Transcription regulatory nucleotide sequences and methods of use

Abstract

Described herein are nucleic acids with constitutive promoter activity and the use of such nucleic acids with constitutive promoter activity to express a polynucleotide of interest in plants.

Description

Technical Field

[0001] Nucleic acids having constitutive promoter activity and the use of such nucleic acids for expressing a polynucleotide of interest in plants are described herein.

Background Art

[0002] Modification of plants to alter and / or improve phenotypic traits (e.g., productivity or quality) requires overexpression or downregulation of endogenous genes or expression of heterologous genes in plant tissues. Such genetic modification relies on the availability of means to drive and control gene expression as required. Indeed, genetic modification relies on the availability and use of suitable promoters that regulate gene expression effectively in plants and confer the desired effects in plants.

Summary of the Invention

[0003] In one aspect, a recombinant gene for regulating the expression of a polynucleotide of interest, the recombinant gene comprising a nucleic acid having constitutive promoter activity that is at least 80% identical to the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof, is described herein. In some embodiments, the nucleic acid having constitutive promoter activity has at least 80% (or at least 90%, 95%, 98%, or at least 99%) or higher identity to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the nucleic acid having constitutive promoter activity comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

[0004] In some embodiments, the recombinant gene further comprises at least one polynucleotide of interest operably linked to a nucleic acid having constitutive promoter activity. In some embodiments, the polynucleotide of interest is a herbicide resistance coding sequence, an insecticidal coding sequence, a nematicidal coding sequence, an antimicrobial coding sequence, an antibacterial coding sequence, an antiviral coding sequence, an abiotic and biotic stress resistance coding sequence, or a sequence that modifies a plant trait such as yield, grain quality, nutrient content, starch quality and quantity, nitrogen fixation and / or utilization, and oil content and / or composition. In some embodiments, the polynucleotide of interest is heterologous to the nucleic acid having constitutive promoter activity.

[0005] In another aspect, the disclosure provides a vector comprising the recombinant gene described herein. In some embodiments, the vector is an expression vector.

[0006] In another aspect, the disclosure provides a host cell comprising the recombinant gene or vector described herein. In some embodiments, the host cell is a plant cell.

[0007] In another aspect, the disclosure provides a plant or plant part or seed comprising the recombinant gene or vector described herein or a heterologous nucleic acid having constitutive promoter activity described herein. In some embodiments, the plant or plant part or seed is a monocotyledonous plant or plant part. In some embodiments, the plant or plant part or seed is a dicotyledonous plant or plant part or seed. In some embodiments, the plant or plant part is hemizygous for the recombinant gene. In some embodiments, the plant or plant part is homozygous for the recombinant gene.

[0008] In another aspect, the present disclosure provides a method for expressing a polynucleotide of interest in a host cell, the method comprising (a) introducing or providing to the host cell a nucleic acid, recombinant gene or vector having a constitutive promoter activity as described herein. In some embodiments, the host cell is a plant cell. In some embodiments, the detectable amount of the accumulated protein encoded by the polynucleotide of interest is about 0.01% to 1.15% (or about 0.05% to 1.15%, or about 0.1% to 1.15%, or about 0.5% to 1.15%, or about 1% to 1.15%) of the total soluble protein extracted. The term "total soluble protein (TSP)" as used herein typically refers to all proteins that are soluble in a buffer suitable for protein quantification facilitated by mechanical disruption.

[0009] In another aspect, the present disclosure provides a method for producing a plant or a plant part or a seed, the method comprising (a) introducing into a plant cell a nucleic acid, recombinant gene or vector having a constitutive promoter activity as described herein, and (b) regenerating a plant or a plant part from the plant cell. In some embodiments, two or more copies of the recombinant gene are introduced into the plant cell.

[0010] In another aspect, the present disclosure provides a method for providing pesticidal activity in a plant, the method comprising introducing or providing to a host cell of the plant a recombinant gene comprising a polynucleotide sequence encoding a pesticidal protein. In some embodiments, the pesticidal protein is an insecticidal protein. In some embodiments, two or more copies of the recombinant gene are introduced into the plant cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0011]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

BEST MODE FOR CARRYING OUT THE INVENTION

[0012] The present disclosure provides an isolated nucleic acid having a constitutive promoter activity that directs the constitutive transcription / expression of a polynucleotide of interest operably linked in a plant cell, plant, or plant part or seed, and a recombinant gene comprising said nucleic acid having a constitutive promoter activity. The present invention is based on the discovery that a nucleic acid having a constitutive promoter activity comprising the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 and functional fragments thereof have constitutive promoter activity in plants and provide an appropriate expression level of a polynucleotide of interest (e.g., a polynucleotide encoding an insecticidal protein). Such appropriate expression enables the expression of a protein, such as an insect resistance protein / insecticidal toxin, at a level that effectively functions as an insecticide without having a harmful effect (e.g., toxicity) on the plant.

[0013] In one aspect, a recombinant gene for regulating the expression of a polynucleotide of interest is described herein, the recombinant gene comprising a nucleic acid having a constitutive promoter activity or a functional fragment thereof that is at least 80% (or at least 90%, 95%, 98%, or at least 99%) identical to the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the nucleic acid having a constitutive promoter activity comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

[0014] As used herein, "nucleic acid having promoter activity" refers to the nucleotide sequence of a promoter.

[0015] As used herein, the term "functional fragment" refers to a nucleic acid sequence that is shorter in length than the nucleic acid having constitutive promoter activity set forth in SEQ ID NO: 1 or SEQ ID NO: 2 but retains the activity of the nucleic acid having constitutive promoter activity set forth in SEQ ID NO: 1 or SEQ ID NO: 2. For example, in some embodiments, a functional fragment of a nucleic acid having constitutive promoter activity comprises a nucleotide sequence of at least 850 bp, at least 900 bp, or at least 1000 bp in length and retains the activity of the nucleic acid having constitutive promoter activity.

[0016] Expression vector Another object of the present invention relates to a vector containing the recombinant gene of the present invention.

[0017] The term "vector" includes phages, plasmids, viral or retroviral vectors, as well as artificial chromosomes, such as bacterial or yeast artificial chromosomes. Further, the term also relates to targeting constructs that enable random or site-specific integration of the targeting construct into genomic DNA. Such targeting constructs contain DNA of sufficient length for homologous or heterologous recombination, as described in detail below. Vectors containing the polynucleotides of the present invention may contain a selectable marker for propagation and / or selection in a host. Vectors may be incorporated into host cells by a variety of techniques well known in the art. When introduced into a host cell, the vector may be present in the cytoplasm or integrated into the genome. In the latter case, it should be understood that the vector may further contain nucleic acid sequences that allow for homologous recombination or heterologous insertion. Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. The terms "transformation" and "transfection", conjugation and transduction, as used in the context of this specification, are intended to include a number of methods well known in the art for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate, rubidium chloride or calcium chloride coprecipitation, DEAE dextran-mediated transfection, lipofection, natural competence, carbon-based clusters, chemically mediated uptake, electroporation or particle bombardment (e.g., "gene gun").Suitable methods for the transformation or transfection of host cells, including plant cells, can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and other laboratory manuals, such as Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, Ed.: Gartland and Davey, Humana Press, Totowa, New Jersey. Alternatively, plasmid vectors may be introduced by heat shock or electroporation techniques. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line prior to application to the host cells. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally occurs only in complementing host / cells.

[0018] The vectors referred to in this specification may be suitable as cloning vectors, i.e., may be replicable in a microorganism system. Such vectors ensure efficient cloning in bacteria, yeast or fungi and allow for stable transformation of plants. Of note are, in particular, various binary and co-integrated vector systems suitable for T-DNA-mediated transformation. Such vector systems are, in principle, characterized by containing at least the vir genes required for Agrobacterium-mediated transformation and the sequences delimiting the T-DNA (T-DNA border). These vector systems may also contain further cis-regulatory regions, such as promoters and terminators and / or selection markers by which transformed host cells or organisms can be identified. Co-integrated vector systems have the vir genes and T-DNA sequences constructed on the same vector, while binary systems are based on at least two vectors, one of which has the vir genes but no T-DNA, and the second vector has the T-DNA but no vir genes. As a result, the last-described vectors are relatively small, easy to manipulate and can be replicated in both Escherichia coli (E. coli) and Agrobacterium. An overview of binary vectors and their use can be found in Hellens et al, Trends in Plant Science (2000) 5, 446-451.Furthermore, by using an appropriate cloning vector, the recombinant gene of the present invention can be introduced into a host cell or organism, such as a plant or an animal, and thus can be used in the transformation of plants, such as those published and cited in Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Florida), chapter 6 / 7, pp. 71-119 (1993); F.F. White, Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205 225.

[0019] The vector of the present invention can be an expression vector. In such an expression vector, the recombinant gene comprises a nucleic acid having the constitutive promoter activity as specified above that enables expression in eukaryotic cells or an isolated fraction thereof. The expression vector may also contain additional regulatory elements including translation enhancers in addition to transcription enhancers, in addition to the recombinant gene of the present invention. The expression vector may also be a gene transfer or targeting vector. Expression vectors derived from viruses such as retroviruses, vaccinia viruses, adeno-associated viruses, herpes viruses, or bovine papillomaviruses may be used for delivery of the recombinant gene or vector of the present invention to a targeted cell population. Recombinant viral vectors can be constructed using methods well known to those skilled in the art. See, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994).

[0020] Suitable expression vector backbones may be derived from expression vectors known in the art, such as the Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8, pRc / CMV, pcDNA1, pcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL). Further examples of typical fusion expression vectors are pGEX (Pharmacia Biotech Inc; Smith, D.B., and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England BioLabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), in which glutathione S-transferase (GST), maltose E-binding protein and protein A are fused to the nucleic acid of interest encoding the protein to be expressed, respectively. Target gene expression from the pTrc vector is based on transcription from the hybrid trp-lac fusion promoter by the host RNA polymerase. Target gene expression from the pET 11d vector is based on transcription of the T7-gn10-lac fusion promoter, which is mediated by the co-expressed viral RNA polymerase (T7 gn1). This viral polymerase is provided by the host strains BL21 (DE3) or HMS174 (DE3) from an endogenous l-prophage having the T7 gn1 gene under the transcriptional control of the lacUV 5 promoter. Examples of vectors for expression in the yeast S. cerevisiae include pYepSecl (Baldari et al. (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123) and pYES2 (Invitrogen Corporation, San Diego, CA).Vectors suitable for use in other fungi, such as filamentous fungi, and methods for constructing the vectors are those described in detail in van den Hondel, C.A.M.J.J., & Punt, P.J. (1991) “Gene transfer systems and vector development for filamentous fungi, Applied Molecular Genetics of fungi, J.F. Peberdy et al., Ed., pp. 1-28, Cambridge University Press: Cambridge, or More Gene Manipulations in Fungi (J.W. Bennett & L.L. Lasure, Ed., pp. 396-428: Academic Press: San Diego). Further suitable yeast vectors are, for example, pAG-1, YEp6, YEp13 or pEMBLYe23.

