Methods and kits for depleting and enriching nucleic acid sequences

Abstract

Kits and methods for enriching and depleting target nucleic acid sequences (e.g., nucleic acid molecules comprising a target nucleic acid sequence). In one embodiment, the method for enriching the target nucleic acid sequence comprises selectively degrading single-stranded sample nucleic acid molecules (e.g., those that do not comprise the target nucleic acid sequence). In one embodiment, the method for depleting the target nucleic acid sequence comprises selectively degrading double-stranded sample nucleic acid molecules (e.g., those that comprise the target nucleic acid sequence).

Description

Detailed Description of the Invention

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent No. 62 / 750,169, filed October 24, 2018, which is incorporated herein by reference in its entirety.

[0002] Regarding the sequence listing The sequence listing associated with this application is provided in text format rather than in printed form and is incorporated herein by reference. The filename of this text file containing the sequence listing is 70380_Seq_final_2019-10-24.txt. This text file, 14 KB in size, was created on October 24, 2019, and is being submitted via EFS-Web with the application herein.

[0003] background Complex biological samples such as tissues, cells, cell lysates, and serum present challenges for determining the sequence and concentration of nucleic acid molecules with specific target sequences. Similarly, determining the sequence and concentration of nucleic acids from a set of barcoded molecules, such as a single-cell RNA sequencing library, presents similar challenges.

[0004] Conventionally, sequencing methods such as Sanger sequencing or next-generation sequencing (NGS) are used to sequence nucleic acids in such complex samples and sequencing libraries, which generate many extra sequences in addition to the sequences based on the target sequence of interest, and when using NGS, a relatively large number of sequence reads are used to achieve the desired sequencing depth.

[0005] Selective enrichment of target nucleic acid sequences or depletion of non-target nucleic acid sequences in complex samples may simplify interpretation of sequencing data and reduce the number of reads required to achieve a particular sequencing depth.

[0006] Thus, there is currently a need in the art to selectively remove some or all of the nucleic acid molecules that are not of interest, or to selectively enrich the proportion of nucleic acid molecules of interest in a complex mixture, such as in preparation for sequencing. The present disclosure seeks to fulfill this need, and further provides related advantages.

[0007] overview To this end, in certain embodiments, the present disclosure provides methods and kits for enriching target nucleic acid molecules. Correspondingly, in other embodiments, the present disclosure provides methods and kits for depleting nucleic acid molecules that are not of interest.

[0008] In one aspect, the present disclosure provides a method for enriching a target nucleic acid sequence. In one embodiment, the method includes the steps of: introducing a capture primer nucleic acid molecule, which is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules among a plurality of sample nucleic acid molecules, each sample nucleic acid molecule comprising a universal adaptor nucleic acid sequence, enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules, and enzymatically degrading single-stranded sample nucleic acid molecules to provide an enriched sample solution having a higher proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

[0009] In another aspect, the present disclosure provides a method for depleting a target nucleic acid sequence. In one embodiment, the method includes the steps of: introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of a plurality of sample nucleic acid molecules, each sample nucleic acid molecule comprising a universal adaptor nucleic acid sequence comprising a ribonucleotide, enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules, and enzymatically cleaving double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a depleted sample solution having a lower proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

[0010] In one aspect, the disclosure provides a kit for enriching a target nucleic acid sequence, hi one embodiment, the kit includes a capture primer nucleic acid molecule complementary or partially complementary to the target sequence and a degradative enzyme configured to degrade single-stranded nucleic acid molecules.

[0011] In another aspect, the disclosure provides a kit for depleting a target nucleic acid sequence, hi one embodiment, the kit includes a capture primer nucleic acid molecule complementary or partially complementary to the target sequence and a degradative enzyme configured to degrade double-stranded nucleic acid molecules.

