Improvement of Long-Term Nucleic Acid Amplification Reaction

Abstract

To provide methods of suppressing decrease in amplification efficiency caused by hydrophilic polymers and of performing efficient nucleic acid amplification reaction, in nucleic acid amplification comprising a step of long-term incubation at a given temperature.SOLUTION: The present invention provides a method of suppressing amplification inhibition caused by hydrophilic polymers by that a specific concentration of single-stranded DNA binding protein is contained in a nucleic acid amplification reaction solution containing a hydrophilic polymer, in a method of amplifying nucleic acids comprising incubating at a temperature greater than 30°C and less than 50°C for a time greater than 30 minutes.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a method for performing a nucleic acid amplification reaction at a predetermined temperature for a long time.

Background Art

[0002] In recent years, various methods for performing an isothermal nucleic acid amplification reaction have been developed. Examples of such methods capable of isothermal nucleic acid amplification include, for example, the RT-RamDA method (Patent Document 1, Non-Patent Document 1) used for amplification from RNA, the Multiple Displacement Amplification (MDA) method (Non-Patent Document 2) used for amplification of DNA, the Strand Displacement Amplification (SDA) method (Non-Patent Document 3), the Rolling Cycle Amplification (RCA) method (Non-Patent Document 4), the Loop-Mediated Isothermal Amplification (LAMP) method (Non-Patent Document 5), etc., which are known and have been put into practical use.

[0003] Among these, the RT-RamDA method can increase cDNA from RNA in a sample by 10 to 100 times more than the conventional reverse transcription reaction, and is a promising method that enables capture of low-expression genes and expansion of the number of detected genes in gene expression analysis from trace amounts of RNA (Patent Document 1, Non-Patent Document 1). By, for example, setting the reaction time at isothermal conditions from 30 minutes to 120 minutes in this RT-RamDA method, a larger amount of cDNA can be obtained (Patent Document 1, Non-Patent Document 1). By obtaining more cDNA, various analyses can be performed on trace amounts of RNA.

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Non-Patent Documents

[0005]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Summary of the Invention

Problems to be Solved by the Invention

[0006] The inventors of the present invention have obtained a previously unknown finding that when a nucleic acid amplification reaction is carried out at a predetermined temperature for a long time using a nucleic acid amplification reaction solution containing a hydrophilic polymer, the amplification efficiency may decrease. Therefore, a main object of the present invention is to provide a method for carrying out a nucleic acid amplification reaction at a high amplification efficiency for a long time even in such a case.

Means for Solving the Problems

[0007] As a result of intensive studies to solve the above problems, the inventors of the present invention have found that in a method for amplifying a nucleic acid, which includes a step of incubating a nucleic acid amplification reaction solution containing a hydrophilic polymer at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes, by adding a single-stranded DNA-binding protein at a specific concentration to the nucleic acid amplification reaction solution, the inhibition of nucleic acid amplification by the hydrophilic polymer can be suppressed, and the nucleic acid can be amplified with high amplification efficiency. Based on this finding, further studies were repeated to complete the present invention.

[0008] That is, typical aspects of the present invention include the following. [Item 1] A method for suppressing the inhibition of nucleic acid amplification by a hydrophilic polymer by containing 40 ng / μL or more of a single-stranded DNA-binding protein in a nucleic acid amplification reaction solution in a method for amplifying a nucleic acid, which includes a step of incubating the nucleic acid amplification reaction solution containing the hydrophilic polymer at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes. [Item 2] The method according to Item 1, wherein the nucleic acid is amplified by the RT-RamDA method. [Item 3] The method according to Item 1 or 2, wherein the nucleic acid amplification reaction solution contains a DNA strand-specific RNA:DNA hybrid strand degrading enzyme, 40 ng / μL or more of a single-stranded DNA-binding protein, a reverse transcriptase, a primer, a template RNA, and a hydrophilic polymer. [Item 4] The method according to Item 3, wherein the DNA strand-specific RNA:DNA hybrid strand degrading enzyme is a non-specific DNA degrading enzyme. [Item 5] The method according to Item 3 or 4, wherein the template RNA is RNA extracted from 1 cell to 1000 cells. [Item 6] The method according to any one of Items 1 to 5, wherein the single-stranded DNA-binding protein is T4 gene 32 protein. [Item 7] The method according to any one of Items 1 to 6, wherein the incubation time is 60 minutes or longer. [Item 8] The method according to any one of Items 1 to 7, wherein the incubation time is 120 minutes or longer. [Item 9] The method according to any one of Items 1 to 8, wherein the hydrophilic polymer is at least one selected from the group consisting of a nucleic acid polymer and polyethylene glycol. [Item 10] The method according to any one of Items 1 to 9, wherein the concentration of the hydrophilic polymer in the nucleic acid amplification reaction solution is 0.01 ng / μL or more. [Item 11] The method according to any one of Items 1 to 10, wherein the hydrophilic polymer is at least one selected from the group consisting of polyinosinic acid and polycytidylic acid. [Item 12] The method according to any one of Items 1 to 11, wherein the incubation temperature is a temperature of 35°C or higher and 40°C or lower. [Item 13] A method for amplifying a nucleic acid, comprising a step of incubating a nucleic acid amplification reaction solution containing a hydrophilic polymer at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes, wherein in the nucleic acid amplification reaction solution, 0.01 to 1500 parts by mass of a single-stranded DNA-binding protein is contained with respect to 1 part by mass of the hydrophilic polymer, thereby suppressing the inhibition of nucleic acid amplification by the hydrophilic polymer. [Item 14] A kit for nucleic acid amplification, comprising a step of incubating a nucleic acid amplification reaction solution at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes, the kit comprising a hydrophilic polymer and a single-stranded DNA-binding protein having a concentration adjusted to be 40 ng / μL or more in the nucleic acid amplification reaction solution. [Item 15] A kit for nucleic acid amplification, comprising a step of incubating a nucleic acid amplification reaction solution at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes, the kit comprising a hydrophilic polymer and 0.01 to 1500 parts by mass of a single-stranded DNA-binding protein with respect to 1 part by mass of the hydrophilic polymer. [Effect of the Invention]

[0009] According to the present invention, for example, even in the presence of a hydrophilic polymer, a nucleic acid amplification reaction can be carried out for a long time without impairing the amplification efficiency. In particular, even when amplifying cDNA from template RNA by the RT-RamDA method or the like, inhibition of amplification due to an extended reaction time can be suppressed, and a reaction can be carried out for a long time with high amplification efficiency. As a result, nucleic acid amplification methods such as the RT-RamDA method can be carried out under various conditions, which is useful for the advancement of gene analysis techniques. For example, it contributes to the promotion of research such as single-cell analysis using the RT-RamDA method, which is applied to techniques such as next-generation sequencers (NGS) and real-time polymerase chain reaction (PCR).