[0021] In some embodiments, the vector(s) described herein that contain a recombinant gene are propagated and amplified in a suitable organism, i.e., an expression host. In some embodiments, one copy of the vector is propagated and amplified in a suitable organism. In some embodiments, two or more (e.g., 3, 4, 5, 6, 7, 8 or more) copies of the vector are propagated and amplified in a suitable organism.

[0022] The term "recombinant gene", as used herein, refers to a linear or circular nucleic acid molecule. It encompasses DNA and RNA sequences that have the ability to direct the expression of a specific nucleotide sequence in a suitable host cell. Generally, it includes a promoter operably linked to the polynucleotide of interest, which may in turn be operably linked to a termination signal and / or other regulatory elements. The recombinant genes of the present invention are characterized by containing a nucleic acid having a constitutive promoter activity as defined herein. The recombinant gene may also include sequences that may be required for proper translation of the nucleotide sequence. The coding region usually encodes the protein of interest, but may encode a functional RNA of interest, such as antisense RNA or untranslated RNA, in the sense or antisense orientation. A recombinant gene containing a polynucleotide sequence of interest may be chimeric, i.e., at least one of its components may be heterologous to at least one of the other components. The recombinant gene may also be one obtained in a recombinant form that is naturally occurring but useful for heterologous expression. The recombinant gene may be assembled entirely extracellularly (e.g., by recombinant cloning techniques). However, the recombinant gene may also be assembled using partially endogenous components. For example, a recombinant gene may be obtained by placing (or inserting) a promoter sequence upstream of an endogenous sequence, such that the endogenous sequence is thereby functionally linked and controlled by the promoter sequence. Similarly, the nucleic acid sequence to be expressed may be placed (or inserted) downstream of an endogenous promoter sequence, such that a recombinant gene is formed. In another embodiment, such a recombinant gene includes a transcription initiation region linked to the polynucleotide of interest. Such a recombinant gene may be provided with a plurality of restriction sites for insertion of the gene of interest such that it is under the transcriptional regulation of a regulatory region. The recombinant gene may additionally contain a selectable marker gene. A cassette includes a transcriptional and translational initiation region functional in plants, a DNA sequence of interest, and transcriptional and translational termination regions in the 5'-3' direction of transcription.The termination region may be native to the transcription initiation region and the DNA sequence of interest, or may be native to the DNA sequence of interest, or may be derived from another source. Convenient termination regions are available from the Ti-plasmids of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions and others described below (see also Guerineau 1991; Proudfoot 1991; Sanfacon 1991; Mogen 1990; Munroe 1990; Ballas 1989; Joshi 1987). The recombinant gene can also contain a multiple cloning site. In such cases, the multiple cloning site may be configured in such a way as to allow for the functional ligation of the polynucleotide to be introduced into the multiple cloning site together with the transcriptional regulatory sequences. In addition to the above-described components, the recombinant gene of the present invention may contain components required for homologous recombination, i.e., genomic sequences flanking the target locus. However, recombinant genes consisting essentially of nucleic acids having constitutive promoter activity are also contemplated, as defined below.

[0023] The terms "operably linked" or "functionally linked" refer to the relatedness of multiple nucleic acid sequences on a single nucleic acid fragment such that the function of one nucleic acid sequence is affected by another nucleic acid sequence. For example, a regulatory DNA sequence is said to be "operably linked" or "associated" with a DNA sequence encoding RNA or a polypeptide when the two sequences are positioned such that the regulatory DNA sequence affects the expression of the coding DNA sequence (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). The coding sequence can be operably linked to the regulatory sequence in a sense or antisense orientation.

[0024] As used herein, the term "promoter" refers to a nucleotide sequence, usually upstream (5') of the coding sequence, that controls the expression of the coding sequence by providing recognition for RNA polymerase and other factors required for proper transcription. Examples of "promoters" include minimal promoters, which are short DNA sequences composed of, in some cases, a TATA box and other sequences that help specify the site of transcription initiation, to which regulatory elements are added for enhanced expression. "Promoter" also refers to a nucleotide sequence that includes a minimal promoter and regulatory elements and has the ability to control the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter of which are often referred to as enhancers. Thus, an "enhancer" is a DNA sequence that can stimulate promoter activity and can be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of the promoter. It has the ability to operate in both orientations (normal or opposite) and to function when moved either upstream or downstream of the promoter. Both enhancers and other upstream promoter elements bind to sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from native genes, or they may be composed of different elements, derived from different promoters found in nature, or composed of synthetic DNA segments.

[0025] A promoter may also contain a DNA sequence involved in the binding of protein factors, and the protein factors control the effectiveness of transcription initiation in response to physiological or developmental conditions. The "initiation site" is the position around the first nucleotide that is part of the sequence to be transcribed, and the first nucleotide is also defined as the +1 position. All other sequences of the gene and its regulatory regions are numbered relative to this site. Downstream sequences (i.e., additional protein-coding sequences in the 3' direction) are named positively, and upstream sequences (mostly regulatory regions in the 5' direction) are named negatively. A promoter element, such as a TATA element, that is inactive or has greatly reduced promoter activity in the absence of upstream activation is referred to as a "minimal" or "core" promoter. In the presence of suitable transcription factors, the minimal promoter functions to permit transcription. A "minimal" or "core" promoter thus consists only of all the basal elements required for transcription initiation, such as the TATA box and / or initiator.

[0026] As used herein, the term "constitutive promoter" refers to a promoter capable of expressing an open reading frame (ORF) in all or substantially all of the plant tissue during all or substantially all of the developmental stages of the plant. Each of the transcription activation elements does not exhibit absolute tissue specificity, but mediates transcription activation in most plant tissues at a level of at least 1% achieved in the plant tissue where transcription is most active. "Constitutive expression" refers to expression using a constitutive promoter.

[0027] As used herein, the terms "cis-regulatory element" or "promoter motif" refer to cis-acting transcriptional regulatory elements that confer an aspect of the overall control of gene expression. Cis-elements may function to bind transcription factors, i.e., trans-acting protein factors that regulate transcription. Some cis-elements bind more than one transcription factor, and transcription factors may interact with more than one cis-element with different affinities. The promoters of the present invention preferably contain cis-elements that can confer or modulate gene expression. Cis-elements can be identified by a number of techniques, including deletion analysis, i.e., deleting one or more nucleotides from the 5'-end or internal region of a promoter; DNA-binding protein analysis using DNase I footprinting, methylation interference, electrophoretic mobility shift assay, in vivo genomic footprinting by ligation-mediated PCR, and other conventional assays; or DNA sequence similarity analysis using known cis-element motifs by conventional DNA sequence comparison methods. The fine structure of cis-elements can be further studied by mutagenesis (or substitution) of one or more nucleotides or other conventional methods. Cis-elements can be obtained by chemical synthesis or by isolation from promoters containing such elements, and they can be synthesized with additional flanking nucleotides containing useful restriction enzyme sites to facilitate manipulation of the subsequences.

[0028] The term "heterologous" with respect to a nucleic acid molecule or DNA refers to a nucleic acid molecule that is not operably linked in nature or is operably linked to a second nucleic acid molecule that is operably linked at a different location in nature or is engineered to be operably linked. For example, a promoter of the present invention is functionally linked to its native coding sequence in its natural environment, while in the present invention, it is linked to another coding sequence that may be derived from the same organism, a different organism, or a synthetic coding sequence. A coding sequence under the control of a promoter of the present invention is heterologous to the promoter when the natural sequence of the coding sequence has been modified as a result of the sequence being engineered, for example, by mutation, such as insertion, deletion, etc., and thus is additionally understood to be heterologous to the promoter of the present invention. Further, a nucleic acid having constitutive promoter activity is heterologous to a plant, plant part, or seed containing it when it is synthetic, derived from another non-crossable organism (transgenic), derived from another crossable organism (cisgenic), or derived from the same organism but its native genomic localization has been altered compared to a control plant (cisgenic), such as a wild-type plant. The altered genomic localization is understood to mean that the nucleic acid having constitutive promoter activity is located on a different chromosome from its native genomic localization in a wild-type plant or is located on the same chromosome but is 10 kb or greater, for example 10 kb, preferably 5 kb or greater, for example 5 kb, more preferably 1000 bp or greater, for example 1000 bp, even more preferably 500 bp or greater, for example 500 bp, particularly preferably 100 bp or greater, for example 100 bp, most preferably 10 bp or greater, for example 10 bp away.

[0029] Expression in a host cell In another aspect, there is provided a method for expressing a polynucleotide of interest in a host cell, the method comprising introducing into the host cell a recombinant gene or vector described herein and expressing the polynucleotide of interest in the host cell, as described herein.

[0030] As used herein, the term "expression" refers to the transcription and / or translation of an endogenous gene, ORF or portion thereof, transgene or cis-gene in a plant. For example, in the case of an antisense construct, expression can refer to the transcription of the antisense DNA only. Additionally, expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression can also refer to the production of a protein.

