Primer Sets and Probes for the Detection of Staphylococcus argenteus

A primer set targeting the nuc gene of Staphylococcus argenteus addresses the issue of misidentification by enabling accurate differentiation from other Staphylococcus species, enhancing detection precision.

JP7719767B2Active Publication Date: 2025-08-06DENKA CO LTD +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2022512604
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-03-31
Filing Date
2021-03-31
Publication Date
2025-08-06
Estimated Expiration
2041-03-31

AI Technical Summary

Technical Problem

Existing methods for detecting Staphylococcus argenteus, such as real-time PCR, often misidentify it as other Staphylococcus species like Staphylococcus aureus, leading to false-negative results.

Method used

A primer set targeting the nuc gene of Staphylococcus argenteus, specifically designed to differentiate it from other Staphylococcus species using primers and probes with tailored sequences, allowing for accurate detection.

Benefits of technology

The primer set and probes enable precise differentiation of Staphylococcus argenteus from other Staphylococcus species, reducing misidentification and improving detection accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007719767000004
    Figure 0007719767000004
  • Figure 0007719767000005
    Figure 0007719767000005
  • Figure 0007719767000006
    Figure 0007719767000006
Patent Text Reader

Abstract

The present invention provides a primer set for detecting the presence of Staphylococcus argenteus in a specimen, the primer set comprising a first primer and a second primer that target the nuc gene of Staphylococcus argenteus.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a primer set, a probe, etc. for detecting the presence of Staphylococcus argenteus. [Background technology]

[0002] Known methods for detecting infectious disease-causing bacteria include the culture identification method, in which the causative bacteria are isolated and cultured and then identified based on their biochemical properties, and the genetic method, in which causative bacteria-specific genes are amplified and detected using genetic methods such as PCR.

[0003] Staphylococcus argenteus is a bacterial species that is rarely, if ever, observed in blood and other samples. Its clinical significance has not yet been clarified. However, when measuring Staphylococcus argenteus using genetic methods such as real-time PCR, there is a problem that it is easily misidentified as other Staphylococcus species, such as Staphylococcus aureus, which causes food poisoning (Patent Documents 1 and 2). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Application Laid-Open No. 2017-163969 [Patent Document 2] Japanese Patent Application Laid-Open No. 2017-163970 Summary of the Invention [Problem to be solved by the invention]

[0005] In view of the above circumstances, an object of the present invention is to provide a primer set, a probe, etc. for detecting the presence of Staphylococcus argenteus. [Means for solving the problem]

[0006] By focusing on the sequence of the nuc (thermostable nuclease) gene of Staphylococcus argenteus, the inventors discovered a sequence that makes it possible to distinguish Staphylococcus argenteus, which has previously often given false-negative results, from other Staphylococcus species, and thus completed the present invention.

[0007] That is, the present application includes the following inventions. [1] A primer set for detecting the presence of Staphylococcus argenteus in a specimen, comprising: A primer set comprising a first primer and a second primer targeting the nuc gene of Staphylococcus argenteus. [2] A primer set according to [1], in which the nuc gene has the base sequence shown in SEQ ID NO: 3 or 4, or has a base sequence in which one or several bases have been deleted, substituted, inserted or added in the base sequence shown in either SEQ ID NO: 3 or 4, and encodes TNase. [3] A primer set according to [1] or [2], wherein the targeted nuc gene has a base sequence including at least 10 consecutive bases from positions 217 to 331 of the base sequence shown in SEQ ID NO: 3 or 4. [4] A primer set according to any one of [1] to [3], wherein the first primer has the base sequence set forth in SEQ ID NO: 9, or has a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 9 in which one or several bases have been deleted, substituted, inserted or added, and has the same function as the base sequence set forth in SEQ ID NO: 9. [5] A primer set according to any one of [1] to [4], wherein the second primer has the base sequence set forth in SEQ ID NO: 10, or has a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 10, in which one or several bases have been deleted, substituted, inserted or added, and has the same function as the base sequence set forth in SEQ ID NO: 10. [6] The primer set according to any one of [1] to [5], further comprising a third primer targeting the nuc gene of Staphylococcus schweitzeri. [7] A primer set according to any one of [1] to [6], wherein the third primer has the base sequence set forth in SEQ ID NO: 11, or has a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 11 in which one or more bases have been deleted, substituted, inserted or added, and has the same function as the base sequence set forth in SEQ ID NO: 11. [8] The primer set according to any one of [1] to [7], further comprising a fourth primer and a fifth primer targeting the nuc gene of Staphylococcus aureus. [9] A primer set according to any one of [1] to [8], wherein the fourth primer has the base sequence set forth in SEQ ID NO: 6, or has a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 6 in which one or several bases have been deleted, substituted, inserted or added, and has the same function as the base sequence set forth in SEQ ID NO: 6.

[10] A primer set according to any one of [1] to [9], wherein the fifth primer has the base sequence set forth in SEQ ID NO: 7, or has a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 7 in which one or several bases have been deleted, substituted, inserted or added, and has the same function as the base sequence set forth in SEQ ID NO: 7.

[11] The primer set according to any one of [1] to

[10] , wherein the primers are labeled with biotin.

[12] A probe for detecting the presence of Staphylococcus argenteus in a specimen, comprising: A probe targeting the nuc gene of Staphylococcus argenteus.

[13] The probe described in

[12] , wherein the nuc gene has the base sequence shown in SEQ ID NO: 3 or 4, or the base sequence shown in SEQ ID NO: 3 or 4 in which one or several bases have been deleted, substituted, inserted or added, and encodes the Nuc protein.

[14] A probe according to

[12] or

[13] , wherein the targeted nuc gene has a base sequence containing at least 8 consecutive bases from positions 217 to 331 of the base sequence shown in SEQ ID NO: 3 or 4.

[15] A probe according to any one of

[12] to

[14] , which has the base sequence set forth in SEQ ID NO: 12, or has a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 12, in which one or several bases have been deleted, substituted, inserted or added, and which has the same function as the base sequence set forth in SEQ ID NO: 12.