[0012] This Summary is provided for the purpose of presenting a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter. DESCRIPTION OF THE DRAWINGS BRIEF DESCRIPTION OF THE DRAWINGS The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as they become better understood by reference to the following detailed description and the accompanying drawings. [Brief explanation of the drawings]

[0013] [Figure 1-1] 1A is a schematic illustration of a sample solution including sample nucleic acid molecules to be enriched and nucleic acid molecules to be depleted, according to an embodiment of the present disclosure, and FIG. 1B is a schematic illustration of the sample solution of FIG. 1A further including capture primer nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 1-2] Figure 1C schematically illustrates the sample solution of Figure 1B after melting the enriched and depleted sample nucleic acid molecules, according to an embodiment of the present disclosure. Figure 1D schematically illustrates the sample solution of Figure 1C after annealing capture primer nucleic acid molecules to target sequences of the enriched nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 1-3] Figure 1E is a schematic illustration of the sample solution of Figure 1D after enzymatic extension of a capture primer nucleic acid molecule annealed to a target sequence, according to an embodiment of the present disclosure. Figure 1F is a schematic illustration of the sample solution of Figure 1E after enzymatic degradation of single-stranded sample nucleic acid molecules in the sample solution, according to an embodiment of the present disclosure. [Figure 1-4] Figure 1G schematically illustrates melting of nucleic acid molecules of the sample solution of Figure 1F, according to an embodiment of the present disclosure. Figure 1H schematically illustrates the sample solution of Figure 1G after removal of capture primer nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 1-5] Figure 1I schematically illustrates the sample solution of Figure 1H further including a polymerase chain reaction (PCR) primer complementary to a universal adapter sequence of a sample nucleic acid molecule in the sample solution, according to an embodiment of the present disclosure. Figure 1J schematically illustrates the sample solution of Figure 1I after PCR amplification of a particular sample nucleic acid molecule in the sample solution, according to an embodiment of the present disclosure. [Figure 2-1] 2A and 2B are schematic illustrations of a sample solution including sample nucleic acid molecules to be enriched and nucleic acid molecules to be depleted, respectively, according to an embodiment of the present disclosure, and a sample solution of FIG. 2A further including capture primer nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 2-2]Figure 2C schematically illustrates the sample solution of Figure 2B after melting the enriched and depleted sample nucleic acid molecules, according to an embodiment of the present disclosure. Figure 2D schematically illustrates the sample solution of Figure 2C after annealing capture primer nucleic acid molecules to target sequences of the depleted nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 2-3] Figure 2E is a schematic illustration of the sample solution of Figure 2D after enzymatic extension of a capture primer nucleic acid molecule annealed to a target sequence, according to an embodiment of the present disclosure. Figure 2F is a schematic illustration of the sample solution of Figure 2E after enzymatic degradation of double-stranded sample nucleic acid molecules in the sample solution, according to an embodiment of the present disclosure. [Figure 2-4] Figure 2G schematically illustrates melting of sample nucleic acid molecules of the sample solution of Figure 2F, according to an embodiment of the present disclosure. Figure 2H schematically illustrates the sample solution of Figure 2G after removal of capture primer nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 2-5] Figure 2I schematically illustrates the sample solution of Figure 2H further including a PCR primer complementary to a universal adapter sequence of a sample nucleic acid molecule in the sample solution, according to an embodiment of the present disclosure. Figure 2J schematically illustrates the sample solution of Figure 2I after