[0031] The "expression pattern" of a promoter (with or without an enhancer) is a pattern of expression levels indicating where in the plant and at which developmental stage transcription is initiated by said promoter. The expression pattern of a set of promoters is said to be complementary when the expression pattern of one promoter shows little overlap with that of another promoter. The level of expression of a promoter can be determined by measuring the "steady-state" concentration of a standard transcribed reporter mRNA. This measurement is indirect because the concentration of the reporter mRNA depends not only on its synthesis rate but also on the rate at which the mRNA is degraded. Thus, the steady-state level results from the synthesis rate and the degradation rate. The rate of degradation, however, can be considered to proceed at a fixed rate when the transcribed sequences are identical, so this value can serve as an indicator of the synthesis rate. When promoters are compared in this way, the techniques available to those skilled in the art are hybridization S1-RNase analysis, Northern blot, and competitive RT-PCR. This list of techniques does not by any means represent all available techniques, but rather describes commonly used procedures for analyzing the transcriptional activity and expression levels of mRNA. In fact, analysis of the transcription start points in almost all promoters has revealed that there is usually no single base at which transcription is initiated, but rather a more or less clustered set of start sites, each of which accounts for some start point of the mRNA. Since this distribution varies from promoter to promoter, the sequences of the reporter mRNA in each population are different from each other. Since each mRNA species undergoes more or less degradation, it is not possible to predict a single degradation rate for different reporter mRNAs. The sequence around the start site ("initiator") has been shown to play an important role in determining the level of RNA expression directed by its specific promoter for various eukaryotic promoter sequences. This also includes the part of the transcribed sequence. The direct fusion of a promoter to a reporter sequence thus leads to suboptimal levels of transcription.Generally used procedures for analyzing expression patterns and levels are through determination of the "steady state" levels of protein accumulation in cells. Commonly used candidates for reporter genes, known to those skilled in the art, are beta-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), and proteins with fluorescent properties such as green fluorescent protein (GFP) from Aequora victoria. In principle, however, many more proteins are suitable for this purpose as long as they do not interfere with essential plant functions. A number of tools are suitable for quantification and determination of localization. Detection systems can be readily created or, for example, those based on immunochemistry, enzymes, fluorescence detection, and quantification are available. Protein levels can be determined in plant tissue extracts or intact tissues using in situ analysis of protein expression. Generally, individual transformants with one chimeric promoter-reporter construct can differ in the level of expression of the reporter gene. The phenomenon where such transformants do not express any detectable product (RNA or protein) is also frequently observed. Variability in expression is generally attributed to "position effects", but the molecular mechanisms underlying this inactivity are usually not clear.

[0032] Expression of the polynucleotide of interest can be determined by various well-known techniques, such as Northern blot or in situ hybridization techniques as described in WO 02 / 102970.

[0033] Nucleic acid As used herein, the term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides in either single-stranded or double-stranded form, and polymers thereof, which are composed of monomers (nucleotides) containing a sugar, a phosphate, and a base which is either a purine or a pyrimidine. Unless otherwise specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants, such as degenerate codon substitutions, and complementary sequences, in addition to the explicitly indicated sequence. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with a mixed-base and / or deoxyinosine residue (Batzer 1991; Ohtsuka 1985; Rossolini 1994). A "nucleic acid fragment" is a portion of a given nucleic acid molecule. In higher plants, deoxyribonucleic acid (DNA) is the genetic material, and ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. The term "nucleotide sequence" refers to a polymer of DNA or RNA which can be single-stranded or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into a DNA or RNA polymer. The terms "nucleic acid" or "nucleotide sequence" may also be used interchangeably with gene, cDNA, DNA, and RNA encoded by a gene.

[0034] "Isolated nucleic acid", as used interchangeably with "isolated DNA" herein, refers to a nucleic acid that, regardless of its length and sequence, does not exist in its natural genomic context. Isolated DNA can refer to, for example, DNA physically separated from its genomic context, such as a fragment of genomic DNA. Isolated DNA can also be DNA that has been artificially produced, such as chemically synthesized DNA, or DNA produced, for example, via an amplification reaction such as the polymerase chain reaction (PCR) well known in the art. Isolated DNA can further refer to DNA that exists in a context where it does not naturally occur. For example, isolated DNA can refer to a DNA fragment present in a plasmid. Further, isolated DNA can refer to a DNA fragment present in a chromosomal context other than the context in which it naturally occurs, such as at a location in a genome different from its natural location, in a genome of a species other than the species in which it naturally occurs, or in an artificial chromosome.

[0035] Nucleic acid variants having a constitutive promoter activity that retains the activity of the wild-type nucleic acid having a constitutive promoter activity are also contemplated. The term "variant" as used herein with respect to a sequence (e.g., a polypeptide or nucleic acid sequence, such as a nucleic acid having a constitutive promoter activity of the present invention) is intended to mean a substantially similar sequence. Naturally occurring allelic variants, such as these, can be identified with the use of well-known molecular biology techniques such as the polymerase chain reaction (PCR) and hybridization techniques.

[0036] Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis. In general, nucleotide sequence variants of the present invention have at least 70%, for example, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, generally at least 80%, for example, 81% - 84%, at least 85%, for example, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% nucleotide sequence identity to the native (wild-type or endogenous) nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof.

[0037] As used herein, the terms "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences refer to the residues that are the same in the two sequences when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to a protein, the positions of non-identical residues are often different by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues having similar chemical properties (e.g., charge or hydrophobicity), and thus do not change the functional properties of the molecule. It is recognized that where sequences differ by conservative substitutions, the percentage of sequence identity may be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art. Typically, this involves scoring conservative substitutions as partial matches rather than complete mismatches, thereby increasing the percentage of sequence identity. Thus, for example, if identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0, conservative substitutions are given a score between 0 and 1. Scoring of conservative substitutions is calculated, for example, as implemented in the program PC / GENE (Intelligenetics, Mountain View, Calif.).

[0038] The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, at least 90%, 91%, 92%, 93%, or 94%, and at least 95%, 96%, 97%, 98%, or 99% sequence identity when compared to a reference sequence, using one of the alignment programs described using standard parameters. Those skilled in the art will recognize that these values can be appropriately adjusted to determine the corresponding identity of the proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, and the placement of reading frames, among other factors.

[0039] Another indication that nucleotide sequences are substantially identical is whether two molecules hybridize to each other under stringent conditions (see below). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) of a particular sequence at a defined ionic strength and pH. However, stringent conditions can encompass temperatures within the range of about 1°C to about 20°C, depending on the desired degree of stringency as otherwise qualified herein. Nucleic acids that do not hybridize to each other under stringent conditions can still be substantially identical if the polypeptides they encode are substantially identical. This can occur, for example, when a copy of a nucleic acid is made using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the polypeptide encoded by the second nucleic acid.

[0040] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments, such as Southern and Northern hybridization, are sequence-dependent and vary under different environmental parameters. Tm is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe (under defined ionic strength and pH). Specificity is typically a function of the wash after hybridization, and the essential factors are the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, Tm can be approximated from the equation of Meinkoth and Wahl, 1984: Tm = 81.5°C + 16.6(log10 M) + 0.41(%GC) - 0.61(% form) - 500 / L Wherein, M is the molar concentration of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is reduced by about 1 °C for each 1% of mismatch, and thus, the Tm, hybridization, and / or washing conditions can be adjusted to hybridize to a sequence of desired identity. For example, if a sequence with >90% identity is desired, the Tm can be decreased by 10 °C. Generally, stringent conditions are selected to be about 5 °C lower than the thermal melting point I of the specific sequence and its complement at the defined ionic strength and pH. However, for highly stringent conditions, hybridization and / or washing 1, 2, 3, or 4 °C lower than the thermal melting point I can be utilized, for moderately stringent conditions, hybridization and / or washing 6, 7, 8, 9, or 10 °C lower than the thermal melting point I can be utilized, and for low stringency conditions, hybridization and / or washing 11, 12, 13, 14, 15, or 20 °C lower than the thermal melting point I can be utilized. Those skilled in the art will understand that the variability in the stringency of hybridization and / or washing solutions is inherently described using the above formula, hybridization and washing compositions, and the desired T. If the desired degree of mismatch results in a T of less than 45 °C (aqueous solution) or less than 32 °C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. Extensive guidance on nucleic acid hybridization can be found in Tijssen, 1993. Generally, high stringency hybridization and washing conditions are selected to be about 5 °C lower than the thermal melting point Tm of the specific sequence at the defined ionic strength and pH.

[0041] Examples of high stringency wash conditions are 0.15 M NaCl at about 15 minutes at 72 °C. An example of stringent wash conditions is a wash in 0.2X SSC for 15 minutes at 65 °C (see Sambrook below for a description of the SSC buffer). In many cases, a low stringency wash is performed prior to the high stringency wash to remove background probe signal. For example, an exemplary medium stringency wash of a duplex of more than 100 nucleotides is 1X SSC for 15 minutes at 45 °C. For example, an exemplary low stringency wash of a duplex of more than 100 nucleotides is 4 - 6X SSC for 15 minutes at 40 °C. For short probes (e.g., about 10 - 50 nucleotides), stringent conditions typically involve a salt concentration of Na ion concentration (or other salt) at pH 7.0 - 8.3 of less than about 1.5 M, more preferably about 0.01 - 1.0 M, and the temperature is typically at least about 30 °C, at least about 60 °C for long probes (e.g., >50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Generally, a signal - to - noise ratio of 2X (or higher) than that observed for unrelated probes in a particular hybridization assay indicates detection of specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially identical. This occurs, for example, when copies of nucleic acids are made using the maximum codon degeneracy allowed by the genetic code.

[0042] Very stringent conditions are selected to be equal to the Tm of a particular probe. Examples of high stringency conditions for hybridization of complementary nucleic acids having more than 100 complementary residues in a Southern or Northern blot filter are hybridization in 50% formamide, e.g., 50% formamide, 1 M NaCl, 1% SDS at 37°C, and washing in 0.1x SSC at 60 - 65°C. Exemplary low stringency conditions include hybridization in a buffer solution of 30 - 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37°C, and washing in 1X - 2X SSC (20X SSC = 3.0 M NaCl / 0.3 M trisodium citrate) at 50 - 55°C. Exemplary moderate stringency conditions include hybridization in 40 - 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and washing in 0.5X - 1X SSC at 55 - 60°C.

[0043] The following are examples of sets of hybridization / washing conditions that can be used to clone nucleotide sequences that are substantially identical to the reference nucleotide sequences of the present invention. The reference nucleotide sequences are preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50°C (very low stringency conditions), more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 2X SSC, 0.1% SDS at 50°C (low stringency conditions), even more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 1X SSC, 0.1% SDS at 50°C (moderate stringency conditions), preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C (high stringency conditions), more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 0.1X SSC, 0.1% SDS at 65°C (very high stringency conditions) and hybridize to the reference nucleotide sequences.

