stores the aggregated microorganisms.

[0068] Further, still another example of an embodiment of the wastewater purification apparatus of the present invention is shown in FIG. 3. An example of the wastewater purification apparatus of the present invention includes the following. (1) The microorganism 18 of the present invention, (2) A carrier flow tank 19 that reduces the organic matter in the wastewater and / or aggregates the microorganisms by treating the wastewater with the microorganism 18 of the present invention, (A) A pump tank 20 that stores the wastewater and sends it to the carrier flow tank 19 and the culture tank 21, (B) A culture tank 21 that pre-grows the microorganism 18 of the present invention, (C) A sedimentation tank 22 that separates the aggregated microorganisms from the microbially treated wastewater, (D) A discharge pump tank 23 that stores and discharges the microbially treated wastewater from which the aggregated microorganisms have been separated, (E) A sludge storage tank 24 that stores the separated aggregated microorganisms.

[0069] The pump tank 20 stores a fixed amount of wastewater 25 containing organic matter and microorganisms, homogenizes it with the stirrer 20a, and then sends it to the carrier flow tank 19 with the pump 20b and to the culture tank 21 with the pump 20c.

[0070] The culture tank 21 stirs the introduced microorganism 18 of the present invention and the wastewater by spraying the air sent from the air blower 19a for air stirring from the air diffuser 21a in the wastewater sent from the pump tank 20, and efficiently grows the microorganism 18 of the present invention attached to the solid carrier 21b. Then, the culture tank 21 pumps and sends the microorganism 18 together with the wastewater to the carrier flow tank 19 by the pump 21c.

[0071] In the carrier flow tank 19, the wastewater containing organic substances and microorganisms is sent together with the microorganism 18 of the present invention, and the air sent from the air blower 19a for air stirring is sprayed from the air diffuser 19b, so that the microorganism 18 of the present invention attached to the solid carrier 19c grows, the organic substances are decomposed, and all the microorganisms including the microorganism 18 of the present invention are aggregated. Then, the carrier flow tank 19 sends the microorganism-treated wastewater to the sedimentation tank 22.

[0072] The microorganism-treated wastewater is allowed to stand in the sedimentation tank 22, so that the aggregated microorganisms floating in the wastewater settle to the bottom of the sedimentation tank 22. Then, the sedimentation tank 22 pumps and sends the wastewater from which the aggregated microorganisms are separated to the discharge pump tank 23, and stores the precipitated aggregated microorganisms in the sludge storage tank 24.

[0073] The discharge pump tank 23 temporarily stores the wastewater from which the aggregated microorganisms are separated, and then discharges the wastewater 26 by the pump 23a.

[0074] The sludge storage tank 24 temporarily stores the aggregated microorganisms.

Example

[0075] The present invention will be described more specifically by the following examples. However, the examples are merely illustrative of the present invention and do not limit the scope of the present invention in any way.

[0076] Example 1 Comparison of Wastewater Treatment Performance In order to objectively evaluate the performance of newly isolated microorganisms for wastewater treatment, the inventors compared the performance of wastewater treatment materials mainly composed of commercially available microorganisms or enzymes for wastewater treatment. In the comparative test of wastewater treatment capacity, wastewater from a meat processing factory in Fukui Prefecture was used. 2 mL of various wastewater treatment materials were added to 100 mL of this meat processing wastewater (inoculation amount 2%), and wastewater treatment was carried out at 28 °C for 24 hours at 120 revolutions per minute using an Erlenmeyer flask with a baffle. The wastewater treatment capacity of the microorganisms was evaluated using the total organic carbon (TOC) in the treated wastewater as an index (using a total organic carbon meter SHIMADZU TOC-L). TOC indicates the total amount of organic substances present in water as the amount of carbon contained in the organic substances, and is used as one of the indicators showing "water pollution". Compared with the conventionally used BOD (biochemical oxygen demand) and COD (chemical oxygen demand), the measurement of TOC value is less affected by interference from coexisting substances in the sample and has the advantage of accurately measuring the amount of organic substances in real time. As a result of the comparative test, in the wastewater from meat processing, the treatment capacity of "QqBiO" (Quad Corporation) was the highest (Figure 4). This was considered to be because QqBiO is a mixed microorganism treatment material composed of different types of microorganisms (about 200 types).