Brief Description of Drawings

[0010]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Mode for Carrying Out the Invention

[0011] Hereinafter, the present invention will be described in more detail while showing embodiments of the present invention. <Method for Suppressing Inhibition of Nucleic Acid Amplification by Hydrophilic Polymer in Method for Amplifying Nucleic Acid> In one embodiment, the present invention provides a method for amplifying nucleic acids, which includes a step of incubating a nucleic acid amplification reaction solution containing a hydrophilic polymer at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes. By containing a single-stranded DNA-binding protein at a specific concentration (or at a specific quantitative ratio with the hydrophilic polymer) in the nucleic acid amplification reaction solution, the nucleic acid amplification inhibition by the hydrophilic polymer is suppressed. This method can be used in any nucleic acid amplification that at least includes the step of incubating under the above conditions. Preferably, this method can be used when amplifying nucleic acids by the RT-RamDA method, but it is not particularly limited.

[0012] 1. Nucleic Acid Amplification Reaction Solution In addition to the hydrophilic polymer and the single-stranded DNA-binding protein, the nucleic acid amplification reaction solution contains components generally used for nucleic acid amplification. In one embodiment, the nucleic acid amplification reaction solution preferably contains a template nucleic acid, a primer, deoxyribonucleotides, a DNA polymerase, a hydrophilic polymer, and a single-stranded DNA-binding protein. Further, the nucleic acid amplification reaction solution may optionally contain other components such as reverse transcriptase. In another embodiment, the nucleic acid amplification reaction solution preferably contains components used in the RT-RamDa method, a hydrophilic polymer, and a single-stranded DNA-binding protein. The RT-RamDA method is generally a nucleic acid amplification method that includes a step of incubating a mixture containing a template RNA, a primer, a DNA strand-specific RNA:DNA hybrid strand degrading enzyme, an RNase H minus reverse transcriptase, and a substrate. In the RT-RamDA method, a complementary strand DNA (cDNA) of the template RNA is synthesized by the RNA-dependent DNA polymerase activity of the RNase H minus reverse transcriptase, and the cDNA strand in the hybrid strand of RNA and cDNA is randomly cleaved by the DNA strand-specific RNA:DNA hybrid strand degrading enzyme. Starting from the cleavage site, the 3'-side cDNA strand is peeled off from the RNA by the strand displacement activity of the RNase H minus reverse transcriptase, and a new cDNA strand is synthesized in the portion peeled off by the RNase H minus reverse transcriptase. Details of the RT-RamDA method are described in, for example, US Patent Application Publication No. 2017 / 0275685 (which is hereby incorporated by reference in its entirety). Therefore, when amplifying nucleic acids by the RT-RamDA method, the nucleic acid amplification reaction solution contains, for example, a template RNA, a primer, deoxyribonucleotides, a reverse transcriptase, a DNA strand-specific RNA:DNA hybrid strand degrading enzyme, a hydrophilic polymer, and a single-stranded DNA-binding protein. Further, the nucleic acid amplification reaction solution may optionally contain other components such as a DNA polymerase.

[0013] (1) Hydrophilic Polymer Hydrophilic polymers are added for various purposes, for example, in nucleic acid amplification methods such as the RT-RamDA method, to enhance the accuracy and synthesis rate when synthesizing and amplifying cDNA from template RNA, or to inhibit cDNA synthesis from specific RNAs (for example, rRNA that is not intended to be synthesized). However, it has been clarified from the results of the test examples described below that when a nucleic acid amplification reaction solution containing a hydrophilic polymer is incubated at a predetermined temperature for a long time, the nucleic acid amplification reaction is inhibited. Without being bound by a specific theory, this is thought to be because the hydrophilic polymer binds to enzymes and components necessary for nucleic acid amplification reactions (for example, RT-RamDA reactions), such as reverse transcriptase and single-stranded DNA-binding protein, and reduces the activity of these enzymes and components. Therefore, a hydrophilic polymer can be an inhibitor that reduces the amplification efficiency in nucleic acid amplification, for example, in a process that includes incubating a nucleic acid amplification reaction solution at a predetermined temperature for a long time. Such hydrophilic polymers are not particularly limited, and examples include nucleic acid polymers, heparin, polyethylene glycol, and the like. These may be used alone or in combination of two or more. Among them, nucleic acid polymers and / or polyethylene glycol tend to cause more inhibition. Among nucleic acid polymers, polyinosinic acid and / or polycytidylic acid particularly tend to cause more inhibition. The nucleic acid amplification conditions (for example, the conditions of the RT-RamDA method) under which the amplification efficiency is reduced by a hydrophilic polymer are not particularly limited as long as they are conditions of incubating at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes, and can be isothermal conditions or thermal cycling conditions. In particular, when the incubation time at a temperature of 35°C or higher and 45°C or lower, especially at a temperature of 35°C or higher and 40°C or lower, is longer than 30 minutes, inhibition tends to occur easily. In particular, the inhibition is strong when the incubation time is 60 minutes or more at the above temperature, and stronger inhibition occurs when the incubation time is 120 minutes or more at the above temperature. Also, stronger inhibition can occur when the incubation time is 240 minutes or more at the above temperature, and even stronger inhibition can occur when the incubation time is 360 minutes or more at the above temperature. The upper limit of the incubation time at the above temperature is not particularly limited, and for example, it may be 420 minutes or less or 360 minutes or less. The lower limit of the concentration of the hydrophilic polymer in the nucleic acid amplification reaction solution is not particularly limited as long as the effects of the present invention can be exhibited. As an example, it is 0.01 ng / μL or more, may be 0.1 ng / μL or more, or may be 1 ng / μL or more with respect to the whole nucleic acid amplification reaction solution. The upper limit of the concentration of the hydrophilic polymer in the nucleic acid amplification reaction solution is also not limited. As an example, it may be 3 μg / μL or less. Further, when the hydrophilic polymer is a nucleic acid polymer, for example, it may be 2 ng / μL or less. When performing a nucleic acid amplification reaction together with a reverse transcription reaction, for example, adding a nucleic acid polymer to the nucleic acid amplification reaction solution is useful for suppressing reverse transcription of ribosomal RNA (WO 2020 / 184551, which is incorporated herein by reference in its entirety). Examples of the nucleic acid polymer include at least one selected from the group consisting of inosinic acid polymer, cytidylic acid polymer, guanylic acid polymer, adenylic acid polymer, thymidylic acid polymer, uridylic acid polymer, deoxyinosinic acid polymer, deoxycytidylic acid polymer, deoxyguanylic acid polymer, deoxyadenylic acid polymer, deoxythymidylic acid polymer, and deoxyuridylic acid polymer. Here, for example, the inosinic acid polymer includes an inosinic acid homopolymer (polyinosinic acid), an inosinic acid copolymer (for example, a copolymer in which the constituent units derived from inosinic acid are more than 50 mol%, 60 mol% or more, 70 mol% or more, 80 mol% or more, or 90 mol% or more and less than 100 mol%), derivatives thereof (for example, those in which a functional group such as a fluorine atom, a bromine atom, an iodine atom, an alkyl group, an amino group, or a mercapto group is introduced into at least a part of the base moiety, and / or at least a part of the phosphoric acid moiety is replaced with a thiophosphoric acid moiety), and salts thereof (for example, alkali metal salts such as sodium salt and potassium salt), and is used in the sense of including double-stranded polymers called poly(I:C) in which polyinosinic acid and polycytidylic acid are annealed. Other cytidylic acid polymers and the like are used in the same sense. Examples of nucleic acid polymers that particularly reduce amplification efficiency include at least one selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, and deoxyguanylic acid polymers. Inosinic acid polymers and / or deoxyinosinic acid polymers, and cytidylic acid polymers and / or deoxycytidylic acid polymers particularly reduce amplification efficiency. The nucleic acid polymer can be of any length, and by way of example, can be a nucleic acid polymer having a full length of 30 to 10,000 base pairs.

