Nanoparticles with a single site for template polynucleotide binding - Patent Application 20070122997

Nanoparticles with a single template site and accessory sites improve sequencing efficiency by minimizing polyclonal clusters and optimizing substrate utilization, addressing inefficiencies in current sequencing platforms.

JP7722934B2Active Publication Date: 2025-08-13ILLUMINA INC +2
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2021577118
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-12-23
Filing Date
2020-12-22
Publication Date
2025-08-13
Estimated Expiration
2040-12-22

AI Technical Summary

Technical Problem

Current sequencing platforms face inefficiencies due to overcrowding of template polynucleotides on substrates, leading to polyclonal clusters that complicate data analysis and increase costs, time, and complexity.

Method used

Nanoparticles with a single template site and multiple accessory sites are used to attach template polynucleotides, ensuring spatial separation and minimizing polyclonal clusters, while maximizing monoclonal clustering.

Benefits of technology

Enhances sequencing efficiency by reducing polyclonal clusters, optimizing substrate utilization, and simplifying data analysis, thereby reducing costs and time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007722934000093
    Figure 0007722934000093
  • Figure 0007722934000094
    Figure 0007722934000094
  • Figure 0007722934000095
    Figure 0007722934000095
Patent Text Reader

Abstract

Nanoparticles are provided, comprising a scaffold, a single template site for attaching a template polynucleotide to the scaffold, and multiple accessory sites for attaching accessory oligonucleotides to the scaffold, wherein the scaffold is selected from an asymmetric acrylamide polymer scaffold or a dendrimer comprising repeating lysyl building blocks, the single template site for attaching the template polynucleotide to the scaffold is selected from covalent and non-covalent template attachment sites, and the multiple accessory sites for attaching accessory oligonucleotides to the scaffold are selected from covalent and non-covalent accessory oligonucleotide attachment sites. Methods of using the nanoparticles are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application is an international application filed under the Patent Cooperation Treaty, which claims priority to U.S. Provisional Patent Application No. 62 / 952,799, filed December 23, 2019, and U.S. Provisional Patent Application No. 62 / 952,866, filed December 23, 2019, the entire contents of which are incorporated herein by reference.

[0002] (Sequence Listing) This application contains a Sequence Listing created on December 16, 2020, the ASCII format of which is designated 1912732.txt and is 3.2 KB in size. This file is incorporated by reference herein in its entirety. [Background technology]

[0003] Many current sequencing platforms use "sequencing by synthesis" (SBS) technology and fluorescence-based methods for detection. In some instances, a large number of target polynucleotides, i.e., template polynucleotides, isolated from a library to be sequenced are attached to the surface of a substrate in a process known as seeding. Multiple copies of the template polynucleotides can then be synthesized upon binding to the surface adjacent to the seeded locations of the copies of the template polynucleotides, in a process called clustering. Nascent copies of the clustered polynucleotides are subsequently synthesized under conditions that emit a signal specific to each nucleotide upon binding to the nascent strand. The clustering of multiple copies of the seeded template polynucleotides adjacent to the originally seeded locations results in a visible amplification of the signal generated during polymerization, improving detection.

[0004] When the available substrate surface is seeded with template polynucleotides as much as possible, the seeding and clustering for SBS operation can maximize the amount of sequencing information obtained during sequencing run.In contrast, the less available surface area of the substrate used for seeding and clustering, the less efficient the SBS process becomes, and the more time, reactants, costs, and complex data processing required to obtain the sequencing information of a given amount of a given library may increase.

[0005] Seeding and clustering also work well when template polynucleotides from a library with different sequences are seeded or attached to surface locations that are sufficiently distant from each other, resulting in spatially distinct clusters of copied polynucleotides (called monoclonality), each resulting from the seeding of a single template polynucleotide. That is, a template polynucleotide library can generally contain a large number of template polynucleotide molecules whose nucleotide sequences differ from each other. If two such template polynucleotides are seeded too close to each other on the surface of a substrate, clustering can result in a spatially mixed population of copied polynucleotides, some of which have the sequence of one of the template polynucleotides seeded nearby, and others of which have the sequence of another template polynucleotide seeded nearby on the surface. Alternatively, two clusters formed from two different template polynucleotides seeded too close to each other may be too close to each other or may even contact each other, so that even if there is no or minimal spatial mixing of the sequences bound to the substrate between the clusters, the imaging system used in the SBS process may not be able to distinguish the two clusters as separate clusters. Such an unfavorable condition may generally be referred to as polyclonality. When polyclonal clusters exist, obtaining unambiguous sequence information from the polyclonal clusters may be more difficult, time-consuming, expensive, less efficient, and require more complex data analysis. Summary of the Invention

[0006] Therefore, it is desirable to perform SBS under conditions in which as much surface area of the substrate as possible is used for seeding and clustering, while also facilitating isolation of the seeded template polynucleotides so as to maximize the monoclonality of the clusters and minimize polyclonal clusters as much as possible. Disclosed herein are compositions and methods that can be used to advantageously increase seeding density and monoclonal clustering in SBS.

[0007] In one aspect, a nanoparticle is provided, the nanoparticle comprising a scaffold; a single template site for attaching a template polynucleotide to the scaffold, the single template site being selected from a covalent template attachment site and a non-covalent template attachment site; and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold, the accessory oligonucleotides being selected from a covalent accessory oligonucleotide attachment site and a non-covalent accessory oligonucleotide attachment site, wherein the scaffold has a structure represented by Formula I: [ka] wherein each X is a compound of formula II: [ka] wherein R2 is a compound of formula IIIa: [ka] wherein R 5 teeth, [ka] wherein x is an integer ranging from 1 to 2,000 and y is an integer ranging from 1 to 10,000, and the ratio of x:y may be from about 10:90 to about 1:99, z are independently H or C 1~4 alkyl, and Formula IIIb: [ka] where R 5 teeth, [ka] wherein y is an integer ranging from 1 to 2,000, and x and z are an integer sum ranging from 1 to 10,000, and the ratio of (x:y):z can be from about (85):15 to about (95):5, wherein each R z are independently H or C 1~4 alkyl, R1 contains a single template site for attaching a template polynucleotide to the scaffold, and R 4 is an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Alkenyl, optionally substituted C1-C 20 Alkynyl, optionally substituted C1-C 20 Oxaalkyl, optionally substituted C1-C 20 Thiaalkyl and optionally substituted C1-C 20 azaalkyl, and the substituents are C1 to C 20 R 3 contains an accessory site for attachment of an accessory oligonucleotide.

[0008] In one example, the single template site comprises a covalent template binding site. In another example, the covalent template binding site is an amine-NHS ester binding site, an amine-imidoester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding site, and a sortase coupling binding site.

[0009] In another example, the single template site comprises a non-covalent template binding site. In yet another example, the non-covalent template binding site comprises a polynucleotide hybridization site. In yet a further example, the non-covalent template binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from a coiled-coil binding site and an avidin-biotin binding site.

[0010] In another example, the plurality of accessory moieties for attaching accessory oligonucleotides to the scaffold comprise covalent accessory oligonucleotide attachment sites. In yet another example, the covalent accessory oligonucleotide attachment sites include amine-NHS ester attachment sites, amine-imidoester attachment sites, amine-pentofluorophenyl ester attachment sites, amine-hydroxymethylphosphine attachment sites, carboxyl-carbodiimide attachment sites, thiol-maleimide attachment sites, thiol-haloacetyl attachment sites, thiol-pyridyl disulfide attachment sites, thiol-thiosulfonate attachment sites, thiol-vinyl sulfone attachment sites, aldehyde-hydrazide attachment sites, aldehyde-alkoxyamine attachment sites, hydroxy-isocyanate attachment sites, azide-alkyne attachment sites, azide-phosphine attachment sites, transcyclooctene-tetrazine attachment sites, norbornene-tetrazine attachment sites, azide-cyclooctyne attachment sites, azide-norbornene attachment sites, oxime attachment sites, SpyTag-SpyCatcher attachment sites, Snaptag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding sites, sortase coupling binding sites, and any combination of two or more of the foregoing.

[0011] In another example, the accessory oligonucleotide binding site comprises a non-covalent accessory oligonucleotide binding site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a polynucleotide hybridization site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0012] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site, hi yet another example, the scaffold further comprises multiple accessory oligonucleotides bound to multiple accessory sites.

[0013] In another example, the nanoparticles may be at least 10 nm in diameter, at least 20 nm in diameter, at least 30 nm in diameter, at least about 40 nm in diameter, at least about 50 nm in diameter, at least about 60 nm in diameter, at least about 70 nm in diameter, at least about 80 nm in diameter, at least about 90 nm in diameter, at least about 100 nm in diameter, at least about 125 nm in diameter, at least about 150 nm in diameter, at least about 175 nm in diameter, at least about 200 nm in diameter, at least about 225 nm in diameter, at least about 250 nm in diameter, at least about 275 nm in diameter, at least about 300 nm, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, at least about 950 nm in diameter.

[0014] In another aspect, a method is provided that includes attaching a single template polynucleotide to a single template site on a nanoparticle. In yet another aspect, a method is provided that includes attaching multiple accessory oligonucleotides to multiple accessory sites on a nanoparticle. In yet another example, the method further includes synthesizing one or more scaffold-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the scaffold-bound copies extend from the accessory oligonucleotides. In yet another example, the method further includes attaching the scaffold to a substrate, wherein the attaching comprises hybridizing an accessory oligonucleotide to the substrate-bound oligonucleotide.

[0015] In one example, the substrate includes a plurality of nanowells, and the substrate-bound oligonucleotides are bound within the plurality of nanowells. In another example, a single scaffold is bound within any one of the nanowells. In yet another example, the method further includes synthesizing one or more substrate-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the substrate-bound copies extend from the accessory oligonucleotides bound to the substrate. In yet another example, the method further includes sequencing at least one of the scaffold-bound copies and the substrate-bound copies, wherein sequencing comprises decoding-by-synthesis.

[0016] In another aspect, a nanoparticle is provided, the nanoparticle comprising: a scaffold; a single template site for attaching a template polynucleotide to the scaffold, the single template site being selected from a covalent template attachment site and a non-covalent template attachment site; and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold, the plurality of accessory sites being selected from a covalent accessory oligonucleotide attachment site and a non-covalent accessory oligonucleotide attachment site; wherein the scaffold comprises a dendrimer, the dendrimer comprising constitutional repeat units of generations 2 to 10, the constitutional repeat units comprising lysines, wherein a lysine of an upstream generation forms a peptide bond with a first lysine of an immediately downstream generation and an isopeptide bond with a second lysine of an immediately downstream generation; wherein the single template site extends from the C-terminus of the lysine of the first generation dendrimer; and wherein the plurality of accessory sites extend from the NH2 group of a lysine of a final generation dendrimer.

[0017] In one example, the single template site comprises a covalent template binding site. In another example, the covalent template binding site is an amine-NHS ester binding site, an amine-imidoester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding site, and a sortase coupling binding site.

[0018] In another example, the single template site comprises a non-covalent template binding site. In yet another example, the non-covalent template binding site comprises a polynucleotide hybridization site. In yet a further example, the non-covalent template binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from a coiled-coil binding site and an avidin-biotin binding site.

[0019] In another example, the plurality of accessory moieties for attaching accessory oligonucleotides to the scaffold comprise covalent accessory oligonucleotide attachment sites. In yet another example, the covalent accessory oligonucleotide attachment sites include amine-NHS ester attachment sites, amine-imidoester attachment sites, amine-pentofluorophenyl ester attachment sites, amine-hydroxymethylphosphine attachment sites, carboxyl-carbodiimide attachment sites, thiol-maleimide attachment sites, thiol-haloacetyl attachment sites, thiol-pyridyl disulfide attachment sites, thiol-thiosulfonate attachment sites, thiol-vinyl sulfone attachment sites, aldehyde-hydrazide attachment sites, aldehyde-alkoxyamine attachment sites, hydroxy-isocyanate attachment sites, azide-alkyne attachment sites, azide-phosphine attachment sites, transcyclooctene-tetrazine attachment sites, norbornene-tetrazine attachment sites, azide-cyclooctyne attachment sites, azide-norbornene attachment sites, oxime attachment sites, SpyTag-SpyCatcher attachment sites, Snaptag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding sites, sortase coupling binding sites, and any combination of two or more of the foregoing.

[0020] In another example, the accessory oligonucleotide binding site comprises a non-covalent accessory oligonucleotide binding site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a polynucleotide hybridization site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0021] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site, hi yet another example, the scaffold further comprises multiple accessory oligonucleotides bound to multiple accessory sites.

[0022] In another example, the nanoparticles may be at least 10 nm in diameter, at least 20 nm in diameter, at least 30 nm in diameter, at least about 40 nm in diameter, at least about 50 nm in diameter, at least about 60 nm in diameter, at least about 70 nm in diameter, at least about 80 nm in diameter, at least about 90 nm in diameter, at least about 100 nm in diameter, at least about 125 nm in diameter, at least about 150 nm in diameter, at least about 175 nm in diameter, at least about 200 nm in diameter, at least about 225 nm in diameter, at least about 250 nm in diameter, at least about 275 nm in diameter, at least about 300 nm, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, at least about 950 nm in diameter.

[0023] In another aspect, a method is provided that includes attaching a single template polynucleotide to a single template site on a nanoparticle. In yet another aspect, a method is provided that includes attaching multiple accessory oligonucleotides to multiple accessory sites on a nanoparticle. In yet another example, the method further includes synthesizing one or more scaffold-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the scaffold-bound copies extend from the accessory oligonucleotides. In yet another example, the method further includes attaching the scaffold to a substrate, wherein the attaching comprises hybridizing an accessory oligonucleotide to the substrate-bound oligonucleotide.

[0024] In one example, the substrate includes a plurality of nanowells, and the substrate-bound oligonucleotides are bound within the plurality of nanowells. In another example, a single scaffold is bound within any one of the nanowells. In yet another example, the method further includes synthesizing one or more substrate-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the substrate-bound copies extend from the accessory oligonucleotides bound to the substrate. In yet another example, the method further includes sequencing at least one of the scaffold-bound copies and the substrate-bound copies, wherein sequencing comprises decoding-by-synthesis.

[0025] In another aspect, a nanoparticle is provided, the nanoparticle comprising a scaffold; a single template site for attaching a template polynucleotide to the scaffold, the single template site being selected from a covalent template attachment site and a non-covalent template attachment site; and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold, the accessory oligonucleotides being selected from a covalent accessory oligonucleotide attachment site and a non-covalent accessory oligonucleotide attachment site, wherein the scaffold has a structure represented by Formula IV: [ka] wherein each X is a compound of formula V: [ka] wherein R2 is a compound of formula VIa: [ka] Formula VIb: [ka] wherein p is an integer selected from 1 to 20; R5 comprises an accessory moiety for attaching an accessory oligonucleotide; R3 is a direct bond; [ka] m is an integer from 1 to 2,000, n is an integer from 1 to 10,000, and R 1 contains a single template site for attaching a template polynucleotide to the scaffold, and R 4 is an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Alkenyl, optionally substituted C1-C 20 Alkynyl, optionally substituted C1-C 20 Oxaalkyl, optionally substituted C1-C 20 Thiaalkyl and optionally substituted C1-C 20 azaalkyl, and the substituents are C1 to C 20 R includes substitution with one or more of alkyl, double-bonded oxygen, and hydroxyl groups; 3 contains an accessory moiety for attaching an accessory oligonucleotide. In any of the foregoing examples, a trithiocarbonate group [ka] may be optionally substituted with a direct bond, a —CH 2 — bond, an —S- bond, an N- bond, or an —O- bond.

