BMPR2 production promoter, angiogenesis promoter, and skin tone improvement agent by reducing redness

Borage extract is used to promote BMPR2 production and angiogenesis, addressing uneven skin tone by reducing redness, providing a safe and effective solution for enhancing skin complexion.

JP7720078B2Active Publication Date: 2025-08-07NIPPON MENARD COSMETIC CO
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
JP2021104889
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-06-24
Publication Date
2025-08-07
Estimated Expiration
2041-06-24

AI Technical Summary

Technical Problem

There is a lack of plant-derived components that effectively promote BMPR2 production and angiogenesis to address uneven skin tone caused by abnormal capillary dilation or lack of capillary angiogenesis, which are not addressed by existing cosmetics or treatments.

Method used

A composition containing borage extract is developed to promote BMPR2 production and angiogenesis, thereby improving uneven skin tone by reducing redness.

Benefits of technology

The borage extract composition safely and effectively promotes BMPR2 production and angiogenesis, enhancing skin complexion by reducing redness and improving skin tone.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007720078000004
    Figure 0007720078000004
  • Figure 0007720078000005
    Figure 0007720078000005
  • Figure 0007720078000001
    Figure 0007720078000001
Patent Text Reader

Abstract

To provide borage extract-containing agents for enhancing BMPR2 production, enhancing angiogenesis, improving color unevenness due to declined skin redness.SOLUTION: The invention relates to cosmetics, drugs, quasi drugs and food comprising a borage extract aiming at healthy good complexion by enhancing angiogenesis. The borage extract of the invention has excellent BMPR2 production enhancing effect and exhibits improvement of color unevenness due to declined skin redness by preventing decline of capillary angiogenesis in the dermal papillary layer caused by aging or UV.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a BMPR2 production promoter, an angiogenesis promoter, and an agent for improving uneven skin tone by reducing redness, each of which contains a borage extract. [Background technology]

[0002] Aging, ultraviolet rays, and other factors can cause uneven skin tone. Skin with an even skin tone, i.e., skin without uneven skin tone, appears youthful and attractive. For this reason, there is a high demand for cosmetics that even out skin tone, and many products on the market that correct the appearance of color, such as foundations and concealers. At the same time, there is also a desire to improve the skin's natural color rather than simply covering it up with makeup cosmetics.

[0003] Skin color is primarily due to the brown color of melanin pigment and the red color of hemoglobin. Skin redness occurs when capillaries in the skin expand abnormally due to inflammation, etc. On the other hand, when capillary vascularization in the papillary dermis is hindered due to aging or ultraviolet rays, a healthy complexion is lost. In other words, skin redness occurs when unevenness occurs due to the partial expansion or disappearance of capillaries in the skin.

[0004] In recent years, research into factors regulating angiogenesis has progressed, and these factors are being used in treatment. For diseases in which improved blood circulation is considered essential, such as arteriosclerosis obliterans, ischemic cardiomyopathy, and congestive heart failure, attempts have been made to reduce tissue damage and necrosis and protect the function of tissues or organs by promoting angiogenesis from tissues surrounding the ischemic area (Non-Patent Document 1).

[0005] Factors known to promote angiogenesis include vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), and attempts have been made to use these growth factors and their genes to treat diseases that require improved blood circulation. However, because these growth factors are proteins, oral administration is difficult, and there have been issues with ensuring the safety of gene therapy that uses viruses as vectors.

[0006] Bone morphogenetic proteins (BMPs) are known to be involved in the differentiation of multipotent mesenchymal stem cells into osteoblasts, as well as in mineralization and bone formation. BMPs belong to the transforming growth factor β (TGFβ) superfamily, and 14 ligands (BMP2, BMP4, BMP7, etc.) and two receptors (BMPR1 and BMPR2) have been identified (Non-Patent Documents 2 and 3). Furthermore, the physiological functions of BMPs are diverse, including their involvement as regulatory factors in cell proliferation, organogenesis, organogenesis, and apoptosis, in addition to cell differentiation and bone formation (Non-Patent Document 4).

[0007] Recent research has highlighted the BMP family as a factor that plays an important role in angiogenesis, and it has been found that its ligand, BMP4, is involved in angiogenesis, similar to VEGF and angiopoietin (Non-Patent Document 5). Furthermore, its receptor, BMPR2, is present on vascular endothelial cells and mediates signal transduction of BMP2, BMP4, and BMP6 (Non-Patent Document 6). Thus, BMP4 and BMPR2 are known to be involved in angiogenesis, and their application in cardiac muscle cell extraction kits (Patent Document 1) is known. However, there has been no research into their application in promoting angiogenesis to maintain a healthy complexion of the skin.