[0044] In some embodiments, the nucleic acid molecules described herein can be "optimized" for enhanced expression in a target plant (see, e.g., WO 91 / 16432; Perlak 1991; Murray 1989). In this manner, the open reading frame in a gene or gene fragment can be synthesized using plant-preferred codons (see, e.g., Campbell & Gowri, 1990 for a discussion of host-preferred codon usage). As such, the nucleotide sequence can be optimized for expression in any plant. It is recognized that all or any portion of the gene sequence can be optimized or synthesized. That is, synthetic or partially optimized sequences can also be used. Variant nucleotide sequences and proteins also include sequences and proteins derived from mutagenic and recombinogenic procedures such as DNA shuffling. Using such procedures, one or more different coding sequences can be engineered to create novel polypeptides having desired properties. In this manner, a library of recombinant polynucleotides is generated from a population of related sequence polynucleotides that include sequence regions having substantial sequence identity and that can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art (see, e.g., Stemmer 1994; Stemmer 1994; Crameri 1997; Moore 1997; Zhang 1997; Crameri 1998; and U.S. Patents 5,605,794, 6, 8, 10, and 12,837,458).

[0045] The polynucleotide of interest As used herein, the term "polynucleotide of interest" refers to a nucleic acid that is expressed under the control of a nucleic acid having the constitutive promoter activity referred to herein. The polynucleotide of interest may encode a polypeptide whose presence is desired in a plant cell, plant, or plant part referred to herein. Such a polypeptide may be an enzyme required for the synthesis of seed storage compounds or a seed storage protein. It should be understood that when the polynucleotide of interest encodes a polypeptide, transcription of the nucleic acid into RNA and translation of the transcribed RNA into a polypeptide may be required. The polynucleotide of interest may also include biologically active RNA molecules and antisense RNAs, ribozymes, microRNAs or siRNAs. For example, undesired enzyme activity in seeds can be reduced due to seed-specific expression of antisense RNAs, ribozymes, microRNAs or siRNAs. The biological principles underlying the action of the biologically active RNA molecules described above are well known in the art. Furthermore, those skilled in the art are well aware of methods for obtaining nucleic acids encoding such biologically active RNA molecules. It should be understood that biologically active RNA molecules can be obtained directly by transcription of the nucleic acid of interest, i.e., without translation into a polypeptide. Preferably, at least one polynucleotide of interest to be expressed under the control of a nucleic acid having the constitutive promoter activity of the present invention is heterologous to the nucleic acid having the constitutive promoter activity, i.e., is not naturally under its control, but the control is generated in a non-natural manner (e.g., by genetic engineering methods).

[0046] Operable linkage with respect to any recombinant gene described herein may be achieved by a variety of methods known in the art, including both in vitro and in vivo procedures. Thus, the recombinant gene of the present invention or a vector containing such a recombinant gene may be achieved using standard recombinant and cloning techniques well known in the art (see, for example, Maniatis 1989; Silhavy 1984; Ausubel 1987).

[0047] An operable linkage can be, for example, the sequential construction of a nucleic acid having constitutive promoter activity described herein with a nucleic acid sequence to be expressed (e.g., the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof), and, optionally, in a manner such that the nucleic acid having constitutive promoter activity can perform its function in the process of expressing the nucleic acid sequence of interest under appropriate conditions, additional regulatory elements may be included, such as polyadenylation or transcription termination elements, enhancers, introns, etc. The term "appropriate conditions" can mean the presence of a recombinant gene in a plant cell. A configuration is preferred in which the nucleic acid sequence of interest to be expressed is placed downstream (i.e., in the 3' direction) of the nucleic acid having constitutive promoter activity of the present invention, in such a way that both sequences are covalently linked. Optionally, additional sequences may be inserted between the two sequences. Such sequences may be, for example, linkers or multiple cloning sites. Furthermore, a sequence encoding a portion of a fusion protein may be inserted (when the expression of a fusion protein of the protein encoded by the nucleic acid of interest is intended). Preferably, the distance between the polynucleotide of interest to be expressed and the nucleic acid having constitutive promoter activity of the present invention is 200 base pairs or less, preferably 100 base pairs or less, more preferably 50 base pairs or less.

[0048] In some embodiments, the recombinant gene is assembled by inserting into the plant genome a nucleic acid having the constitutive promoter activity described herein (e.g., the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof). Such insertion results in an operable linkage to a nucleic acid sequence of interest already present in the genome. Due to the insertion, the nucleic acid of interest is expressed to be constitutive due to the transcriptional regulatory properties of the nucleic acid having constitutive promoter activity. The insertion may be directed or by chance. When the insertion is directed, it may be achieved, for example, by gene editing. By this procedure, the native promoter is replaced with the nucleic acid having the constitutive promoter activity of the present invention, whereby the expression profile of the endogenous gene can be modified. The nucleic acid having constitutive promoter activity may also be inserted such that the antisense mRNA of the endogenous gene is expressed, thereby inducing gene silencing.

[0049] Similarly, the polynucleotide of interest to be expressed may be inserted into the plant genome containing the nucleic acid having constitutive promoter activity in its natural genomic environment (i.e., may be linked to its native gene) such that the inserted sequence is operably linked to the nucleic acid having constitutive promoter activity, thereby forming the recombinant gene of the present invention.

[0050] The recombinant gene may be used for a number of expression purposes, such as the expression of a protein, or the expression of antisense RNA, sense or double-stranded RNA. The expression of the nucleic acid sequence may confer an agriculturally valuable trait to the plant.

[0051] In some embodiments, the polynucleotide of interest is an insect tolerance gene; a disease tolerance gene, e.g., a bacterial disease tolerance gene, a fungal disease tolerance gene, a viral disease tolerance gene, or a nematode disease tolerance gene; a herbicide tolerance gene; a gene affecting the composition or quality of a grain; a nutrient utilization gene; a mycotoxin reduction gene; a male sterility gene; a selectable marker gene; a screenable marker gene; a negative selection marker; a positive selection marker; a gene affecting an agronomic trait of a plant, i.e., yield, standability, etc.; or an environmental or stress tolerance gene, i.e., a herbicide tolerance or resistance, an insect tolerance or resistance, a disease tolerance or resistance (viral, bacterial, fungal, oomycete, or nematode), a stress resistance or tolerance (exemplified by tolerance or resistance to drought, heat, cold, freezing, excess moisture, salt stress, or oxidative stress), an increased yield, food content and composition, physical appearance, male sterility, drydown, standability, productivity, starch properties or amount, oil amount and quality, and amino acid or protein composition, etc., obtained from one or more genes.

[0052] By "tolerance" is meant a plant that does not substantially exhibit a phenotypic change as a result of the administration of an agent, infection by a pathogen, or exposure to a stress. By "resistance" is meant a plant that may exhibit some phenotypic change as a result of infection but does not substantially reduce the reproductive ability or substantially alter the metabolism.

[0053] In some embodiments, the polynucleotide of interest is a selectable marker gene. As used herein, the term "selectable marker gene" refers to a gene that confers a growth advantage on a plant or plant cell transformed with a recombinant plant gene for the selectable marker in the presence of a corresponding selection compound (e.g., herbicide) in the growth medium, compared to a plant or plant cell that has not been transformed with the recombinant plant gene and thus does not contain the selectable marker gene. The selectable marker gene and / or the recombinant plant gene for the marker gene may be heterologous to the plant to be transformed and thus not naturally present in the plant to be transformed.

[0054] In some embodiments, the selectable marker gene is a negative selectable marker gene. The negative selectable marker gene confers resistance and / or increased resistance to a selection compound (e.g., a herbicide). Exemplary selectable marker genes include the HPPD inhibitors described in WO 2011 / 095460, which is hereby incorporated by reference in its entirety; phosphinothricin acetyltransferase (PAT; also named Bialaphoeresistance; bar; De Block et al. (1987) Plant Physiol 91:694-701; European Patent No. 0 333 033; US Patent No. 4,975,374), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; US Patent No. 5,633,435) or glyphosate oxidoreductase gene (US Patent No. 5,463,175) (which confers resistance to glyphosate (trademark) (N-(phosphonomethyl)glycine) (Shah of al. (1986) Science 233: 478)), glyphosate (trademark) degrading enzyme (glyphosate (trademark) oxidoreductase; gox), sulfonylurea and imidazolinone inactivating acetolactate synthase (e.g., mutant ALS variants having, for example, S4 and / or Hra mutations), bromoxynil (trademark) degrading nitrilase (bxn) kanamycin or G418 resistance gene (NPTII; NPTI) (e.g., encoding neomycin phosphotransferase (Fraley et al. (1983) Proc Natl Acad Sci USA 80:4803)) (expressing an enzyme conferring resistance to the antibiotics kanamycin and related antibiotics neomycin, paromomycin, gentamicin, and G418), dicamba degrading enzymes (O-demethylase, oxygenase, ferredoxin) (Behrens et al. 2007 Science 316:1185-1188; US Patent No. 7,022,896) marker genes (e.g., conferring resistance to the toxic effects imposed by D-amino acids such as D-alanine and D-serine) (WO 03 / 060133), but are not limited thereto.Marker genes in this context may be the daol gene (EC: 1.4.3.3; GenBank Acc.-No.: U60066) from yeast Rhodotorula gracilis (Rhodosporidium toruloides) and the E. coli gene dsdA (D-serine dehydratase (D-serine deaminase) [EC: 4.3.1.18; GenBank Acc.-No.: J01603).

[0055] In some embodiments, the selectable marker gene is a positive selectable marker, which confers a growth advantage on the transformed plant compared to the non-transformed plant. Exemplary positive selectable markers include, but are not limited to, mannose-6-phosphate isomerase (in combination with mannose), UDP-galactose-4-epimerase (e.g., in combination with galactose), or mannose-6-phosphate isomerase in combination with mannose.