[0077] Example 2 Search for Wastewater Treatment Microorganisms As shown in Example 1, since QqBiO is a mixed material containing various types of microorganisms, it has a high wastewater treatment capacity. However, in its manufacturing process, it is difficult to evenly blend different microorganisms, so there is a problem that the product quality is unstable. Therefore, the inventors tried to isolate microorganisms with excellent wastewater treatment capacity even when they are single. Microorganisms with high wastewater treatment capacity were searched mainly in water systems in Japan. As a result of intensive search, the E2 strain with a high treatment capacity equivalent to that of QqBiO was successfully isolated from meat processing wastewater (Figure 5). Furthermore, the E2 strain had high aggregability that QqBiO did not have. This is an extremely important property in wastewater treatment, making it easy to discard sludge and omitting the treatment process with a flocculant (Figure 6). When the aggregated and precipitated E2 strain was observed with an electron microscope, it was found that a large amount of biopolymers were secreted outside the cells, and these adsorbed to each other to form aggregates (Figure 7). This aggregability is an extremely excellent property as a wastewater treatment microorganism because it can precipitate not only E2 strains but also other types of microorganisms and solids present in the wastewater together.

[0078] Example 3 Identification Test of Microorganisms Since the E2 strain showed extremely excellent treatment capacity in meat processing wastewater, the nucleotide sequence analysis of 16S rDNA (16S rRNA gene, about 1,500 bp), morphological observation, and physiological and biochemical property tests were carried out to estimate its taxonomic group. (16S rDNA Partial Nucleotide Sequence Analysis) · DNA Extraction: Achromopeptidase (FUJIFILM Wako Pure Chemical, Japan) · PCR Amplification: Tks Gflex DNA Polymerase (Takara Bio, Japan) · Cycle Sequencing: BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) · Primers Used: PCR Amplification: 9F, 1510R Sequences: 9F, 515F, 1099F, 536R, 926R, 1242R 1510R · Sequencing: ABI PRISM 3130 xl Genetic Analyzer System (Applied Biosystems) · Base sequence determination: ChromasPro 2.1 (Technelysium, AUS) · BLAST homology search: ENKI (TechnoSuruga Laboratory, Japan) was used as the analysis software, and the databases used were the International Nucleotide Sequence Database (DDBJ / ENA(EMBL) / GenBank) and DB-BA15.0 (TechnoSuruga Laboratory). · Molecular phylogenetic analysis: The neighbor-joining method was used for estimating the phylogenetic tree, the base substitution model was Kimura-2-parameter, and the reliability of the tree was evaluated by the bootstrap method (1,000 replications).

[0079] Results of BLAST homology search against DB-BA 15.0 (TechnoSuruga Laboratory) and the International Nucleotide Sequence Database (DDBJ / ENA (EMBL) / GenBank) using the microorganism identification system (analysis software: ENKI) showed that the nucleotide sequence of the 16S rDNA of strain E2 was 99.6% homologous to the reference strain KIN192 of Kinneretia asaccharophila T (accession number AY136099) (Tables 1 and 2). Also, in the molecular phylogenetic tree (Figure 8) analyzed based on the nucleotide sequence obtained from the BLAST homology search against DB-BA 15.0, strain E2 was included within the cluster formed by the Comamonadaceae family, which includes the genus Kinneretia (1 genus, 1 species), the genus Mitsuaria, the genus Pelomonas, the genus Roseteles, etc., and K. asaccharophila KIN192 T (AY136099), indicating that they were closely related. Thus, based on the results of 16S rDNA nucleotide sequence analysis, strain E2 was presumed to be a novel bacterial species Kinneretia sp. closely related to K. asaccharophila

[0080]

Table 1

[0081]

Table 2

[0082] Example 4 Physiological and biochemical property tests Colony observation was performed using a stereomicroscope, morphological observation was performed using an optical microscope, and catalase reaction, oxidase reaction, acid / gas production from glucose, and oxidation / fermentation (O / F) of glucose were tested based on the method of Barrow & Feltham (Cowan and Steel’s Manual for the Identification of Medical Bacteria, 3rd ed. Cambridge: Cambridge University Press; 1993). · Gram staining: Faver G "Nissui" (Nissui Pharmaceutical, Japan) · Microscope: Optical microscope BX50F4 (Olympus, Japan) · Stereomicroscope: SMZ800N (Nikon, Japan) · The following kits were used for physiological and biochemical property tests. API 20 NE (bioMerieux, FRA) [SIID30828-01] API ZYM (bioMerieux, FRA) [SIID30828-01] API 20 E (bioMerieux, FRA) [SIID30828-02, 03] The results of the physiological and biochemical property tests of strain E2 showed that it was a Gram-negative motile bacillus that did not form spores and showed positive catalase and oxidase reactions (Table 3). These properties were consistent with those of the genus Kinneretia, whose attribution was suggested from the results of 16S rDNA sequence analysis, except for the catalase reaction. In addition, strain E2 reduced nitrates, did not produce indole, did not ferment glucose, showed negative urease and β-galactosidase activities, did not hydrolyze esculin and gelatin, assimilated glucose and potassium gluconate, and did not assimilate L-arabinose, maltose, DL-malic acid, etc. (Table 4). Furthermore, strain E2 showed activities of alkaline phosphatase, trypsin, acid phosphatase, etc., did not show activities such as esterase (C8), and did not grow at 10°C (Table 3 and Table 5). Although these properties were somewhat consistent with those of K. asaccharophila, which was shown to be closely related based on the results of 16S rDNA sequence analysis, many differences were also observed.