PCR amplification of the sample nucleic acid molecule in the sample solution, according to an embodiment of the present disclosure. [Figure 3-1] 3A is a schematic illustration of a sample solution comprising enriched sample nucleic acid molecules and depleted nucleic acid molecules, according to an embodiment of the present disclosure. FIG. 3B is a schematic illustration of the sample solution of FIG. 3A further comprising capture primer nucleic acid molecules, including blocked capture primer nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 3-2] Figure 3C schematically illustrates the sample solution of Figure 3B after melting the enriched and depleted sample nucleic acid molecules, according to an embodiment of the present disclosure. Figure 3D schematically illustrates the sample solution of Figure 3C after annealing capture primer nucleic acid molecules to target sequences of the depleted nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 3-3]Figure 3E schematically illustrates the sample solution of Figure 3D after enzymatic extension of capture primer nucleic acid molecules annealed to target sequences, according to an embodiment of the present disclosure. Figure 3F schematically illustrates the sample solution of Figure 3E after enzymatic degradation of double-stranded sample nucleic acid molecules in the sample solution, according to an embodiment of the present disclosure. [Figure 3-4] Figure 3G schematically illustrates melting of sample nucleic acid molecules of the sample solution of Figure 2F, according to an embodiment of the present disclosure. Figure 3H schematically illustrates the sample solution of Figure 3G after removal of capture primer nucleic acid molecules, according to an embodiment of the present disclosure. [Figure 3-5] Figure 3I schematically illustrates the sample solution of Figure 3H further including a PCR primer complementary to a universal adapter sequence of a sample nucleic acid molecule in the sample solution, according to an embodiment of the present disclosure. Figure 3J schematically illustrates the sample solution of Figure 3I after PCR amplification of the sample nucleic acid molecule in the sample solution, according to an embodiment of the present disclosure. [Figure 4-1] 1A and 1B are schematic illustrations of capture primer nucleic acid molecules according to embodiments of the present disclosure bound to Hygro. [Figure 4-2] 1A and 1B are schematic illustrations of capture primer nucleic acid molecules according to embodiments of the present disclosure bound to Hygro. [Figure 4-3] 1A and 1B are schematic illustrations of capture primer nucleic acid molecules according to embodiments of the present disclosure bound to Hygro. [Figure 5-1] 1A-1C are schematic illustrations of capture primer nucleic acid molecules according to embodiments of the present disclosure bound to AmpR. [Figure 5-2] 1A-1C are schematic illustrations of capture primer nucleic acid molecules according to embodiments of the present disclosure bound to AmpR. [Figure 6-1] 1A-B schematically illustrate a capture primer nucleic acid molecule comprising a universal adaptor sequence comprising a poly-T sequence, according to an embodiment of the present disclosure, bound to AmpR. [Figure 6-2] 1A-B schematically illustrate a capture primer nucleic acid molecule comprising a universal adaptor sequence comprising a poly-T sequence, according to an embodiment of the present disclosure, bound to AmpR. [Figure 7-1] 1A-B schematically illustrate a capture primer nucleic acid molecule comprising a universal adapter sequence comprising a poly-T sequence attached to Hygro according to an embodiment of the present disclosure. [Figure 7-2] 1A-B schematically illustrate a capture primer nucleic acid molecule comprising a universal adapter sequence comprising a poly-T sequence attached to Hygro according to an embodiment of the present disclosure. [Figure 7-3] 1A-B schematically illustrate a capture primer nucleic acid molecule comprising a universal adapter sequence comprising a poly-T sequence attached to Hygro according to an embodiment of the present disclosure. [Figure 8] 1 is an image of an electrophoresis gel showing the results of an electrophoresis experiment demonstrating enrichment of sample nucleic acid molecules containing a target sequence, according to an embodiment of the present disclosure.