[0026] In one example, the single template site comprises a covalent template binding site. In another example, the covalent template binding site is an amine-NHS ester binding site, an amine-imidoester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding site, and a sortase coupling binding site.

[0027] In another example, the single template site comprises a non-covalent template binding site. In yet another example, the non-covalent template binding site comprises a polynucleotide hybridization site. In yet a further example, the non-covalent template binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from a coiled-coil binding site and an avidin-biotin binding site.

[0028] In another example, the plurality of accessory moieties for attaching accessory oligonucleotides to the scaffold comprise covalent accessory oligonucleotide attachment sites. In yet another example, the covalent accessory oligonucleotide attachment sites include amine-NHS ester attachment sites, amine-imidoester attachment sites, amine-pentofluorophenyl ester attachment sites, amine-hydroxymethylphosphine attachment sites, carboxyl-carbodiimide attachment sites, thiol-maleimide attachment sites, thiol-haloacetyl attachment sites, thiol-pyridyl disulfide attachment sites, thiol-thiosulfonate attachment sites, thiol-vinyl sulfone attachment sites, aldehyde-hydrazide attachment sites, aldehyde-alkoxyamine attachment sites, hydroxy-isocyanate attachment sites, azide-alkyne attachment sites, azide-phosphine attachment sites, transcyclooctene-tetrazine attachment sites, norbornene-tetrazine attachment sites, azide-cyclooctyne attachment sites, azide-norbornene attachment sites, oxime attachment sites, SpyTag-SpyCatcher attachment sites, Snaptag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding sites, sortase coupling binding sites, and any combination of two or more of the foregoing.

[0029] In another example, the accessory oligonucleotide binding site comprises a non-covalent accessory oligonucleotide binding site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a polynucleotide hybridization site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0030] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site, hi yet another example, the scaffold further comprises multiple accessory oligonucleotides bound to multiple accessory sites.

[0031] In another example, the nanoparticles may be at least 10 nm in diameter, at least 20 nm in diameter, at least 30 nm in diameter, at least about 40 nm in diameter, at least about 50 nm in diameter, at least about 60 nm in diameter, at least about 70 nm in diameter, at least about 80 nm in diameter, at least about 90 nm in diameter, at least about 100 nm in diameter, at least about 125 nm in diameter, at least about 150 nm in diameter, at least about 175 nm in diameter, at least about 200 nm in diameter, at least about 225 nm in diameter, at least about 250 nm in diameter, at least about 275 nm in diameter, at least about 300 nm, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, at least about 950 nm in diameter.

[0032] In another aspect, a method is provided that includes attaching a single template polynucleotide to a single template site on a nanoparticle. In yet another aspect, a method is provided that includes attaching multiple accessory oligonucleotides to multiple accessory sites on a nanoparticle. In yet another example, the method further includes synthesizing one or more scaffold-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the scaffold-bound copies extend from the accessory oligonucleotides. In yet another example, the method further includes attaching the scaffold to a substrate, wherein the attaching comprises hybridizing an accessory oligonucleotide to the substrate-bound oligonucleotide.

[0033] In one example, the substrate includes a plurality of nanowells, and the substrate-bound oligonucleotides are bound within the plurality of nanowells. In another example, a single scaffold is bound within any one of the nanowells. In yet another example, the method further includes synthesizing one or more substrate-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the substrate-bound copies extend from the accessory oligonucleotides bound to the substrate. In yet another example, the method further includes sequencing at least one of the scaffold-bound copies and the substrate-bound copies, wherein sequencing comprises decoding-by-synthesis.

[0034] In another aspect, a nanoparticle is provided, the nanoparticle comprising: a scaffold; a single template site for attaching a template polynucleotide to the scaffold, the single template site being selected from a covalent template binding site and a non-covalent template binding site; and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold, the accessory oligonucleotides being selected from a covalent accessory oligonucleotide binding site and a non-covalent accessory oligonucleotide binding site, wherein the scaffold comprises: VII: [ka] wherein each X is a compound of formula VIII: [ka] wherein y is an integer from 1 to 20, and R2 is a compound of formula IXa: [ka] Formula IXb: [ka] wherein p is an integer selected from 1 to 20; R5 comprises an accessory moiety for attaching an accessory oligonucleotide; R3 is a direct bond; [ka] m is an integer from 1 to 2,000, n is an integer from 1 to 10,000, and R 1 contains a single template site for attaching a template polynucleotide to the scaffold, and R 4 is an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Alkenyl, optionally substituted C1-C 20 Alkynyl, optionally substituted C1-C 20 Oxaalkyl, optionally substituted C1-C 20 Thiaalkyl and optionally substituted C1-C 20 azaalkyl, and the substituents are C1 to C 20 R includes substitution with one or more of alkyl, double-bonded oxygen, and hydroxyl groups; 3 contains an accessory moiety for attaching an accessory oligonucleotide. In any of the foregoing examples, a trithiocarbonate group [ka] can be optionally substituted with a direct bond, a —CH 2 — bond, an —S- bond, an N- bond, or an —O- bond.

[0035] In one example, the single template site comprises a covalent template binding site. In another example, the covalent template binding site is an amine-NHS ester binding site, an amine-imidoester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding site, and a sortase coupling binding site.

[0036] In another example, the single template site comprises a non-covalent template binding site. In yet another example, the non-covalent template binding site comprises a polynucleotide hybridization site. In yet a further example, the non-covalent template binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from a coiled-coil binding site and an avidin-biotin binding site.

[0037] In another example, the plurality of accessory moieties for attaching accessory oligonucleotides to the scaffold comprise covalent accessory oligonucleotide attachment sites. In yet another example, the covalent accessory oligonucleotide attachment sites include amine-NHS ester attachment sites, amine-imidoester attachment sites, amine-pentofluorophenyl ester attachment sites, amine-hydroxymethylphosphine attachment sites, carboxyl-carbodiimide attachment sites, thiol-maleimide attachment sites, thiol-haloacetyl attachment sites, thiol-pyridyl disulfide attachment sites, thiol-thiosulfonate attachment sites, thiol-vinyl sulfone attachment sites, aldehyde-hydrazide attachment sites, aldehyde-alkoxyamine attachment sites, hydroxy-isocyanate attachment sites, azide-alkyne attachment sites, azide-phosphine attachment sites, transcyclooctene-tetrazine attachment sites, norbornene-tetrazine attachment sites, azide-cyclooctyne attachment sites, azide-norbornene attachment sites, oxime attachment sites, SpyTag-SpyCatcher attachment sites, Snaptag-O 6 -benzylguanine binding site, CLIP tag-O 2 benzylcytosine binding sites, sortase coupling binding sites, and any combination of two or more of the foregoing.

[0038] In another example, the accessory oligonucleotide binding site comprises a non-covalent accessory oligonucleotide binding site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a polynucleotide hybridization site. In yet another example, the non-covalent accessory oligonucleotide binding site comprises a non-covalent peptide binding site, the non-covalent peptide binding site being selected from one or both of a coiled-coil binding site and an avidin-biotin binding site.

[0039] In another example, the nanoparticle further comprises a single template polynucleotide bound to a single template site, hi yet another example, the scaffold further comprises multiple accessory oligonucleotides bound to multiple accessory sites.

[0040] In another example, the nanoparticles may be at least 10 nm in diameter, at least 20 nm in diameter, at least 30 nm in diameter, at least about 40 nm in diameter, at least about 50 nm in diameter, at least about 60 nm in diameter, at least about 70 nm in diameter, at least about 80 nm in diameter, at least about 90 nm in diameter, at least about 100 nm in diameter, at least about 125 nm in diameter, at least about 150 nm in diameter, at least about 175 nm in diameter, at least about 200 nm in diameter, at least about 225 nm in diameter, at least about 250 nm in diameter, at least about 275 nm in diameter, at least about 300 nm, at least about 325 nm in diameter, at least about 350 nm in diameter, at least about 375 nm in diameter, at least about 400 nm in diameter, at least about 425 nm in diameter, at least about 450 nm in diameter, at least about 475 nm in diameter, at least about 500 nm in diameter, at least about 550 nm in diameter, at least about 600 nm in diameter, at least about 650 nm in diameter, at least about 700 nm in diameter, at least about 750 nm in diameter, at least about 800 nm in diameter, at least about 850 nm in diameter, at least about 900 nm in diameter, at least about 950 nm in diameter.

[0041] In another aspect, a method is provided that includes attaching a single template polynucleotide to a single template site on a nanoparticle. In yet another aspect, a method is provided that includes attaching multiple accessory oligonucleotides to multiple accessory sites on a nanoparticle. In yet another example, the method further includes synthesizing one or more scaffold-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the scaffold-bound copies extend from the accessory oligonucleotides. In yet another example, the method further includes attaching the scaffold to a substrate, wherein the attaching comprises hybridizing an accessory oligonucleotide to the substrate-bound oligonucleotide.

[0042] In one example, the substrate includes a plurality of nanowells, and the substrate-bound oligonucleotides are bound within the plurality of nanowells. In another example, a single scaffold is bound within any one of the nanowells. In yet another example, the method further includes synthesizing one or more substrate-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the substrate-bound copies extend from the accessory oligonucleotides bound to the substrate. In yet another example, the method further includes sequencing at least one of the scaffold-bound copies and the substrate-bound copies, wherein sequencing comprises decoding-by-synthesis. [Brief explanation of the drawings]

[0043] These and other features, aspects, and advantages of the present disclosure will become better understood from the following detailed description when taken in conjunction with the accompanying drawings.

[0044] [Figure 1] 1 illustrates an example of a nanoparticle, according to an embodiment of the present disclosure.

[0045] [Figure 2] 1 shows an example of a portion of a nanoparticle scaffold, according to an embodiment of the present disclosure.

[0046] [Figure 3] 1 shows an example of a single template polynucleotide moiety and accessory binding moiety on a nanoparticle, according to an embodiment of the present disclosure.

[0047] [Figure 4] 1 illustrates an example method for synthesizing nanoparticles according to the present disclosure.

[0048] [Figure 5] An example of nanoparticles having a dendrimer structure with a constitutional repeating unit containing lysine is shown below.

[0049] [Figure 6]1 illustrates a synthetic method for synthesizing example nanoparticles according to an embodiment of the present disclosure.

[0050] [Figure 7] 1 shows an example of attachment of a template to a nanoparticle, according to an embodiment of the present disclosure.

[0051] [Figure 8] 1 shows an example of non-covalently attaching a template polynucleotide to a nanoparticle by hybridization, according to an embodiment of the present disclosure.

[0052] [Figure 9] 1 shows an example of non-covalent attachment of a template polynucleotide to a nanoparticle via a coiled-coil peptide binding site, according to an embodiment of the present disclosure.

[0053] [Figure 10] 1 is a graph showing the number of nanoparticles per nanowell as a function of nanowell surface area, according to an embodiment of the present invention.

[0054] [Figure 11A] 10A-10C illustrate examples of using a scaffold to seed a substrate with template polynucleotides, according to aspects of the present disclosure. [Figure 11B] 10A-10C illustrate examples of using a scaffold to seed a substrate with template polynucleotides, according to aspects of the present disclosure. [Figure 11C] 10A-10C illustrate examples of using a scaffold to seed a substrate with template polynucleotides, according to aspects of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0055] References throughout this specification to "one example," "another example," "an example," etc. mean that a particular element (e.g., a feature, structure, and / or characteristic) described in connection with an example is included in at least one example described herein and may or may not be present in other examples. Furthermore, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0056] The present disclosure relates to compositions and methods for increasing monoclonal clustering during SBS. In one example, the principle of size exclusion is used to seed individual template polynucleotides, thus preventing them from clustering too close to each other. By associating each individual template polynucleotide with nanoparticles of a given sufficient spatial dimension, the template polynucleotides can be induced to bind to the surface of a substrate sufficiently far from each other, reducing the formation of polyclonal clusters and increasing the formation of monoclonal clusters. The nanoparticles can contain binding sites for the template polynucleotide. The nanoparticles can have only one single site for binding of the template polynucleotide. Thus, only one template polynucleotide can be bound to a nanoparticle, and as a result, binding of the template polynucleotide to the scaffold prevents binding of a second template polynucleotide to the same nanoparticle, and the bound template polynucleotide occupies its single template polynucleotide binding site. The binding of only a single template polynucleotide per nanoparticle, and the resulting spatial distribution of such nanoparticle-bound template polynucleotides from each other (due directly or indirectly to the size of the bound nanoparticle), reduces the formation of polyclonal clusters.

[0057] In addition to the template polynucleotide, the nanoparticles may also contain one or more other types of binding sites, referred to herein as accessory binding sites, for attaching the nanoparticles to a composition or surface. For example, in addition to a single template polynucleotide binding site, the nanoparticles may contain accessory binding sites that allow the nanoparticles to be attached to the surface of a substrate used in an SBS process. In another example, the nanoparticles may have one or more accessory binding sites for attaching one or more surface polymers to the nanoparticles. In another example, the nanoparticles may contain one or more accessory binding sites for attaching accessory oligonucleotides to the nanoparticles, where the oligonucleotides may be attached to the termini of the template polynucleotide or copies thereof as part of the clustering process, as described in more detail below. In another example, such accessory oligonucleotides may be hybridizable to oligonucleotides attached to the surface of a substrate used in an SBS process, thereby allowing nanoparticles with a single template polynucleotide attached to such a substrate surface.

[0058] The scaffold can include a single binding site for a template polynucleotide and one or more accessory sites, for example, for attachment of accessory oligonucleotides, and the single template polynucleotide binding site can be of a different chemical nature or structure from the chemical nature or structure of the accessory binding site. The single template polynucleotide binding site among all binding sites can be the only site having a chemical nature or structure designed to bind to a template polynucleotide, and the corresponding chemical nature or structure is a chemical nature or structure for binding to a template polynucleotide. In comparison, one or more accessory binding sites can have a different chemical nature or structure that is incompatible with binding or attaching to a template polynucleotide. Rather, one or more accessory binding sites can have a chemical nature or structure that is compatible with binding or attaching to other compositions or structures to which the accessory binding site is intended, such as accessory oligonucleotides, polymers, etc., but is incompatible with binding or attaching to a template polynucleotide. Thus, a template polynucleotide cannot bind or attach to more than one accessory binding site, resulting in binding of only one template polynucleotide per nanoparticle at a single template polynucleotide binding site on the nanoparticle.

[0059] The template polynucleotide can be a polynucleotide obtained from a sample, such as a polydeoxyribonucleic acid isolated from a sample, or a cDNA molecule copied from an mRNA molecule obtained from a sample. The SBS process can be performed, for example, to determine the nucleotide sequence of the template polynucleotide or to identify one or more polymorphisms or mutations in the gene sequence of the template polynucleotide compared to a reference sequence. A library can be prepared from one or more samples, and the library contains multiple template polynucleotides obtained from one or more samples. The template polynucleotide can be obtained by obtaining a polynucleotide sequence that is part of a sequence that was present in the sample or copied from the sample. By sequencing multiple template polynucleotides in the SBS process, sequence information for the multiple template polynucleotides in the library is collected for the sample from which the library was obtained, and when analyzed, sequence, genotype, or other sequence-related information for the template polynucleotides can be determined.