[0014] (2) Single-Stranded DNA-Binding Protein Examples of single-stranded DNA-binding proteins include, for example, T4 gene 32 protein, RecA, SSB (Single-Stranded DNA Binding Protein), and combinations of two or more thereof. In the present invention, by setting the concentration of the single-stranded DNA-binding protein to 40 ng / μL or more, the amplification efficiency can be increased in nucleic acid amplification including a step of incubating at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes. Without being bound by a particular theory, this is thought to be because increasing the concentration of the single-stranded DNA-binding protein binds to the hydrophilic polymer and suppresses the inhibitory effect of the hydrophilic polymer on the nucleic acid amplification reaction (for example, the RT-RamDA reaction). The concentration of the single-stranded DNA-binding protein in the nucleic acid amplification reaction solution is not particularly limited as long as it is 40 ng / μL or more, but it is preferably 45 ng / μL or more, more preferably 50 ng / μL or more, still more preferably 55 ng / μL or more, even more preferably 60 ng / μL or more, and particularly preferably 65 ng / μL or more. The upper limit of the concentration of the single-stranded DNA-binding protein in the nucleic acid amplification reaction solution is not particularly limited, but can be, for example, 150 ng / μL or less, 140 ng / μL or less, 130 ng / μL or less, 120 ng / μL or less, 110 ng / μL or less, or 100 ng / μL or less. By adding the single-stranded DNA-binding protein to the nucleic acid amplification reaction solution at such a concentration, even in nucleic acid amplification including a step of incubating the nucleic acid amplification reaction solution containing the hydrophilic polymer at a predetermined temperature for a long time, the inhibition of nucleic acid amplification by the hydrophilic polymer is suppressed, and sufficient amplification efficiency can be maintained. In one embodiment, the content of the single-stranded DNA-binding protein is preferably 0.01 part by mass or more, more preferably 0.015 part by mass or more, and even more preferably 0.02 part by mass or more with respect to 1 part by mass of the hydrophilic polymer. In a specific embodiment, when the hydrophilic polymer is a nucleic acid polymer, the content of the single-stranded DNA-binding protein is preferably 10 parts by mass or more (or more than 10 parts by mass) with respect to 1 part by mass of the nucleic acid polymer, more preferably 15 parts by mass or more, even more preferably 20 parts by mass or more, even more preferably 30 parts by mass or more, and particularly preferably 40 parts by mass or more. Further, the content of the single-stranded DNA-binding protein is preferably 1500 parts by mass or less, more preferably 1000 parts by mass or less, even more preferably 500 parts by mass or less, and particularly preferably 100 parts by mass or less with respect to 1 part by mass of the hydrophilic polymer. In a specific embodiment, when the hydrophilic polymer is polyethylene glycol, the content of the single-stranded DNA-binding protein is preferably less than 10 parts by mass, more preferably 5 parts by mass or less, even more preferably 1 part by mass or less, even more preferably 0.5 part by mass or less, and particularly preferably 0.1 part by mass or less with respect to 1 part by mass of polyethylene glycol. By coexisting the hydrophilic polymer and the single-stranded DNA-binding protein at such a ratio, the effects of the present invention are more likely to be exhibited more surely.

[0015] (3) DNA Strand-Specific RNA:DNA Hybrid Strand Degrading Enzyme The DNA strand-specific RNA:DNA hybrid strand-degrading enzyme is preferably an enzyme having an activity of cleaving a DNA strand in an RNA-DNA hybrid strand. As such an enzyme, for example, a double-stranded specific DNA-degrading enzyme or a non-specific DNA-degrading enzyme can be used. In the present invention, among these, a non-specific DNA-degrading enzyme is preferred.

[0016] Double-strand specific DNA degrading enzymes (also referred to as double-strand specific nucleases; DSN) can use enzymes derived from prokaryotes or eukaryotes, but preferably, double-strand specific DNA degrading enzymes derived from crustaceans or variants thereof can be used. Specific examples include the following. · Solenocera melantho (Sword shrimp) DNase · Penaeus japonicus (Kuruma shrimp) DNase · Paralithodes camtschaticus (King crab) DSN · Pandalus borealis (Northern prawn) dsDNase · Chionoecetes opilio (Snow crab) DSN · Other DSN homologs The double-strand specific DNA degrading enzyme is preferably an enzyme having DNA degrading activity even at a temperature below 60°C. Among the above, double-strand specific DNA degrading enzymes derived from shrimp or variants thereof are preferred. As the double-strand specific DNA degrading enzyme, commercially available products can be used. Commercially available products include dsDNase (ArcticZymes), Hl-dsDNase (ArcticZymes), dsDNase (Thermo scientific), Shrimp DNase, Recombinant (affymetrix), Atlantis dsDNase (Zymo Research), Thermolabile Nuclease (Roche), etc.