[0008] One cause of uneven skin tone is increased redness due to abnormal dilation of capillaries in the skin caused by inflammation, etc. This is related to an increase in endothelin B receptors present on capillaries. On the other hand, another cause is a decrease in redness due to a lack of capillary angiogenesis in the papillary dermis caused by aging and ultraviolet rays, etc. This is related to a decrease in BMPR2 present on capillaries.

[0009] Borage is a plant of the Borago genus in the Boraginaceae family of the Lamiales order, a type of herb, and its scientific name is Borago officinalis. It is native to the Mediterranean coast of central Europe. To date, borage extract-containing cosmetic compositions, bath and cleansing compositions (Patent Document 2), skin cosmetics (Patent Document 3), collagen production promoters, MMP inhibitors, melanogenesis inhibitors, cell proliferation promoters, antioxidants, and wrinkle-reducing agents (Patent Document 4) are known. However, no BMPR2 production promoters, angiogenesis promoters, or agents for reducing skin redness and improving uneven skin tone are known. Furthermore, the effects of borage extract in promoting BMP, VEGF, and bFGF production are also unknown. [Prior art documents] [Patent documents]

[0010] [Patent Document 1] WO2016 / 104614 [Patent Document 2] Patent Publication No. 2001-122730 [Patent Document 3] Patent Publication No. 9-278641 [Patent Document 4] Patent Publication No. 2020-2053 [Non-patent literature]

[0011] [Non-Patent Document 1] Osamu Shintani et al., Angiology, 46, 289-295 (2006) [Non-patent document 2] Shizuka Yamada et al., Biomedical Engineering, 44(4), 490-495(2006) [Non-patent document 3] Yuji Mishima, Biochemistry, 89(3), 400-413(2017) [Non-patent document 4] Masatake Izumi et al., Journal of Dental Science, 102(10), 764-771(2002) [Non-Patent Document 5] Suzuki Yuka, Doctoral Dissertation (Medicine) from the University of Tokyo, No. 25919, ID 500000536037 [Non-patent document 6] Liam A Hurst et al,Nat.Commun.,8,14079(2017) Summary of the Invention [Problem to be solved by the invention]

[0012] The problem to be solved by the present invention is to discover a plant-derived component that promotes BMPR2 production, and to provide an excellent BMPR2 production promoter, an angiogenesis promoter, and an agent for improving uneven skin tone by reducing redness, which have a clear mode of action and use this as an active ingredient. [Means for solving the problem]

[0013] As a result of intensive research aimed at solving the above problems, the present inventors have found that borage extract has an excellent effect of promoting BMPR2 production. Furthermore, the present inventors have found that a composition containing borage extract has excellent effects of promoting BMPR2 production, promoting angiogenesis, and improving uneven skin tone by reducing redness, leading to the completion of the present invention.

[0014] That is, the present invention relates to a BMPR2 production promoter, an angiogenesis promoter, and an agent for improving uneven skin tone by reducing redness, each of which contains a borage extract.

[0015] The present invention includes the following inventions. (1) A BMPR2 production promoter characterized by containing borage extract. (2) The BMPR2 production promoter according to claim 1, which promotes BMPR2 production in vascular endothelial cells. (3) An angiogenesis promoter characterized by containing borage extract. (4) An agent for improving uneven skin tone by reducing redness, characterized by containing borage extract. [Effects of the Invention]

[0016] The borage extract of the present invention was found to have an excellent effect in promoting BMPR2 production.Furthermore, a BMPR2 production promoter, an angiogenesis promoter, and an agent for improving uneven skin tone by reducing redness, which contain this extract, were found to be safe and to have an excellent effect in adjusting the skin's healthy complexion by promoting angiogenesis. [Brief explanation of the drawings]

[0017] [Figure 1] This is a microscopic photograph of Experimental Example 3, in which human vascular endothelial cells (HUVECs) were irradiated with UVA, and then borage extract was added, and the cells were reseeded in a Boyden chamber, and cell migration was compared.