[0060] The template polynucleotide may be treated as part of the process of obtaining the template polynucleotide from a sample. Part of the treatment may include adding polynucleotide sequences, such as to the 5-prime, 3-prime, or both ends of the template, to aid in the subsequent SBS process. As further disclosed herein, the template polynucleotide may be further modified by adding features that facilitate or enable the formation of bonds with sites on the nanoparticles.

[0061] The template polynucleotide can be of any given length suitable for obtaining sequencing information in the SBS process. For example, the template polynucleotide may be about 50 nucleotides in length, about 75 nucleotides in length, about 100 nucleotides in length, about 125 nucleotides in length, about 150 nucleotides in length, about 175 nucleotides in length, about 200 nucleotides in length, about 225 nucleotides in length, about 250 nucleotides in length, about 275 nucleotides in length, about 300 nucleotides in length, about 325 nucleotides in length, about 350 nucleotides in length, about 375 nucleotides in length, about 400 nucleotides in length, about 425 nucleotides in length, about 450 nucleotides in length, about 475 nucleotides in length, about 500 nucleotides in length, about 525 nucleotides in length, about 550 nucleotides in length, about 575 nucleotides in length, about 600 nucleotides in length, about 625 nucleotides in length, about 650 nucleotides in length, about 675 nucleotides in length, about 700 nucleotides in length, about 725 nucleotides in length, about 750 nucleotides in length, about 775 nucleotides in length, about 800 nucleotides in length, Length of nucleotides, about 825 nucleotides, about 850 nucleotides, about 875 nucleotides, about 900 nucleotides, about 925 nucleotides, about 950 nucleotides, about 975 nucleotides, about 1,000 nucleotides, about 1,025 nucleotides, about 1,050 nucleotides, about 1,075 nucleotides, about 1,100 nucleotides, about 1,125 nucleotides, about 1,150 nucleotides, about 1,175 nucleotides The length of the polynucleotide may be about 1,200 nucleotides, about 1,225 nucleotides, about 1,250 nucleotides, about 1,275 nucleotides, about 1,300 nucleotides, about 1,325 nucleotides, about 1,350 nucleotides, about 1,375 nucleotides, about 1,400 nucleotides, about 1,425 nucleotides, about 1,450 nucleotides, about 1,475 nucleotides, about 1,500 nucleotides or more.

[0062] In some instances, there may be two or more different populations of accessory binding sites on a nanoparticle, one with one type of chemistry or structure that is compatible with binding or attaching to one population of compositions or structures, and the other with a second type of chemistry or structure that is compatible with binding or attaching to another population of compositions or structures. For example, one population of accessory sites may have a chemistry or structure that is compatible with binding to accessory oligonucleotides, such that the accessory oligonucleotides can bind to copies of template polynucleotides that participate in clustering of the template polynucleotides on the nanoparticles, as described in more detail below, while other accessory sites may have a different chemistry or structure that is compatible with binding or attaching to the surface of a substrate for performing SBS.

[0063] The nanoparticles may include a scaffold. The scaffold is a structural element of the nanoparticle's volume, depending on the desired minimum distance between template nanoparticles or the maximum density of template nanoparticles bound to the nanoparticles desired for a given application. The scaffold may include the aforementioned binding sites, such as a single template polynucleotide binding site and one or more accessory binding sites. Together, the scaffold and binding sites may comprise the nanoparticle. The scaffold may be synthesized to include, or may be synthesized to include, one or more chemical properties or structures for binding. That is, the scaffold may be synthesized or modified to include a single site for binding to the template polynucleotide and one or more additional binding sites corresponding to the accessory binding site, but with different chemical properties or structures from the single template polynucleotide binding site.

[0064] The scaffold may comprise an asymmetric polymer, with several polymer chains extending from a scaffold core that also contains different binding sites for the template polynucleotide. Linear or branched polymer chains may extend from the scaffold core, with accessory binding sites on the polymer, and another binding site with a binding chemistry orthogonal to the accessory binding site present on the scaffold core for binding to a single template polynucleotide. In one example, the scaffold may comprise a core from which an acrylamide monomer-containing heteropolymer or homopolymer extends, including an accessory binding site, and another binding site with a different binding chemistry for binding the template polynucleotide. In one example, the scaffold core may comprise attachment points for two or three linear or branched polymers.

[0065] In one example, the scaffold may comprise two or three linear or branched polymers individually likened to a scaffold core. A non-limiting example of a scaffold is represented by Formula I: [ka] wherein each X is a compound of formula II: [ka] wherein R2 is a compound of formula IIIa: [ka] wherein R 5 teeth, [ka] wherein x is an integer ranging from 1 to 2,000 and y is an integer ranging from 1 to 10,000, and the ratio of x:y may be from about 10:90 to about 1:99, z are independently H or C 1~4 alkyl, and Formula IIIb:

[0066] [ka] where R 5 teeth, [ka] wherein y is an integer ranging from 1 to 2,000, and x and z together are an integer ranging from 1 to 10,000, and the ratio of (x:y):z can be from about (85):15 to about (95):5, wherein each R z are independently H or C 1~4 alkyl, R1 contains a single template site for attaching a template polynucleotide to the scaffold, and R 4 is an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Alkenyl, optionally substituted C1-C 20 Alkynyl, optionally substituted C1-C 20 Oxaalkyl, optionally substituted C1-C 20 Thiaalkyl and optionally substituted C1-C 20 azaalkyl, and the substituents are C1 to C 20 R 3 contains an accessory site for attachment of an accessory oligonucleotide. In any of the foregoing examples, a trithiocarbonate group [ka] can be optionally substituted with a direct bond, a —CH 2 — bond, an —S- bond, an N- bond, or an —O- bond.

[0067] In another example, R2 is a group of formula IIIa [ka] where y can be 0 and x can be an integer from 1 to 2,000.

[0068] In one example, R1 is an amine-NHS ester binding site, an amine-imido ester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 -benzylcytosine binding site or a sortase coupling binding site. In specific, non-limiting examples, R1 comprises an amine group, a tetrazine group, or a dibenzocyclooctene group.

[0069] In one example, each R 3 are amine-NHS ester binding sites, amine-imidoester binding sites, amine-pentofluorophenyl ester binding sites, amine-hydroxymethylphosphine binding sites, carboxyl-carbodiimide binding sites, thiol-maleimide binding sites, thiol-haloacetyl binding sites, thiol-pyridyl disulfide binding sites, thiol-thiosulfonate binding sites, thiol-vinyl sulfone binding sites, aldehyde-hydrazide binding sites, aldehyde-alkoxyamine binding sites, aldehyde-NHS ester binding sites, hydroxy-isocyanate binding sites, azide-alkyne binding sites, azide-phosphine binding sites, trans-cyclooctene-tetrazine binding sites, norbornene-tetrazine binding sites, azide-cyclooctyne binding sites, azide-norbornene binding sites, oxime binding sites, SpyTag-SpyCatcher binding sites, SnapTag-O 6-benzylguanine binding site, CLIP tag-O 2 -benzylcytosine binding site, or a sortase coupling binding site. In a specific, non-limiting example, each R 3 contains an azido group.

[0070] In a specific, non-limiting example, the scaffold comprises the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka]

[0071] In another example, X is [ka] In another example, X may include [ka] In another example, X may include [ka] may include:

[0072] In another example, R 1 binds to a template polynucleotide, and one or more R 3 is attached to an accessory, such as an accessory oligonucleotide. In another example, the accessory oligonucleotide is attached to a nucleotide sequence that is a copy of or complementary to the template polynucleotide.

[0073] Another non-limiting example of a scaffold is represented by formula IV: [ka] wherein each X is a compound of formula V: [ka] wherein R2 is a compound of formula VIa: [ka] Formula VIb: [ka] wherein p is an integer selected from 1 to 20; R5 comprises an accessory moiety for attaching an accessory oligonucleotide; R3 is a direct bond; [ka] m is an integer from 1 to 2,000, n is an integer from 1 to 10,000, and R 1 contains a single template site for attaching a template polynucleotide to the scaffold, and R 4 is an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Alkenyl, optionally substituted C1-C 20 Alkynyl, optionally substituted C1-C 20 Oxaalkyl, optionally substituted C1-C 20 Thiaalkyl and optionally substituted C1-C 20 azaalkyl, and the substituents are C1 to C 20 R includes substitution with one or more of alkyl, double-bonded oxygen, and hydroxyl groups; 3 contains an accessory moiety for attaching an accessory oligonucleotide. In any of the foregoing examples, a trithiocarbonate group [ka] may be optionally substituted with a direct bond, a —CH 2 — bond, an —S- bond, an N- bond, or an —O- bond.

[0074] In one example, R1 is an amine-NHS ester binding site, an amine-imido ester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 -benzylcytosine binding site or a sortase coupling binding site. In another example, R1 comprises a coiled-coil binding site or an avidin-biotin binding site. In specific, non-limiting examples, R1 comprises an amine group, a tetrazine group, or a dibenzocyclooctene group.

[0075] In one example, each R5 is an amine-NHS ester binding site, an amine-imido ester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 -benzylcytosine binding site, or a sortase coupling binding site. In another example, each R5 comprises a coiled-coil binding site or an avidin-biotin binding site. In a specific, non-limiting example, each R5 comprises an azide group.

[0076] In a specific, non-limiting example, the scaffold comprises the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka]

[0077] In a specific, non-limiting example, the scaffold has the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka] wherein R6 is [ka] is selected from.

[0078] In another specific, non-limiting example, the scaffold comprises the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka]

[0079] In another specific, non-limiting example, the scaffold comprises the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka]

[0080] In another example, R 1 binds to a template polynucleotide, and one or more R 5 is attached to an accessory, such as an accessory oligonucleotide. In another example, the accessory oligonucleotide is attached to a nucleotide sequence that is a copy of or complementary to the template polynucleotide.

[0081] In another example, the scaffold core can be or can be derived from a precursor triazine molecule. A non-limiting example of a scaffold is represented by Formula IV: [ka] wherein each X is a compound of formula VIII: [ka] wherein y is an integer from 1 to 20, and R2 is a compound of formula IXa: [ka] Formula IXb: [ka] wherein p is an integer selected from 1 to 20; R5 comprises an accessory moiety for attaching an accessory oligonucleotide; R3 is a direct bond; [ka] m is an integer from 1 to 2,000, n is an integer from 1 to 10,000, and R 1 contains a single template site for attaching a template polynucleotide to the scaffold, and R 4 is an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Alkenyl, optionally substituted C1-C 20 Alkynyl, optionally substituted C1-C 20 Oxaalkyl, optionally substituted C1-C 20 Thiaalkyl and optionally substituted C1-C 20 azaalkyl, and the substituents are C1 to C 20 R includes substitution with one or more of alkyl, double-bonded oxygen, and hydroxyl groups; 3 contains an accessory moiety for attaching an accessory oligonucleotide. In any of the foregoing examples, a trithiocarbonate group [ka] may be optionally substituted with a direct bond, a —CH 2 — bond, an —S- bond, an N- bond, or an —O- bond.

[0082] In one example, R1 is an amine-NHS ester binding site, an amine-imido ester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 -benzylcytosine binding site or a sortase coupling binding site. In another example, R1 comprises a coiled-coil binding site or an avidin-biotin binding site. In specific, non-limiting examples, R1 comprises an amine group, a tetrazine group, or a dibenzocyclooctene group.

[0083] In one example, each R5 is an amine-NHS ester binding site, an amine-imido ester binding site, an amine-pentofluorophenyl ester binding site, an amine-hydroxymethylphosphine binding site, a carboxyl-carbodiimide binding site, a thiol-maleimide binding site, a thiol-haloacetyl binding site, a thiol-pyridyl disulfide binding site, a thiol-thiosulfonate binding site, a thiol-vinyl sulfone binding site, an aldehyde-hydrazide binding site, an aldehyde-alkoxyamine binding site, an aldehyde-NHS ester binding site, a hydroxy-isocyanate binding site, an azide-alkyne binding site, an azide-phosphine binding site, a transcyclooctene-tetrazine binding site, a norbornene-tetrazine binding site, an azide-cyclooctyne binding site, an azide-norbornene binding site, an oxime binding site, a SpyTag-SpyCatcher binding site, a SnapTag-O 6 -benzylguanine binding site, CLIP tag-O 2 -benzylcytosine binding site, or a sortase coupling binding site. In another example, each R5 comprises a coiled-coil binding site or an avidin-biotin binding site. In a specific, non-limiting example, each R5 comprises an azide group.

[0084] In a specific, non-limiting example, the scaffold comprises the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka]

[0085] In another specific, non-limiting example, the scaffold has the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka] wherein R6 is [ka] is selected from.

[0086] In another specific, non-limiting example, the scaffold comprises the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka]

[0087] In another specific, non-limiting example, the scaffold comprises the following structure (for simplicity of depiction, only one X is shown in full, but the other two X have the same structure as the fully shown X): [ka]

[0088] In another example, R 1 binds to a template polynucleotide, and one or more R 5 is attached to an accessory, such as an accessory oligonucleotide. In another example, the accessory oligonucleotide is attached to a nucleotide sequence that is a copy of or complementary to the template polynucleotide.

[0089] Polymer chains can be grown from the scaffold core using controlled radical polymerization (CRP) methods. Polymers can be grown from the scaffold core by reversible addition-fragmentation chain transfer (RAFT) polymerization, ATRP (atom transfer radical polymerization), or NMP (nitroxide-mediated radical polymerization). In another example, polymers can be synthesized and then attached to the scaffold core. CRP methods can involve precise control over the degree of polymerization (DP) of the polymer attached to the scaffold core, thus controlling the polymer molecular weight and nanoparticle size. For example, about 100 per strand, about 150 per strand, about 200 per strand, about 250 per strand, about 300 per strand, about 350 per strand, about 400 per strand, about 450 per strand, about 500 per strand, about 550 per strand, about 600 per strand, about 650 per strand, about 700 per strand, about 750 per strand, about 800 per strand, about 850 per strand, about 900 per strand, about 950 per strand, about 1,000 per strand, about 1,050 per strand, about 1,100 per strand, about 1,150 per chain, about 1,200 per chain, about 1,250 per chain, about 1,300 per chain, about 1,350 per chain, about 1,400 per chain, about 1,450 per chain, about 1,500 per chain, about 1,550 per chain, about 1,600 per chain, about 1,650 per chain, about 1,700 per chain, about 1,750 per chain, about 1,800 per chain, about 1,850 per chain, about 1,900 per chain, about 1,950 per chain, or about 2,000 DP per chain. In some examples, after growing a first such polymer from the scaffold core, a second such polymer can be further extended from the first polymer by the RAFT process as a "living" RAFT polymerization process.

[0090] In another example, a scaffold can include a dendron whose constitutional repeating units include lysine amino acids, where the lysine is a branch point and polymerization occurs by forming a peptide bond between the carboxylic acid of the amino acid and the α-amino group of the lysine of the immediately upstream generation, and an isopeptide bond between the ε-amino terminus of the lysine of the immediately upstream generation. Lysine thereby serves as a branch point within the dendrimer structure. In one example, the core unit of the dendrimer can include lysine. For example, the carboxylic acid of the core unit lysine can bind to a single template polynucleotide binding site, while the α-amino and ε-amino groups can branch and bind to downstream amino acids. For example, cysteine can be bound to the core lysine to provide a single thiol-templated polynucleotide binding site. In another example, other amino acids, modified amino acids, or other structures can extend from the core lysine to provide a single template polynucleotide binding site. The terminal group of the most downstream branch of the dendron can include an accessory binding site. For example, the accessory binding site can include a lysyl α-group and a lysyl ε-amino group of the terminal generation of the dendron. As used herein, the terms downstream and upstream refer to the direction along the branch chain relative to the core unit of the dendron, with upstream meaning toward the core unit and downstream meaning toward the terminal unit of the branch chain. A dendron can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more generations.