[16] A kit comprising the primer set according to any one of [1] to

[11] and the probe according to any one of

[12] to

[15] .

[17] The kit according to

[16] , further comprising a probe targeting the nuc gene of Staphylococcus aureus.

[18] A kit described in

[17] , in which the probe targeting the nuc gene of Staphylococcus aureus has the base sequence set forth in SEQ ID NO: 8, or has a base sequence containing at least 8 consecutive bases in the base sequence set forth in SEQ ID NO: 8 in which one or more bases have been deleted, substituted, inserted or added, and has the same function as the base sequence set forth in SEQ ID NO: 8.

[19] A method for detecting the presence of Staphylococcus argenteus in a sample, the method using a primer set according to any one of [1] to

[11] .

[20] The method according to

[19] , which comprises a step of differentiating Staphylococcus argenteus from Staphylococcus schweitzeri or other Staphylococcus bacteria using the first, second, and third primers.

[21] The method according to

[19] or

[20] , further comprising using the probe according to any one of

[12] to

[15] .

[22] The method according to any one of

[19] to

[21] , wherein the other Staphylococcus bacterium is Staphylococcus aureus or a coagulase-negative Staphylococcus bacterium.

[23] Coagulase-negative staphylococci include Staphylococcus epidermidis, Staphylococcus auricularis, Staphylococcus carnosus, Staphylococcus condimenti, Staphylococcus debuckii, Staphylococcus massiliensis, Staphylococcus piscifermentans, Staphylococcus simulans, and Staphylococcus capitis. Staphylococcus capitis; Staphylococcus caprae; Staphylococcus saccharolyticus; Staphylococcus haemolyticus; Staphylococcus devriesei; Staphylococcus hominis; Staphylococcus hyicus; Staphylococcus agnetis; Staphylococcus chromogenes; Staphylococcus cornubiensis; Staphylococcus felis felis); Staphylococcus delphini; Staphylococcus intermedius; Staphylococcus lutrae;Staphylococcus microti, Staphylococcus muscae, Staphylococcus pseudintermedius, Staphylococcus rostri, Staphylococcus schleiferi, Staphylococcus lugudnensis, Staphylococcus saprophyticus, Staphylococcus arlettae, Staphylococcus caeli, Staphylococcus cohnii, Staphylococcus eclorum Staphylococcus equorum; Staphylococcus gallinarum; Staphylococcus kloosii; Staphylococcus leei; Staphylococcus nepalensis; Staphylococcus succinus; Staphylococcus xylosus; Staphylococcus sciuri; Staphylococcus fleurettii; Staphylococcus lentus; Staphylococcus stepanovicii; Staphylococcus vitulinus vitulinus); Staphylococcus simulans;The method according to any one of

[19] to

[22] , wherein the bacterium is one or more species selected from the group consisting of Staphylococcus pasteuri and Staphylococcus warneri.

[24] The method according to

[23] , wherein the other Staphylococcus bacterium is Staphylococcus aureus, and further uses a fourth primer and a fifth primer and / or probe that target the nuc gene of Staphylococcus aureus. [Effects of the Invention]

[0008] The primers and / or probes of the present invention make it possible to differentiate Staphylococcus argenteus, which has been prone to misidentification, from other Staphylococcus bacteria with higher accuracy than conventional methods. [Brief explanation of the drawings]

[0009] [Figure 1] Multiple alignment results of the nuc genes of S. aureus strains NCTC13626 and AR221 (SEQ ID NOs: 1 and 2), the nuc genes of S. argenteus strains NCTC13711 and XNO106 (SEQ ID NOs: 3 and 4), and the nuc gene of S. schweitzeri strain FSCB5 (SEQ ID NO: 5). [Figure 2] Growth curve results for the amplification products obtained using the primer set of SEQ ID NOs: 6 and 7. The solid line shows the results for the S. aureus JCM5676 strain, and the dashed line shows the results for the S. argenteus JCM31982 strain. [Figure 3] Growth curve results for the amplification products obtained using the primer set of SEQ ID NOs: 9, 10, and 11. The solid line shows the results for the S. aureus JCM5676 strain, and the dashed line shows the results for the S. argenteus JCM31982 strain. [Figure 4] Detection results on a substrate using DNA probes targeting the genomic DNA of S. aureus and S. argenteus. The vertical axis shows the fluorescence intensity measured at πCode. [Figure 5]Detection results on a substrate using a DNA probe for clinical samples. The vertical axis shows the fluorescence intensity measured at πCode. [Figure 6] Growth curve results of the amplification products obtained using the primer set of SEQ ID NOs: 6, 7, 9, 10, and 11. [Figure 7] Growth curve results of the amplification products obtained using the primer set of SEQ ID NOs: 13 and 14. [Figure 8] Results of thermal melting curve analysis of PCR products when primer sets of SEQ ID NOs: 6, 7, 9, 10, and 11 were used. [Figure 9] 1 shows the results of thermal melting curve analysis of PCR products when the primer set of SEQ ID NOs: 13 and 14 was used. [Figure 10] Results of detection of S. aureus and S. argenteus genomic DNA on a substrate using the primer set of SEQ ID NOs: 6, 7, 9, 10, and 11 and the primer set of SEQ ID NOs: 13 and 14. The vertical axis indicates the fluorescence intensity measured at πCode. DETAILED DESCRIPTION OF THE INVENTION

[0010] Hereinafter, an embodiment of the present invention (hereinafter referred to as "the present embodiment") will be described, but the scope of the present invention should not be interpreted as being limited to the following embodiment.

[0011] (primer set) In a first aspect, a primer set for detecting the presence of Staphylococcus argenteus in a sample is provided, the primer set comprising a first primer and a second primer targeting the nuc gene of Staphylococcus argenteus.

[0012] The nuc gene in Staphylococcus bacteria encodes TNase, a heat-stable nuclease unique to Staphylococcus aureus, and is known to be a suitable target gene for genetic techniques (Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 30: 1654-1660, 1992.).