[0018] [Figure 2] These are micrographs of experimental example 4, in which a three-dimensional vascular model with a constructed vascular structure was irradiated with UVA, and then borage extract was added to the top of the model, and angiogenesis was compared. The dotted line in the image indicates the top of the gel, and indicates that angiogenesis occurred up to that point. The arrow in the image also indicates that the top of the gel moved in the direction of the arrow. DETAILED DESCRIPTION OF THE INVENTION

[0019] BMPR2 in the present invention is a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine-threonine kinases, and is also known as bone morphogenetic protein receptor 2, bone morphogenetic protein receptor type II, bone morphogenetic protein receptor type 2, bone morphogenetic protein type II receptor, BMR2, PPH1, BMPR3, BRK-3, POVD1, T-ALK, and BMPR-II.

[0020] The vascular endothelial cells of the present invention are cells that cover the lumen of blood vessels in a single layer.

[0021] In the present invention, angiogenesis refers to a phenomenon in which new blood vessel branches branch off from existing blood vessels to form a vascular network.

[0022] The uneven skin tone caused by a decrease in redness in the present invention is caused by a decrease in the healthy red color of the skin due to a lack of capillary vascularization in the papillary dermis caused by aging, ultraviolet rays, etc.

[0023] The borage used in this invention is a type of herb native to the Mediterranean coast of central Europe. It grows to a height of about 30-60 cm, with pale green leaves and stems covered in white hairs, and blue or white star-shaped flowers blooming in the summer. It is also known as borage, lapis lazuli, borage, borage, borage, borage, and borago.

[0024] The borage extract used in the present invention is borage (scientific name: Borago officinalis) of the Boraginaceae family of the Lamiales order, and is extracted from parts of the plant such as flowers, fruits, seeds, leaves, stems, and roots, or from the whole plant. The extraction method is not particularly limited, and may be, for example, extraction by heating or extraction at room temperature. Furthermore, the plant may be used as is for extraction, or may be processed by drying, crushing, shredding, etc.

[0025] The extraction method is not particularly limited, but can be carried out using water, hot water, or a mixed solvent of water and an organic solvent, by stirring or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are preferred, with water, ethanol, 1,3-butylene glycol, and propylene glycol being particularly preferred. These solvents may be used alone or in combination. Particularly preferred extraction solvents include water or a water-ethanol mixed polar solvent. The amount of solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, the amount of the whole borage plant (dry weight). However, for convenience of operations such as concentration and isolation after extraction, it is preferable that the amount of solvent used be 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, etc.

[0026] The extract may be used as the extracted solution as it is, or, if necessary, may be subjected to treatment such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, etc., within the scope of the effects of the present invention. Furthermore, the extracted solution may be subjected to treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0027] In the present invention, the extract may be used as is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, and acidulants, which are used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., within a range that does not impair the effects of the extract.

[0028] The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and examples of dosage forms thereof include lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath additives, foundations, dusting powders, lipsticks, ointments, poultices, candy tablets, capsules, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, liquids, emulsions, suppositories, and solutions for injection.

[0029] For external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, calculated as solid matter. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to see an enhancement of the effect, which is uneconomical.

[0030] For internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Generally, the daily dosage per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0031] Next, in order to explain the present invention in detail, production examples, formulation examples, and experimental examples of the extract used in the present invention are given as examples, but the present invention is not limited to these. In the production examples, % means % by weight, and in the formulation examples, parts of the content means parts by weight. [Example]

[0032] Borage extracts were produced as follows: In Production Examples 1 to 4, the whole plant of borage was used as the extraction material.

[0033] (Production Example 1) Preparation of hot water extract of borage 200 mL of water was added to 10 g of dried borage, and extraction was carried out for 2 hours at 95-100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.4 g of a hot water extract of borage.

[0034] (Production Example 2) Preparation of 50% ethanol extract of borage 10 g of dried borage was soaked in 200 mL of 50% ethanol aqueous solution at room temperature for 7 days to perform extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 1.1 g of 50% ethanol extract of borage.

[0035] (Production Example 3) Preparation of Borage Ethanol Extract 10 g of dried borage was soaked in 200 mL of ethanol at room temperature for 7 days for extraction, and the resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.4 g of ethanol extract of borage.

[0036] (Production Example 4) Preparation of 1,3-butylene glycol extract of borage 10 g of dried borage was soaked in 200 mL of 1,3-butylene glycol at room temperature for 7 days to perform extraction, and the resulting extract was filtered to obtain 192 g of 1,3-butylene glycol extract of borage. [Example]

[0037] (Formulation example 1) Lotion Prescription Content (parts) 1. 50% ethanol extract of borage (Preparation Example 2) 2.0 2.1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly, and components 7 to 10 are dissolved uniformly. The mixture is then mixed and filtered to obtain the product.