[0091] In one example, an upstream lysine is linked to two downstream lysines via its α-amino and ε-amino groups, and each such downstream lysine is in turn linked to two more lysines via the formation of peptide and epsilon peptide bonds with its α-amino and ε-amino groups, resulting in a dendron of lysine constitutional repeat units (linked to the amino group of the upstream lysine via its upstream carboxylic acid and to the two downstream lysines via their amino groups, respectively).

[0092] In another example, the scaffold can include a first polypeptide sequence that includes one or more lysine residues within the polypeptide. One or more such lysines can form an isopeptide bond to a subsequent polypeptide through its epsilon amino group and can also form a peptide bond to an adjacent amino acid within the polypeptide through its alpha amino group. Such subsequent polypeptides can also be or include one or more lysines, and the lysines of one or more such subsequent polypeptides can form an isopeptide bond to a further polypeptide through its epsilon amino group and can also form a peptide bond to an adjacent amino acid within the subsequent polypeptide through its alpha amino group. Such further polypeptides can in turn include one or more lysines that form one or more isopeptide bonds to one or more further polypeptides, and so on. Contiguous polynucleotides with consecutive lysine branch points can also be included. In this example, the scaffold includes polypeptides linked to each other in a branch formation connected at lysine residues. The first polypeptide sequence may contain or be attached to a single template polynucleotide binding site, and the final polypeptide (e.g., a next, additional, further, or subsequent polypeptide that does not include a lysine that forms an isopeptide bond to the successive polypeptide) may contain the accessory binding site of the final polypeptide (e.g., at the terminal amino group of the N-terminal amino acid, at the epsilon amino acid of a lysine of the final polypeptide, or both).

[0093] The template polynucleotide for binding to the scaffold can be any length suitable for sequencing in the SBS process, etc. For example, the template polynucleotide can be about 50 nucleotides long, about 75 nucleotides long, about 100 nucleotides long, about 125 nucleotides long, about 150 nucleotides long, about 175 nucleotides long, about 200 nucleotides long, about 225 nucleotides long, about 250 nucleotides long, about 275 nucleotides long, about 300 nucleotides long, about 325 nucleotides long, about 350 nucleotides long, about 375 nucleotides long, about 400 nucleotides long, about 425 nucleotides long, about 450 nucleotides long, about 475 nucleotides long, about 500 nucleotides long, about 525 nucleotides long, about 550 nucleotides long, about 575 nucleotides long, about 600 nucleotides long, about 625 nucleotides long, about 650 nucleotides long, The length may be about 675 nucleotides, about 700 nucleotides, about 725 nucleotides, about 750 nucleotides, about 775 nucleotides, about 800 nucleotides, about 825 nucleotides, about 850 nucleotides, about 875 nucleotides, about 900 nucleotides, about 925 nucleotides, about 950 nucleotides, about 975 nucleotides, about 1,000 nucleotides, about 1,100 nucleotides, about 1,200 nucleotides, about 1,300 nucleotides, about 1,40 nucleotides, about 1,500 nucleotides, about 1,600 nucleotides, about 1,700 nucleotides, about 1,800 nucleotides, about 1,900 nucleotides, about 2,000 nucleotides or more.

[0094] Binding of a single template polynucleotide or accessory (e.g., accessory oligonucleotide, accessory composition, or accessory structure) to a scaffold can be achieved by including moieties or structures in the scaffold and template polynucleotide or accessory that are complementary to each other, i.e., configured to covalently or non-covalently bind to each other to form a bond therebetween. They can be complementary for covalent binding or complementary for non-covalent binding. A scaffold can include a single template site having a moiety or structure that is complementary to or corresponds to a moiety or structure that binds to a template polynucleotide (a single template site). A scaffold can also include other moieties or structures that are complementary to or correspond to a moiety or structure bound to an accessory (an accessory site), or can bind to such other moieties or structures. Cross-reactivity between moieties or structures bound to a template polynucleotide and moieties or structures in an accessory site should be avoided to prevent binding of multiple template polynucleotides to a scaffold. Cross-reactivity between moieties or structures bound to an accessory and moieties or structures in a single template site should also be avoided to prevent occupation of a single template site by an accessory that prevents binding of a single template polynucleotide. In some instances, such cross-reactivity can be avoided by chemically blocking a single template site or accessory site while allowing an accessory to bind to the accessory site or a single template polynucleotide to bind to the single template site, respectively, and then unblocking the unoccupied site to allow binding of a single template polynucleotide or accessory.

[0095] A non-exclusive list of complementary binding partners is shown in Table 1. [Table 1-1] [Table 1-2] [Table 1-3]

[0096] All of the foregoing can be added to or included in the scaffolds disclosed herein for binding to a template polynucleotide or an accessory such as an accessory oligonucleotide, and the template polynucleotide or accessory can include or be modified to include complementary portions or structures of the foregoing pairs for binding to the scaffold.

[0097] Any suitable bioconjugation method for adding or forming a bond between such pairs of complementary moieties or structures can be used. The modified nucleotide can be a commercially available, proprietary example of one or other of such exemplary pairs of complementary moieties or structures, and methods for including, attaching, or incorporating one or more of such exemplary moieties or structures into polymers, nucleotides, or polynucleotides are also known. Bifunctional linker molecules are also commercially available, bearing at one end a moiety or structure from one complementary pair of binding partners listed in Table 1 and at the other end a moiety or structure from a binding partner of another complementary pair of binding partners listed in Table 1. A portion or structure of a scaffold, template polynucleotide, or an accessory portion or structure, or an oligo or peptide that binds to any of the aforementioned features to provide a portion or structure for linking any of the aforementioned features, can be attached to one end of such a linker, such that the original portion or structure is substantially replaced by another portion or structure, i.e., the portion or structure present at the other end of the linker.

[0098] The modified amino acid may be one of the examples of such a pair of complementary moieties or structures, or other commercially available proprietary examples, and methods for including or attaching one or more such examples of moieties or structures to an amino acid or polypeptide are also known. Methods for forming bonds between members of such pairs of complementary moieties or structures are also known. Thus, such complementary moieties or structures can be added to or included in the scaffold and template polynucleotide or the scaffold and accessory to form binding sites and enable binding therebetween.

[0099] As used herein, the term "polypeptide" is intended to mean a chain of amino acids linked together by peptide bonds. The terms "protein" and "polypeptide" may be used interchangeably. A polypeptide may comprise a sequence of any number of amino acids linked together by peptide bonds, where the number of amino acids may be about 2 or more, about 5 or more, about 10 or more, about 15 or more, about 20 or more, about 25 or more, about 30 or more, about 35 or more, about 40 or more, about 45 or more, about 50 or more, about 55 or more, about 60 or more, about 65 or more, about 70 or more, about 75 or more, about 80 or more, about 85 or more, about 90 or more, about 95 or more, about 100 or more, about 110 or more, about 120 or more, about 130 or more, about 140 or more, about It can be 150 or more, about 160 or more, about 170 or more, about 180 or more, about 190 or more, about 200 or more, about 225 or more, about 250 or more, about 275 or more, about 300 or more, about 325 or more, about 350 or more, about 375 or more, about 400 or more, about 425 or more, about 450 or more, about 475 or more, about 500 or more, about 550 or more, about 600 or more, about 650 or more, about 700 or more, about 750 or more, about 800 or more, about 850 or more, about 900 or more, about 950 or more, or about 1000 or more.

[0100] In some cases, polypeptides, i.e., proteins, may employ a structure or three-dimensional conformation that promotes or enables binding to another binding partner, such as another polypeptide, or other non-protein binding partner, that employs a three-dimensional conformation that promotes such binding. Polypeptides may also employ a three-dimensional conformation that promotes the performance of an enzymatic reaction on another substrate polypeptide or other molecule, or to serve as a substrate for another enzymatic or other reaction. Polypeptides may also employ a three-dimensional conformation such that sites such as the amino terminus, carboxyl terminus, side groups of an amino acid, or modifications to an amino acid, may be accessible for binding to another molecule.

[0101] A variety of bioconjugation chemistries can be used to attach the template polynucleotide to the scaffold. Chemical moieties can be included in or attached to sites capable of forming covalent conjugations with complementary chemical moieties, which can be attached to or included in the template polynucleotide. The template polynucleotide can then be conjugated to the scaffold via covalent bonds between the complementary chemical moieties.

[0102] In another example, the scaffold may comprise, or be attached to, as a single template site, a polypeptide sequence capable of forming a covalent bond to another polypeptide sequence or other chemical moiety. Such other polypeptide or other chemical moiety may then be included in or attached to the template polynucleotide such that the single template site of the scaffold and template polynucleotide can be covalently bonded to one another. Alternatively, the template polynucleotide may have a first such polypeptide sequence, and the single template site of the scaffold may have such other polypeptide sequence or other chemical moiety capable of covalently bonding to the polypeptide sequence of the template polynucleotide. Non-limiting examples of such pairs include the SpyTag / SpyCatcher system, Snaptag / O 6 -Benzylguanine-based and CLIP tag / O 2 -benzylcytosine system.

[0103] The amino acid sequences of complementary pairs of SpyTag / SpyCatcher systems and the polynucleotides encoding them may be available. Exemplary sequences are shown in Table 1. Several amino acid site mutations of the SpyTag and SpyCatcher sequences may be available for inclusion in recombinant polypeptides. Snap tag is a functional O-6-methylguanine-DNA methyltransferase, and CLIP tag is a modified version of Snap tag. Nucleotide sequences encoding Snap tag, CLIP tag, and SpyCatcher may be commercially available for subcloning and inclusion in engineered polypeptide sequences.

[0104] Alternatively, complementary pairs for covalent attachment at a single template site of the scaffold and a template polynucleotide can be covalently linked to each other via enzyme-catalyzed formation of a covalent bond. For example, a single template site of the scaffold and a template polynucleotide can contain motifs that can be covalently linked to each other by sortase-mediated coupling, e.g., an LPXTG amino acid sequence on one side and an oligoglycine nucleophilic sequence (e.g., 3-5 repeating glycans) on the other side. Sulfotase-mediated transpeptidation can then be performed to result in covalent attachment of the scaffold and template polynucleotide at the single template site.

[0105] In another example, the scaffold can include a region for non-covalent binding of a single template polynucleotide at a single template site. For example, the scaffold can include oligonucleotides for hybridizing to the ends of the template polynucleotide by Watson-Crick base pairing. In another example, the scaffold and template polynucleotide can include or be bound to complementary peptide binding sites. For example, the scaffold and template polynucleotide can include or be bound to peptide sequences that can bind to each other as a complementary pair of coiled-coil motifs. The coiled-coil motif is a structural feature of some polypeptides in which two or more polypeptide chains each form an α-helical secondary structure, and the α-helices coil together to form a tight, non-covalent bond. The coiled-coil sequence can include a heptad repeat, i.e., a repeating pattern of seven amino acids HPPHCPC (H represents a hydrophobic amino acid, C represents a typically charged amino acid, and P represents a polar, hydrophilic amino acid). An example of a heptad repeat is found in the leucine zipper coiled coil, in which the fourth amino acid of the heptad repeat is often leucine.

[0106] The scaffold may comprise or be bound to one amino acid sequence that forms part of a coiled-coil binding pair, and the template polynucleotide may be bound to another amino acid sequence that is the scaffold or is complementary to the portion that binds to the scaffold, forming the other portion of the coiled-coil binding pair, such that the two bind to each other. For example, the scaffold may be covalently bound to one amino acid sequence that forms part of a coiled-coil binding pair, and the template polynucleotide may be bound to another amino acid sequence that is the scaffold or is complementary to the portion that binds to the scaffold, forming the other portion of the coiled-coil binding pair, such that the two bind to each other.

[0107] In another example, the scaffold and template polynucleotides may each comprise or be bound to the other complementary partner of a non-covalently bound peptide pair. An example is the biotin-avidin binding pair. Biotin and avidin peptides (such as avidin, streptavidin, and neutravidin, all of which are collectively referred to herein as "avidin" unless otherwise specified) form strong non-covalent bonds with each other. One part of such a pair, whether the binding moiety is biotin or avidin, may be part of or bound to either the scaffold or template polynucleotide, and the complementary part is or is bound to the corresponding part of the scaffold or template polynucleotide, allowing non-covalent binding therebetween.

[0108] Numerous methods can be used to include or add one or more biotin moieties to DNA molecules, template polynucleotides, scaffolds, oligo-DNAs, other polypeptides, or other compositions for linking molecules together as described herein (e.g., template polynucleotide to scaffold, accessory to scaffold, etc.). For example, biotinylated nucleotides are commercially available for incorporation into DNA molecules by polymerases, and kits for adding biotin moieties to polynucleotides or polypeptides are commercially available. Biotin residues can also be added to amino acids or modified amino acids or nucleotides or modified nucleotides. The cross-linking chemistries listed in Table 1 can also be used to add biotin groups to proteins, such as carboxylic acid, amine, or thiol groups. Some biotin ligase enzymes can also be used for enzymatically targeted biotinylation, such as biotinylation of polypeptides (e.g., biotinylation of the lysine residue of the AviTag amino acid sequence GLNDIFEAQKIEWHE (SEQ ID NO: 3) contained in a polypeptide). Genetically engineered ascorbate peroxidase (APEX) can also be used to modify biotin to allow biotinylation of electron-rich amino acids such as tyrosine and, in some cases, tryptophan, cysteine, or histidine.

[0109] In another example, a polypeptide containing the amino acid sequence DSLEFIASKLA (SEQ ID NO: 4) can be biotinylated (at the more N-terminal end of the two S residues present in the sequence), which is a substrate for Sfp phosphotetenyl transferase-catalyzed covalent binding of a small molecule conjugated to coenzyme A (CoA). For example, a polypeptide containing this sequence can be biotinylated via covalent attachment to the polypeptide by a CoA-biotin conjugate. This system can also be used to attach many other types of binding moieties or structures identified in Table 1 for use in generating binding sites on scaffolds for binding to DNA molecules or polypeptides or other molecules disclosed herein. For example, CoA conjugated to any of the reactive pair moieties identified in Table 1 can be covalently attached by Sfp phosphotetenyl transferase to a polypeptide containing the sequence identified above, thereby enabling binding of another composition containing a complementary binding partner to the polypeptide.

[0110] Other enzymes can be used to add a linking moiety to a polypeptide. For example, lipoic acid ligase enzymes can add lipoic acid molecules, or modified lipoic acid molecules containing a linking moiety identified in Table 1, such as an alkyne or azide group, can be covalently attached to the side amine of a lysine residue within the amino acid sequence DEVLVEIETDKAVLEVPGGEEE (SEQ ID NO: 5) or GFEIDKVWYDLDA (SEQ ID NO: 6) contained in the polypeptide. In another example, a scaffold, template polynucleotide, or other polypeptide or DNA molecule intended to be contained therein or attached thereto may contain or be attached to an active serine hydrolase. A fluorophosphonate molecule becomes covalently attached to a serine residue in the active site of a serine hydrolase. Analogs of commercially available fluorophosphonate molecules containing a linking moiety identified in Table 1, such as an azide group or a desthiobiotin group (an analog of biotin that can bind to avidin). Thus, such groups may be used in scaffolds as disclosed herein or covalently attached to serine hydrolase enzymes contained in or attached to polypeptides or DNA molecules attached to scaffolds, and such binding moieties or structures may be covalently attached thereto by use through the attachment of modified fluorophosphonate molecules suitable for generating binding sites on such proteins for complementary binding partners from Table 1 (such as azido-alkyne, azido-phosphine, azido-cyclooctyne, azido-norbornene, or desthiobiotin-avidin linkages).