[0013] The specimen is not particularly limited as long as it is suspected of containing Staphylococcus argenteus or other Staphylococcus species, and examples thereof include human or non-human body fluids such as blood, serum, plasma, urine, feces, saliva, sputum, tissue fluid, cerebrospinal fluid, and swabs, or dilutions thereof, with blood, serum, plasma, urine, feces, cerebrospinal fluid, and dilutions thereof being preferred. The specimen may also be food.

[0014] Examples of the nuc gene of Staphylococcus argenteus include those having the base sequence shown in SEQ ID NO: 3 or 4, or those having the base sequence shown in SEQ ID NO: 3 or 4 in which one or more bases have been deleted, substituted, inserted or added, and which encode TNase.

[0015] For example, the first primer as a forward primer may have any sequence that can hybridize under stringent conditions to the base sequence shown in SEQ ID NO: 3 or 4, or to the base sequence shown in SEQ ID NO: 3 or 4 in which one or more bases have been deleted, substituted, inserted or added.

[0016] Similarly, the second primer as a reverse primer may have any sequence as long as it can hybridize under stringent conditions to the complementary strand of the base sequence shown in SEQ ID NO: 3 or 4, or to a base sequence in which one or several bases have been deleted, substituted, inserted or added in the complementary strand of the base sequence shown in SEQ ID NO: 3 or 4.

[0017] As used herein, "stringent conditions" refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed, and can be appropriately determined based on information such as the length of the nucleotide sequence. For example, stringent conditions can be set with reference to Molecular Cloning (Fourth Edition, Cold Spring Harbor Laboratory Press, New York). Stringent conditions can also be defined as conditions under which polynucleotides with high homology (preferably identity), for example, polynucleotides with a homology of 70% or more, preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, and particularly preferably 99% or more, hybridize with each other, but polynucleotides with lower homology do not hybridize with each other.

[0018] Specific stringent conditions include incubating a base sequence complementary to the desired base sequence and a sample suspected of containing Staphylococcus argenteus in a hybridization solution (50% formamide, 10x SSC (0.15M NaCl, 15mM sodium citrate, pH 7.0), 5x Denhardt's solution, 1% SDS, 10% dextran sulfate, 10μg / ml denatured salmon sperm DNA, and 50mM phosphate buffer (pH 7.5)) at approximately 42°C to approximately 50°C, followed by washing with 0.1x SSC, 0.1% SDS at approximately 65°C to approximately 70°C.

[0019] Primers and probes are designed to avoid cross-reaction with sequences from other related species, but can be modified appropriately depending on the system used to detect the amplification product and other conditions. When generating an amplification product 100 to 200 bases long, it is preferable to target the nucleotide sequence from position 217 to position 331 of the nucleotide sequence shown in SEQ ID NO: 3 or 4. Primers and probes are designed to have a nucleotide sequence containing at least 10 consecutive nucleotides from the nucleotide sequence constituting such a target. Primers are preferably designed so that their termini, particularly the 3' terminus, have a mismatch with Staphylococcus bacteria other than Staphylococcus argenteus.

[0020] Examples of a first primer targeting the nuc gene of Staphylococcus argenteus include one having the nucleotide sequence set forth in SEQ ID NO: 9 below, or one having a nucleotide sequence containing at least 10 consecutive nucleotides in the nucleotide sequence set forth in SEQ ID NO: 9 in which one or more nucleotides have been deleted, substituted, inserted or added, and which has the same function as the nucleotide sequence set forth in SEQ ID NO: 9. 5'- TTCCACTTCTATTTTCTTAGCATTC -3' (SEQ ID NO: 9)

[0021] Examples of second primers targeting the nuc gene of Staphylococcus argenteus include those having the nucleotide sequence set forth in SEQ ID NO: 10 below, or those having a nucleotide sequence containing at least 10 consecutive nucleotides in the nucleotide sequence set forth in SEQ ID NO: 10 in which one or more nucleotides have been deleted, substituted, inserted or added, and having the same function as the nucleotide sequence set forth in SEQ ID NO: 10. 5'- ATTAATTGATACGCCYGAAACG -3' (SEQ ID NO: 10)

[0022] The length of the first and second primers is arbitrary and can be set appropriately within the range of, for example, about 10 to about 35 bases, but is preferably at least 10 bases or more.

[0023] The ratio of the first primer to the second primer is not particularly limited and may be the same or different from each other. When the primer set is used in asymmetric PCR, the concentration of one primer may be adjusted to be higher than the concentration of the other primer.

[0024] Staphylococcus bacteria are classified as coagulase-positive or coagulase-negative; for example, Staphylococcus argenteus is coagulase-positive. Among coagulase-negative staphylococci (CNS), there is Staphylococcus epidermidis, a staphylococcus frequently found in clinical specimens. Staphylococcus argenteus must also be differentiated from these coagulase-negative staphylococci. Coagulase-negative staphylococci lack the nuc gene fragment, making them suitable for differentiation.

[0025] A primer based on the nucleotide sequence of SEQ ID NO: 10 can also be used as a forward primer to detect the presence of Staphylococcus schweitzeri. Although coagulase-positive Staphylococcus schweitzeri is related to Staphylococcus aureus, its sequence is known to be more closely related to Staphylococcus argenteus.

[0026] The first and second primers can specifically amplify all or part of the nuc gene of Staphylococcus argenteus, allowing differentiation from other Staphylococcus species. Alternatively, melting curve analysis of the amplified products of the first and second primers and comparison of the melting temperatures with those of the amplified products of other primer sets can distinguish Staphylococcus argenteus from other Staphylococcus species.

[0027] The first and second primers specifically amplify a region of the nuc gene of Staphylococcus argenteus, allowing differentiation from other Staphylococcus species, such as Staphylococcus aureus or coagulase-negative staphylococci.

[0028] The genus Staphylococcus is currently classified into 36 species and 19 subspecies, and is widely distributed in nature among humans, mammals including livestock, and birds. Staphylococcus aureus, also known as Staphylococcus aureus, is the most pathogenic of the genus Staphylococcus, causing suppurative diseases in humans and staphylococcal food poisoning. Staphylococcus aureus is coagulase-positive.