[0038] (Prescription Example 2) Cream Prescription Content (parts) 1. Hot water extract of borage (Production Example 1) 1.0 2. Squalane 5.5 3. Olive Oil 3.0 4. Stearic Acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-butylene glycol 8.5 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-9, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 11-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 10 at 45°C, then cool further to 30°C to form the final product.

[0039] (Comparative Formulation Example 1) Conventional cream A conventional cream was prepared by replacing the hot water extract of borage in Formulation Example 2 with purified water.

[0040] (Formulation Example 3) Emulsion Prescription Content (parts) 1. Borage ethanol extract (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl Monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene Glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 1-8, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 10-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 9 at 45°C, then cool further to 30°C to form the final product.

[0041] (Formulation Example 4) Gel Prescription Content (parts) 1. 1,3-butylene glycol extract of borage (Preparation Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make the total volume 100 [Manufacturing method] Components 2 to 5, 1, and 6 to 11 are each dissolved uniformly, and then mixed to form the product.

[0042] (Prescription Example 5) Pack Prescription Content (parts) 1. Hot water extract of borage (Production Example 1) 5.0 2. Polyvinyl alcohol 12.0 3. Ethanol 5.0 4.1,3-Butylene Glycol 8.0 5. Methyl parahydroxybenzoate 0.2 6. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 7. Citric acid 0.1 8. Sodium citrate 0.3 9.Fragrance (appropriate amount) 10. Add purified water to make the total volume 100 [Manufacturing method] Dissolve ingredients 1 to 10 uniformly to obtain the product.

[0043] (Formulation example 6) Foundation Prescription Content (parts) 1. 50% ethanol extract of borage (Preparation Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene Glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow Iron Oxide 2.0 18.Fragrance (appropriate amount) 19. Add purified water to make the total volume 100 [Manufacturing Method] Components 2-8 are heated and dissolved, and the mixture is maintained at 80°C to form the oil phase. Component 9 is thoroughly swelled in component 19, and then components 1 and 10-13 are added and mixed uniformly. Components 14-17, which have been pulverized and mixed in a grinder, are added to this, and the mixture is stirred in a homomixer and maintained at 75°C to form the water phase. The water phase is added to this oil phase while stirring, and emulsified. The mixture is then cooled, and component 18 is added at 45°C. The mixture is then cooled to 30°C while stirring to form the final product.

[0044] (Formulation Example 7) Bath additive Prescription Content (parts) 1. Ethanol extract of borage (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total volume 100 [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0045] (Prescription Example 8) Ointment Prescription Content (parts) 1. 1,3-butylene glycol extract of borage (Preparation Example 4) 5.0 2. Polyoxyethylene cetyl ether (30E.O.) 2.0 3. Glyceryl monostearate 10.0 4. Liquid Paraffin 5.0 5. Cetyl alcohol 6.0 6. Methyl parahydroxybenzoate 0.1 7. Propylene Glycol 10.0 8. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-5, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 6-8, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool to 30°C while stirring to form the final product.

[0046] (Prescription Example 9) Powder Prescription Content (parts) 1. Hot water extract of borage (Production Example 1) 0.5 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.5 [Manufacturing method] Mix ingredients 1 to 3 to form a powder.

[0047] (Prescription Example 10) Tablets Prescription Content (parts) 1. 50% ethanol extract of borage (Preparation Example 2) 2.5 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 5.5 [Manufacturing Method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Component 6 is added to the formed granules and compressed into tablets. Each tablet weighs 0.52 g.

[0048] (Prescription Example 11) Tablets Prescription Content (parts) 1. Ethanol extract of borage (Production Example 3) 1.0 2. Dry cornstarch 49.8 3. Erythritol 40.0 4. Citric Acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7. Purified water 1.1 [Manufacturing method] Mix ingredients 1 to 4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet weighs 1.0 g.

[0049] (Formulation Example 12) Beverage Prescription Content (parts) 1. Hot water extract of borage (Production Example 1) 0.025 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5.Purified water 94.825 [Manufacturing Method] Dissolve ingredients 2 and 3 in a small amount of water. Then add ingredients 1, 4, and 5 and mix.