[0111] Any of the aforementioned methods of biotinylating a composition that facilitates the addition of functional groups to a polypeptide bound to a scaffold as part of a scaffold, or to an accessory or template polynucleotide as part of an accessory, to bind to a polypeptide comprising an avidin sequence (such as an avidin polypeptide contained in or bound to another composition) or otherwise to form bonds between the scaffold and the template polynucleotide or between the scaffold and the accessory, can be used to enable or facilitate bonding between components as disclosed herein.

[0112] To bind to a single template site on the scaffold, the template polynucleotide may have a complementary binding moiety or structure attached thereto. In one example, during the preparation of a library sample, multiple template polynucleotides may be prepared for sequencing. Generally, during such sample preparation, the template polynucleotides of the library sample are modified to contain specific nucleotide sequences in addition to the sequences already included as part of the library to be sequenced. Such added nucleotide sequences may serve any of a variety of functions, such as subsequent identification of the template polynucleotide as part of the seeding process or binding to the surface of the SBS substrate. According to the present disclosure, such preparations of template polynucleotides may also include complementary binding moieties or structures attached thereto or included therein.

[0113] For example, preparation of a template polynucleotide can include the attachment of a nucleotide sequence within the template polynucleotide, such as extending from one of its ends, that is complementary to another sequence contained within or attached to a single template site of the scaffold. Hybridization via Watson-Crick base pairing results in binding between the two. In another example, an accessory, such as an accessory oligonucleotide, can be modified to allow covalent attachment of a moiety or structure complementary to the accessory to the accessory. For example, modifications to a nucleotide contained in an accessory, such as an accessory oligonucleotide, such as a phosphate group, base, or sugar, can be included to provide a site for covalent attachment to the accessory site of the scaffold. The accessory site of the scaffold can then contain a complementary moiety or structure that allows attachment to an accessory, such as an oligo-DNA accessory. In one example, a polynucleotide sequence added to a template polynucleotide during sample preparation is modified to include a binding moiety that includes the complementary portion of the accessory binding site of the scaffold. Many modified nucleotides bearing such chemical moieties are commercially available for covalent attachment of compositions to DNA molecules incorporating such modified nucleotides.

[0114] In another example, a template polynucleotide can be modified, such as during sample preparation, by conjugation to a polypeptide. Such a polypeptide can have an amino acid sequence and / or structure that is complementary to the amino acid structure of a single template site of a scaffold, such that the template polynucleotide can bind to the single template site of a scaffold via its conjugated polypeptide. Examples of polypeptide pairs for covalent or non-covalent binding between a single template site of a scaffold and a template polynucleotide are provided above, and non-limiting examples include an alpha-helical amino acid sequence with heptad repeats to form a coiled-coil bond with each other, a biotin-avidin binding pair, a SpyTag / SpyCatcher system, and an LPXTG / oligoglycine nucleophile pair for sortase-mediated transpeptidation binding. In another example, a template polynucleotide can be modified, such as during sample preparation, by conjugating a Snap tag sequence or O 6 -benzylguanine, and the single template site of the scaffold contains the other of the two, to provide a Snap tag / O 6 In another example, the template polynucleotide may be modified during sample preparation with a CLIP tag sequence or an O-benzylguanine system, allowing for covalent bonding between the two. 2 -benzylguanine, and the single template site of the scaffold contains the other of the two, 2 -Benzylguanine-based and CLIP tag / O 2 -benzylcytosine system, which allows for covalent bonding between the two.

[0115] All of the above examples can be similarly used to attach one or more accessories to one or more accessory sites on a scaffold. For attachment to the accessory site of a DNA or polypeptide scaffold, the accessory (such as an accessory oligo DNA) can have a complementary binding moiety or structure attached thereto. In one example, a nucleotide sequence can be included in or attached to the accessory, or can include a complementary binding moiety or structure attached to or included in the accessory.

[0116] In another example, an accessory (such as an accessory oligo DNA) can comprise a nucleotide sequence, or in the case of an accessory oligo DNA, can be attached to a nucleotide sequence, such as extending from one of its ends, that is complementary to another sequence contained in or attached to the accessory site of the scaffold. Watson-Crick base pairing between the complementary sequences results in hybridization and binding between the two, and thus binding of the accessory to the accessory binding site. In another example, the accessory can include a covalent modification to enable covalent attachment of a moiety or structure complementary to the accessory. For example, modifications to a nucleotide contained in a template polynucleotide, such as a phosphate group, base, or sugar, can be included to provide a site for covalent attachment to the accessory site of the scaffold. The accessory site of the scaffold can then include a complementary moiety or structure that allows binding to an accessory, such as an oligo DNA accessory. In one example, the accessory portion of the scaffold accessory binding site is a nucleotide modified to include a binding moiety, which can be added to an accessory, such as an accessory oligo DNA, or included in a polynucleotide sequence contained in the accessory to enable binding therebetween. Many modified nucleotides bearing such chemical moieties are commercially available for covalent attachment of the composition to a DNA molecule into which such modified nucleotides are incorporated.

[0117] In another example, an accessory moiety can be modified by conjugation to a polypeptide. Such a polypeptide can have an amino acid sequence and structure that is complementary to the amino acid structure of the accessory moiety of the scaffold, such that the accessory can bind to the accessory moiety of the scaffold via its conjugated polypeptide. Examples of polypeptide pairs for covalent or non-covalent binding between the accessory moiety and the accessory are provided above, and non-limiting examples include alpha-helical amino acid sequences with heptad repeats to form coiled-coil bonds with each other, biotin-avidin binding pairs, SpyTag / SpyCatcher systems, and LPXTG / oligoglycine nucleophilic pairs for sortase-mediated transpeptidation binding. In another example, an accessory, such as an accessory oligo-DNA, can be conjugated to a Snap tag sequence or O 6 -benzylguanine, and the accessory site of the scaffold contains the other of the two, 6 In another example, the accessory may be a CLIP tag sequence or an O-benzylguanine system, which allows for a covalent bond between the two. 2 -benzylguanine, and the accessory site of the scaffold contains the other of the two, 2 -benzylguanine system, which may allow for covalent bonding between the two.

[0118] In one example, a single template polynucleotide can be bound to a single template site on a scaffold, and multiple accessory nucleotides, such as accessory oligo-DNA molecules, can be bound to the accessory sites on the scaffold. An example of such an oligo-DNA molecule can be a primer for clustering on the scaffold. As part of a conventional clustering process, copies of the template polynucleotide or its complement are generated on the surface of a substrate. As described above, in some examples, such surface clustering can undesirably result in the formation of one or more polyclonal clusters. As disclosed herein, clustering can be performed on the scaffold, such as in solution, without first binding the scaffold to a surface. In another example, a scaffold with a single template polynucleotide bound thereto can be bound to the surface of a substrate, and then clustering can be performed on the surface of the substrate, on the scaffold, or on the scaffold and the surface of the substrate.

[0119] In the case of a clustering procedure, a template polynucleotide may be modified, such as during sample preparation, to include one or more nucleotide sequences at one or both of its 3-prime and 5-prime ends. Copies of the template nucleotide and nucleotide sequences complementary to the template nucleotide may then be synthesized on a scaffold as disclosed herein to form a cluster. Such clustering on a scaffold may result in the formation of monoclonal clusters.

[0120] For example, a template polynucleotide can bind to a single template binding site, with its 5-prime end oriented toward the scaffold and its 3-prime end oriented away from the binding site toward the scaffold. The 3-prime end can contain a nucleotide sequence complementary to a nucleotide sequence contained in a first primer. A "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA or single-stranded RNA) that serves as a starting point for DNA or RNA synthesis. Primers can be any number of bases in length and can contain various non-natural nucleotides. In examples, primers are short strands ranging from 20 to 40 bases or 10 to 20 bases. The copy of the primer complementary to the 3-prime end of the template polynucleotide can further bind to an accessory site on the scaffold.

[0121] A polymerization reaction can then be performed in which the 3-prime end of the template polynucleotide hybridizes to a first primer attached to the scaffold that is complementary to the 3-prime end via Watson-Crick base pairing. A polymerase in the polymerization reaction can generate a nascent strand complementary to the template polynucleotide attached to the scaffold, starting from the primer attached to the scaffold to which the 3-prime end of the template polynucleotide hybridizes. The template polynucleotide and its complement can then be dehybridized.

[0122] The complement of the template polynucleotide at the 3-prime end of the complement can contain a nucleotide sequence complementary to the second primer sequence. A copy of the second primer complementary to the 3-prime end of the complement of the template polynucleotide can further bind to the accessory site of the scaffold. A second polymerization reaction can then be carried out in which the 3-prime end of the template polynucleotide hybridizes to a first primer attached to the scaffold that is complementary to the 3-prime end via Watson-Crick base pairing, and the 3-prime end of the complement of the template polynucleotide hybridizes to a second primer attached to the scaffold that is complementary to the 3-prime end via Watson-Crick base pairing. The polymerase in the second polymerization reaction can generate another nascent strand complementary to the template polynucleotide attached to the scaffold, starting from the first primer attached to the scaffold to which the 3-prime end of the template polynucleotide hybridizes. Additionally, the polymerase in the second polymerization reaction may generate additional copies of the nascent strand of the template polynucleotide, initiated from a primer bound to the scaffold, which, upon binding to the scaffold, hybridizes with the 3-prime end of the complement of the template polymerized in the previous polymerization reaction. The template polynucleotide and its copy and its complement may then be dehybridized.

[0123] Subsequent polymerization reactions can then be carried out in an iterative process. The 3-prime ends of the scaffold-bound template polynucleotide and its copy hybridize to a scaffold-bound first primer, and the 3-prime ends of the scaffold-bound complement of the template polynucleotide hybridize to a scaffold-bound second primer. Nascent strands are polymerized by a polymerase initiated at the scaffold-bound first and second primers to which the scaffold-bound template polynucleotide and its complement and their copies are hybridized. Following dehybridization of the polymerized strands, successive polymerization reactions are carried out, thereby increasing the copy number of the template polynucleotide and its complement binding to the scaffold. In this way, the copy and complement of the template polynucleotide are amplified, and the amplified copies bind to the scaffold, forming clusters. As disclosed herein, this clustering process can be carried out on the scaffold, such as in solution, in contrast to conventional clustering, which is carried out on the surface of a substrate in a conventional SBS process. Monoclonal clusters are present on the scaffold because there are copies of only a single template polynucleotide and its complement clustered on the scaffold.

[0124] In an example where a sequence at or attached to the 5-prime end of a template polynucleotide binds to a single template site and the 3-prime end of the template polynucleotide is oriented away from the scaffold, the template polynucleotide can bind to the single template site of the scaffold by hybridization to a primer sequence attached to or part of the single template site, referred to as a template site primer. In one example, a template polynucleotide prepared by a sample preparation process can have a nucleotide sequence complementary to the template site primer at or attached to the 5-prime end. When such a nucleotide sequence complementary to the template site primer is made 3-prime, the template polynucleotide can contain a nucleotide sequence corresponding to the nucleotide sequence of the second primer described above (the second primer is a primer attached to the scaffold to which the 3-prime end of its complement to the template polynucleotide can hybridize by complementary Watson-Crick base pairing). Including such a sequence in the template polynucleotide means that the complement of the template polynucleotide synthesized during the polymerization step has a polynucleotide sequence toward its 3-prime end that is complementary to the sequence of such a second primer. Having such a sequence toward the 3-prime end of the complement of the template polynucleotide allows hybridization of the 3-prime end of the complement of such a second primer during the subsequent polymerization reaction during clustering.

[0125] At the 3-prime end of the template polynucleotide, the template polynucleotide, oriented away from the 5-prime end of the template polynucleotide bound to a single template site, may contain a sequence complementary to the first primer as described above. As described above, during the first polymerization step, such a nucleotide sequence at the 3-prime end of the template polynucleotide may hybridize to the first primer, followed by polymerization of the nascent complement of the template polynucleotide. It may be advantageous for there to be a break in the polymerization of the complement of the template polynucleotide between the portion of the template polynucleotide hybridized to the template site primer and the nucleotide sequence located at 3-prime in the template polynucleotide containing the sequence of the second primer. That is, it may be advantageous for the complement of the template polynucleotide to have a sequence complementary to the second primer at its 3-prime end. However, if there is no break in polymerization after adding a nucleotide sequence complementary to the sequence corresponding to the second primer to the nascent complement of the template polynucleotide, the 3-prime end of the complement of the template polynucleotide will not terminate there.

[0126] For example, if the nucleotide sequence complementary to the template site primer is 5-prime to and contiguous with the sequence complementary to the second primer, the 3-prime end of the synthetic complement of the template polynucleotide may contain the nucleotide sequence contained in the template site primer. For example, when polymerizing the complement of the template polynucleotide, the DNA polymerase may remove the template site primer from hybridization to the 5-prime end of the template polynucleotide and polymerize the addition of its corresponding nucleotide sequence to the 3-prime end of the complement of the template polynucleotide. This result may be undesirable if it impairs the ability of the accessory site at the 3-prime end of the complement of the template polynucleotide to hybridize to the second primer.

[0127] Thus, in one example, it may be desirable to incorporate a 3-prime polymerization interruption into the 5-prime end of a template polynucleotide, where the 5-prime end of the template nucleotide is attached to a single template site by hybridization to a template site primer. For example, a linker, such as a PEG linker, alkyl linker, or other chemical moiety, can be included to connect the nucleotide sequence that hybridizes to the template site primer to the 5-prime end of the template polynucleotide. The presence of such a linker, rather than connecting a contiguous nucleotide sequence, prevents the polymerase from adding a nucleotide sequence corresponding to the template site primer to the 3-prime end of the complement of the template polynucleotide, which will instead terminate with a nucleotide sequence complementary to the nucleotide sequence of the second primer, as desired.

[0128] In another example, the template polynucleotide may have a polynucleotide sequence at or attached to the 3-prime end of the template polynucleotide that is complementary to a primer that is part of or attached to a single template site of the scaffold, referred to as the template site primer. Hybridization of such a sequence at or attached to the 3-prime end of the template polynucleotide to the template site primer can be followed by a polymerization process in which a DNA polymerase polymerizes the formation of a nascent polynucleotide complementary to the template polynucleotide, starting from the template site primer. The template polynucleotide is then dehybridized from its scaffold-bound complement to the template polynucleotide. The 3-prime end of the scaffold-bound complement of the template polynucleotide, oriented away from the scaffold-bound site, can contain a nucleotide sequence complementary to the second primer sequence described above (the second primer is a scaffold-bound primer to which the 3-prime end of the template polynucleotide complement can hybridize by complementary Watson-Crick base pairing). A copy of a second primer complementary to the 3-prime end of the complement of the template polynucleotide may further bind to the accessory site of the scaffold. A second polymerization reaction may then be performed in which the 3-prime end of the complement of the template polynucleotide hybridizes to the scaffold-bound second primer complementary to the 3-prime end via Watson-Crick base pairing. The polymerase in the second polymerization reaction may generate a copy of a nascent strand of the template polynucleotide (i.e., a complement of the complement of the scaffold-bound template polynucleotide) initiated from the scaffold-bound second primer to which the 3-prime end of the complement of the template polymerized in the previous polymerization reaction is hybridized. A dehybridization step may then be performed to dehybridize the scaffold-bound complement of the template polynucleotide and the copy of the template polynucleotide from each other.