[0017] As non-specific DNA-degrading enzymes, those having the activity of cleaving the DNA strand of a hybrid strand of RNA and DNA, substantially not having the activity of cleaving the RNA strand of a hybrid strand of RNA and DNA or single-stranded RNA, and preferably having a lower activity of cleaving single-stranded DNA compared to the activity of cleaving the DNA strand of a hybrid strand of RNA and DNA can be mentioned. The non-specific DNA-degrading enzyme is preferably an enzyme having DNA-degrading activity even at a temperature lower than 60°C. As such non-specific DNA-degrading enzymes, commercially available products can also be used. For example, it is possible to use DNase I (manufactured by Thermo Fisher, DNase I), etc. As the non-specific DNA-degrading enzyme, an enzyme derived from a prokaryote or a eukaryote can be used, but preferably, a non-specific DNA-degrading enzyme derived from a mammal or a modified form thereof, more preferably a non-specific DNA-degrading enzyme derived from a bovine or a modified form thereof can be used.

[0018] The above-mentioned modified form means an enzyme obtained by modifying a naturally occurring amino acid sequence. Specifically, an enzyme consisting of an amino acid sequence having 80% or more (preferably 90% or more, more preferably 95% or more) sequence identity with a naturally occurring amino acid sequence, and an enzyme consisting of an amino acid sequence having a deletion, substitution, and / or addition of one or several (for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3) amino acids in a naturally occurring amino acid sequence.

[0019] (4) Primer Examples of primers include specific primers for template nucleic acids such as template RNA, oligo dT primers, random primers, and combinations of two or more of these. Among these, oligo dT primers and random primers, unlike primers specific to a particular sequence, can anneal to any RNA and initiate reverse transcription of a wide variety of RNAs, so they are preferred in situations where DNA synthesis by comprehensive reverse transcription of RNA is required. In certain embodiments, it is particularly beneficial to perform the reverse transcription reaction using a combination of an oligo dT primer and a random primer. The molar ratio of the oligo dT primer to the random primer is, for example, 1:5 to 1:15, preferably 1:8 to 1:12. Examples of random primers include, for example, completely random primers and NSR (Not So Random) primers. A completely random primer is a mixture of primers having various base sequences, and each base sequence is a completely random base sequence. A completely random primer may contain a sequence that completely matches (or is completely complementary to) the rRNA sequence. Examples of completely random primers include completely random pentamers, completely random hexamers, completely random heptamers, completely random octamers, and combinations thereof. For example, a completely random hexamer may be a mixture of all possible base sequences (4 6 types) of the four nucleotides (A, T, C, G). An NSR primer is obtained by removing from a completely random primer a primer having a sequence that is completely complementary to the rRNA sequence. Examples of the rRNA sequence to be removed include, for example, the 18S rRNA sequence, 28S rRNA sequence, 12S rRNA sequence, 16S rRNA sequence, and combinations thereof. Examples of NSR primers include, for example, those obtained by excluding from a completely random hexamer a hexamer having a sequence that is completely complementary to the rRNA sequence. Also, those obtained by excluding from a primer set such as a completely random pentamer, completely random heptamer, or completely random octamer a primer having a sequence that is completely complementary to the rRNA sequence can also be used as NSR primers. By using such NSR primers, it is possible to suppress the transcription of rRNA, which is said to account for about 80 to 90% of in vivo RNA. Therefore, the transcription amount of RNA other than rRNA can be relatively increased. Thus, for example, the sensitivity can be improved by analyzing mRNA and the like. Details of the NSR primers are described in 1) Amour et al., Digital transcriptome profiling using selective hexamer priming for cDNA synthesis, Nature Methods, Vol. 6, No. 9, 2009, pp. 647-649, 2) Ozsolak et al., Digital transcriptome profiling from attomole-level RNA samples, Genome Research, Vol. 20, 2010, pp. 519-525, 3) U.S. Patent Application Publication No. 2010 / 0029511 (incorporated herein by reference in its entirety), etc. From the viewpoint of annealing, the length of the primer is, for example, 5 bases or more, preferably 6 bases or more. From the viewpoint of synthesis, it is, for example, 30 bases or less, preferably 25 bases or less, more preferably 20 bases or less. In the nucleic acid amplification reaction solution, the concentration of the primer is not particularly limited, but is, for example, 1 to 10 μM, preferably 2 to 6 μM, more preferably 3 to 5 μM.

[0020] (5) Deoxyribonucleotide As the deoxyribonucleotide, deoxyribonucleoside triphosphate is preferred. Examples of the deoxyribonucleotide triphosphate include, for example, deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxyadenosine triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxyuridine triphosphate (dUTP), derivatives thereof, and combinations of two or more of these. Among these, a mixture of dCTP, dGTP, dATP, and dTTP, a mixture of dCTP, dGTP, dATP, and dUTP, a mixture of dCTP, dGTP, dATP, dTTP, and dUTP, etc. are preferred.

[0021] (6) Reverse Transcriptase Reverse transcriptase refers to any protein (enzyme) having reverse transcription activity (RNA-dependent DNA polymerase activity), and is not particularly limited, but a polymerase showing reverse transcriptase activity is preferred. Further, the reverse transcriptase preferably has low RNase H activity or no RNase H activity. Examples of the reverse transcriptase include, for example, avian myeloblastosis virus reverse transcriptase (AMV-RT), moloney murine leukemia virus reverse transcriptase (MMLV-RT), human immunovirus reverse transcriptase (HIV-RT), EIRV-RT, RAV2-RT, C. hydrogenogormans DNA polymerase, rTthDNA polymerase, SuperScript I, SuperScript II, mutants thereof, and derivatives thereof. Among these, MMLV-RT is preferred.

[0022] (7) DNA Polymerase The nucleic acid amplification reaction solution may or may not contain the following DNA polymerase: Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENT (trademark), DEEPVENT (trademark), and variants thereof

[0023] (8) RNase Inhibitor The nucleic acid amplification reaction solution may contain an RNase inhibitor. The RNase inhibitor is not particularly limited, and examples thereof include proteins derived from human placenta, rat lung, or porcine liver, etc.

[0024] (9) Template Nucleic Acid In the present invention, the target template nucleic acid is not particularly limited, but is preferably RNA. The template RNA is not particularly limited, but is preferably RNA extracted from 1 cell to 1000 cells, more preferably RNA extracted from 1 cell to 100 cells. Particularly preferably, it is RNA extracted from 1 cell. The number of cells can be appropriately adjusted by a cell sorter. Extraction of RNA from cells can be performed by any RNA extraction method known in the art, and may also be extracted using a commercially available RNA extraction kit, etc.