[0029] Coagulase-negative Staphylococci include, but are not limited to, Staphylococcus auricularis, Staphylococcus carnosus, Staphylococcus condimenti, Staphylococcus debuckii, Staphylococcus massiliensis, Staphylococcus piscifermentans, Staphylococcus simulans, Staphylococcus epidermidis, and Staphylococcus capitis. Staphylococcus capitis; Staphylococcus caprae; Staphylococcus saccharolyticus; Staphylococcus haemolyticus; Staphylococcus devriesei; Staphylococcus hominis; Staphylococcus hyicus; Staphylococcus agnetis; Staphylococcus chromogenes; Staphylococcus cornubiensis; Staphylococcus felis felis); Staphylococcus delphini; Staphylococcus intermedius; Staphylococcus lutrae;Staphylococcus microti, Staphylococcus muscae, Staphylococcus pseudintermedius, Staphylococcus rostri, Staphylococcus schleiferi, Staphylococcus lugudnensis, Staphylococcus saprophyticus, Staphylococcus arlettae, Staphylococcus caeli, Staphylococcus cohnii, Staphylococcus eclorum Staphylococcus equorum; Staphylococcus gallinarum; Staphylococcus kloosii; Staphylococcus leei; Staphylococcus nepalensis; Staphylococcus succinus; Staphylococcus xylosus; Staphylococcus sciuri; Staphylococcus fleurettii; Staphylococcus lentus; Staphylococcus stepanovicii; Staphylococcus vitulinus vitulinus); Staphylococcus simulans; Staphylococcus pasteuri;Staphylococcus warneri, etc.

[0030] The primer set may include additional primers other than the first and second primers, such as a third, fourth, fifth, sixth, etc. Detection sensitivity can be improved by using appropriate additional primers. Examples of such primers include primers for detecting Staphylococcus argenteus and other Staphylococcus species expected to be present in the sample. Examples of other Staphylococcus species include Staphylococcus schweitzeri.

[0031] An example of a forward primer for detecting Staphylococcus schweitzeri is the one described above as SEQ ID NO: 10, and an example of a reverse primer is one having the base sequence described as SEQ ID NO: 11, or one having a base sequence containing at least 10 consecutive bases in the base sequence described as SEQ ID NO: 11 in which one or more bases have been deleted, substituted, inserted or added, and which has the same function as the base sequence described as SEQ ID NO: 11.

[0032] The nucleic acid amplification reaction using the above primers can detect the presence of Staphylococcus argenteus in a sample and differentiate it from other Staphylococcus species. For example, the accuracy of differentiation can be improved by using the fourth and fifth primers that target the nuc gene of Staphylococcus aureus.

[0033] Examples of the fourth primer include those having the base sequence set forth in SEQ ID NO: 6, or those having a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 6 in which one or several bases have been deleted, substituted, inserted or added, and having the same function as the base sequence set forth in SEQ ID NO: 6.

[0034] Examples of the fifth primer include a primer having the base sequence set forth in SEQ ID NO: 7, or a primer having a base sequence containing at least 10 consecutive bases in the base sequence set forth in SEQ ID NO: 7 in which one or more bases have been deleted, substituted, inserted or added, and having the same function as the base sequence set forth in SEQ ID NO: 7.

[0035] Examples of nucleic acid amplification methods include PCR, such as multiplex PCR, loop-mediated isothermal AMP (LAMP), isothermal and chimeric primer-initiated amplification of nucleic acids (ICAN), rolling circle amplification (RCA), ligase chain reaction (LCR), and strand displacement amplification (SDA). When a sample is expected to contain a large number of Staphylococcus bacteria, multiplex PCR is preferred, as it is capable of comprehensively and simultaneously detecting multiple bacteria.

[0036] The amplification product can be detected by known methods such as electrophoresis using polyacrylamide or agarose gels. For example, in electrophoresis, the presence of the amplification product can be identified from the mobility of the amplification product relative to the mobility of markers with known molecular weights.

[0037] To detect the amplified product after the nucleic acid amplification reaction, a label capable of specifically recognizing the amplified product may be used. Examples of such labels include fluorescent dyes, biotin, digoxigenin, etc. When a fluorescent label is used, the fluorescence can be detected using a fluorescence microscope, a fluorescent plate reader, etc.

[0038] (probe) In a second aspect, a probe for detecting the presence of Staphylococcus argenteus in a sample is provided, the probe being capable of targeting the nuc gene of Staphylococcus argenteus.

[0039] The probe is preferably designed to contain a mismatch within the probe to a Staphylococcus bacterium other than Staphylococcus argenteus, which shortens the base length of the full match portion upon hybridization, improving specificity and reducing false positives.

[0040] Examples of probes for Staphylococcus argenteus or Staphylococcus schweitzeri include those having the nucleotide sequence set forth in SEQ ID NO: 12 below, or those having a nucleotide sequence containing at least 8 consecutive nucleotides in the nucleotide sequence set forth in SEQ ID NO: 12, in which one or more nucleotides have been deleted, substituted, inserted, or added, and which have the same function as the nucleotide sequence set forth in SEQ ID NO: 12: 5'-CATATTTTTCAACGCCT-3' (SEQ ID NO: 12).

[0041] A probe for a Staphylococcus bacterium other than Staphylococcus argenteus or Staphylococcus schweitzeri may be combined. Examples of probes for Staphylococcus aureus include those having the nucleotide sequence set forth in SEQ ID NO: 8 below, or those having a nucleotide sequence containing at least 50 consecutive nucleotides in the nucleotide sequence set forth in SEQ ID NO: 18, in which one or several nucleotides have been deleted, substituted, inserted, or added, and which have the same function as the nucleotide sequence set forth in SEQ ID NO: 8.

[0042] The probes may be attached to solid phase bodies such as beads, examples of which include beads suitable for multiplex assays, such as beads having unique analog code identifiers for storing information about the multiplex assay, as disclosed in WO2018052464A1.

[0043] (kit) In a third aspect, a kit is provided that includes a primer set for detecting the presence of Staphylococcus argenteus in a sample and a probe for detecting the presence of Staphylococcus argenteus in a sample.