[0129] The template polynucleotide copy at the 3-prime end of the copy may contain a nucleotide sequence complementary to the first primer sequence. The copy of the first primer complementary to the 3-prime end of the template polynucleotide copy may further bind to the accessory site of the scaffold. A third polymerization reaction may then be performed in which the 3-prime end of the template polynucleotide copy hybridizes to the first primer attached to the scaffold, which is complementary to the 3-prime end, via Watson-Crick base pairing, and the 3-prime end of the complement of the template polynucleotide hybridizes to the second primer attached to the scaffold, which is complementary to the 3-prime end, via Watson-Crick base pairing. The polymerase in the third polymerization reaction may generate another nascent strand complement of the template polynucleotide, starting from the first primer attached to the scaffold, to which the 3-prime end of the template polynucleotide is hybridized, upon binding to the scaffold. The polymerase in the third polymerization reaction may also generate additional copies of the nascent strand of the template polynucleotide, initiated from a second primer attached to the scaffold, to which the 3-prime end of the complement of the template polymerized in the previous polymerization reaction is hybridized. A dehybridization step may then be performed to dehybridize the copy of the template polynucleotide and the complement of the template polynucleotide from each other.

[0130] Subsequent polymerization reactions can then be carried out in an iterative process. The 3-prime ends of the scaffold-bound template polynucleotide copies hybridize to a scaffold-bound first primer, which is complementary thereto, and the 3-prime ends of the scaffold-bound template polynucleotide complements hybridize to a scaffold-bound second primer, which is complementary thereto. Nascent strands are polymerized by a polymerase initiated at the scaffold-bound template polynucleotide and its complement and the scaffold-bound first and second primers to which these copies are hybridized. Dehybridization of the strands is carried out after polymerization, followed by a continuous polymerization reaction and further dehybridization. In this way, the template polynucleotide copies and complements are amplified, and the amplified copies and complements are bound to the scaffold to form clusters. As disclosed herein, this clustering process can be carried out on the scaffold, such as in solution, in contrast to conventional clustering, which is carried out on the surface of a substrate in conventional SBS processes. Monoclonal clusters are present on the scaffold because there are copies of only a single template polynucleotide and its complement clustered on the scaffold.

[0131] In one example, an end of the template polynucleotide contains or is bound to a nucleotide sequence that is complementary to a nucleotide sequence contained in or bound to a single template site of the scaffold, referred to as a third template site primer. In one example, the complement of the template polynucleotide can be synthesized on the scaffold starting at the third template site primer.

[0132] In an example of clustering on a scaffold as disclosed herein, a template polynucleotide can be bound to a single template site on the scaffold according to any of the various covalent or non-covalent bonds disclosed herein. For example, either end of the template polynucleotide can contain a portion or structure from a binding site pair as identified in Table 1, and the complementary portion or structure of the same pair can be present on a single template site on the scaffold. Several successive polymerizations can then follow, as described above. For example, the 3-prime end of a template polynucleotide bound to a single template site on the scaffold facing or at the 5-prime end of the template polynucleotide can be hybridized to its complement synthesized by an oligonucleotide primer bound to an accessory site on the scaffold and a DNA polymerase. Several successive polymerizations can then follow, as described above, resulting in the polymerization of multiple copies of the template polynucleotide and its complement arising from the accessory site on the scaffold. Because only a single template polynucleotide is bound to the scaffold and the scaffold has only a single template polynucleotide site, these copies will constitute a monoclonal cluster on the scaffold.

[0133] In another example, the scaffold can be attached to the surface of a substrate, such as the surface of a substrate used in an SBS procedure. For example, the accessory site of the scaffold can include, be, or be attached to a site that binds to the surface of the substrate, or a composition that binds to the surface of the substrate. In one example, the surface of the substrate can be attached to a primer, such as, for example, a copy of a primer complementary to the first or second primer described above, or both, as a non-limiting example. Such complementary primers can be attached directly to the surface of the substrate, or to a modified surface, such as a surface to which a polymer molecule (e.g., PAZAM or related polymer) is attached and the primers are bound to such a polymer. The aforementioned first and second primers can be attached to the accessory site of the scaffold (either directly or via a polymer, such as, for example, PAZAM or other PAZAM-like polymers as disclosed above, or a spacer or other composition). The first and second primers of such a scaffold, or the first and second primers attached to the scaffold, can hybridize to their complementary primers upon attachment to the surface of the substrate, thereby attaching the scaffold to the surface of the substrate.

[0134] The first primer and the second primer can be exemplified by the primers used in existing SBS processes.Specific examples of suitable primers include the P5 and / or P7 primers used on the surface of the commercially available flow cell sold by Illumina Inc. for sequencing on HiSeq™, HiSeqX™, MiSeq™, MiSeqDX™, MiNISeq™, NextSeq™, NextSeqDX™, NovaSeq™, Genome Analyzer™, ISEQ™ and other instrument platforms. Furthermore, a portion of the template polynucleotide containing a nucleotide sequence corresponding to or complementary to the first or second primer described above may have a sequence corresponding to or complementary to, for example, a P5 primer (such as the nucleotide sequence of AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 7)), a P7 primer (such as the nucleotide sequence of CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 8)), or both, according to the primer sequences used in the above-described SBS platform or the like.

[0135] Substrates for SBS processes can include, by way of non-limiting example, substrates used in any of the aforementioned SBS platforms. As a non-limiting example, such a substrate can be a flow cell. As used herein, the term "flow cell" is intended to mean a container having a chamber (i.e., a flow channel) in which a reaction can occur, an inlet for delivering reagents to the chamber, and an outlet for removing reagents from the chamber. In some examples, the chamber allows for detection of a reaction or signal occurring within the chamber. For example, the chamber can include one or more transparent surfaces that allow for optical detection within the chamber of an array, optically labeled molecules, or the like. As used herein, a "flow channel" or "flow channel region" can be a region defined between two coupled components that can selectively receive a liquid sample. In some examples, the flow channel can be defined between a patterned support and a lid and, therefore, can be in fluid communication with one or more recesses defined in the patterned support. In other examples, the flow channel can be defined between an unpatterned support and a lid.

[0136] As used herein, the term "recess" refers to a discrete, concave feature in a patterned support having a surface opening that is completely surrounded by a gap region of the surface of the patterned support. The recess can have a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, or a star (with any number of vertices). The cross section of the recess taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, or the like. By way of example, the recess can be a well. Also, as used herein, a "functionalized recess" refers to a discrete, concave feature to which a primer is attached, and in some instances, a polymer (such as Pazam or a similar polymer) is attached to the surface of the recess.

[0137] The term "support" or "substrate" of a flow cell refers to a support or substrate to which surface chemistries can be applied. The term "patterned substrate" refers to a support having recesses defined therein or thereon. The term "unpatterned substrate" refers to a substantially planar support. A substrate may also be referred to herein as a "support," a "patterned support," or an "unpatterned support." The support may be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The support is generally rigid and insoluble in aqueous liquids. The support may be inert to chemicals used to modify the recesses. For example, the support may be inert to chemicals used to form a polymer coating layer, bond a primer to a deposited polymer layer, etc. Examples of suitable supports include epoxy siloxanes, glass and modified or functionalized glass, polyhedral oligomeric silsequioxanes (POSS) and their derivatives, plastics (such as polystyrene and copolymers of acrylics, styrenes and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefin / cycloolefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon, ceramic / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped P+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (TaO5) or other tantalum oxides (TaO x), hafnium oxide (HaO2), carbon, metal, inorganic glass, etc. The support may also be glass, or silicon, or a silicon-based polymer, such as a POSS material, optionally having a coating layer of tantalum oxide or another ceramic oxide on the surface. The POSS material may be one disclosed in Kejagoas et al., Microelectronic Engineering 86 (2009) 776-668, which is incorporated herein by reference in its entirety.

[0138] In one example, the recesses can be wells, such that the patterned substrate includes an array of wells on its surface. The wells can be microwells or nanowells. The size of each well can be characterized by its volume, well opening area, depth, and / or diameter.

[0139] Each well can have any volume capable of confining liquid. The minimum or maximum volume can be selected to accommodate, for example, the expected throughput (e.g., multiplexing), resolution, analyte composition, or analyte reactivity for downstream use of the flow cell. For example, the volume can be at least about 1×10 -3 μm 3 , about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , about 100μm 3 Alternatively or additionally, the volume may be at most about 1×10 4 μm 3 , about 1×10 3 μm 3 , about 100μm 3 , about 10μm 3 , about 1μm 3 , about 0.1μm 3 , or even less.

[0140] The area occupied by each well opening can be selected based on criteria similar to the well volume described above. For example, the area of each well opening on the surface should be at least about 1×10 -3 μm 2 , about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , about 10μm 2 , about 100μm 2 Alternatively or additionally, the area may be at most about 1×10 3 μm 2 , about 100μm 2 , about 10μm 2 , about 1μm 2 , about 0.1μm 2 , about 1×10 -2 μm 2 The area occupied by each well opening can be greater than, less than, or in between the above values.

[0141] The depth of each well can be at least about 0.1 μm, about 1 μm, about 10 μm, about 100 μm, or more. Alternatively, or in addition, the depth can be at most about 1×10 3 The depth of each well 14' may be greater than, less than, or between the above values.

[0142] In some cases, the diameter of each well can be at least about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, about 100 μm, or more. Alternatively, or in addition, the diameter can be at most about 1×10 3The diameter can be about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 900 nm, about 950 nm, about 1 μm, about 1.25 μm, about 1.5 μm, about 1.74 μm, about 2 μm, about 2.25 μm, about 2.5 μm, about 2.75 μm, about 3 μm, about 3.25 μm, about 3 μm, about 3.25 μm, about 3 μm, about 3.5 ... The diameter of each well may be greater than, less than, or between the above values. As used herein, the term nanowell refers to a well having a circular opening with a maximum diameter of about 1 μm or less.

[0143] Ranges provided herein should be understood to include the stated range and any value or subrange within the stated range. For example, a range of about 100 mm to about 1 μm (1000 nm) should be interpreted to include not only the explicitly recited limits of about 100 mm to about 1 μm, but also individual values such as about 708 nm, about 945.5 nm, and subranges such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Furthermore, when "about" and / or "substantially" are used to describe values, these are meant to encompass slight variations (up to ±10%) from the stated value.

[0144] In one example, nanoparticles can be sized so that their presence in a well, such as a nanowell, occupies most of the well's volume, preventing other nanoparticles from fully occupying the well at the same time. The size of nanoparticles can be designed or determined by reference to the known size of wells on the surface of a substrate so that they can enter wells where no other nanoparticles are present, but cannot enter wells due to the presence of other nanoparticles that have previously entered the well. Nanoparticles sized so that more than one nanoparticle cannot fit into a well can promote monoclonality of clusters within the well. For example, in a conventional SBS process, template polynucleotides can be introduced into a flow cell patterned with wells in a solution at a concentration calibrated to maximize the number of wells seeded with the template polynucleotide (i.e., bound directly to a well-bound primer or via a surface-bound polymer that is complementary to a partial nucleotide sequence of the template polynucleotide) while minimizing the formation of polyclonal clusters.

[0145] In one example, a flow cell can include nanoscale regions that are not recesses or nanowells, or otherwise spatially isolated regions, referred to herein as nanopads, to which template polynucleotides or scaffolds can be attached or seeded. In some examples, the flow cell surface includes nanopads separated from one another by areas of the surface to which template polynucleotides or scaffolds cannot be attached. The nanopads can be spaced apart to promote the formation of monoclonal clusters. For example, nanopads can be spaced apart so that a cluster formed in one nanopad seeded with a single template polynucleotide is sufficiently separated from another such nanopad seeded with only one template polynucleotide. However, it can be difficult to prevent a nanopad from being seeded with more than one template polynucleotide, resulting in the formation of more than one polyclonal cluster. In examples disclosed herein, nanoparticles can promote the formation of monoclonal clusters, favoring polyclonal clusters, by preventing the seeding or binding of more than one template polynucleotide within a given nanopad. For example, the size of the nanoparticles may be such that there are insufficient locations on the nanopad for more than one nanoparticle to bind, and the template polynucleotide binds to a single template polynucleotide site on the scaffold.

[0146] In some cases, polyclonal clusters may occur when two or more template polynucleotides with different nucleotide sequences bind to or seed each other in the same cell. Molecules may be distributed into wells based on their concentration in the applied solution according to a Poisson distribution (according to which there is a balance between minimizing the number of unoccupied wells and minimizing the number of wells occupied by multiple heterologous template polynucleotides (to increase the efficiency of SBS runs)). The difference between the minimum well size and the size of the template polynucleotide (e.g., the diameter of a B-DNA molecule is approximately 2 mm) may lead to the selection of either a concentration that does not use too much substrate surface, such as the surface within the well, as is available or desirable, or a concentration that leads to the formation of undesirable or undesirably large numbers of polyclonal clusters.

[0147] As disclosed herein, template polynucleotides are bound to nanoparticles, one template polynucleotide per nanoparticle. Nanoparticles can be sized so that they can enter wells of a flow cell where other nanoparticles are not already present, but cannot enter wells of a flow cell where other nanoparticles are already present. Clustering, such as monoclonal clustering, can occur on the nanoparticles before they enter the well, resulting in monoclonal clusters present in the well. Alternatively, template polynucleotides can be bound to template sites on nanoparticles, and the nanoparticles enter and bind to the well (e.g., by attachment to the surface of an accessory site or modification to the surface of the well), thereby seeding the well with only a single nanoparticle; clustering then proceeds within the well, resulting in monoclonal clusters present in the well. In some instances, some degree of clustering can occur on the nanoparticles before they enter the well, and further clustering can occur after the nanoparticles enter the well. All such instances include instances in which monoclonal clusters are formed in the well. Additionally, reducing or minimizing the size of the nanoparticles, or in one example, adjusting the size of the nanoparticles so that there are no more than two nanoparticles in one well at the same time, can reduce, minimize, or in one example, eliminate the formation of polyclonal clusters.

[0148] Nanoparticle size can be adjusted by modifying the size of the scaffold, modifying the size of the accessory attached to the accessory moiety, such as the attached polymer, or both. Nanoparticle size can also be modified by the amount of clustering that occurs or does not occur on the nanoparticle, such as by modifying the number of sites on the nanoparticle to which copies and complements of the template polynucleotide can bind during several rounds of polymerization during clustering; fewer such sites may lower the upper limit of nanoparticle size, while more such sites may increase the upper limit of nanoparticle size. Multiple rounds of polymerization during clustering can also change nanoparticle size; more rounds may increase the number of copies and complements of the template polynucleotide attached to the nanoparticle, thus increasing its upper limit of size, while fewer rounds may decrease the number of copies and complements of the template polynucleotide attached to the nanoparticle, thus decreasing its upper limit of size. The size of the nanoparticle can be determined according to its size before and after clustering occurs on the scaffold.