[0083]

Table 3

[0084]

Table 4

[0085]

Table 5

[0086] Thus, strain E2 was included in the genus Kinneretia and was most closely related to K. asaccharophila among known species. However, based on the results of 16S rDNA nucleotide sequence analysis and physiological and biochemical property tests, it was different from K. asaccharophila, so the taxonomic group to which it belonged at the species level could not be estimated. Therefore, based on the results of the above identification tests, strain E2 was identified as a novel bacterium, Kinneretia sp. So far, only one species, K. asaccharophila, belonging to the genus Kinneretia has been found in Lake Kinneret in Israel, and strain E2 discovered in Japan is the second species of the genus Kinneretia.

[0087] Example 5 Wastewater treatment performance test The microbiota of wastewater treatment facilities is composed of a variety of microorganisms. By introducing a single microorganism into them, we investigated how much wastewater treatment effect could actually be exerted. The on-site test was carried out using the wastewater treatment facility attached to a meat processing factory in Fukui Prefecture. The average amount of wastewater treated in this facility is about 120 m 3 / day. The wastewater (raw water) flowing into the wastewater treatment facility from the meat processing factory is temporarily stored in the raw water tank, and then pumped to the "flow adjustment tank" by the raw water pump. After equalizing the wastewater properties here, a certain amount of water is transferred to the reaction tank using a pump and a metering device (Figure 9). In the reaction tank, a flocculant is added to agglomerate the suspended solids (SS) and n-Hex in the wastewater, and the pH is adjusted with caustic soda (sodium hydroxide) to promote the flocculation reaction. Subsequently, a part of the pressurized floating treated water is treated with pressurized air to obtain fine air bubbles, which are mixed with the wastewater pumped from the reaction tank. In the pressurized floating device, fine air bubbles are generated in the wastewater, and the bubbles are attached to the agglomerates (flocs) of organic matter formed by the flocculant, causing the flocs to float and separating and removing oil and grease solids, etc. The pressurized floating treated water passing through the pressurized floating device thus has its biochemical oxygen demand (BOD), normal hexane extract (n-Hex), and suspended solids (SS) reduced to a certain extent. Further, the pressurized floating treated water is transferred to the "first chamber (carrier fluidized bed) of the wastewater treatment tank", and during the process of passing through a plurality of wastewater treatment tanks, the BOD and n-Hex are treated by microorganisms to be below the discharge standard value. On the other hand, the flocs separated and removed as sludge (a state that can be uniformly spread in water and measured as a concentration) by the pressurized floating device are temporarily stored in the sludge storage tank and then transferred to the dehydrator by the sludge transfer pump. In the dehydrator, dehydration is carried out using cationic and anionic polymer flocculants, and the dehydrated sludge is disposed of off-site as industrial waste. Thus, in the wastewater treatment facility, problems such as "using a large amount of chemicals" in the pressurized floating device, "industrial waste of the generated sludge", and "bad odor diffusing outside the facility" have existed. Furthermore, a large amount of energy was required for "sludge dehydration" and "pressurizing a large amount of water". To solve these problems all at once, in the on-site test, the pressurized floating device was not used, and the culture solution of strain E2 was added to the first chamber of the wastewater treatment tank at 100 L / m 3It was directly introduced at a ratio of . As a result, even without using a pressurized flotation device and applying a wastewater treatment load about 1.6 times higher than that during normal operation, it was possible to clear the discharge standard values of biochemical oxygen demand (BOD) and n-hexane extract (n-Hex) (Figures 10 and 11). Also, the coagulability was maintained (Figure 12). The effects by these E2 strains lasted for about one month with a single introduction. Due to the amazing high efficiency by these E2 strains, the running cost of the wastewater treatment facility could be reduced to about 1 / 4 of the conventional level.