[0044] The kit may also include reagents for detecting Staphylococcus argenteus, such as reagents for performing an amplification reaction. Reagents for performing an amplification reaction include, for example, buffer solutions, salts, primers, deoxyribonucleotides, and a thermostable DNA polymerase. The contents and reagents of the kit can be appropriately determined by those skilled in the art depending on the amplification method. The kit may further include a solid phase for hybridization with the amplification product or probe obtained using the primers.

[0045] The kit may further include primers and probes for detecting Staphylococcus aureus, Staphylococcus epidermidis, or other Staphylococcus species expected to be contained in the sample. Examples of primers and probes for detecting Staphylococcus aureus include primers having the nucleotide sequences shown in SEQ ID NOs: 6 and 7, and a probe having the nucleotide sequence shown in SEQ ID NO: 8.

[0046] (Detection method) In a fourth aspect, there is provided a method for detecting the presence of Staphylococcus argenteus in a sample, which can use the above-described primer set and / or probe to detect the presence of Staphylococcus argenteus.

[0047] The primer set of SEQ ID NOs: 9 and 10 can be used to differentiate Staphylococcus argenteus from Staphylococcus aureus or other Staphylococcus species. The reverse primer of SEQ ID NO: 10 in combination with the forward primer of SEQ ID NO: 11 can also detect the presence of Staphylococcus schweitzeri.

[0048] The specimen may be further subjected to ANI (Average Nucleotide Identity) analysis to determine whether the detected bacteria are identical or different.

[0049] The present invention will be explained in more detail below with reference to examples, but the present invention is not limited to these examples. [Example]

[0050] Example 1: Detection on a substrate using DNA probes targeting genomic DNA of S. aureus and S. argenteus

[0051] Primer and probe design Primers and probes represented by sequence numbers 6 to 12 were designed based on the multiple alignment results of the nuc genes of S. aureus strains NCTC13626 and AR221 (sequence numbers 1 and 2), S. argenteus strains NCTC13711 and XNO106 (sequence numbers 3 and 4), and S. schweitzeri strain FSCB5 (sequence number 5) shown in Figure 1. [Table 1]

[0052] Confirmation of nucleic acid amplification Genomic DNA extracted from S. aureus strain JCM5676 and S. argenteus strain JCM31982 was used as a template for real-time PCR amplification using primers SEQ ID NOs: 6 and 7 or primers SEQ ID NOs: 9, 10, and 11. The amplification reagents used were the TaKaRa Multiplex Assay Kit Ver. 2 (Takara Bio Inc.), and EvaGreen (biotium) as the intercalator dye. Each primer was added to a final concentration of 0.2 μM, and the template genomic DNA was added to 10 μg / L. The PCR reaction mixture was prepared by mixing the template DNA and other components with 1x 2x Reaction buffer and 1U of Multiplex Enzyme Mix from the TaKaRa Multiplex Assay Kit Ver. 2. A Light Cycler 480 System II (Roche Diagnostics) was used as the measurement device.

[0053] The amplification reaction conditions used were as follows: 94℃: 30 seconds 60℃: 60 seconds -> 94℃: 30 seconds (45 cycles) 72℃: 600 seconds

[0054] The measurement results when the primers of SEQ ID NOs: 6 and 7 were used are shown in Figure 2, and the measurement results when the primers of SEQ ID NOs: 9, 10, and 11 were used are shown in Figure 3. With the primer set of SEQ ID NOs: 6 and 7, amplification was confirmed only in the S. aureus JCM5676 strain, whereas with the primer set of SEQ ID NOs: 9, 10, and 11, amplification was confirmed only in the S. argenteus JCM31982 strain. From the above, it was found that the primer set of SEQ ID NOs: 6 and 7 and the primer set of SEQ ID NOs: 9, 10, and 11 have the function of amplifying the targeted nucleic acid components of each other.

[0055] Nucleic Acid Amplification and Detection Using S. aureus JCM 5676 strain and S. argenteus JCM 31982 strain, PCR amplification, hybridization reaction on a substrate, labeling, and fluorescence measurement were performed using the primer sets of SEQ ID NOs: 6, 7, 9, 10, and 11. Primers of SEQ ID NOs: 7 and 11 were used, with the 5' ends modified with biotin via a linker.

[0056] The amplification was performed using the TaKaRa Multiplex Assay Kit Ver. 2 (Takara Bio Inc.). Each primer was added to a final concentration of 0.2 μM, and the template genomic DNA was added to 10 μg / L. The 2× Reaction buffer and Multiplex Enzyme Mix (1U) from the TaKaRa Multiplex Assay Kit Ver. 2 were used to prepare the PCR reaction mixture, which was then mixed with the template DNA and other components. The nucleic acid amplification device used was the T100 Thermal Cycler (Bio-Rad). After the amplification reaction, a thermal denaturation reaction was performed using the same device before the hybridization reaction on the substrate.

[0057] The reagents used for the hybridization reaction on the substrate were a mixture of a solution containing substrate 1 on which the probe of sequence number 8 was immobilized and substrate 2 on which the probe of sequence number 12 was immobilized, saline-sodium-phosphate-EDTA buffer (SSPE-buffer), and a PCR reaction solution that had been heat-denatured.

[0058] Streptavidin-Phycoerythrin (PlexBio) was used as the labeling reagent. The hybridization reaction and labeling on the substrate were performed using an IntelliPlex 1000 πCode Processor (PlexBio).

[0059] The fluorescence measurement device used was PlexBio (registered trademark) 100 Fluorescent Analyzer (PlexBio).