[0025] (10) Additive The nucleic acid amplification reaction solution may further contain other additives. Examples of other additives include buffers, salts, surfactants, and combinations of two or more of these. Examples of buffers include Tris, Bis-Tris, Tricine, Bis-Tricine, Hepes, Mops, Tes, Taps, Pipes, Caps, and combinations of two or more of these. The buffer is usually dissolved in water (preferably nuclease-free water) and used in the form of an aqueous solution. Examples of salts include chlorides (e.g., lithium chloride, sodium chloride, potassium chloride, magnesium chloride, manganese chloride), acetates (e.g., lithium acetate, sodium acetate, potassium acetate, magnesium acetate, manganese acetate), sulfates (e.g., potassium sulfate, magnesium sulfate, manganese sulfate), and combinations of two or more thereof. Surfactants include anionic surfactants (e.g., sodium dodecyl sulfate, sodium cholate, sodium deoxycholate), cationic surfactants (e.g., cetyltrimethylammonium bromide), nonionic surfactants (e.g., octylphenol ethoxylate, polyoxyethylene lauryl ether, polyoxyethylene oleyl ether, polyoxyethylene stearyl ether, polyoxyethylene sorbitan monolaurate), and zwitterionic surfactants (e.g., 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid), etc. These may be used alone or in combination of two or more. As a particularly preferred embodiment, a nonionic surfactant can be used.

[0026] 2. Incubation The method for amplifying a nucleic acid includes at least a step of incubating at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes. When incubation under such conditions is carried out in a nucleic acid amplification reaction solution containing a hydrophilic polymer, amplification inhibition may occur over time. However, according to the present invention, such amplification inhibition can be effectively suppressed. The step of incubating at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes may be under isothermal conditions or under thermal cycle conditions. When the step of incubating at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes is carried out under thermal cycle conditions, the total time of each incubation time at two or more temperature conditions within this temperature range is longer than 30 minutes.

[0027] In one embodiment, when nucleic acid amplification from template RNA is performed by the RT-RamDA method, the incubation of the nucleic acid amplification reaction solution may be carried out under isothermal conditions or under thermal cycling conditions, but isothermal conditions are preferred.

[0028] (1) Isothermal Conditions When incubation (especially incubation in the RT-RamDA method) is carried out under isothermal conditions, for example, it can be carried out at a predetermined temperature between higher than 30°C and lower than 50°C, preferably at a predetermined temperature between 35°C and 45°C, more preferably at a predetermined temperature between 35°C and 40°C, for example, 37°C, and can be carried out at this temperature for a predetermined time (for example, longer than 30 minutes and not more than 420 minutes, preferably 60 minutes to 420 minutes, more preferably 120 minutes to 420 minutes). Incubation at a predetermined temperature between higher than 30°C and lower than 50°C may be carried out in two or more steps. For example, it may be incubated for 5 to 15 minutes at a predetermined temperature between higher than 30°C and lower than 35°C, and then incubated for a predetermined time (for example, 20 to 60 minutes) at a predetermined temperature between 35°C and lower than 50°C. After incubation for a time longer than 30 minutes at a predetermined temperature between higher than 30°C and lower than 50°C, for example, it may be incubated at a predetermined temperature between 50°C and lower than 100°C. Incubation at a predetermined temperature between 50°C and lower than 100°C may be carried out in two or more steps. For example, it may be incubated for 5 to 15 minutes at a predetermined temperature between 50°C and lower than 80°C, and then incubated for 5 to 15 minutes at a predetermined temperature between 80°C and 90°C.

[0029] (2) Thermal Cycling Conditions When performing incubation (especially incubation by the RT-RamDA method) under thermal cycle conditions, combine a predetermined temperature T1 (e.g., 33°C) between higher than 30°C and less than 35°C and a predetermined temperature T2 (e.g., 37°C) between 35°C or higher and 45°C or lower, and take a predetermined time (e.g., 1 to 3 minutes, for example 2 minutes) at T1 and a predetermined time (e.g., 1 to 3 minutes, for example 2 minutes) at T2 as one cycle, and preferably repeat this 10 to 40 cycles, more preferably 15 to 35 cycles, and the reaction may be carried out for a time longer than 30 minutes. Note that prior to the above thermal cycle, for example, incubate at a predetermined temperature between 25°C or higher and less than 30°C for a predetermined time (e.g., 5 to 15 minutes), then at a predetermined temperature between 30°C or higher and less than 35°C for a predetermined time (e.g., 5 to 15 minutes), and then at a predetermined temperature between 35°C or higher and less than 50°C for a predetermined time (e.g., 1 to 5 minutes). Also, after the above thermal cycle, for example, incubate at a predetermined temperature between 50°C or higher and less than 80°C for a predetermined time (e.g., 5 to 15 minutes), and then at a predetermined temperature between 80°C or higher and 90°C or lower for a predetermined time (e.g., 5 to 15 minutes).

[0030] <Kit for Nucleic Acid Amplification> As described above, according to the present invention, even in the presence of an amplification inhibitor such as a hydrophilic polymer, a nucleic acid amplification reaction (e.g., RT-RamDA reaction) can be carried out with high amplification efficiency for a long time. Therefore, from another aspect, the present invention further provides a kit for nucleic acid amplification including a step of incubating at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes. In one embodiment, the kit includes a hydrophilic polymer and a single-stranded DNA-binding protein at a concentration adjusted so that the final concentration in the nucleic acid amplification reaction solution is 40 ng / μL or more. Here, the concentration adjusted so that the final concentration in the nucleic acid amplification reaction solution is 40 ng / μL or more means that, for example, when the reagent is used after being diluted 2-fold, it may be prepared as a reagent containing a single-stranded DNA-binding protein at a concentration of 80 ng / μL or more, and when the reagent is used after being diluted 3-fold, it may be prepared as a reagent containing a single-stranded DNA-binding protein at a concentration of 120 ng / μL or more. In another embodiment, the kit includes a hydrophilic polymer and a single-stranded DNA-binding protein in an amount of 0.01 to 1500 parts by mass per 1 part by mass of the hydrophilic polymer. The kit may be provided in a form in which the hydrophilic polymer and the single-stranded DNA-binding protein are filled in one container, or may be provided in a form in which the respective components are filled in separate containers and mixed at the time of use. Further, the kit may contain other components such as a DNA strand-specific RNA:DNA hybrid strand-degrading enzyme, a reverse transcriptase, a primer, a template nucleic acid, a buffer, and a salt. The specific types of components that can be included in the kit may be the same as those detailed in the above method. Also, the reaction conditions such as the reaction temperature and reaction time of the incubation performed when performing the nucleic acid amplification reaction using the kit may be the same as those in the above method. By using the kit, a nucleic acid amplification reaction can be performed for a long time while suppressing a decrease in amplification efficiency, so that a large amount of cDNA can be amplified and a wide range of gene analysis can be performed.