[0014] Detailed Description The present disclosure provides kits and methods for enriching a target nucleic acid sequence (such as a nucleic acid molecule that includes the target nucleic acid sequence), as well as kits and methods for depleting a target nucleic acid sequence (such as a nucleic acid molecule that includes the target nucleic acid sequence).

[0015] As used herein, the terms "nucleic acid" and "polynucleotide" refer to biopolymers made from monomer units called "nucleotides." Typically, each nucleotide consists of a pentose sugar, a phosphate group, and a nitrogenous base (also called a "nucleobase"). The structure of the sugar moiety typically determines the type of nucleic acid polymer. Nucleic acid monomers are linked to form the linear sequence of a nucleic acid polymer. Nucleic acids encompassed by the present disclosure can include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), cDNA, or synthetic nucleic acids known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), or other synthetic polymers with nucleotide side chains, or any combination thereof. Nucleic acid molecules can be single-stranded or double-stranded (including complementary single-stranded polynucleotide strands hybridized by base pairing of individual nucleobases). Typically, cDNA, RNA, GNA, TNA, or LNA is single-stranded. The DNA can be double-stranded (dsDNA) or single-stranded (ssDNA).

[0016] Nucleotide subunits of nucleic acids may be natural, artificial, or modified. As described above, nucleotides typically contain a nucleobase, a sugar, and at least one phosphate group. The nucleobase is typically a heterocycle. Suitable nucleobases include canonical purines and pyrimidines, more specifically adenine (A), guanine (G), thymine (T) (or uracil (U) in RNA, typically instead of thymine (T)), and cytosine (C). The sugar is typically a pentose sugar. Suitable sugars include, but are not limited to, ribose and deoxyribose. Nucleotides are typically ribonucleotides or deoxyribonucleotides. Nucleotides typically contain monophosphates, diphosphates, or triphosphates. These are generally referred to herein as nucleotides or nucleotide residues, and refer to subunits. Unless otherwise specified, terms such as nucleotide and nucleotide residue are not intended to imply any particular structure or characteristics. As noted above, nucleic acids according to the present disclosure may also include synthetic variants of DNA or RNA. "Synthetic variants" encompass nucleic acids incorporating known analogs of natural nucleotides and / or nucleobases that can hybridize to nucleic acids in a manner similar to natural nucleotides. Examples of synthetic variants include peptide nucleic acids (PNAs), phosphorothioate DNA, and locked nucleic acids.Modified or synthetic nucleobases and analogues include 5-Br-UTP, 5-Br-dUTP, 5-F-UTP, 5-F-dUTP, 5-propynyl-dCTP, 5-propynyl-dUTP, diaminopurine, S2T, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-caprylamide, 5-hydroxybenzoate ... carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil Modified nucleobases may include, but are not limited to, uracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. Those skilled in the art can easily determine which base pairs are considered to be base pair matches or base pair mismatches for each modified nucleobase.

[0017] method In one aspect, the present disclosure provides a method for enriching and / or depleting a target nucleic acid sequence, such as a target nucleic acid sequence present on a sample nucleic acid in a complex sample solution containing sample nucleic acid molecules that do not contain the target nucleic acid sequence.

[0018] Enrichment method In one embodiment, the present disclosure provides a method for enriching a target nucleic acid sequence, the method comprising: (a) introducing a capture primer nucleic acid molecule, which is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules among a plurality of sample nucleic acid molecules, each sample nucleic acid molecule comprising a universal adapter nucleic acid sequence, into a sample solution; (b) enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically degrading single-stranded sample nucleic acid molecules to provide an enriched sample solution having a higher proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

[0019] Methods for enriching target nucleic acid sequences according to embodiments of the present disclosure are described below. In this regard, attention is directed to Figures 1A-1J, which schematically illustrate methods for enriching target nucleic acid sequences according to embodiments of the present disclosure.

[0020] 1A is a schematic illustration of a sample solution containing enriched and depleted nucleic acid molecules. As shown, the sample solution includes a starting pool of nucleic acid molecules, including double-stranded nucleic acid molecules to be enriched and double-stranded nucleic acid molecules to be depleted. Where the sample nucleic acid molecules are shown as double-stranded, in one embodiment, the sample nucleic acid molecules include single-stranded sample nucleic acid molecules or a combination of single-stranded and double-stranded sample nucleic acid molecules. The double-stranded nucleic acid molecules to be enriched include universal adapter nucleic acid sequences a, a * , b, and b * and target nucleic acid sequences c and c * The double-stranded nucleic acid molecule to be depleted is shown to include universal adaptor nucleic acid sequences a, a *, b, and b * and target nucleic acid sequences c and c * Nucleic acid sequences d and d that are different from * and a universal adaptor nucleic acid sequence a, a in both the enriched sample nucleic acid molecule and the depleted sample nucleic acid molecule. * , b, and b * , are depicted as including common features, shown generally as ovals in the figure. As further described herein with respect to Figure IF, such common features are suitable for enzymatic degradation under certain conditions, such as when the universal adapter nucleic acid sequence is single-stranded.