[0149] As used herein, the term "nanoparticle" is intended to mean a particle having a maximum dimension up to about 1,000 nm in size. Depending on the geometric shape, the dimension may refer to length, width, height, diameter, etc. Although "diameter" is generally used herein to describe a dimension by way of example, the nanoparticles described herein need not be spherical or circular. The nanoparticles disclosed herein may have a diameter of about 2 nm, about 5 nm, about 7 nm, about 10 nm, about 12 nm, about 15 nm, about 17 nm, about 20 nm, about 22 nm, about 25 nm, about 27 nm, about 30 nm, about 32 nm, about 35 nm, about 40 nm, about 42 nm, about 45 nm, about 47 nm, about 50 nm, about 52 nm, about 55 nm, about 57 nm, about 60 nm, about 62 nm, about 65 nm, about 67 nm, about 70 nm, about 72 nm, about 75 nm, about 77 nm, about 80 nm, about 82 nm, about 85 nm, about 87 nm, about 90 nm, about 92 nm, about 95 nm, about 97 nm, about 100 nm, about 125 nm, about The diameter may be 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1,000 nm. The diameter of nanoparticles is measured by dynamic light scattering (DLS), also known as quasi-elastic light scattering, and is expressed as twice the hydrodynamic radius (Rh), and can be determined with a DLS system or other systems that include DLS and other functionalities (e.g., ZETASIZER®, Malvern Instruments Limited).

[0150] The nanoparticles disclosed herein may have a particle size of about 2 nm to about 10 nm, about 5 nm to about 15 nm, about 7 nm to about 20 nm, about 10 nm to about 25 nm, about 15 nm to about 30 nm, about 20 nm to about 50 nm, about 40 nm to about 60 nm, about 50 nm to about 75 nm, about 60 nm to about 100 nm, about 70 nm to about 100 nm, about 75 nm to about 100 nm, about 80 nm to about 110 nm, about 90 nm to about 130 nm, about 100 nm to about 150 nm, about 100 nm to about 200 nm, about 150 nm to about 225 nm, about 200 nm to about 250 nm, about 200 nm to about 300 nm, about 300 nm to about 400 nm, about 350 nm to about 450 nm, about 350 nm to about 400 nm, about 350 nm to about 5 ... Approx. 300nm, approx. 225nm ~ approx. 275nm, approx. 250nm ~ approx. 300nm, approx. 275nm ~ approx. 325nm, approx. 300nm ~ approx. 40 0nm, about 300nm to about 350nm, about 325nm to about 375nm, about 350nm to about 400nm, about 375nm to about 425nm , about 400nm to about 500nm, about 400nm to about 450nm, about 425nm to about 475nm, about 450nm to about 500nm, about 4 75nm ~ approx. 525nm, approx. 500nm ~ approx. 600nm, approx. 500nm ~ approx. 550nm, approx. 525nm ~ approx. 575nm, approx. 550nm ~600nm, approximately 575nm ~ approximately 625nm, approximately 600nm ~ approximately 700nm, approximately 600nm ~ approximately 625nm, approximately 625nm ~ approximately 6 75nm, about 650nm to about 700nm, about 675nm to about 725nm, about 700nm to about 800nm, about 700nm to about 725n m, about 725nm to about 775nm, about 750nm to about 800nm, about 775nm to about 825nm, about 800nm to about 900nm, about 800nm to about 850nm, about 825nm to about 875nm, about 850nm to about 900nm, about 875nm to about 925nm, about 900n The diameter may be within the range of about 1,000 nm, about 900 nm to about 950 nm, about 925 nm to about 975 nm, about 950 nm to about 1,000 nm, about 300 nm to about 450 nm, about 350 nm to about 500 nm, about 400 nm to about 550 nm, about 450 nm to about 600 nm, about 500 nm to about 650 nm, about 550 nm to about 700 nm, about 600 nm to about 750 nm, about 650 nm to about 800 nm, about 700 nm to about 850 nm, about 750 nm to about 900 nm, about 800 nm to about 950 nm, or about 850 nm to about 1,000 nm.

[0151] For convenience and clarity, certain terms employed in the specification, examples, and claims are described here.

[0152] "Acrylate groups" include salts, esters, and conjugate bases of acrylic acid and its derivatives (e.g., methacrylic acid). An acrylate ion has the molecular formula CH2=CHCOO - It has.

[0153] "Acrylamide monomer" has the structure [ka] or a substituted analog thereof (e.g., methacrylamide or N-isopropylacrylamide). An example of a monomer containing an acrylamide group and an azide group is azidoacetamidopentylacrylamide. [ka] is.

[0154] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group can have from 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. Examples include the notation "C 1~4 "Alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0155] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. Alkenyl groups can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0156] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. Alkynyl groups can have 2 to 20 carbon atoms.

[0157] Alkoxy or alkoxyl refers to groups of 1 to 20 carbon atoms, such as 1 to 10 carbon atoms, such as 1 to 6 carbon atoms, in a straight or branched configuration attached to the parent structure through an oxygen. Examples include methoxy, ethoxy, propoxy, isopropoxy, and the like.

[0158] Oxaalkyl refers to an alkyl residue in which one or more carbons (and their associated hydrogens) have been replaced by oxygen. Examples include methoxypropoxy, 3,6,9-trioxadecyl, and the like. The term oxaalkyl refers to compounds in which the oxygen is attached to its adjacent atom through a single bond (forming an ether bond), not a double-bonded oxygen, as in a carbonyl group. Similarly, thiaalkyl and azaalkyl refer to alkyl residues in which one or more carbons have been replaced by sulfur or nitrogen, respectively. Examples of azaalkyl include ethylaminoethyl and aminohexyl.

[0159] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When aryl is a ring system, all rings in the system are aromatic. Aryl groups can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0160] As used herein, the term "linked" refers to the state of two things being joined, fixed, adhered, connected, or bound to one another, either covalently or non-covalently (e.g., by hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic and hydrophobic interactions). For example, a nucleic acid can be bound to a functionalized polymer by covalent or non-covalent bonds.

[0161] An "azide" or "azido" functional group refers to an -N3.

[0162] As used herein, a "bonding region" refers to a region on a substrate that is to be bonded to another substance, which may be, for example, a spacer layer, a lid, another substrate, etc., or a combination thereof (e.g., a spacer layer and a lid). The bond formed in the bonding region may be a chemical bond (as described above) or a mechanical bond (e.g., using fasteners, etc.).

[0163] "tert-butyloxycarbonyl group" (Boc) [ka] "Butyloxycarbonyloxy" refers to the -OCO2tBu group.

[0164] As used herein, "carbocyclyl" refers to a non-aromatic ring or ring system containing only carbon atoms in the ring system backbone. When a carbocyclyl is a ring system, two or more rings can be joined together in a fused, bridged, or spiro-connected manner. A carbocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Thus, carbocyclyl includes cycloalkyl, cycloalkenyl, and cycloalkynyl. A carbocyclyl group can have 3 to 20 carbon atoms. Examples of carbocyclyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.

[0165] As used herein, the term "carboxylic acid" or "carboxyl" refers to --COOH.

[0166] As used herein, "cycloalkylene" means a fully saturated carbocyclyl ring or ring system attached to the rest of the molecule through two points of attachment.

[0167] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, wherein none of the rings in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. As used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclic ring or ring system having at least one double bond and at least one heteroatom in the ring backbone, wherein none of the rings in the ring system is aromatic.

[0168] As used herein, "hydroxy" or "hydroxyl" refers to an --OH group.

[0169] As used herein, a "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA or single-stranded RNA) that serves as a starting point for DNA or RNA synthesis. The 5' end of the primer may be modified to allow for a coupling reaction with a functionalized polymer layer. The length of the primer can be any number of bases and can include a variety of non-natural nucleotides. In one example, the primer is a short chain ranging from 20 to 40 bases.

[0170] As used herein, the term "optionally substituted" can be used interchangeably with "unsubstituted or substituted." The term "substituted" refers to the replacement of one or more hydrogen atoms of a specified group with a specified radical. For example, substituted alkyl, aryl, cycloalkyl, heterocyclyl, etc. means that one or more H atoms in each residue are replaced with halogen, haloalkyl, alkyl, acyl, alkoxyalkyl, hydroxy lower alkyl, carbonyl, phenyl, heteroaryl, benzenesulfonyl, hydroxy, lower alkoxy, haloalkoxy, oxaalkyl, carboxy, alkoxycarbonyl [—C(═O)O-alkyl], alkoxycarbonylamino [HNC(═O)O-alkyl], carboxamido [—C(═O)NH], alkylaminocarbonyl [—C(═O)NH-alkyl], cyano, acetoxy, nitro, amino, alkylamino, dialkylamino, (alkyl)(aryl)aminoalkyl, alkylaminoalkyl (cycloalkylaminoalkyl), etc. and the like), dialkylaminoalkyl, dialkylaminoalkoxy, heterocyclylalkoxy, mercapto, alkylthio, sulfoxide, sulfone, sulfonylamino, alkylsulfinyl, alkylsulfonyl, alkylsulfonylamino, arylsulfonyl, arylsulfonylamino, acylaminoalkyl, acylaminoalkoxy, acylamino, amidino, aryl, benzyl, heterocyclyl, heterocyclylalkyl, phenoxy, benzyloxy, heteroaryloxy, hydroxyimino, alkoxyimino, oxaalkyl, aminosulfonyl, trityl, amidino, guanidino, ureido, benzyloxyphenyl, and benzyloxy-substituted alkyl, aryl, cycloalkyl, or heterocyclyl. "Oxo" is also included among the substituents referred to in "optionally substituted," although one of skill in the art will recognize that because oxo is a divalent radical, there are situations in which it is not suitable as a substituent (e.g., on phenyl). In one example, one, two, or three hydrogen atoms can be replaced with a specified radical. In the case of alkyl and cycloalkyl, more than two hydrogen atoms may be replaced by fluorine, and in fact all available hydrogen atoms may be replaced by fluorine.Such compounds (e.g., perfluoroalkyls) are included in the class of "fluorohydrocarbons." For clarity, the generic term may include more than one substituent. Thus, for example, "haloalkyl" or "halophenyl" refers to an alkyl or phenyl in which at least one, but possibly more than one, hydrogen is replaced with a halogen. In some examples, the substituent is halogen, haloalkyl, alkyl, acyl, hydroxyalkyl, hydroxy, alkoxy, haloalkoxy, oxaalkyl, carboxy, cyano, acetoxy, nitro, amino, alkylamino, dialkylamino, alkylthio, alkylsulfinyl, alkylsulfonyl, alkylsulfonylaminoarylsulfonyl, arylsulfonylamino, and benzyloxy.

[0171] The term "substituted with at least one oxygen-containing substituent" is used in describing the compounds described herein. An oxygen-containing substituent is a substituent that contains oxygen in addition to carbon and hydrogen, and may also contain additional heteroatoms such as nitrogen (e.g., carboxamide or methanesulfonyl). Typical examples of oxygen-containing substituents include alkoxy, hydroxy, fluoroalkoxy, formyl, acetyl, and other C1-C6 acyl chains. Non-limiting examples

[0172] The following examples are intended to illustrate certain embodiments of the present disclosure, but are not intended to limit its scope in any way.

[0173] Figure 1 shows a diagram of a non-limiting example of a nanoparticle disclosed herein. In this non-limiting example, a single template polynucleotide moiety is shown as a wedge-shaped portion of the scaffold portion of the nanoparticle, as disclosed. A single template polynucleotide is shown bound to the single template moiety. Also shown in this non-limiting example are multiple accessories extending from the accessory moiety of the scaffold. In the center diagram, the accessories are shown as polymers. In the left panel, multiple copies of a polynucleotide complementary to the template polynucleotide and copies of the template polynucleotide are shown bound to and extending from the scaffold. In this example, these extend from the polymer, which in turn extends from the scaffold.

[0174] In the right panel, nanoparticles with template polynucleotides bound at a single template site are shown within a well of a substrate. Multiple accessory oligonucleotides are shown extending from the scaffold. Although not shown in the right panel, in this example, accessory oligonucleotides extend from a polymer bound to the scaffold. The nucleotide sequence of the accessory oligonucleotide is complementary to the primer bound to the surface of the well. The accessory oligonucleotide thereby hybridizes to the primer bound to the well and binds to the surface of the well. In this case, due to the size of the nanoparticle relative to the size of the well, only one nanoparticle can be present in the well. Therefore, clustering is initiated from a single template.

[0175] Figure 2 is a diagram of a non-limiting example of a nanoparticle scaffold according to the present disclosure. On the left, the scaffold is shown as an asymmetric scaffold with three polymer tails and a single template polynucleotide attached to the scaffold. On the right, an example of the molecular structure of a nanoparticle (comprising a three-armed RAFT agent core) is shown, with a single template attachment point depicted and polymers extending from the scaffold core. Also shown are non-limiting examples of acrylamide monomers that may form part of the scaffold, including accessory moieties, shown in this example as azide groups (e.g., matrix monomer and primer attachment points).

[0176] Figure 3 shows another non-limiting example of a scaffold polymer disclosed herein. On the right side, a scaffold core is shown with three polymer arms extending therefrom, and a single template polynucleotide binding site is shown. On the left side, the chemical structure of the core and one of the polymer arms is shown (the other polymer arms are omitted for clarity, but are included in the scaffold). A dibenzocyclooctene group is shown as the single template polynucleotide binding site, and accessory binding sites are shown on the depicted polymer arm.

[0177] Figure 4 shows another non-limiting example of a synthetic scheme for one example of a scaffold according to an embodiment of the present disclosure. In this example, the amine end of the Tris molecule is blocked (t-butyldicarbonate, or BocO, DIPEA, or N,N-diisopropylethylamine, and THF, or tetrahydrofuran), and a 2-(dodecylthiocarbonothioylthio)-2-methylpropionic acid (DDMAT) group is added to the hydroxyl end of the Tris core. Two options are shown for subsequent polymerization. In Route 1, standard aqueous RAFT polymerization is performed to add the monomer to the chain, followed by deprotection of the amine group and attachment of a dibenzocyclooctene (DBCO) group to the amine group. In alternative Route 2, the amine group is first deblocked with trifluoroacetic acid (TFA), and a dibenzylcyclooctene group is first attached (DBCO-PEG-NHS ester) before performing RAFT polymerization to add the monomer group.

[0178] An alternative scheme for synthesizing a scaffold according to the present disclosure is as follows: [ka] (In this example, for simplicity, only one of the polymer arms is shown after addition of DDMAT, but all three arms would have the same structure.) In this non-limiting working example, a PEG linker is added between the template polynucleotide moiety (R) and the polymer arm containing the accessory moiety (an azide group in this example).

[0179] Another scheme for synthesizing scaffolds that has been carried out in accordance with aspects of the present disclosure follows the following non-limiting working example. [ka] From there, the following non-limiting example synthetic scheme can be carried out (again, only one of three polymer arms is shown for clarity of illustration, but all polymer arms are synthesized according to the same scheme): [ka]

[0180] In this non-limiting example, the single template polynucleotide moiety is a tetrazine. Monomers with the following R can be added during polymerization to synthesize different types of scaffolds (for example, to add azide groups for accessory binding sites) as disclosed herein: [ka]

[0181] The following monomers with R2 can be optionally added during polymerization to synthesize different types of scaffolds as disclosed herein: [ka]

[0182] The acrylamide monomers can optionally be PEGylated according to the following scheme: [ka]

[0183] An alternative scheme for synthesizing a scaffold from a triazine core in accordance with the present disclosure follows the following non-limiting example. [ka] [ka]

[0184] In this non-limiting example, the single template polynucleotide moiety is an amine extending from the top of the tetrazine core, as described above. Monomers with the following R can be added during polymerization to synthesize different types of scaffolds (as a non-limiting example, to add azide groups for accessory binding sites), as disclosed herein. [ka]

[0185] The following monomers with R2 can be optionally added during polymerization to synthesize different types of scaffolds as disclosed herein: [ka]

[0186] The acrylamide monomers can optionally be PEGylated according to the following scheme: [ka]

[0187] Bifunctional PEGylated secondary amines for attachment to the triazine scaffold core can be synthesized according to the following scheme. [ka]

[0188] Stoichiometric control of the components added during the initial addition of a bifunctional PEGylated secondary amine to the triazine scaffold core and purification methods (e.g., based on polarity differences) can be used to aid in the generation of disubstituted triazines (two bifunctional secondary amines attached) as opposed to mono- and trisubstituted versions.