Example

[0031] Hereinafter, the present invention will be described in more detail based on examples, but the present invention is not limited to these examples.

[0032] Example 1: Influence of Polyinosinic Acid on Long-Term Amplification in RT-RamDA Method In this example, the following experiment was conducted to compare how the amplification rate in the RT-RamDA method changes when the reaction time at 37°C is 2 hours with the addition of a nucleic acid polymer (polyinosinic acid). To analyze the amplification rate in the RT-RamDA method, first, a nucleic acid fragment sample was provided in 5 μL of reverse transcription reaction solution 1 (normal reverse transcription reaction) shown in Table 1 as a control, and the reverse transcription reaction was performed with reaction cycle 1 shown in Table 2. Separately, a nucleic acid fragment sample was provided in 5 μL of each of the various RT-RamDA reaction solutions 1 (conditions 1 to 4) shown in Table 3, and the RT-RamDA reaction was performed with reaction cycle 2 shown in Table 4. As the nucleic acid fragment sample, 10 pg of RNA purified from HeLa cells using the RNeasy Mini Kit (Qiagen) was used.

[0033]

Table 1

[0034]

Table 2

[0035]

Table 3

[0036]

Table 4

[0037] Thereafter, analysis was performed by real-time PCR using the following method. Specifically, the reaction solutions after reverse transcription reaction or RT-RamDA reaction were each diluted 10-fold with nuclease free water (Qiagen), and 2 μL (1 / 25 volume) of the diluted solution was used for the qPCR reaction. qPCR was performed using StepOne Plus (Life Technologies) under the following conditions. The qPCR reaction solution [20 μl (THUNDERBIRD (trademark) SYBR qPCR Mix (TOYOBO), 6 pmol forward primer, 6 pmol reverse primer, 2 μl diluted reverse transcription reaction solution or RT-RamDA reaction solution, nuclease free water)] was treated at 95°C for 1 minute to activate the enzyme, and then 40 cycles of denaturation at 95°C for 15 seconds and extension reaction at 60°C for 1 minute were performed. Melting curve analysis was performed at 95°C for 15 seconds, 60°C for 15 seconds, and 95°C for 15 seconds. As the target gene, the amplification rate of the β-ACTIN gene was analyzed by real-time PCR. The primer set is as follows. (5’→3’) Forward primer: CGCGAGAAGATGACCCAGAT (SEQ ID NO: 1) Reverse primer: GCCAGAGGCGTACAGGGATA (SEQ ID NO: 2) After analysis, the amplification rate by the RT-RamDA reaction was evaluated by subtracting the Ct value of the RT-RamDA method obtained from the sample to which the RT-RamDA reaction solution 1 was added from the Ct value of the normal reverse transcription reaction obtained from the sample to which the reverse transcription reaction solution 1 was added, and calculating the ΔCt value. Since the RT-RamDA method has a higher amplification rate than the normal reverse transcription reaction, the Ct value becomes lower than that in the case of the normal reverse transcription reaction. Therefore, the higher the ΔCt value, the smaller the Ct value of each test reaction solution (each RT-RamDA reaction solution), which means that the amplification rate is higher.

[0038] The results of Example 1 are shown in FIG. 1. It was found that when the reaction time at 37 °C was 120 minutes, the amplification rate by RT-RamDA increased as the addition amount of polyinosinic acid decreased. Therefore, it was shown that amplification inhibition occurs when incubation is carried out for a long time in the RT-RamDA reaction by adding a nucleic acid polymer (hydrophilic polymer) such as polyinosinic acid.

[0039] Example 2: Evaluation 1 of Components for Suppressing Long-Term Amplification Inhibition by Polyinosinic Acid in RT-RamDA Method In this example, the following experiment was conducted to examine whether increasing the concentration of reverse transcriptase or single-stranded DNA-binding protein affects the inhibition of the long-term amplification reaction of the RT-RamDA reaction by polyinosinic acid observed in Example 1. To analyze the amplification rate by the RT-RamDA method, first, as a control, a nucleic acid fragment sample was provided in 5 μL of the reverse transcription reaction solution 1 (normal reverse transcription reaction) shown in Table 1 in the same manner as in Example 1, and the reverse transcription reaction was carried out with the reaction cycle shown in Table 2. Separately, a nucleic acid fragment sample was provided in 5 μL of each of the various RT-RamDA reaction solutions 2 (conditions 1 to 4) shown in Table 5, and the RT-RamDA reaction was carried out with the reaction cycle 3 shown in Table 6. As the nucleic acid fragment sample, 10 pg of RNA purified from HeLa cells using the RNeasy Mini Kit (Qiagen) was used.

[0040]

Table 5

[0041]

Table 6

[0042] After the reverse transcription reaction or RT-RamDA reaction, the amplification rate of the RT-RamDA reaction was analyzed by real-time PCR using the β-ACTIN gene and the NEAT1 gene as indicators in the same manner as in Example 1. The primer sets used were the same as those in Example 1 for the β-ACTIN gene, and the following primer set was used for the NEAT1 gene. Forward primer: CAGTTAGTTTATCAGTTCTCCCATCCA (SEQ ID NO: 3) Reverse primer: GTTGTTGTCGTCACCTTTCAACTCT (SEQ ID NO: 4) Also, the reaction solution and thermal cycle conditions of real-time PCR were carried out in the same manner as in Example 1. After the analysis, the Ct value of the RT-RamDA method obtained from the sample to which the RT-RamDA reaction solution 2 was added was subtracted from the Ct value of the normal reverse transcription reaction obtained from the sample to which the reverse transcription reaction solution 1 was added, and the amplification rate by the RT-RamDA reaction was evaluated by obtaining the ΔCt value.