[0021] The method of the present disclosure is suitable for enriching multiple sample solutions containing nucleic acid molecules. In one embodiment, the sample solution is selected from the group consisting of a WGS library, a WES library, an ATAC-seq library, a ChIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, a single-cell RNA-seq library, a DNA data storage library, or any other library with universal adapters at both ends. The mixture of DNA molecules may be pre-amplified or unamplified, enzymatically generated, or chemically synthesized. The universal adapters (domain a and domain b) are used to enrich the DNA molecules. * ) may comprise DNA and / or RNA nucleotides. As further described herein, at least one of the ribonucleotides may be guanine. In one embodiment, a universal adaptor nucleic acid sequence is present on all or substantially all nucleic acid molecules in the library.

[0022] In one embodiment, the sample solution includes double-stranded or single-stranded sample nucleic acid molecules containing 3' modifications configured to prevent or limit self-annealing and extension, such as from a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, and an RNA-seq library. In one embodiment, such 3' modifications include dideoxynucleotides (ddNTPs), inverted 3'dT, or nucleotide sequences that reduce binding energy (e.g., adenine, thymine, or uracil). In one embodiment, the starting sample solution includes double-stranded sample nucleic acid molecules, such as a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, and an RNA-seq library, generated by using PCR primers containing poly-T or poly-A overhangs at their 5' ends.

[0023] In one embodiment, the universal adapter nucleic acid sequence is added by PCR, transposition, reverse transcription, ligation, chemical synthesis, or other well-known methods for adding adapters to DNA sequences, e.g., as further described herein with respect to the kits of the present disclosure.

[0024] In one embodiment, the universal adapter nucleic acid sequence comprises a nucleic acid sequence adjacent to the 3' or 5' end that is configured not to bind to itself, such as in a hairpin configuration, thus avoiding self-priming. In one embodiment, the universal adapter nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof. See, e.g., Figures 6 and 7.

[0025] In one embodiment, the nucleotides in the sample solution include ribonucleotides or deoxynucleotides. In one embodiment, such nucleotides include nucleotides selected from the group consisting of locked nucleic acids, peptide nucleic acids, 2'-O-methyl RNA, 2'-O-methoxyethyl RNA, and phosphorothioate-modified nucleic acids. Thus, in one embodiment, a degradative enzyme, such as RNase T1, further described herein, is replaced with a degradative enzyme capable of selectively cleaving modified ribonucleotides or deoxynucleotides having a single-stranded conformation.

[0026] As described above, in one embodiment, the method includes introducing into the sample solution one or more capture primer nucleic acid molecules that are complementary or partially complementary to target nucleic acid sequences of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules. Figure 1B schematically illustrates the sample solution of Figure 1A further comprising a capture primer nucleic acid molecule c', according to an embodiment of the present disclosure.

[0027] As described above, a capture primer nucleic acid molecule is complementary or partially complementary to a target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule contains multiple bases, such as 1 to 5 bases, that are not complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is 90% or more complementary to the target nucleic acid sequence. However, such partially complementary capture primer nucleic acid molecules are configured to bind to the target nucleic acid sequence depending on, for example, the annealing temperature and / or other reaction conditions described herein.

[0028] In one embodiment, the method includes maintaining the temperature of the sample solution above the melting temperature of the plurality of sample nucleic acid molecules. Figure 1C schematically illustrates the sample solution of Figure 1B after melting the enriched and depleted nucleic acid molecules according to an embodiment of the present disclosure. In one embodiment, the melting temperature is 95°C or higher. At the melting temperature of the plurality of sample nucleic acid molecules, the temperature of the sample solution is sufficient to fully or partially cleave Watson-Crick bonds between the sample nucleic acid molecules, thereby increasing the number of single-stranded or partially single-stranded sample nucleic acid molecules in the sample solution. As shown, such melting results in the target nucleic acid sequences c and c * and nucleic acid sequences d and d * is exposed and becomes available to bind to other nucleic acid sequences, such as the capture primer nucleic acid molecule c'.

[0029] In one embodiment, the method includes maintaining the sample solution at a temperature near or below the annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence. Such an annealing temperature is generally suitable for annealing at least a portion of the capture primer nucleic acid molecule to the target nucleic acid sequence. In one embodiment, the annealing temperature ranges from about 50°C to about 72°C. Figure ID illustrates a sample solution of a target sequence c of a nucleic acid molecule to be enriched according to an embodiment of the present disclosure. * 1C after annealing capture primer nucleic acid molecules c' to the target nucleic acid sequence c of the sample nucleic acid molecule to be enriched. * is bonded to.