[0189] Figure 5 shows an example of a dendrimer scaffold according to an embodiment of the present disclosure. In this example, a polypeptide containing four lysines and terminating in a C-terminal cysteine is shown. The second, third, and fourth lysines contain forks containing isopeptide bonds to another lysine group via their epsilon-amino groups. The second lysine has a single lysine linked by an isopeptide bond. The third lysine is linked to a dilysine, which has another lysine linked by an isopeptide bond to the epsilon-amino group of its C-terminal lysine. The fourth lysine is linked to a trilysine residue, which has another lysine linked to the second lysine by an isopeptide bond, and a dilysine residue linked by an isopeptide bond to its C-terminal lysine.

[0190] Thus, in this example of a dendron scaffold, different numbers of generations emerge from the branches extending from the cysteine core. In other examples, more or fewer generations may be included, and different branches may have the same or different numbers of generations. In other examples, additional species of amino acids may be included between the lysyl forks, for example, via peptide bonds to lysine residues, or at the termini bearing a single template polynucleotide site.

[0191] Figure 6 shows a synthetic scheme for nanoparticles in which branched lysine substituents have α-amino peptide bonds and ε-amino isopeptide bonds, such as within a lysyl dendrimer structure scaffold or a scaffold of lysine-containing polypeptides linked by isopeptide bonds at the ε-amino groups of the lysine substituents to form a branched peptide scaffold. Using solid-phase peptide synthesis, for example, a sequence of amino acids can be synthesized together in a linear polypeptide chain according to the upper panel of Figure 6 (a sequential synthesis strategy using solid-phase peptide synthesis (SPSS)). Amine groups are blocked with fluorenylmethyloxycarbonyl (Fmoc) or tert-butyloxycarbonyl (Boc). The protecting groups are selectively removed in the presence of an added composition / coupling reagent. Linear polypeptides can be synthesized by repeated protection of free amino groups (adding n monomers (n = number of cycles)), followed by their removal and addition of activated amino acids (adding n monomers (n = number of cycles)). This allows for the generation of linear chains of charged amino acids containing one or more lysine residues as components of the scaffold. The composition can then be cleaved from the base resin and further modified as desired.

[0192] As further shown in the bottom panel of Figure 6, a convergent solid-phase protein synthesis method can be used in which lengths of individually formed polypeptide chains containing one or more lysine residues can be added as a polymer set during synthesis steps (bottom panel, convergent synthesis strategy by solid-phase peptide synthesis (SPPS)). In some examples not shown in Figure 6, amino acids or polypeptides can be added independently as branches to a fork, a structure containing two amino groups (i.e., the α-amino group of lysine or another amino acid at the N-terminus and the ε-amino acid of lysine) rather than being linearly linked from a single amino group as shown in Figure 22. For example, a lysine amino acid with two amino groups can serve as a forked attachment point where two branches of a linear polypeptide or two individual lysine residues can be attached to each amino group according to the solid-phase protein synthesis scheme shown in Figure 6.

[0193] Figure 7 is a diagram of different methods for attaching a template polynucleotide to a scaffold. At the top, a scaffold with a single template polynucleotide site is shown. On the left, a template site primer is included in the single template polynucleotide site, the end of which is complementary to the end of the template polynucleotide, allowing non-covalent attachment of the template polynucleotide to the scaffold via Watson-Crick base pair hybridization. In the center, the template polynucleotide and the single template polynucleotide site each have complementary portions or structures that result in the formation of a covalent bond between the template polynucleotide and the scaffold. On the right, a polypeptide is included in the single template site, with a complementary polypeptide attached to the end of the template polynucleotide. The non-covalent bond between the polypeptide of the single template site and the template polynucleotide attaches the template polynucleotide to the scaffold.

[0194] Figure 8 shows an example of a template polynucleotide bound to a single template site on a protein scaffold by hybridization to a template site primer represented by PX (GFP-oligoconjugate). Two examples of library template polynucleotides are shown: a standard library molecule with P5 and P7 sequences, a region complementary to the PX template site primer at its 3-prime end (designated PX'), or a modified version in which the PX' sequence is separated from the P5 sequence by a PEG linker. An ether chain is attached to the single template site on the scaffold. The standard library sequence can be used in a first chain extension polymerization reaction, with the PX primer serving as the initiating primer for polymerizing the nascent strand complementary to the template polynucleotide.

[0195] FIG. 9 shows examples of non-covalent bonds, specifically coiled-coil peptide non-covalent bonds (in one example, K D <1x10 -10(The M is in the picomolar range.) Two amino acid sequences of alpha-helical polypeptide structures that form two complementary binding partners for coiled-coil binding are shown. By attaching such sequences to a scaffold or library template polynucleotide, the template polynucleotide can be attached to the scaffold via non-covalent bonds between the alpha helices. In another example, one of the alpha-helical sequences complementary to a sequence attached to the scaffold can be attached to an accessory, such as an accessory oligonucleotide for attaching an accessory oligonucleotide to an accessory site.

[0196] Figure 10 shows an example graph (seeding events vs. nanowell surface area) of a test of the number of scaffolds of a given size that can be present in a nanowell (dendrimer / nanowell) of a given nanowell surface area (SA) or diameter (D). Nanoparticles approximately 100 nm in diameter (with a structure different from that of the nanoparticles disclosed herein) were seeded into nanowells of 185 nm, 285 nm, or 375 nm in diameter, and the number of dendrimers per nanowell was measured. The resulting line of best fit (y = 3E-0.5x - 3.4874, R 2 = 0.9991) indicates that in this example, single nanoparticle seeding of the nanowells would be the result of using nanoparticles approximately 100 nm in diameter and nanowells approximately 100 nm in diameter.

[0197] 11A-11C show examples of seeding a substrate with a template polynucleotide using a scaffold according to embodiments of the present disclosure. The scaffold, configured as a DNA dendrimer scaffold according to U.S. Provisional Patent Application No. 62 / 952,799, had a diameter of 50 nm to 150 nm. The scaffold contains a single template site (Pa) for binding the template polynucleotide and multiple accessory moieties (cPX). FIG. 11A shows the template polynucleotide and its complement, with primer sequences attached to each end (P5 / cP5 and P7 / cP7). The P5 primer end of the template polynucleotide is joined to a primer (cPa) by a PEG linker. The cPa primer is complementary to the single template site (Pa) of the scaffold. FIG. 11B is a depiction of a scaffold molecule hybridized via its single template site (Pa) to the template polynucleotide and its complement shown in FIG. 11A via the cPa primer. The scaffold is bound to a substrate, which is bound to a primer (PX) that is complementary to the accessory site (cPX) of the scaffold, which is also bound to the primer, allowing hybridization of the template ends and clustering on the substrate.

[0198] Figure 11C shows an example, as described above, demonstrating the use of a scaffold with a single template site to seed a substrate with template polynucleotides followed by clustering. The scaffold was bound to the template polynucleotide according to the embodiments of the present disclosure and Figures 11A and 11B. The template polynucleotide (library) and scaffold were combined at the indicated molar ratio, seeded onto a substrate (a flow cell with nanowells for seeding), and then clustered according to a recombinase-driven cluster amplification process (ExAmp cluster amplification). Negative controls include a scaffold without a template and a template without a scaffold. As a positive control (+ control), clustering was performed on a substrate without a scaffold, using clustering on a substrate after hybridization of template molecules to primers bound to the substrate without a scaffold.

[0199] The left panel shows images of the flow cell after the clustering process under the above conditions (two negative controls, five conditions with various scaffold:template molar ratios, and one positive control). The fluorescence in all conditions except the negative control indicates that scaffolds with a single template-binding site can seed the substrate with template polynucleotides and support the clustering process. The bar graphs are quantitative measurements of the clustering results for the eight conditions. The top graph shows the cycle 1 intensity, or yield, as an indirect measure of cluster size (intensity is directly proportional to cluster size, or yield). The %PF in the bottom graph is the % filter passing (the percentage of nanowells that pass the threshold filter), indicating the purity of the clusters formed therein. That is, it is directly proportional to the number of nanowells with monoclonal clusters.

[0200] It should be understood that all combinations of the foregoing concepts and additional concepts more particularly discussed herein (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein and may be used to obtain the benefits and advantages described herein. The present application also includes the following aspects. [Aspect 1] A nanoparticle, a scaffold; a single template site for attaching a template polynucleotide to the scaffold, the single template site being selected from a covalent template binding site and a non-covalent template binding site; and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold, the accessory oligonucleotides being selected from a covalent accessory oligonucleotide binding site and a non-covalent accessory oligonucleotide binding site; The scaffold has formula I: [ka] wherein each X is a compound of formula II: [ka] wherein R 2 is represented by formula IIIa: [ka] wherein R 5 teeth,

change

change

change

change

change

change

change

change

change

change

change

change

change

Claims

1. A nanoparticle, a scaffold; a single template site for attaching a template polynucleotide to the scaffold, the single template site being selected from a covalent template binding site and a non-covalent template binding site; and a plurality of accessory sites for attaching accessory oligonucleotides to the scaffold, the accessory oligonucleotides being selected from a covalent accessory oligonucleotide binding site and a non-covalent accessory oligonucleotide binding site; (A) the scaffold has Formula I: 【Chemical 1】 wherein each X is a compound of formula II: 【Chemistry 2】 is a compound of the formula R 2 teeth, i) Formula IIIa: 【Chemistry 3】 [During the ceremony, R 5 teeth, 【Chemistry 4】 is selected from x is an integer ranging from 1 to 20,000, y is an integer ranging from 1 to 100,000, and the ratio of x:y may be from 10:90 to 1:99; and Each R z are independently H or C 1~4 alkyl] or ii) Formula IIIb: 【Chemistry 5】 [During the ceremony, R 5 teeth, 【Chemistry 6】 is selected from y is an integer ranging from 1 to 2,000, the sum of x and z is ranging from 1 to 10,000, and the ratio of (x:y):z can be from (85):15 to (95):5; and Each R z are independently hydrogen or (C 1~4 ) alkyl] is a compound of R 1 comprises the single template site for attaching a template polynucleotide to the scaffold; R 4 is an optionally substituted C 1 ~C 20 Alkyl, optionally substituted C 1 ~C 20 Alkenyl, optionally substituted C 1 ~C 20 Alkynyl, optionally substituted C 1 ~C 20 Oxaalkyl, optionally substituted C 1 ~C 20 Thiaalkyl, and optionally substituted C 1 ~C 20 azaalkyl, and the substituents are selected from C 1 ~C 20 including substitution with one or more of alkyl, double-bonded oxygen, and hydroxyl groups; R 3 comprises an accessory site for attaching an accessory oligonucleotide, The compound, (B) the single template site is (i) amine-NHS ester binding site, amine-imidoester binding site, amine-pentofluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, aldehyde-NHS ester binding site, hydroxy-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, transcyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, SnapTag-O6 a covalent template binding site selected from a benzylguanine binding site, a CLIP tag-O 2 -benzylcytosine binding site, and a sortase coupling binding site; or (ii) a non-covalent template binding site comprising a polynucleotide hybridization site or a non-covalent peptide binding site, wherein the non-covalent peptide binding site is selected from a coiled-coil binding site and an avidin-biotin binding site; and (C) the plurality of accessory sites for attaching accessory oligonucleotides to the scaffold are (i) amine-NHS ester binding site, amine-imidoester binding site, amine-pentofluorophenyl ester binding site, amine-hydroxymethylphosphine binding site, carboxyl-carbodiimide binding site, thiol-maleimide binding site, thiol-haloacetyl binding site, thiol-pyridyl disulfide binding site, thiol-thiosulfonate binding site, thiol-vinyl sulfone binding site, aldehyde-hydrazide binding site, aldehyde-alkoxyamine binding site, hydroxy-isocyanate binding site, azide-alkyne binding site, azide-phosphine binding site, transcyclooctene-tetrazine binding site, norbornene-tetrazine binding site, azide-cyclooctyne binding site, azide-norbornene binding site, oxime binding site, SpyTag-SpyCatcher binding site, Snap tag-O 6 -benzylguanine binding site, CLIP tag-O 2 - a covalent accessory oligonucleotide binding site selected from a benzylcytosine binding site, a sortase coupling binding site, and any combination of two or more of the foregoing; or (ii) a non-covalent accessory oligonucleotide binding site comprising a polynucleotide hybridization site or a non-covalent peptide binding site, wherein the non-covalent peptide binding site is selected from one or both of a coiled-coil binding site and an avidin-biotin binding site. Including, The nanoparticles.

2. The nanoparticle of claim 1 , further comprising a single template polynucleotide bound to the single template site.

3. The nanoparticle of claim 1 or 2, further comprising a plurality of accessory oligonucleotides bound to the plurality of accessory moieties.

4. The nanoparticles of any one of claims 1 to 3, wherein the nanoparticles are at least about 10 nm in diameter.

5. A method for binding a template polynucleotide in a sequencing method, the method comprising binding a single template polynucleotide to the single template site of the nanoparticle described in claim 1.

6. A method for binding a template polynucleotide in a sequencing method, the method comprising binding a plurality of accessory oligonucleotides to the plurality of accessory sites of the nanoparticles described in claim 1 or 2.

7. 7. The method of claim 5 or 6, further comprising synthesizing one or more scaffold-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the scaffold-bound copies extend from the accessory oligonucleotide.

8. 8. The method of any one of claims 5 to 7, further comprising attaching the scaffold to a substrate, wherein the attaching comprises hybridizing accessory oligonucleotides to the oligonucleotides attached to the substrate.

9. 9. The method of claim 8, wherein the substrate comprises a plurality of nanowells, and the oligonucleotides bound to the substrate are bound within the plurality of nanowells.

10. 10. The method of claim 9, wherein only one scaffold is bound within any one of said nanowells.

11. 11. The method of any one of claims 8-10, further comprising synthesizing one or more substrate-bound copies selected from a copy of the template polynucleotide, a copy of a polynucleotide complementary to the template polynucleotide, and both copies, wherein the substrate-bound copies extend from a substrate-bound accessory oligonucleotide.

12. 12. The method of claim 7 or 11, further comprising sequencing at least one of the scaffold-bound copy and the substrate-bound copy, wherein said sequencing comprises decoding-by-synthesis.

Citation Information

Patent Citations

  • Brush-like copolymer

    JP2010511065A

  • Nucleic acid complex

    JP2014520506A

  • Polymer coating

    JP2015529576A

  • Tagged multinucleotides useful for nucleic acid sequencing

    JP2019521096A

  • DNA sequencing by synthesis with nucleotide analogues and raman detection

    WO2017176679A1