[0050] Next, experimental examples will be given to explain the effects of the present invention in detail. [Example]

[0051] (Experimental Example 1) Effect of borage extract on the expression of the gene encoding BMPR2 protein in human vascular endothelial cells BMPR2 mRNA expression levels were measured. Human vascular endothelial cells (HUVECs) were seeded in 6-well plates and cultured in HuMedia-EG2 (Kurabo Industries, Ltd.) medium at 37°C and 5% CO2. When the cells reached confluence, borage extract (Production Example 1) dissolved in HuMedia-EG2 at final concentrations of 10 and 100 μg / mL was added. Total RNA was extracted 24 hours after addition. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the total RNA content was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). mRNA expression levels were measured by real-time RT-PCR using the total RNA extracted from the cells. Real-time RT-PCR was performed using the High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems). Specifically, 500 ng of total RNA was reverse transcribed and then subjected to PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures were performed according to established procedures, and the BMPR2 mRNA expression level was calculated as a ratio to the expression level of β-actin mRNA, an internal standard. The BMPR2 expression rate was calculated as the ratio of the BMPR2 mRNA expression level in the sample-added group to the BMPR2 mRNA expression level in the control (no sample added) group. The primers used to measure the expression level of each gene are as follows:

[0052] Primer set for BMPR2 AACACCACTCAGTCCACCTC (SEQ ID NO: 1) TCTCCTGTCAACATTCTGTATCC (SEQ ID NO: 2) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 3) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 4)

[0053] The results are shown in Table 1. The expression level of BMPR2 mRNA in human vascular endothelial cells was increased by borage extract. Similar effects were observed with borage extracts obtained by other extraction methods (Production Examples 2, 3, and 4).

[0054] [Table 1]

[0055] (Experimental Example 2) Effect of borage extract on UVA-induced changes in gene expression encoding BMPR2 protein in human vascular endothelial cells Human vascular endothelial cells (HUVECs) were seeded in a 6-well plate and cultured in HuMedia-EG2 (Kurabo) medium at 37°C and 5% CO2. When the HUVECs reached confluence, they were washed with PBS(-) and then irradiated with UVA 10 J / cm2 in the presence of PBS(-). 2The cells were irradiated with 100 μg / mL of borage extract (Production Example 1) dissolved in HuMedia-EG2 at final concentrations of 10 and 100 μg / mL. After 6 hours of incubation, total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the total RNA content was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). mRNA expression levels were measured by real-time RT-PCR using the total RNA extracted from the cells. For real-time RT-PCR, a High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. Specifically, 500 ng of total RNA was reverse transcribed and then PCR was performed (95°C for 15 seconds, 60°C for 60 seconds, 40 cycles). The remaining procedures were performed according to established procedures, and the BMPR2 mRNA expression level was calculated as a ratio to the expression level of β-actin mRNA, an internal standard. The BMPR2 expression rate was calculated as the ratio of the BMPR2 mRNA expression level in the UVA-irradiated group and the UVA-irradiated + sample-added group to the BMPR2 mRNA expression level in the control group (no UVA irradiation, no sample added).

[0056] The results are shown in Table 2. UVA irradiation reduced BMPR2 mRNA expression levels, but borage extract restored this. Similar effects were observed with borage extracts obtained by other extraction methods (Production Examples 2, 3, and 4).

[0057] [Table 2]

[0058] (Experimental Example 3) Effect of borage extract on the migration ability of human vascular endothelial cells Human vascular endothelial cells (HUVECs) were seeded in a 6-well plate and cultured in HuMedia-EG2 (Kurabo) medium at 37°C and 5% CO2. When the HUVECs reached confluence, they were washed with PBS(-) and then irradiated with UVA 10 J / cm2 in the presence of PBS(-). 2 After irradiation, the medium was replaced with HuMedia-EG2, and borage extract (Production Example 1) dissolved in HuMedia-EG2 to a final concentration of 100 μg / mL was added. After culturing for 6 hours after irradiation, the cells were detached and seeded onto cell culture inserts for migration. To evaluate migration, a Boyden chamber assay using 24-well cell culture inserts was used. Specifically, cell culture inserts (8 μm pore size, BD) were placed in the dedicated lower wells (24-well plates). BMP4 (Cosmo Bio) dissolved in HuMedia-EG2 at a final concentration of 1 ng / mL was added to the lower wells. Meanwhile, HUVECs irradiated with UVA and supplemented with borage extract were placed in the inserts at 5 × 10 per insert. 4 Cells were seeded and cultured for 24 hours. The medium inside the insert was removed, and the cells on the upper side of the insert were scraped off with a cotton swab. The cells that migrated to the lower side of the insert were fixed with methanol for 10 minutes and stained with 4% Giemsa solution. After washing and drying, the membrane was excised from the insert, and the number of migrated cells was counted under a microscope. The total number of cells in eight fields per insert was used as the number of migrated cells, and the value was calculated by taking the control (unirradiated with UVA and no sample added) as 100%.