[0088] Example 6 Analysis of the microbial flora (community) in wastewater As described above, the wastewater (raw water) flowing into the wastewater treatment facility from the meat processing factory is temporarily stored in the raw water tank and then pumped to the "flow adjustment tank" by the raw water pump. It is considered that various and numerous microorganisms have already propagated at this stage. Therefore, for the purpose of understanding how the E2 strain functions in such a complex microbial environment, "microbial flora (community structure)" in the wastewater and "time-course dynamic analysis of the E2 strain" were conducted. The community structure in the wastewater (raw water) was analyzed by amplicon sequencing, and the dynamics of the E2 strain introduced into the wastewater treatment tank were analyzed by real-time PCR. (1) Amplicon sequencing analysis 1. DNA extraction · Extraction method: MORA-EXTRACT kit (Kyokuto Pharmaceutical, Japan), cell disruption device: FastPrep-24 5G (MP-Biomedicals, USA) · Supplementary absorbance measurement: NanoDrop ND8000 (Thermo Fisher Scientific, USA), DNA concentration (ng / μl), DNA purity (A260 / A280) 2. PCR · Primers used: Pro341F - Pro805R (about 430 bp excluding the primer sequences of bacterial and archaeal 16S rDNA) · PCR conditions: Takahashi S, Tomita J, Nishioka K, Hisada T, Nishijima M. Development of a prokaryotic universal primer for simultaneous analysis of Bacteria and Archaea using next-generation sequencing. PLoS One 2014; 9: e105592. 3. Amplicon sequence analysis · Sequencer: MiSeq (Illumina, USA), determine the sequence excluding the primer sequence (about 380 - 430 bp) · Sequencing Kit: MiSeq Reagent Kit v3 (600 cycles) (Illumina) 4. fastq paired - end concatenation · Software: fastq - join 5. Sequence pre - processing (quality filtering) · Software: FASTX - Toolkit 6. Chimera check · Software: Remove chimeric sequences detected by QIIME1.8.0 and usearch6.1.544_i86 7. Homology search 1) Search by Ribosomal Database Project (RDP) · Software: Metagenome@KIN (World Fusion, Japan) · Database: RDP MultiClassifier ver.2.11 (16S rDNA) Cut Off: Phylum: 0.8 (Extract taxa with a confidence of 0.8 or higher) Taxonomic group: Kingdom - Genus 2) Search by microbial identification database · Software: Metagenome@KIN (World Fusion) · Database: Microbial Identification Database DB-BA13.0 (TechnoSuruga Laboratory, Japan) Extract the top taxonomic group with a similarity rate of 97% or more as a closely related species Taxonomic group: Kingdom to species 8. Comparative analysis between specimens · Software: Metagenome@KIN (World Fusion) · Analysis method: Principal component analysis and cluster analysis (Clustering method: group average method, distance function: Pearson correlation coefficient) (2) Real-time PCR analysis 1. DNA extraction · Extraction method: MORA-EXTRACT kit (Kyokuto Pharmaceutical, Japan), cell disruption device: FastPrep-24 5G (MP-Biomedicals, USA) · Absorbance measurement: NanoDrop ND8000 (Thermo Fisher Scientific, USA), DNA concentration (ng / μL), DNA purity (A260 / A280) 2. PCR conditions · Primer Amplify the 16S rDNA of all eubacteria comprehensively using the combination of 341f - 534r (Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 1993;59:695-700.) Kasaccharo_F (GTGGGGGATAACTGCTCGAAAGAGCAG (SEQ ID NO: 2)) - Kasaccharo_R (TACCCCGAGGTATTAACCCAGAGCG (SEQ ID NO: 3)) was designed and amplified to specifically amplify only the 16S rDNA of strain E2 · Standard: Escherichia coli JCM 1649 T (For measuring the copy number of 16S rDNA in all true bacteria) Plasmid DNA derived from strain E2 (for measuring the copy number of 16S rDNA of K. asaccharophila) 3. Real-time PCR · Reagent: TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio, Japan) · Instrument: Rotor-Gene Q (QIAGEN, DEU)