[0056] In some embodiments, the selectable marker gene is the acetohydroxyacid synthase (AHAS) gene, or a mutant AHAS gene. The acetohydroxyacid synthase enzyme (also known as acetolactate synthase, or ALS) is a protein found in plants and microorganisms and catalyzes the first step in the synthesis of branched-chain amino acids (valine, leucine, and isoleucine). Preferably, it has the enzyme activity described in Enzyme Commission Code EC 2.2.1.6. The mutant AHAS protein preferably confers resistance to at least one imidazolinone herbicide. Imidazolinone herbicides are well known in the art and preferably include imazapyr, imazakine, imazethapyr, imazapic, imazamox, and imazamethabenz. Preferably, the imidazolinone herbicide is imazakine. More preferably, the imidazolinone herbicide is imazethapyr. Most preferably, the imidazolinone herbicide is imazapyr.

[0057] Exemplary mutant AHAS genes are disclosed in International Publication No. WO 2004 / 005516 or International Publication No. WO 2008 / 124495, which are incorporated herein by reference in their entireties. Further mutant AHAS genes are disclosed in International Publication No. WO 2006 / 015376 or International Publication No. WO 2007 / 054555 or U.S. Patent Application Publication No. US 2010 / 0287641. Mutant AHAS enzymes confer resistance to imidazolinone herbicides.

[0058] Additional selectable marker genes are marker genes that confer resistance or increased resistance to the toxic effects imposed by D-amino acids. Such marker genes may encode proteins having the ability to metabolize D-amino acids. The D-amino acids may be D-alanine and D-serine. The marker genes may encode D-serine ammonia-lyase, D-amino acid oxidase, and D-alanine transaminase. Preferred examples of such marker genes that encode proteins having the ability to metabolize D-amino acids are those disclosed in International Publication No. WO 03 / 060133, International Publication No. WO 05 / 090584, International Publication No. WO 07 / 107,516, and International Publication No. WO 08 / 077,570, which are international patent publication numbers incorporated herein by reference in their entireties.

[0059] In some embodiments, the polynucleotide of interest is a herbicide tolerance gene encoding a herbicide tolerance protein. Exemplary herbicide tolerance genes include, but are not limited to, genes encoding phosphinothricin acetyltransferase (bar and pat), glyphosate-resistant EPSP synthase gene, glyphosate-degrading enzyme gene gox encoding glyphosate oxidoreductase, deh (encoding a dehalogenase enzyme that inactivates dalapon), herbicide tolerance (e.g., sulfonylurea and imidazolinone) acetolactate synthase, and the bxn gene (encoding a nitrilase enzyme that degrades bromoxynil). The bar and pat genes encode the enzyme, phosphinothricin acetyltransferase (PAT), which inactivates the herbicide phosphinothricin and prevents this compound from inhibiting the glutamine synthetase enzyme. The enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSP synthase) is normally inhibited by the herbicide N-(phosphonomethyl)glycine (glyphosate). However, genes encoding glyphosate-tolerant EPSP synthase enzymes are known. The deh gene encodes the enzyme dalapon dehalogenase and confers tolerance to the herbicide dalapon. The bxn gene encodes a unique nitrilase enzyme that converts bromoxynil to a non-herbicidal degradation product.

[0060] In some embodiments, the polynucleotide of interest is an insect resistance gene encoding an insect resistance protein or a variant thereof. Such variants can include synthetically derived sequences, such as, but not limited to, sequences that are fusions of two or more polynucleotides of interest (e.g., two or more insect resistance genes). Exemplary insect resistance genes include, but are not limited to, genes encoding insecticidal proteins, such as Cry and Cyt proteins, as well as genes encoding insecticidal proteins such as vegetative insecticidal proteins known as "Vip" proteins, all of which are well known to those skilled in the art. Examples of such genes include members of the Cry1, e.g., Cry1A, Cry1B, Cry1C, Cry1D, Cry1E, Cry1F, and Cr1I families; members of the Cry2, e.g., Cry2A family; members of the Cry9, e.g., Cry9A, Cry9B, Cry9C, Cry9D, Cry9E, and Cry9F families; and members of the Vip3 family, etc. Those skilled in the art will understand that plants may contain any gene that confers the desired agronomic trait. Exemplary insect resistance genes include, but are not limited to, the Bacillus thuringiensis crystal toxin gene or Bt gene (Watrud 1985). The Bt gene can provide resistance to lepidopteran or coleopteran pests, such as the European corn borer (ECB) and the corn rootworm (CRW). Examples of Bt toxin genes for use in such embodiments can include the CryIA(b) and CryIA(c) genes. Other endotoxin genes from other species of B. thuringiensis that affect insect growth or development can also be used in this regard. Protease inhibitors may also provide insect resistance (Johnson 1989) and are therefore useful in plant transformation. The use of the protease inhibitor II gene, pinII, from tomato or potato is particularly intended to be useful.Other genes encoding inhibitors of the insect digestive system, or genes encoding enzymes or cofactors that promote the production of inhibitors, may also be useful. Cystatins and amylase inhibitors, such as those from wheat and barley, may exemplify this group.

[0061] Also, genes encoding lectins can confer additional or alternative insecticidal properties. Lectins (originally called phytohemagglutinins) are multivalent carbohydrate-binding proteins that have the ability to agglutinate erythrocytes from a wide range of species. Lectins have recently been identified as insecticides with activity against weevils, ECB, and cutworms (Murdock 1990; Czapla & Lang, 1990). Lectin genes intended to be useful include, for example, wheat and barley germ agglutinins (WGA) and rice lectin (Gatehouse 1984), with WGA being preferred.

[0062] Genes that control the production of large or small polypeptides that are active against insects when introduced into insect pests, such as lytic peptides, peptide hormones, and toxins and venoms, form another aspect of the invention. For example, the expression of juvenile hormone esterase directed against specific insect pests is also intended to result in insecticidal activity or may cause the arrest of metamorphosis (Hammock 1990).

[0063] Plants and host cells Also intended are host cells or non-human organisms containing the recombinant genes described herein. They may be prokaryotic or eukaryotic. Both microorganisms and higher organisms are included. Examples of microorganisms are bacteria, yeast, algae, and fungi. Preferred bacteria are bacteria of the genera Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus or Cyanobacterim, such as Synechocystis and other bacteria described in Brock Biology of Microorganisms Eighth Edition (pages A-8, A-9, A10 and A11). In some embodiments, the cell or non-human organism containing the recombinant genes described herein is a plant cell or a plant (as defined herein). In some embodiments, the plant is hemizygous for the recombinant gene. In some embodiments, the plant is homozygous for the recombinant gene.

[0064] Other examples of microorganisms are those having the ability to infect plants and transfer DNA into their genomes, particularly bacteria of the genus Agrobacterium, such as Agrobacterium tumefaciens and rhizogenes. Examples of yeast are Candida, Saccharomyces, Hansenula and Pichia. Examples of fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Fusarium, and Beauveria.

[0065] In some embodiments, the host cell is a plant cell, a plant, a plant seed or other plant part, a non-human animal, or a multicellular microorganism. As used herein, the term "plant" refers to a photosynthetic eukaryotic multicellular organism. Plants include green algae (Phylum Chlorophyta), red algae (Phylum Rhodophyta), Glaucophyta, mosses and liverworts (Bryophytes), seedless vascular plants (horsetails, club mosses, ferns), and seed plants (angiosperms and gymnosperms). The term "plant" includes whole plants, plant ancestors and progeny, and plant parts, such as seeds, shoots, stems, leaves, roots, flowers, and tissues and organs, each of which contains the gene / nucleic acid of interest. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, microspores, and bulbils, each of which also contains the gene / nucleic acid of interest.

[0066] As used herein, the term "plant part" includes all components of a plant, including seeds, shoots, stems, leaves, roots, flowers, and plant tissues and organs, plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, microspores, and bulbils. A "bulbil" is any type of organ, tissue, or cell of a plant that has the ability to develop into a complete plant. A bulbil can be based on vegetative reproduction (also known as vegetative propagation, vegetative multiplication, or vegetative cloning) or sexual reproduction. A bulbil can thus be a seed, or a part of a non-reproductive organ such as a stem or leaf. In particular, with respect to the Poaceae family, suitable bulbils can also be sections of a stem, i.e., stem cuttings.

[0067] Particularly contemplated are plants, plant parts or seeds comprising the recombinant genes or vectors described herein. The recombinant genes or vectors may be present in the cytoplasm of the organism or may be integrated into the genome by heterologous or homologous recombination. Host cells, particularly host cells obtained from plants or animals, may be introduced into developing embryos to obtain mosaic or chimeric organisms, i.e., organisms comprising the host cells described herein, i.e., plants. Suitable organisms are, for example, all organisms suitable for the expression of recombinant genes.

[0068] Plants expressing genes encoding enzymes that affect the integrity of insect cuticles form yet another aspect of the invention. Such genes include, for example, those encoding chitinase, protease, lipase, and compounds that inhibit chitin synthesis, the production of nikkomycin, any of which are intended for introduction for the production of insect-resistant maize plants. Also falling within the scope of useful transgenes of the invention are genes encoding activities that affect insect molting, for example genes that affect the production of ecdysteroid UDP-glucosyltransferase.

[0069] Also encompassed by the invention are genes encoding enzymes that promote the production of compounds that reduce the quality of nutrition of the host plant against insect pests. It may, for example, be possible to confer insecticidal activity on plants by altering the sterol composition. Sterols are obtained by insects from feeding and are used for hormone synthesis and membrane stability. Thus, alterations in the plant sterol composition by the expression of novel genes, for example genes that directly promote the production of unwanted sterols or genes that convert desirable sterols into unwanted forms, can confer insecticidal activity on plants by having a negative effect on insect growth and / or development. Lipoxygenase is a naturally occurring plant enzyme that has been shown to exhibit an anti-nutritional effect against insects and to reduce the quality of their feeding nutrition. Accordingly, a further embodiment of the invention relates to plants having enhanced lipoxygenase activity that may be resistant to insect feeding.