[0043] The results of Example 2 are shown in Figure 2. Under the condition containing polyinosinic acid (Condition 1), even when the reaction time at 37 °C was made longer than 30 minutes, the amplification rate did not improve, and in fact, a decrease was also observed in some cases. Under the condition where the reverse transcriptase concentration was doubled (Condition 2), the same result as Condition 1 was obtained, and no effect of suppressing the amplification inhibition of the long-time reaction was observed. On the other hand, under the conditions where the concentration of the single-stranded DNA-binding protein T4 gene 32 protein was doubled (Conditions 3 and 4), a tendency for the amplification rate to improve in proportion to the reaction time was observed. Therefore, it was shown that even when polyinosinic acid (a hydrophilic polymer) was added, increasing the amount of the single-stranded DNA-binding protein could improve the amplification rate of the RT-RamDA reaction in proportion to the reaction time.

[0044] Example 3: Evaluation 2 of Components for Suppressing Long-Term Amplification Inhibition by Polyinosinic Acid in RT-RamDA Method In this example, it was examined whether the effect of increasing the concentration of the single-stranded DNA-binding protein observed in Example 2 could be similarly confirmed when other reverse transcriptases were used. Similar to Example 2, first, a nucleic acid fragment sample was provided in 5 μL of reverse transcription reaction solution 1 (normal reverse transcription reaction) shown in Table 1 as a control, and the reverse transcription reaction was performed with the reaction cycle shown in Table 2. Separately, a nucleic acid fragment sample was provided in 5 μL of RT-RamDA reaction solution 3 (conditions 1 to 4) shown in Table 7, and the RT-RamDA reaction was performed with reaction cycle 3 shown in Table 6 in the same manner as in Example 2. As the nucleic acid fragment sample, 10 pg of RNA purified from HeLa cells using the RNeasy Mini Kit (Qiagen) was used.

[0045]

Table 7

[0046] After the reverse transcription reaction or RT-RamDA reaction, the amplification rate of the RT-RamDA reaction was analyzed by real-time PCR using the β-ACTIN gene and NEAT1 gene as indicators in the same manner as in Example 1. The same primer sets for the β-ACTIN gene and NEAT1 gene as in Example 2 were used. Also, the reaction solution and thermal cycle conditions of real-time PCR were carried out in the same manner as in Example 1. After the analysis, the Ct value of the RT-RamDA method obtained from the sample to which RT-RamDA reaction solution 3 was added was subtracted from the Ct value of the normal reverse transcription reaction obtained from the sample to which reverse transcription reaction solution 1 was added, and the amplification rate by the RT-RamDA reaction was evaluated by obtaining the ΔCt value.

[0047] The results of Example 3 are shown in Fig. 3. Similar results were obtained even when the reverse transcriptase was changed from ReverTra Ace (RT) manufactured by Toyobo Co., Ltd. used in Example 2 to PrimeScript (PS) manufactured by Takara Bio Inc. Therefore, it was more strongly confirmed that even when polyinosinic acid (hydrophilic polymer) was added, by increasing the amount of single-stranded DNA-binding protein, the amplification rate of the RT-RamDA reaction could be improved in proportion to the reaction time.

[0048] Example 4: Influence of Concentration of Single-Stranded DNA-Binding Protein In this example, the relationship between the amplification rate of the RT-RamDA reaction when reacting for a long time and the concentration of single-stranded DNA-binding protein was analyzed in more detail. Similar to the previous examples, first, as a control, a nucleic acid fragment sample was provided in 5 μL of reverse transcription reaction solution 1 (ordinary reverse transcription reaction) shown in Table 1, and the reverse transcription reaction was carried out with the reaction cycle shown in Table 2. Separately, a nucleic acid fragment sample was provided in 5 μL of RT-RamDA reaction solution 4 (conditions 1 to 6) shown in Table 8, and the RT-RamDA reaction was carried out with reaction cycle 4 shown in Table 9. As the nucleic acid fragment sample, 10 pg of RNA purified from HeLa cells using the RNeasy Mini Kit (Qiagen) was used.

[0049]

Table 8

[0050]

Table 9

[0051] After the reverse transcription reaction or RT-RamDA reaction, the amplification rate of the RT-RamDA reaction was analyzed by real-time PCR using the β-ACTIN gene as an index in the same manner as in Example 1. The same primer set for the β-ACTIN gene as in Example 1 was used. Also, the reaction solution and thermal cycle conditions of real-time PCR were carried out in the same manner as in Example 1. After analysis, the amplification rate by the RT-RamDA reaction was evaluated by subtracting the Ct value of the RT-RamDA method obtained from the sample to which the RT-RamDA reaction solution 4 was added from the Ct value of the normal reverse transcription reaction obtained from the sample to which the reverse transcription reaction solution 1 was added, and calculating the ΔCt value.

[0052] The results of Example 4 are shown in FIG. 4. In the reaction of the 120-minute RT-RamDA reaction, the amplification rate of the βACTIN gene improved in proportion to the concentration of T4 gene 32 protein. Particularly for the βACTIN gene, the amplification rate greatly improved at a T4 gene 32 protein concentration of 42 ng / μL or more.

[0053] Example 5: Suppression Effect on Amplification Inhibition by Polycytidylic Acid In this example, the effect of using polycytidylic acid (polyC), which is another hydrophilic polymer (nucleic acid polymer), in the long-term RT-RamDA reaction was examined. Similar to the previous examples, first, a nucleic acid fragment sample was provided in 5 μL of the reverse transcription reaction solution 1 (normal reverse transcription reaction) shown in Table 1 as a control, and the reverse transcription reaction was performed using the reaction cycle shown in Table 2. Separately, a nucleic acid fragment sample was provided in 5 μL of the RT-RamDA reaction solution 5 (conditions 1 to 3) shown in Table 10, and the RT-RamDA reaction was performed using reaction cycle 3 shown in Table 6. As the nucleic acid fragment sample, 10 pg of RNA purified from HeLa cells using the RNeasy Mini Kit (Qiagen) was used.

Table 10

[0054] After the reverse transcription reaction or the RT-RamDA reaction, the amplification rate of the RT-RamDA reaction was analyzed by real-time PCR using the βACTIN gene and the NEAT1 gene as indicators in the same manner as in Example 1. The same primer sets for the βACTIN gene and the NEAT1 gene as in Example 2 were used. Also, the reaction solution and thermal cycle conditions of real-time PCR were carried out in the same manner as in Example 1. After analysis, the amplification rate by the RT-RamDA reaction was evaluated by subtracting the Ct value of the RT-RamDA method obtained from the sample to which the reverse transcription reaction solution 5 was added from the Ct value of the normal reverse transcription reaction obtained from the sample to which the reverse transcription reaction solution 1 was added, and obtaining the ΔCt value.