[0089] As a result of analyzing the microbial flora of the wastewater (raw water) by next-generation sequencer, it was confirmed that there were always more than 300 to 400 types (at the genus level) of bacteria and archaea at the stage of the "flow adjustment tank", and it was a biologically extremely diverse environment. Furthermore, by real-time PCR analysis, when counting the number of microorganisms present in the wastewater during treatment, at the time of input, it was 7.08 x 10 8 / mL, and bacteria on the order of 10 8 / mL were constantly detected thereafter (Figure 13). Also, the cell concentration of strain E2 introduced into the wastewater treatment tank in the state of the culture solution was 2.12 x 10 3 / mL immediately after being introduced at a ratio of 100 L / m 7 / mL, which was approximately 3% of the total number of bacteria. However, after 24 hours, it decreased to the order of 10 5 / mL, and after 48 hours, it decreased to the order of 10 4 / mL, and then remained stable at the order of 10 4 / mL for 1 month, and a high wastewater treatment effect continued (Figure 13). Thus, in the wastewater where there are constantly more than 300 types at the genus level and bacteria on the order of 10 8 / mL, strain E2 was 10 4It was confirmed that it stably functions as a wastewater treatment microorganism at a cell concentration on the order of / mL.

Industrial Applicability

[0090] The microorganism of the present invention has a wastewater purification ability equivalent to that of existing wastewater treatment materials. Moreover, surprisingly, it can aggregate other types of microorganisms and solid components together, so it is not necessary to treat the wastewater with a flocculant in advance before performing the treatment with the microorganism of the present invention. As a result, by using the microorganism, the cost for wastewater treatment can be significantly reduced without omitting the pretreatment and without modifying the existing drainage facilities.

Explanation of Symbols

[0091] 1: Microorganism of the present invention 2: Carrier flow tank 2a: Blower for air agitation 2b: Diffuser 2c: Solid carrier 3: Wastewater containing organic matter and / or microorganisms 4: Microbially treated wastewater 5: Microorganism of the present invention 6: Carrier flow tank 6a: Diffuser 6b: Solid carrier 7: Pump tank 7a: Agitator 7b: Pump 8: Reaction tank 8a: Agitator 9: Flocculant 10: Pressurized flotation device 11: Culture tank 11a: Blower for air agitation 11b: Diffuser 11c: Solid carrier 11d: Pump 12: Sedimentation tank 13: Discharge pump tank 13a: Pump 14: Sludge storage tank 15: Wastewater containing organic matter, microorganisms, suspended substances and n-Hex 16: Excess sludge 17: Wastewater 18: Microorganisms of the present invention 19: Carrier flow tank 19a: Blower for air agitation 19b: Air diffuser 19c: Solid carrier 20: Pump tank 20a: Stirrer 20b: Pump 20c: Pump 21: Culture tank 21a: Air diffuser 21b: Solid carrier 21c: Pump 22: Sedimentation tank 23: Discharge pump tank 23a: Pump 24: Sludge storage tank 25: Wastewater containing organic matter and microorganisms 26: Wastewater

Claims

1. An isolated Kinneretia microorganism with the accession number NITE P-03538.

2. An organic matter reducer containing the microorganism according to Claim 1.

3. A microbial flocculant containing the microorganism according to Claim 1.

4. A method for reducing organic matter, including contacting the microorganism according to Claim 1 with a sample containing organic matter.

5. A method for aggregating microorganisms, including contacting the microorganism according to Claim 1 with a sample containing microorganisms.

6. A wastewater treatment device including: (1) The microorganism according to Claim 1, and (2) A microbial treatment tank that reduces organic matter and / or aggregates microorganisms in wastewater by treating the wastewater with the microorganism in (1).

7. The device according to Claim 6, further including at least one selected from the following: (A) A pump tank that stores wastewater and sends it to other tanks, (B) A culture tank that pre-grows the microorganism according to Claim 1, (C) A solid-liquid separation tank that separates aggregated microorganisms from the wastewater treated with microorganisms, (D) A discharge tank that stores and discharges the wastewater treated with microorganisms from which the aggregated microorganisms have been separated, (E) A sludge storage tank that stores the separated aggregated microorganisms, (F) A reaction tank that aggregates suspended substances and n-Hex in wastewater by treating the wastewater with a flocculant, and (G) A dissolved air flotation device that separates the aggregated suspended substances and aggregated n-Hex from the wastewater treated with the flocculant.

8. The device according to Claim 6, further including: (A) A pump tank that stores wastewater and sends it to other tanks, (B) A culture tank that pre-grows the microorganism according to Claim 1, (C) A solid-liquid separation tank that separates aggregated microorganisms from the wastewater treated with microorganisms, (D) A discharge tank that stores and discharges the wastewater treated with microorganisms from which the aggregated microorganisms have been separated, and (E) A sludge storage tank that stores the separated aggregated microorganisms.

Images