[0070] The nature of the plants, plant parts, and seeds is not limited. For example, the plant, plant part, or seed can be monocotyledonous or dicotyledonous. In some embodiments, the plant, plant part, or seed is from a monocotyledonous plant. In some embodiments, the plant or plant part is from a dicotyledonous plant. Examples of plant cells having uses according to the present disclosure include the genera: Ananas, Musa, Vitis, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Carica, Persea, Prunus, Syragrus, Theobroma, Coffea, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Mangifera, Cichorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucurbita, Cucumis, Browaalia,Cells (or whole plants or plant parts) derived from Lolium, Malus, Apium, Gossypium, Vicia, Lathyrus, Lupinus, Pachyrhizus, Wisteria, Stizolobium, Agrostis, Phleum, Dactylis, Sorghum, Setaria, Zea, Oryza, Triticum, Secale, Avena, Hordeum, Saccharum, Poa, Festuca, Stenotaphrum, Cynodon, Coix, Olyreae, Phareae, Glycine, Pisum, Psidium, Passiflora, Cicer, Phaseolus, Lens, and Arachis are included, but not limited to these.

[0071] In some embodiments, the plant cell is from the Poaceae family, such as the genus: Hordeum, Secale, Avena, Sorghum, Andropogon, Holcus, Panicum, Oryza, Zea, Triticum, such as the genus and species: Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum secalinum, Hordeum distichon, Hordeum aegiceras, Hordeum hexastichon, Hordeum hexastichum, Hordeum irregulare, Hordeum sativum, Hordeum secalinum, Secale cereale, Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida, Sorghum bicolor, Sorghum halepense, Sorghum saccharatum, Sorghum vulgare, Andropogon drummondii, Holcus bicolor, Holcus sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, Sorghum cernuum, Sorghum dochna, Sorghum drummondii,Cells (or whole plants or plant parts) from Sorghum bicolor (L.) Moench, Sorghum arundinaceum (Desv.) Stapf, Sorghum caffrorum (Retz.) Beauv., Sorghum dochna (Forssk.) Snowden, Sorghum drummondii, Sorghum durra, Sorghum guineense, Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum subglabrescens, Sorghum verticilliflorum, Sorghum vulgare, Holcus halepensis, Sorghum miliaceum, Panicum militaceum, Oryza sativa, Oryza latifolia, Zea mays, Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum or Triticum vulgare are included.

[0072] In some embodiments, the plants used are oil fruit crops containing large amounts of lipid compounds, such as peanuts, rapeseed, canola, sunflowers, safflowers, poppies, mustard, flax, castor oil plants, olives, sesame, Calendula, Punica (pomegranate), Matricaria, mullein, thistles, wild roses, hazelnuts, almonds, macadamias, avocados, Ginkgo biloba, pumpkins / squashes, ramie, soybeans, pistachios, Lycium, trees (oil palm, coconut, walnut), or crops such as corn, wheat, rye, triticale, triticale, rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants such as potatoes, tobacco, eggplants and tomatoes, Vicia species, peas, alfalfa or bushy plants (coffee, cocoa, tea), Salix species, as well as perennial grasses and fodder crops. The plants according to the invention may be oil crop plants, such as peanuts, rapeseed, canola, sunflowers, safflowers, poppies, mustard, flax, castor oil plants, olives, Calendula, Punica (pomegranate), Matricaria, pumpkins, ramie, soybeans, Lycium, trees (oil palm, coconut).

[0073] Also contemplated is a method of producing a plant or plant part, including a plant tissue, plant organ, plant or seed, comprising introducing the recombinant gene of the vector described herein into a plant cell and regenerating the plant cell to form a plant tissue, plant organ, plant or seed.

[0074] A method of providing pesticidal activity to a plant, comprising introducing into a plant cell a recombinant gene of a vector described herein that contains a nucleotide sequence encoding a pesticidal protein and regenerating the plant cell to form a plant or plant part, including a plant tissue, plant organ, plant, or seed, thereby providing pesticidal activity to the plant. In some embodiments, the pesticidal activity is insecticidal activity.

[0075] The recombinant gene can be introduced into plant cells by a number of methods recognized in the art. Plant species can be transformed with the DNA constructs or recombinant genes described herein by DNA-mediated transformation of plant cell protoplasts and subsequent regeneration of plants from the transformed protoplasts by procedures well known in the art.

[0076] Any plant tissue having the ability for subsequent clonal propagation, whether by organogenesis or embryogenesis, can be transformed with the vectors described herein. As used herein, the term "organogenesis" means the process by which shoots and roots develop sequentially from a growth center, and the term "embryogenesis" means the process by which shoots and roots develop together (not sequentially) in a concerted manner from either somatic or gametic cells. The particular tissue selected will vary depending on the available and best-suited clonal propagation system for the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristems (e.g., apical meristems, axillary buds, and root apical meristems), and induced meristems (e.g., cotyledonary meristems and multilane meristems).

[0077] Plants can take on various forms. For example, a plant may be a chimera of transformed and non-transformed cells, a plant may be a clonal transformant (e.g., all cells are transformed to contain a recombinant gene), or a plant may include grafts of transformed and untransformed tissue (e.g., a transformed rootstock in a citrus species is grafted onto an untransformed shoot). Transformed plants may be propagated by various means, such as by clonal propagation or classical mating techniques. For example, a first-generation (or T1) transformed plant may be self-pollinated to obtain a homozygous second-generation (or T2) transformed plant, and the T2 plants may be further propagated through classical mating techniques. Dominant selectable markers (e.g., npt II) may be associated with the recombinant gene to assist in mating.

[0078] Plant transformation can be carried out using a single DNA molecule or multiple DNA molecules (i.e., co-transformation), and both of these techniques are suitable for use with the recombinant genes described herein. A number of transformation vectors are available for plant transformation, and the recombinant genes of the present invention can be used in combination with any such vector. The choice of vector depends on the selected transformation technique and the target species for transformation.

[0079] Various techniques are available and known to those skilled in the art for introducing constructs into plant cell hosts. Exemplary techniques include transformation with DNA using A. tumefaciens or A. rhizogenes as transformation agents, liposomes, PEG precipitation, electroporation, DNA injection, direct DNA uptake, particle bombardment, and particle acceleration (see, e.g., European Patent No. 295959 and European Patent No. 138341) (see below). However, cells other than plant cells may also be transformed with the recombinant genes described herein. An overview of plant expression vectors and reporter genes, as well as Agrobacterium and Agrobacterium-mediated gene transfer, can be found in Gruber et al. (1993).

[0080] Expression vectors containing genomic or synthetic fragments can be introduced into protoplasts, intact tissues, or isolated cells. The expression vector may be introduced into intact tissues. General methods for culturing plant tissues are provided, for example, in Maki et al., (1993); and Phillips et al. (1988). The expression vector may be introduced into maize or other plant tissues using direct gene transfer methods such as particle-mediated delivery, DNA injection, and electroporation. The expression vector may also be introduced into plant tissues using particle media delivery using a gene gun device. See, for example, Tomes et al. (1995). The vectors of the present invention can be used not only for the expression of structural genes, but also in exon-trap cloning or promoter-trap procedures to detect differential gene expression in various tissues (Lindsey 1993; Auch & Reth 1990).

[0081] In some embodiments, binary vectors of the Ti and Ri plasmids of Ti-derived vectors of species of the genus Agrobacterium are used to transform a variety of higher plants, including monocotyledonous and dicotyledonous plants such as soybean, cotton, rapeseed, tobacco, and rice (Pacciotti 1985: Byrne 1987; Sukhapinda 1987; Lorz 1985; Potrykus, 1985; Park 1985: Hiei 1994). The use of T-DNA for transforming plant cells has been extensively studied and is well described (European Patent No. 120516; Hoekema, 1985; Knauf, 1983; and An 1985).

[0082] Other transformation methods are available to those skilled in the art, which are, for example, the direct uptake of foreign DNA constructs (see European Patent No. 295959), the technique of electroporation (Fromm 1986), or high-velocity ballistic impact with metal particles coated with nucleic acid constructs (Kline 1987, and U.S. Patent No. 4,945,050). Once transformed, the cells can be regenerated by those skilled in the art. Of particular relevance are recently described methods for transforming foreign genes into commercially important crops such as rapeseed (De Block 1989), sunflower (Everett 1987), soybean (McCabe 1988; Hinchee 1988; Chee 1989; Christou 1989; European Patent No. 301749), rice (Hiei 1994), and maize (Gordon-Kamm 1990; Fromm 1990).

[0083] One of ordinary skill in the art will recognize that the choice of method may depend on the type of plant targeted for transformation, i.e., monocotyledonous or dicotyledonous. Suitable methods for transforming plant cells include, but are not limited to, microinjection (Crossway 1986), electroporation (Riggs 1986), Agrobacterium-mediated transformation (Hinchee 1988), direct gene transfer (Paszkowski 1984), and ballistic particle acceleration using devices available from Agracetus, Inc., Madison, Wis., and BioRad, Hercules, Calif. (e.g., see U.S. Patent No. 4,945,050; and McCabe 1988). See also Weissinger 1988; Sanford 1987 (onions); Christou 1988 (soybeans); McCabe 1988 (soybeans); Datta 1990 (rice); Klein 1988 (maize); Klein 1988 (maize); Klein 1988 (maize); Fromm 1990 (maize); and Gordon-Kamm 1990 (maize); Svab 1990 (tobacco chloroplasts); Koziel 1993 (maize); Shimamoto 1989 (rice); Christou 1991 (rice); European Patent Application No. 0 332 581 (orchardgrass and other Pooideae); Vasil 1993 (wheat); Weeks 1993 (wheat).

[0084] Methods using either direct gene transfer or Agrobacterium-mediated transfer are generally, but not necessarily, carried out using a selectable marker which can provide resistance to an antibiotic (e.g., kanamycin, hygromycin or methotrexate) or a herbicide (e.g., phosphinothricin). For certain plant species, different antibiotic or herbicide selectable markers may be preferred. Commonly used selectable markers in transformation include the nptII gene (Messing & Vierra, 1982; Bevan 1983) which confers resistance to kanamycin and related antibiotics, the bar gene (White 1990, Spencer 1990) which confers resistance to the herbicide phosphinothricin, the hph gene (Blochlinger & Diggelmann) which confers resistance to the antibiotic hygromycin, and the dhfr gene (Bourouis 1983) which confers resistance to methotrexate.