[0030] In one embodiment, the capture primer nucleic acid molecule is configured to be predominantly single-stranded at the annealing temperature. In this regard, the capture primer nucleic acid molecule is configured to be predominantly single-stranded at the annealing temperature and therefore to bind to the target nucleic acid sequence most of the time. In one embodiment, the capture primer nucleic acid molecule is configured to be predominantly at least partially double-stranded at the annealing temperature. In this regard, the capture primer nucleic acid molecule is in a configuration suitable for binding to the target nucleic acid sequence less often than at the annealing temperature. Thus, binding of such double-stranded capture primer nucleic acid molecules to target nucleic acid sequences is generally more selective than that of single-stranded capture primer nucleic acid molecules.

[0031] In one embodiment, the capture primer nucleic acid molecule further comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule. Such double-stranded capture primer nucleic acid molecules are generally double-stranded at the annealing temperature and are therefore less likely to bind to the target nucleic acid sequence. In this regard, such double-stranded capture primer nucleic acid molecules are more likely to bind to the target nucleic acid sequence.

[0032] In one embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules of the plurality of sample nucleic acid molecules, and the second target nucleic acid sequence is different from the target nucleic acid sequence. In this regard, by maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, the capture primer nucleic acid molecule can bind to various target nucleic acid sequences. As further described herein with reference to Figures 1E and 1F, sample nucleic acid molecules containing various target sequences complementary or partially complementary to the capture primer nucleic acid molecule can undergo enzymatic extension and be protected from degradation.

[0033] In one embodiment, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In one embodiment, the phosphorothioate bond is located between the 3'-terminal base of the capture primer nucleic acid molecule and the base immediately adjacent to the 3'-terminal base. Such a phosphorothioate bond is configured to withstand 3' exonuclease activity, such as that in a proofreading polymerase.

[0034] As described above, the sample nucleic acid molecule comprises a universal adapter nucleic acid sequence. In one embodiment, the universal adapter nucleic acid sequence of the plurality of sample nucleic acid molecules comprises an adapter tag nucleic acid sequence. In one embodiment, the adapter tag nucleic acid sequence defines a unique nucleic acid sequence. Such a unique sequence can be used to determine the origin of the sample nucleic acid molecule (e.g., the cell, tissue, or suspension from which it originated) if such a unique nucleic acid sequence has a different sequence than another adapter tag nucleic acid sequence used to tag sample nucleic acid molecules in other samples, such as other cells, tissues, or cell suspensions.

[0035] Such adaptor tag nucleic acid sequences are suitable for enumerating multiple nucleic acid molecules in a sample, such as by sequencing the sample solution. In one embodiment, each adaptor tag nucleic acid molecule comprises multiple degenerate bases suitable for enumerating amplified sample nucleic acid molecules after a nucleic acid amplification reaction.

[0036] In one embodiment, the annealing temperature of the capture primer nucleic acid molecules and the second target nucleic acid sequence is relatively close to the annealing temperature of the capture primer nucleic acid molecules and the target nucleic acid sequence such that at least some of the capture primer nucleic acid molecules can bind to the second target nucleic acid sequence by maintaining the sample solution at the annealing temperature of the capture primer nucleic acid molecules and the target nucleic acid sequence. Thus, in one embodiment, the capture primer nucleic acid molecules and the second target nucleic acid sequence have a second annealing temperature within about 1°C to about 5°C of the annealing temperature.

[0037] In one embodiment, the sample solution is maintained at a temperature near, but possibly not exactly at, the annealing temperature. In this regard, capture primer nucleic acid molecules may have varying binding specificities, such that the capture primer nucleic acid molecules may bind to multiple target nucleic acid sequences, e.g., having relatively similar sequences, thereby enriching multiple different sample nucleic acid molecules. Thus, in one embodiment, maintaining the sample solution at a temperature near or below the annealing temperature of the capture primer nucleic acid molecules includes maintaining the sample solution at a temperature within about 1°C to about 5°C of the annealing temperature of the capture primer nucleic acid molecules.