[0060] The reaction conditions used were as follows: Amplification reaction conditions 94℃: 30 seconds 60℃: 60 seconds -> 94℃: 30 seconds (30 cycles) 72℃: 600 seconds

[0061] Heat denaturation conditions 95℃: 5 minutes -> Rapid cooling to 4℃

[0062] Hybridization conditions 37℃: Incubate for 20 minutes

[0063] Labeling conditions Incubate at 37℃ for 10 minutes

[0064] The measurement results are shown in Figure 4. When the S. aureus JCM5676 strain was used as the template, fluorescence was observed on Substrate 1, and when the S. argenteus JCM31982 strain was used as the template, fluorescence was observed on Substrate 2. Furthermore, when water was used as a template as a negative control, no fluorescence was observed. From the above, it is expected that by using the primers of SEQ ID NOS: 6, 7, 9, 10, and 11 and the probes of SEQ ID NOS: 8 and 12, it will be possible to differentiate between S. aureus and S. argenteus, which was previously impossible to distinguish. It was also confirmed that the primer sets of SEQ ID NOS: 6, 7, 9, 10, and 11 function even when coexisting in the same system.

[0065] Example 2: Detection on a substrate using DNA probes for three clinical specimens (blood culture fluid)

[0066] Nucleic Acid Amplification and Detection In the culture identification method, specimens 1 and 2 identified as S. aureus and specimen 3 identified as S. epidermidis were subjected to PCR amplification, hybridization reaction on a substrate, labeling, and fluorescence measurement using the QIAamp BiOstic Bacteremia DNA Kit (QIAGEN) and the primer set of SEQ ID NOs: 6, 7, 9, 10, and 11, with genomic DNA extracted according to the standard protocol provided with the kit. The primers used had biotin-modified 5'-ends via a linker.

[0067] The amplification was performed using the TaKaRa Multiplex Assay Kit Ver. 2 (Takara Bio Inc.). Each primer was added to a final concentration of 0.2 μM, and the template genomic DNA was added to 10 μg / L. The 2× Reaction buffer and Multiplex Enzyme Mix (1U) from the TaKaRa Multiplex Assay Kit Ver. 2 were used to prepare the PCR reaction mixture, which was then mixed with the template DNA and other components. The nucleic acid amplification device used was the T100 Thermal Cycler (Bio-Rad). After the amplification reaction, a thermal denaturation reaction was performed using the same device before the hybridization reaction on the substrate.

[0068] The reagents used for the hybridization reaction on the substrate were a mixture of a solution containing substrate 1 on which the probe of sequence number 8 was immobilized and substrate 2 on which the probe of sequence number 12 was immobilized, saline-sodium-phosphate-EDTA buffer (SSPE-buffer), and a PCR reaction solution that had been heat-denatured.

[0069] Streptavidin-Phycoerythrin (PlexBio) was used as the labeling reagent. The hybridization reaction and labeling on the substrate were performed using an IntelliPlex 1000 πCode Processor (PlexBio).

[0070] The fluorescence measurement device used was PlexBio (registered trademark) 100 Fluorescent Analyzer (PlexBio).

[0071] The reaction conditions used were as follows: Amplification reaction conditions 94℃: 30 seconds 60℃: 60 seconds -> 94℃: 30 seconds (30 cycles) 72℃: 600 seconds

[0072] Heat denaturation conditions 95℃: 5 minutes -> Rapid cooling to 4℃

[0073] Hybridization conditions 37℃: Incubate for 20 minutes

[0074] Labeling conditions 37℃: Incubate for 10 minutes

[0075] The measurement results are shown in FIG. 5. When sample 1 was used as the template, fluorescence was observed on substrate 1, and when sample 2 was used as the template, fluorescence was observed on substrate 2. This, in light of Example 1, suggested the possibility that sample 2 was S. argenteus. In subsequent Verification 1, whole genome analysis using a next-generation sequencer and bacterial species identification by ANI were performed on samples 1 and 2. As a result, it was found that sample 1 was S. aureus, while sample 2 was classified as S. argenteus. In combination with Example 1, by using the primer set of SEQ ID NOs: 6, 7, 9, 10, and 11 and the probes of SEQ ID NOs: 8 and 12, it became possible to distinguish between S. aureus and S. argenteus, which had previously been impossible to distinguish between them.

[0076] Furthermore, since no fluorescence was observed from either substrate for sample 3, it was found that using the primer set of sequence numbers 6, 7, 9, 10, and 11 and the probes of sequence numbers 8 and 12 would not result in the false detection of S. epidermidis, another Staphylococcus bacterium.

[0077] Verification 1: Whole genome analysis of specimens 1 and 2 using a next-generation sequencer and bacterial species identification by ANI The DDH (DNA-DNA Hybridization) method was traditionally used to identify bacterial species using gene sequence information, but this has now been replaced by the ANI (Average Nucleotide Identity) method as the standard method. ANI is a method for identifying bacterial species based on the calculation results of which reference sequence registered in a database has the highest sequence similarity to the sequence of the entire genome being analyzed.

[0078] i) Picking bacteria from isolated colonies and extracting genomes Bacteria were picked from isolated colonies and treated with phenol / chloroform / isoamyl alcohol (Nippon Genetics). The supernatant was then used to extract the genome using the FastGene Gel / PCR Extraction Kit (Nippon Genetics) according to the standard protocol provided with the reagent.

[0079] ii) Library preparation Libraries were prepared using the QIAseq FX DNA Library kit (QIAGEN) according to the standard protocol provided with the kit.

[0080] iii) Sequencing reaction Using the MiSeq Reagent kit v3 600 cycles, 300 bp x 2 paired-end sequencing reactions were performed using the MiSeq (Illumina) instrument according to the standard protocol provided with the reagent.

[0081] iiii) Bacterial species identification by ANI The raw data obtained from the instrument were trimmed using Trimmomatic version 0.38, and whole genome sequences were generated using SPAdes version 3.13.0 for de novo assembly. The National Center for Biotechnology Information's NCBI RefSeq database was used for bacterial species identification using ANI with BBTools.

[0082] Sample 1 showed the highest similarity to S. aureus in the database (ANI Value: 98.62%), followed by S. schweitzeri (ANI Value: 93.56%). Sample 2 also showed the highest similarity to S. argenteus in the database (ANI Value: 99.09%), followed by S. schweitzeri (ANI Value: 94.87%). Generally, the threshold for determining the identity of bacterial species using ANI is 95-96% (Kim, M, HS Oh, SC Park, J Chun. 2014. Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. Int J Syst Evol Microbiol 64: 346-351). Based on this threshold, Sample 1 was identified as S. aureus, and Sample 2 was identified as S. argenteus. From the above, the validity of the results of Example 2 was supported by whole genome analysis and bacterial species identification by ANI.