[0085] Methods for the production and further characterization of stably transformed plants are well known to those skilled in the art. By way of example, transformed plant cells are placed in an appropriate selection medium for the selection of transformed cells, and the transformed cells grow into callus, shoots grow from the callus, and small plants are generated from the shoots by growth in a rooting medium. Various constructs are usually ligated to a marker for selection in plant cells. Conveniently, the marker may be resistant to a biocide, particularly an antibiotic such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, or a herbicide, etc. The particular marker used allows the selection of transformed cells compared to cells lacking the introduced DNA. The components of the DNA construct containing the transcription cassette of the present invention may be prepared from sequences native (endogenous) or foreign (exogenous) to the host. By "foreign" it is meant that the sequence is not found in the wild-type host into which the construct is introduced. A heterologous construct contains at least one region that is not native to the gene from which the transcription initiation region is derived.

[0086] To confirm the presence of the introduced polynucleotide of interest in the transformed cells and plants, various assays may be performed. Such assays include, for example, "molecular biology" assays well known to those skilled in the art, such as Southern and Northern blotting, in situ hybridization and nucleic acid-based amplification methods, such as PCR or RT-PCR or TaqMan; "biochemical" assays, such as, for example, detection of the presence of protein products by immunological means (ELISA and Western blot) or by enzyme function; plant part assays, such as seed assays; and, for example, analysis of the phenotype of the whole regenerated plant for disease or pest resistance.

[0087] DNA may be isolated from cell lines or any plant part to determine the presence of a preselected nucleic acid segment through the use of techniques well known to those skilled in the art. It is noted that intact sequences may not necessarily be present, presumably due to rearrangement or deletion of sequences in the cell.

[0088] In some embodiments, the presence of the nucleic acid element introduced through the methods of the present invention may be determined by polymerase chain reaction (PCR). Using these techniques, discrete fragments of nucleic acid are amplified and detected by gel electrophoresis. This type of analysis allows determination of whether a preselected nucleic acid segment is present in a stable transformant, but does not prove integration of the introduced preselected nucleic acid segment into the host cell genome. Additionally, PCR techniques cannot be used to determine whether a transformant has an exogenous gene introduced at different sites in the genome, i.e., whether the transformants are of independent origin. It is contemplated that PCR techniques can be used to clone fragments of host genomic DNA adjacent to the introduced preselected DNA segment.

[0089] Known PCR methods include, but are not limited to, methods using pairs of primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, and partially mismatched primers, etc.

[0090] Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique, the unique DNA sequences introduced into the host genome and the adjacent host DNA sequences can be identified. Therefore, the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. Additionally, through Southern hybridization, it is possible to demonstrate the presence of a preselected DNA segment introduced into high molecular weight DNA, i.e., to confirm that the preselected DNA segment introduced is integrated into the host cell genome. The technique of Southern hybridization provides information obtained using PCR, such as the presence of a preselected DNA segment, but further demonstrates integration into the genome and characterizes each individual transformant.

[0091] Using the technique of dot or slot blot hybridization, which is a modification of the Southern hybridization technique, the same information derived from PCR, such as the presence of a preselected DNA segment, can be obtained.

[0092] Both PCR and Southern hybridization techniques can be used to demonstrate the transmission of a preselected DNA segment to progeny. In most cases, the characteristic Southern hybridization pattern for a given transformant segregates as one or more Mendelian genes in the progeny (Spencer 1992; Laursen 1994), indicating stable inheritance of the gene. The nonchimeric nature of the callus and the parental transformant (R0) was suggested by the germline transmission of the transformed DNA in the callus, R0 plants, and R1 progeny that segregated for the transformed gene and the identical Southern blot hybridization patterns and intensities.

[0093] DNA analysis techniques may be performed using DNA isolated from any part of the plant, but RNA may be expressed in only certain cell or tissue types and therefore it is necessary to prepare RNA for analysis from these tissues. PCR techniques may also be used for the detection and quantification of RNA produced from a preselected DNA segment that has been introduced. In this application of PCR, it is necessary to first reverse transcribe the RNA to DNA using an enzyme such as reverse transcriptase and then amplify the DNA through the use of conventional PCR techniques. In most cases, PCR techniques are useful but do not demonstrate the integrity of the RNA product. Further information about the nature of the RNA product can be obtained by Northern blotting. This technique demonstrates the presence of the RNA species and provides information about the integrity of that RNA. The presence or absence of the RNA species can also be determined using dot or slot blot Northern hybridization. These techniques are modifications of Northern blotting and only demonstrate the presence or absence of the RNA species.

[0094] Southern blotting and PCR can be used to detect a preselected DNA segment of interest, but they do not provide information on whether the preselected DNA segment is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced preselected DNA segments or by assessing phenotypic changes brought about by their expression.

[0095] Assays for the production and identification of specific proteins can utilize the physicochemical, structural, functional, or other properties of the proteins. Unique physicochemical or structural properties enable the protein to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focusing electrophoresis, or by chromatographic techniques, such as ion exchange or gel exclusion chromatography. The unique structure of individual proteins provides an opportunity to use specific antibodies to detect their presence in a format, such as an ELISA assay. Combinations of approaches may be used with even higher specificity, such as Western blotting where antibodies are used to localize individual gene products separated by electrophoretic techniques. Additional techniques may be used to absolutely confirm the nature of the product of interest, such as evaluation by amino acid sequencing after purification. These are the most commonly used ones, but other procedures may additionally be used.

[0096] Assay procedures may also be used to identify protein expression by functionality, particularly the ability of an enzyme to catalyze a specific chemical reaction involving specific substrates and products. Following these reactions, physical or chemical procedures may be used to provide and quantify the loss of substrate or the production of reaction products. Examples vary with the enzyme being analyzed.

[0097] Very frequently, the expression of a gene product is determined by assessing the phenotypic consequences of that expression. These assays can also take many forms, including but not limited to the analysis of changes in the chemical composition, morphology, or physiological properties of plants. Morphological changes may include taller stature or thicker stalks. Most often, changes in the response of a plant or plant part to an imposed treatment are evaluated under carefully controlled conditions referred to as a bioassay.

[0098] Provided is the use of a nucleic acid having constitutive promoter activity as described herein for regulating the expression of a nucleic acid operably linked in a plant or for identifying other nucleic acids having constitutive promoter activity.

[0099] A method of manufacturing a food, feed, or industrial product includes: a) obtaining a plant, plant part, or seed of the invention; and b) preparing a food, feed, or industrial product from the plant, plant part, or seed. The method may also include cases where a) the food or feed is oil, meal, grain, starch, flour, or protein; or b) the industrial product is biofuel, fiber, industrial chemical, pharmaceutical, or dietary supplement.

[0100] It should be understood that the present invention is not limited to the specific methodologies, protocols, cell lines, plant species or genera, constructs, and reagents described as such. The scientific terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention, which is also to be understood as being limited only by the appended claims. It should also be noted that when used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a vector” includes reference to one or more vectors and equivalents thereof known to those skilled in the art, and the like.

[0101] Sequence Listing This application contains a Sequence Listing in computer-readable form (filename: 202017P2_Seqlisting.txt; size: 5,022 bytes; created on November 20, 2020), which is incorporated by reference in its entirety as separate parts of this disclosure.

[0102] [Examples] Unless otherwise indicated in the examples, all recombinant DNA techniques are performed according to standard protocols as described in Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA, Volumes 1 and 2, and Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK), Volumes I and II. Standard materials and methods for plant molecular studies are described in Plant Molecular Biology Labfax (1993), R.D.D. Croy, BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK, co-published. Standard materials and methods for polymerase chain reaction can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and McPherson at al. (2000) PCR - Basics: From Background to Bench, First Edition, Springer Verlag, Germany.

[0103] [Example 1] Cloning of the Promoter Region of the Soybean Gene glyma13g33190 To clone the promoter region of P-bdc16-1.2, the soybean gene glyma13g33190 (Soybase annotation Glyma 1.1) designated as SEQ ID NO: 1, a plasmid containing the promoter sequence of the glyma13g33190 gene from Thorne was used as a template for PCR amplification of SEQ ID NO: 1 using the Q5 High-Fidelity DNA Polymerases kit from NEB (Ipswich, MA, USA). PCR was performed on the plasmid DNA using an adapter and sequence-specific primers (forward primer: ctccgaatatctcttagttgaaaaaaaacatttc (SEQ ID NO: 5); reverse primer: TTTCTTTCTTGCTTTCTTATGATTCTCTTCTTCTC (SEQ ID NO: 6)). The adapter is a short DNA sequence complementary to the destination vector sequence adjacent to the cloning site. The PCR product was resolved using electrophoresis on a 0.8% (w / v) agarose gel. A fragment having a size of approximately 1080 bp was excised from the gel, purified, and assembled into the plant gene expression vector pBay01339 developed by the inventors, which had been pre-digested with SbfI and BsgI enzymes, using the Gibson assembly kit (SGI-DNA, Madison, Wis., USA) according to the manufacturer's instructions. The resulting vector pBay02059 was sequenced and aligned with the P-bdc16-1.2 sequence from Thorne, and 100% alignment was found.

[0104] P-bdc16-1.2 was originally cloned from soybean (Glycine Max cultivar Thorne) genomic DNA using PCR amplification.

[0105] [Example 2] Promoter Deletion Variants A series of 200 bp deletions from the 5'-end of P-bdc16-1.2 were generated via PCR-mediated cloning. Briefly, the promoter region of the soybean gene glyma13g33190 with sizes of 480 bp (SEQ ID NO: 4), 680 bp (SEQ ID NO: 3), and 880 bp (SEQ ID NO: 2) was PCR amplified from the plasmid DNA of pBay02059. PCR was performed in the same manner as described in Example 1. The PCR primers consisted of an adapter and sequence-specific primers for each of these truncated promoters having the same 3'-end. The adapter is a short DNA sequence complementary to the destination vector sequence adjacent to the cloning site. In this case, the destination vector is pBay02059. The PCR products were resolved using electrophoresis on a 1% (w / v) agarose gel. Fragments with sizes of 480 bp (SEQ ID NO: 4), 680 bp (SEQ ID NO: 3), and 880 bp (SEQ ID NO: 2) were excised from the gel, purified, and assembled into pBay02059 pre-digested with SbfI and BsgI enzymes using the Gibson assembly kit (SGI-DNA, Madison, Wis., USA) according to the manufacturer's instructions. The resulting plasmids pBay2206, pBay02207, pBay02208 contain P-bdc16-1.3 (880 bp - SEQ ID NO: 2), P-bdc16-1.4 (680 bp - SEQ ID NO: 3), P-bdc16-1.5 (480 bp - SEQ ID NO: 4), respectively. The results are shown in Figure 2.