[0055] The results of Example 5 are shown in FIG. 5. Even in the sample to which polycytidylic acid was added, the amplification rate by the RT-RamDA reaction decreased in the RT-RamDA reaction for long times of 120 minutes and 360 minutes, similar to the case of the previous examples with polyinosinic acid. Also, by increasing the concentration of the single-stranded DNA-binding protein T4 gene 32 protein from 33 ng / μL to 67 ng / μL, the amplification rate in the reaction time of the RT-RamDA reaction for 120 minutes and 360 minutes was improved. Therefore, it was shown that hydrophilic polymers other than polyinosinic acid also inhibit the RT-RamDA reaction, and this inhibition can be alleviated by adding 40 ng / μL or more of a single-stranded DNA-binding protein such as T4 gene 32 protein.

[0056] Example 6: Suppression Effect on Amplification Inhibition by Polyethylene Glycol In this example, the effect of using polyethylene glycol (PEG), another hydrophilic polymer, in the long-time RT-RamDA reaction was examined. Similar to the previous examples, first, a nucleic acid fragment sample was provided in 5 μL of the reverse transcription reaction solution 1 (normal reverse transcription reaction) shown in Table 1 as a control, and the reverse transcription reaction was performed with the reaction cycle shown in Table 2. Separately, a nucleic acid fragment sample was provided in 5 μL of the RT-RamDA reaction solution 6 (conditions 1 to 3) shown in Table 11, and the RT-RamDA reaction was performed with reaction cycle 3 shown in Table 6. As the nucleic acid fragment sample, 10 pg of RNA purified from HeLa cells using the RNeasy Mini Kit (Qiagen) was used.

Table 11

[0057] After the reverse transcription reaction or RT-RamDA reaction, the amplification rate of the RT-RamDA reaction was analyzed by real-time PCR using the β-ACTIN gene as an index in the same manner as in Example 1. The same primer set for the β-ACTIN gene as in Example 1 was used. Also, the reaction solution and thermal cycle conditions of real-time PCR were carried out in the same manner as in Example 1. After the analysis, the Ct value of the RT-RamDA method obtained from the sample to which the RT-RamDA reaction solution 6 was added was subtracted from the Ct value of the normal reverse transcription reaction obtained from the sample to which the reverse transcription reaction solution 1 was added, and the amplification rate by the RT-RamDA reaction was evaluated by obtaining the ΔCt value.

[0058] The results of Example 6 are shown in FIG. 6. A decrease in the amplification rate was also observed in the sample to which polyethylene glycol (PEG) was added. In particular, in the RT-RamDA reaction for a long time of 120 minutes and 360 minutes, the amplification rate by the RT-RamDA reaction was significantly decreased. Also, by increasing the concentration of the single-stranded DNA-binding protein T4 gene 32 protein from 33 ng / μL to 67 ng / μL, a significant decrease in the amplification rate in the RT-RamDA reaction for a long time of 120 minutes and 360 minutes could be significantly suppressed. Therefore, it was shown that hydrophilic polymers other than nucleic acid polymers also inhibit the RT-RamDA reaction, and this inhibition can be suppressed by adding 40 ng / μL or more of a single-stranded DNA-binding protein such as T4 gene 32 protein.

Industrial Applicability

[0059] According to the present invention, it becomes possible to suppress the inhibitory action even in a system to which an inhibitor that reduces the amplification efficiency is added when performing a nucleic acid amplification reaction such as the RT-RamDA reaction at a predetermined temperature for a long time. This technique is useful for various gene analysis methods such as single-cell analysis using the RT-RamDA method.

Claims

1. A method for amplifying nucleic acid, comprising the step of incubating a nucleic acid amplification reaction solution containing a hydrophilic polymer at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes, wherein the nucleic acid amplification reaction solution contains a single-stranded DNA-binding protein at 40 ng / μL or more, thereby suppressing the inhibition of nucleic acid amplification by the hydrophilic polymer.

2. The method according to claim 1, wherein the nucleic acid is amplified by the RT-RamDA method.

3. The method according to claim 1 or 2, wherein the amplification reaction solution contains an RNA:DNA hybrid strand-degrading enzyme specific for DNA strands, a single-stranded DNA-binding protein at 40 ng / μL or more, a reverse transcriptase, a primer, a template RNA, and a hydrophilic polymer.

4. The method according to claim 3, wherein the RNA:DNA hybrid strand-degrading enzyme specific for DNA strands is a non-specific DNA-degrading enzyme.

5. The method according to claim 3 or 4, wherein the template RNA is RNA extracted from 1 cell to 1000 cells.

6. The method according to any one of claims 1 to 5, wherein the single-stranded DNA-binding protein is T4 gene 32 protein.

7. The method according to any one of claims 1 to 6, wherein the incubation time is 60 minutes or more.

8. The method according to any one of claims 1 to 7, wherein the incubation time is 120 minutes or more.

9. The method according to any one of claims 1 to 8, wherein the hydrophilic polymer is at least one selected from the group consisting of a nucleic acid polymer and polyethylene glycol.

10. The method according to any one of claims 1 to 9, wherein the concentration of the hydrophilic polymer in the nucleic acid amplification reaction solution is 0.01 ng / μL or more.

11. The method according to any one of claims 1 to 10, wherein the hydrophilic polymer is at least one selected from the group consisting of polyinosinic acid and polycytidylic acid.

12. The method according to any one of claims 1 to 11, wherein the incubation temperature is a temperature of 35°C or more and 45°C or less.

13. A method for amplifying a nucleic acid, comprising the step of incubating a nucleic acid amplification reaction solution containing a hydrophilic polymer at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes, wherein in the nucleic acid amplification reaction solution, a single-stranded DNA binding protein is contained in an amount of 0.01 to 1500 parts by mass with respect to 1 part by mass of the hydrophilic polymer, thereby suppressing the inhibition of nucleic acid amplification by the hydrophilic polymer.

14. A kit for nucleic acid amplification, comprising a hydrophilic polymer and a single-stranded DNA binding protein having a concentration adjusted to be 40 ng / μL or more in a nucleic acid amplification reaction solution, the kit comprising a step of incubating the nucleic acid amplification reaction solution at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes.

15. A kit for nucleic acid amplification, comprising a hydrophilic polymer and 0.01 to 1500 parts by mass of a single-stranded DNA binding protein with respect to 1 part by mass of the hydrophilic polymer, the kit comprising a step of incubating the nucleic acid amplification reaction solution at a temperature higher than 30°C and lower than 50°C for a time longer than 30 minutes.

Images