[0083] Comparative Example 1: Comparison with the prior art Investigation of amplification efficiency of primer sets

[0084] The amplification ability as primer performance of S. argenteus primers SEQ ID NOs: 13 and 14 (Table 2) described in JP 2017-163969 A (cited above) was compared with that of SEQ ID NOs: 6, 7, 9, 10, and 11 of the present application.

[0085] [Table 2]

[0086] Confirmation of nucleic acid amplification Genomic DNA extracted from S. aureus strain JCM5676 and S. argenteus strain JCM31982 was used as a template for real-time PCR amplification using the primer sets of SEQ ID NOs: 13 and 14, or SEQ ID NOs: 6, 7, 9, 10, and 11. The amplification reagents used were the TaKaRa Multiplex Assay Kit Ver. 2 (Takara Bio Inc.), and EvaGreen (biotium) as the intercalator dye. Each primer was added to a final concentration of 0.2 μM, and the template genomic DNA was added to 10 μg / L. The 2× Reaction buffer in the TaKaRa Multiplex Assay Kit Ver. 2 was used at a final concentration of 1×, and 1 U of Multiplex Enzyme Mix was used. The PCR reaction mixture was prepared by mixing the template DNA and other components. A Mic Real-time PCR (Bio Molecular Systems) was used as the measurement device, and measurements were performed in triplicate.

[0087] The conditions used were as follows: Amplification reaction 94℃: 30 seconds 60℃: 60 seconds -> 94℃: 30 seconds (40 cycles) 72℃: 600 seconds

[0088] Thermal melting reaction 95℃: 5 seconds 65℃: 30 seconds 65℃->95℃ 0.1℃ / sec

[0089] The measurement results when using the primer set of SEQ ID NOs: 6, 7, 9, 10, and 11 are shown in Figure 6, and the measurement results when using the primer set of SEQ ID NOs: 13 and 14 are shown in Figure 7. Amplification of the S. aureus JCM5676 strain and the S. argenteus JCM31982 strain was confirmed with both the primer set of SEQ ID NOs: 6, 7, 9, 10, and 11 and the primer set of SEQ ID NOs: 13 and 14. From the above, it was found that the primer sets of SEQ ID NOs: 6, 7, 9, 10, and 11 and the primer set of SEQ ID NOs: 13 and 14 have the function of amplifying the targeted nucleic acid components of each other.

[0090] The results of thermal melting curve analysis of PCR products when the primer set of SEQ ID NOs: 6, 7, 9, 10, and 11 was used are shown in FIG. 8, and the results when the primer set of SEQ ID NOs: 13 and 14 was used are shown in FIG.

[0091] Thermal melting curve analysis is a method for analyzing the components of nucleic acid molecules present in a solution by lowering the reaction temperature after the PCR reaction, forming a complementary strand in the solution to incorporate an intercalator, and then heating the reaction solution, observing the release process of the intercalator associated with dissociation of the complementary strand by measuring fluorescence over time.The temperature at which the complementary strand dissociates is a parameter specific to each nucleic acid molecule, determined by base length, composition, etc., so by checking this temperature, it is possible to determine what nucleic acid molecules are present in the solution, and this method is widely used to analyze non-specific amplification products such as primer dimers.

[0092] Thermal melting curve analysis of the PCR products of the S. aureus JCM5676 strain and the S. argenteus JCM31982 strain amplified with the primer sets of SEQ ID NOs: 6, 7, 9, 10, and 11 and SEQ ID NOs: 13 and 14 all showed a unimodal distribution. The unimodal distribution confirmed that the nucleic acid component in the reaction solution was a single component and that the desired specific amplification product was generated, demonstrating that both primer sets were specific.

[0093] To compare the amplification ability of each primer set, Cq values were calculated and the results are shown in Table 3. The Cq value is the PCR cycle number at which the threshold value is exceeded. When amplifying the same target, a primer set with a lower Cq value is considered to have a higher amplification efficiency. For the S. argenteus JCM31982 strain, the primer set of SEQ ID NOS: 6, 7, 9, 10, and 11 was found to have a Cq value 6.6 lower than the primer set of SEQ ID NOS: 13 and 14. This indicates that the primer set of SEQ ID NOS: 6, 7, 9, 10, and 11 is superior to the primer set of SEQ ID NOS: 13 and 14 in amplifying S. argenteus. Meanwhile, there was little difference in the Cq values for the S. aureus JCM5676 strain between the primer sets, indicating that both primer sets have comparable performance in amplifying S. aureus.

[0094] [Table 3]

[0095] Comparative Example 2: Comparison with prior art Comparison of discrimination ability

[0096] Nucleic Acid Amplification and Detection Genomic DNA extracted from S. aureus strain JCM5676 and S. argenteus strain JCM31982 was used as a template. PCR amplification, hybridization on a substrate, labeling, and fluorescence measurement were performed using primer sets of SEQ ID NOs: 6, 7, 9, 10, and 11, or SEQ ID NOs: 13 and 14. Primers of SEQ ID NOs: 7 and 11 were biotinylated via a linker at the 5' end. Each primer was added to a final concentration of 0.2 μM, and the template genomic DNA was added to 10 μg / L. The 2× Reaction buffer from the TaKaRa Multiplex Assay Kit Ver. 2 was used at a final concentration of 1×, and 1 U of Multiplex Enzyme Mix was used. A T100 Thermal Cycler (Bio-Rad) was used as the nucleic acid amplifier. After the amplification reaction, a thermal denaturation reaction was performed using the same instrument before hybridization on a substrate.

[0097] The reagents used for the hybridization reaction on the substrate were a mixture of a container containing substrate 1 on which the probe of sequence number 8 was immobilized, a solution containing substrate 2 on which the probe of sequence number 12 was immobilized, a solution containing substrate 3 on which the probe of sequence number 15 (ATAAGCTAAGCCACGTCC) was immobilized, saline-sodium-phosphate-EDTA buffer (SSPE-buffer), and a PCR reaction solution that had been heat-denatured.