[0106] [Example 3] Tobacco transient assay Agrobacterium strain EHA105 (Hood et al., 1986) was transformed with plasmid DNA of pBay02059, pBay2206, pBay02207, and pBay02208. The obtained Agrobacterium containing these plasmids was used to agro-infiltrate fully expanded young leaves of Nicotiana Benthamian (Wydro et al., 2006). The infiltrated leaf samples were collected 2 days after agro-infiltration. Reporter (insect resistance gene) expression (% total soluble protein, % TSP) was analyzed in these samples. The results are shown in Figure 3.

[0107] [Example 4] Additional expression analysis Expression data (RNA-seq) for the native soybean glyma13g33190 from which the promoter P-bdc16-1.2 (SEQ ID NO: 1) is derived was performed. RNA-seq data was generated using soybean tissues (cultivar Thorne) at GENEWIZ (South Plainfield, NJ). As shown in Figure 4, P-bdc16-1.2 (SEQ ID NO: 1) is constitutively expressed in all plant tissues tested, including stems, leaves, roots, and flower seeds / sheaths.

[0108] [Example 5] Stable transformation in soybean cultivars Stable transformation events were generated using an A. tumefaciens transformation method that utilized starting material from mature half-seeds as described on pages 275 - 284 of Agrobacterium Protocols (Luth et al., 2015). Agrobacterium strain EHA105 (Hood et al., 1986) was transformed with plasmid DNA from vector pBay02059 and used for stable transformation experiments. The starting material was sourced from two soybean cultivars suitable for transformation representing two distinct mature groups (MG), MG3 and MG8. Successful gene transfer was confirmed by both herbicide selection and copy number PCR to select T0 events containing a single T-DNA insertion. See Table 1 and Figure 5.

[0109] [Table 1]

[0110] After identification of positive events, samples were taken at the v2 - v3 growth stage and relative protein expression was confirmed by ELISA using an assay specific to the introduced insect resistance gene (Figure 6).

[0111] [Example 6] Expression of the polynucleotide of interest in soybean cultivars Events representing the interquartile range of protein expression of the insect resistance gene in the T0 generation were selected (MG3 soybean n = 9 events, MG8 soybean n = 8 events). Segregating T1 seeds were sown and plants were grown under typical greenhouse conditions. All plants were sampled for copy number immediately upon emergence and analyzed for both the insect resistance gene and the herbicide selection marker. See Table 2 and Figures 7 and 8.

[0112] [Table 2]

[0113] ELISA analysis samples were collected from each event in the v3-v4 growth stage as follows - one 0-copy (null) and both 1-copy (hemizygous) and 2-copy (homozygous) vectors up to three. See Figure 9.

[0114] The present invention includes, for example, the following embodiments: [Embodiment 1](a) A nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof, and (b) A nucleic acid comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof An isolated nucleic acid having constitutive promoter activity, selected from the group consisting of. [Embodiment 2] A recombinant gene for regulating the expression of a polynucleotide of interest, comprising the nucleic acid having constitutive promoter activity described in Embodiment 1. [Embodiment 3] The recombinant gene according to Embodiment 2, further comprising at least one polynucleotide of interest operably linked to the nucleic acid having constitutive promoter activity. [Embodiment 4] The recombinant gene according to Embodiment 2 or Embodiment 3, wherein the polynucleotide of interest encodes an insecticidal protein or a herbicide selection marker. [Embodiment 5] A vector comprising the nucleic acid having constitutive promoter activity described in Embodiment 1, or the recombinant gene according to any one of Embodiments 2 to 4. [Embodiment 6] The vector according to Embodiment 5, which is an expression vector. [Embodiment 7] A host cell comprising the heterologous nucleic acid having constitutive promoter activity described in Embodiment 1, the recombinant gene according to any one of Embodiments 2 to 4, or the vector according to Embodiment 5 or Embodiment 6. [Embodiment 8] The host cell according to Embodiment 7, which is a plant cell. [Embodiment 9] A plant, plant part or seed comprising the heterologous nucleic acid having constitutive promoter activity described in Embodiment 1, the recombinant gene according to any one of Embodiments 2 to 4, or the vector according to Embodiment 5 or Embodiment 6. [Embodiment 10] A method for expressing a polynucleotide of interest in a host cell, comprising: (a) Introducing into the host cell the nucleic acid having constitutive promoter activity described in Embodiment 1, the recombinant gene according to any one of Embodiments 2 to 4, or the vector according to Embodiment 5 or Embodiment 6, and (b) Expressing at least one polynucleotide of interest in the host cell A method comprising. [Embodiment 11] The method according to Embodiment 10, wherein the host cell is a plant cell. The method according to embodiment 10 or embodiment 11, wherein the detectable amount of the accumulated protein encoded by the polynucleotide of interest is about 0.01% to 1.15% of the total soluble protein extracted. [Embodiment 13] A method for producing a plant or a plant part, comprising: (a) introducing into a plant cell a nucleic acid having a constitutive promoter activity as described in embodiment 1, a recombinant gene as described in any one of embodiments 2 to 4, or a vector as described in embodiment 5 or embodiment 6, and (b) regenerating the plant cell to form a plant or a plant part. The method comprising the above steps. [Embodiment 14] A method for providing pesticidal activity in a plant, comprising: (a) introducing into a host cell of the plant a nucleic acid having a constitutive promoter activity as described in embodiment 1, a recombinant gene as described in any one of embodiments 2 to 4, or a vector as described in embodiment 5 or embodiment 6, and (b) expressing a polynucleotide encoding a pesticidal protein in the host cell, thereby providing pesticidal activity in the plant. The method comprising the above steps. [Embodiment 15] The method according to embodiment 14, wherein the pesticidal protein is an insecticidal protein. [Embodiment 16] Use of a nucleic acid having a constitutive promoter activity as described in embodiment 1 for regulating the expression of a nucleic acid operably linked in a plant. [Embodiment 17] Use of a nucleic acid having a constitutive promoter activity as described in embodiment 1 for identifying other nucleic acids having a constitutive promoter activity. [Embodiment 18] A method for producing a food, a feed, or an industrial product, comprising: (a) obtaining a plant, a plant part, or a seed as described in embodiment 9, and (b) preparing a food, a feed, or an industrial product from the plant, the plant part, or the seed. The method comprising the above steps. [Embodiment 19] (a) the food or feed is oil, meal, grain, starch, flour, or protein, or (b) the industrial product is biofuel, fiber, industrial chemical, pharmaceutical, or dietary supplement. The method according to embodiment 18. References Hood, E. E., G. L. Helmer, R. T. Fraley, and M.-D. Chilton. 1986. The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA. J. Bacteriol. 168:1291-1301. Wydro M., E. Kozubek, and P. Lehmann. 2006. Optimization of transient Agrobacterium-mediated gene expression system in leaves of Nicotiana benthamiana. Acta Biochimica Polonica. Vol. 53, No 2 / 2006, 289-298.

Claims

1. (a) A nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and (b) A nucleic acid comprising a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 An isolated nucleic acid having constitutive promoter activity, selected from the group consisting of.

2. A recombinant gene for regulating the expression of a polynucleotide of interest, comprising the nucleic acid having constitutive promoter activity according to Claim 1.

3. The recombinant gene according to Claim 2, further comprising at least one polynucleotide of interest operably linked to the nucleic acid having constitutive promoter activity.

4. The recombinant gene according to Claim 2 or Claim 3, wherein the polynucleotide of interest encodes an insecticidal protein or a herbicide selection marker.

5. A vector comprising the nucleic acid having constitutive promoter activity according to Claim 1 or the recombinant gene according to any one of Claims 2 to 4.

6. The vector according to Claim 5, which is an expression vector.

7. A host cell comprising the heterologous nucleic acid having constitutive promoter activity according to Claim 1, the recombinant gene according to any one of Claims 2 to 4, or the vector according to Claim 5 or Claim 6.

8. The host cell according to Claim 7, which is a plant cell.

9. A plant, plant part or seed comprising the heterologous nucleic acid having constitutive promoter activity according to Claim 1, the recombinant gene according to any one of Claims 2 to 4, or the vector according to Claim 5 or Claim 6.

10. A method for expressing a polynucleotide of interest in a host cell, comprising: (a) Introducing into the host cell the nucleic acid having constitutive promoter activity according to Claim 1, the recombinant gene according to any one of Claims 2 to 4, or the vector according to Claim 5 or Claim 6, and (b) Expressing at least one polynucleotide of interest in the host cell A method comprising.

11. The method according to Claim 10, wherein the host cell is a plant cell.

12. The method according to Claim 10 or Claim 11, wherein the detectable amount of the accumulated protein encoded by the polynucleotide of interest is about 0.01% to 1.15% of the total soluble protein extracted.

13. A method for producing a plant or plant part, comprising: (a) Introducing a nucleic acid having constitutive promoter activity according to claim 1, a recombinant gene according to any one of claims 2 to 4, or a vector according to claim 5 or 6 into a plant cell, and (b) regenerating the plant cell to form a plant or a plant part A method comprising.

14. A method for providing pesticidal activity in a plant, comprising: (a) Introducing a nucleic acid having constitutive promoter activity according to claim 1, a recombinant gene according to any one of claims 2 to 4, or a vector according to claim 5 or 6 into a host cell of a plant, and (b) expressing a polynucleotide encoding a pesticidal protein in the host cell, thereby providing pesticidal activity in the plant A method comprising.

15. The method according to claim 14, wherein the pesticidal protein is an insecticidal protein.

16. Use of a nucleic acid having constitutive promoter activity according to claim 1 for regulating the expression of a nucleic acid operably linked in a plant.

17. Use of a nucleic acid having constitutive promoter activity according to claim 1 for identifying other nucleic acids having constitutive promoter activity.

18. A method for producing a food, a feed, or an industrial product, comprising: (a) obtaining a plant, a plant part, or a seed according to claim 9, and (b) preparing a food, a feed, or an industrial product from the plant, the plant part, or the seed A method comprising.

19. (a) the food or feed is oil, meal, grain, starch, flour, or protein, or (b) the industrial product is biofuel, fiber, industrial chemical, pharmaceutical, or dietary supplement The method according to claim 18.

Images