[0059] Figure 1 shows an overall image of the cells that had migrated to the bottom of the insert, and Table 3 shows the results of measuring the cell migration rate. UVA irradiation reduced the number of cells that had migrated to the bottom of the insert, but borage extract restored cell migration. Furthermore, borage extract itself was found to have a cell migration-promoting effect. Similar effects were also observed in borage extracts (Production Examples 2, 3, and 4).

[0060] [Table 3]

[0061] (Experimental Example 4) Effect of Borage Extract on Angiogenesis First, a substrate for constructing vascular structures was prepared. Collagen gel was prepared using Cell Matrix Type IA (Nitta Gelatin). The prepared collagen gel was finely crushed and then dehydrated by centrifugation to produce collagen gel fragments with a diameter of approximately 10-100 μm. 100 μL of Matrigel (Corning) was added to 1 mL of this collagen gel, and after thorough suspension, the gel was incubated at 37°C to coat the gel with Matrigel. Next, human vascular endothelial cells (HUVECs) were analyzed using Cell Tracker TM Staining was performed with Orange CMRA Dye (Thermo). 5 The cells were added to 100 μL of the collagen gel, thoroughly suspended, and then poured into a culture insert (Falcon). 25 μL of collagen was then poured into the insert, which was then allowed to solidify to form a cap, allowing the vascular structure to form. UVA 10J / cm2 was applied to the gel in which the vascular structure was constructed. 2 After irradiation, BMP4 (Cosmo Bio) and borage extract (Production Example 1) added to HuMedia-EG2 (Kurabo) were added to the top of the gel to final concentrations of 1 ng / mL and 100 μg / mL, respectively, and the gel was cultured for an additional 48 hours. After culture, the state of the vascular structure was observed using a fluorescence microscope by turning the culture insert sideways.

[0062] An overall image of the vascularized gel is shown in Figure 2. Adding BMP4 to the top of the gel caused blood vessels to extend upward, but this was inhibited by UVA irradiation. However, even after UVA irradiation, adding borage extract to the top of the gel simultaneously with BMP4 restored blood vessel extension. Similar effects were observed with borage extract (Production Examples 2, 3, and 4).

[0063] (Experimental Example 5) Usage test A one-month usage test was conducted on 23 female subjects (aged 20-50) with uneven skin tone on their cheeks, using the cream of Formulation Example 2 and the conventional cream of Comparative Formulation Example 1. After use, the degree of uneven skin tone due to redness on the skin was assessed by questionnaire.

[0064] As a result, the cream containing the extract of the present invention reduced the degree of uneven skin tone caused by redness on the cheeks. Furthermore, no skin troubles were reported in any of the subjects during the test period, and there were no safety issues. There were also no problems with the deterioration of the prescribed ingredients. [Industrial Applicability]

[0065] The BMPR2 production promoter, angiogenesis promoter, and agent for improving uneven skin tone by reducing redness, which are characterized by containing borage extract, according to the present invention, exhibit excellent improving effects for their intended purposes, and therefore can provide cosmetics, pharmaceuticals, quasi-drugs, and foods that aim to improve the healthy complexion of skin by promoting angiogenesis.

Claims

1. A BMPR2 production promoter characterized by containing a hot water extract of borage.

2. The BMPR2 production promoter according to claim 1, which promotes BMPR2 production in vascular endothelial cells.

3. An angiogenesis promoter characterized by containing a hot water extract of borage.

4. An agent for reducing redness and improving uneven skin tone, characterized by containing a hot water extract of borage.

Citation Information

Patent Citations

  • Skin color-improving beautifier

    JP1997268118A

  • Skin cosmetic

    JP1997278641A

  • External preparation for skin

    JP1999322628A

  • Cosmetic composition containing moisturizing plant extract

    JP2001122730A

  • Preparation for external use for ameliorating blood circulation

    JP2004123622A