[0098] Streptavidin-Phycoerythrin (PlexBio) was used as the labeling reagent. The hybridization reaction and labeling on the substrate were performed using an IntelliPlex 1000 πCode Processor (PlexBio).

[0099] The fluorescence measurement device used was PlexBio (registered trademark) 100 Fluorescent Analyzer (PlexBio).

[0100] The reaction conditions used were as follows: Amplification reaction conditions 94℃: 30 seconds 60℃: 60 seconds -> 94℃: 30 seconds (30 cycles) 72℃: 600 seconds

[0101] Heat denaturation conditions 95℃: 5 minutes -> Rapid cooling to 4℃

[0102] Hybridization conditions 37℃: Incubate for 20 minutes

[0103] Labeling conditions 37℃: Incubate for 10 minutes

[0104] The measurement results are shown in Figure 10. As evaluated in Example 1, Substrates 1 and 2 have been found to be capable of distinguishing between S. aureus and S. argenteus. For Substrate 3, almost no fluorescence was observed from either S. aureus or S. argenteus, making significant detection nearly impossible.

[0105] From the above, it was found that an assay using the primer set of sequence numbers 6, 7, 9, 10, and 11 with a solution containing substrate 1 on which a probe of sequence number 8 is immobilized and substrate 2 on which a probe of sequence number 12 is immobilized has superior amplification efficiency compared to prior art.

Claims

1. A primer set for detecting the presence of Staphylococcus argenteus in a specimen, comprising: A primer set comprising a first primer having the base sequence set forth in SEQ ID NO: 9 and a second primer having the base sequence set forth in SEQ ID NO: 10, both of which target the nuc gene of Staphylococcus argenteus, wherein the targeted nuc gene has a base sequence including at least 10 consecutive bases from the base sequence of positions 217 to 331 of the base sequence set forth in SEQ ID NO: 3 or 4.

2. The primer set according to claim 1, further comprising a third primer that targets the nuc gene of Staphylococcus schweitzeri and has the base sequence set forth in SEQ ID NO:

11.

3. The primer set according to claim 2, further comprising a fourth primer having the base sequence set forth in SEQ ID NO: 6 and a fifth primer having the base sequence set forth in SEQ ID NO: 7, both of which target the nuc gene of Staphylococcus aureus.

4. The primer set according to any one of claims 1 to 3, wherein the primers are labeled with biotin.

5. 1. A probe for detecting the presence of Staphylococcus argenteus in a specimen, comprising: A probe having the base sequence set forth in SEQ ID NO: 12, which targets the nuc gene of Staphylococcus argenteus.

6. A kit comprising the primer set according to any one of claims 1 to 4 and the probe according to claim 5.

7. The kit according to claim 6, further comprising a probe having the base sequence set forth in SEQ ID NO: 8, which targets the nuc gene of Staphylococcus aureus.

8. A method for detecting the presence of Staphylococcus argenteus in a sample, the method using the primer set according to any one of claims 1 to 4.

9. The method according to claim 8, which comprises a step of distinguishing Staphylococcus argenteus from other Staphylococcus bacteria, wherein the other Staphylococcus bacteria are not Staphylococcus schweitzeri.

10. The method according to claim 8 or 9, further comprising using the probe according to claim 5.

11. The method according to claim 9, wherein the other Staphylococcus bacterium is Staphylococcus aureus or a coagulase-negative Staphylococcus bacterium.

12. Coagulase-negative Staphylococcus bacteria include Staphylococcus epidermidis, Staphylococcus auricularis, Staphylococcus carnosus, Staphylococcus condimentii, Staphylococcus debuckii, Staphylococcus massiliensis, and the like. Staphylococcus massiliensis, Staphylococcus piscifermentans, Staphylococcus simulans, Staphylococcus capitis, Staphylococcus caprae, Staphylococcus saccharolyticus, Staphylococcus haemolyticus Staphylococcus haemolyticus; Staphylococcus devriesei; Staphylococcus hominis; Staphylococcus hyicus; Staphylococcus agnetis; Staphylococcus chromogenes; Staphylococcus cornubiensis Staphylococcus cornubiensis; Staphylococcus felis; Staphylococcus delphini; Staphylococcus intermedius; Staphylococcus lutrae;Staphylococcus microti; Staphylococcus muscae; Staphylococcus pseudointermedius; Staphylococcus rostri; Staphylococcus schleiferi; Staphylococcus lugdunensis; Staphylococcus saprophyticus Staphylococcus saprophyticus; Staphylococcus arlettae; Staphylococcus caeli; Staphylococcus cohnii; Staphylococcus equorum; Staphylococcus gallinarum; Staphylococcus kloosii; Staphylococcus riei Staphylococcus leei; Staphylococcus nepalensis; Staphylococcus succinus; Staphylococcus xylosus; Staphylococcus sciuri; Staphylococcus fleurettii; Staphylococcus lentus; Staphylococcus stepanovich stepanovicii); Staphylococcus vitulinus; Staphylococcus simulans;12. The method according to claim 11, wherein the bacterium is one or more selected from the group consisting of Staphylococcus pasteuri and Staphylococcus warneri.

13. The method according to claim 9, wherein the other Staphylococcus bacterium is Staphylococcus aureus, and further uses a fourth primer having the base sequence set forth in SEQ ID NO: 6 and a fifth primer and / or probe having the base sequence set forth in SEQ ID NO: 7 that target the nuc gene of Staphylococcus aureus.

Citation Information

Patent Citations

  • Seatbelt assembly

    CN110194119A

  • Primer and probe for detecting methicillin-resistant staphylococcus aureus, and method for detecting methicillin-resistant staphylococcus aureus using the same

    JP2013048619A

  • Oligonucleotide for detecting staphylococcus

    JP2017163969A

  • Oligonucleotide for detecting staphylococcus aureus

    JP2017163970A