[0038] As described above, in one embodiment, a method according to the present disclosure includes enzymatically extending a capture primer nucleic acid molecule annealed to a target nucleic acid sequence of one or more sample nucleic acid molecules. In one embodiment, enzymatically extending the capture primer nucleic acid molecule includes introducing into the sample solution an extension enzyme configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence. Figure 1E illustrates an example of an enzymatically extending capture primer nucleic acid molecule annealed to a target nucleic acid sequence, according to an embodiment of the present disclosure. * 1D after enzymatic extension of a capture primer nucleic acid molecule c' annealed to a target nucleic acid sequence c'. * The nucleic acid sequence annealed to the universal adaptor nucleic acid sequence b is extended to form the universal adaptor nucleic acid sequence b * As further described herein, by binding to a universal adaptor nucleic acid sequence, the extended capture primer nucleic acid molecule inhibits enzymatic degradation of double-stranded sample nucleic acid molecules.

[0039] The extending enzyme can include any enzyme configured to perform enzymatic extension of a capture primer nucleic acid molecule that is annealed to another nucleic acid molecule, hi one embodiment, the extending enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and combinations thereof.

[0040] In one embodiment, the step of enzymatically extending the capture primer nucleic acid molecule comprises maintaining the sample solution at or near an extension temperature of the extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence with the extension enzyme. Such extension temperature may be the same as or different from the annealing temperature. In one embodiment, the extension temperature is in the range of about 68°C to about 72°C.

[0041] The disclosed method includes enzymatically degrading specific nucleic acid molecules in a sample solution to provide an enriched sample solution containing a higher proportion of sample nucleic acid molecules containing target nucleic acid sequences than the sample solution. In one embodiment, such enzymatic degradation includes enzymatically degrading single-stranded sample nucleic acid molecules. As described above with respect to Figures 1D and 1E, sample nucleic acid molecules containing nucleic acid sequences complementary or partially complementary to capture primer nucleic acid molecules may generally be double-stranded. In this regard, by enzymatically degrading single-stranded nucleic acid molecules, such as in combination with other steps such as amplifying intact sample nucleic acid molecules, the sample solution is enriched for nucleic acid molecules containing target nucleic acid sequences.

[0042] In one embodiment, the step of enzymatically degrading the single-stranded sample nucleic acid molecules includes introducing into the sample solution a degradative enzyme configured to degrade single-stranded nucleic acid molecules comprising a universal adaptor nucleic acid sequence. In one embodiment, the degradative enzyme is introduced into the sample solution after the step of enzymatically extending the capture primer nucleic acid molecules. In one embodiment, the degradative enzyme is introduced into the sample solution before the step of enzymatically extending the capture primer nucleic acid molecules. In such an embodiment, the degradative enzyme may not be active, for example, at the extension temperature, and therefore does not degrade, or does not substantially degrade, single-stranded nucleic acid molecules at the extension temperature. Rather, in one embodiment, the degradative enzyme is active at temperatures lower than the extension temperature.

[0043] In one embodiment, the step of enzymatically degrading the single-stranded sample nucleic acid molecules comprises maintaining the temperature of the sample solution at the decomposition temperature of the decomposition enzyme. In one embodiment, the decomposition temperature is lower than the annealing temperature. In one embodiment, the decomposition temperature is lower than the extension temperature. In one embodiment, the decomposition temperature is about 60° C. or less.

[0044] In one embodiment, the decomposition temperature is the activity temperature of the decomposition enzyme. Thus, by maintaining the sample solution at or near the decomposition temperature, the decomposition enzyme becomes active, for example, active in decomposing single-stranded nucleic acid molecules. In one embodiment, the decomposition enzyme is inactive at a temperature selected from the extension temperature, melting temperature, annealing temperature, and combinations thereof. In this regard, the decomposition enzyme does not, or does not substantially, enzymatically decompose single-stranded nucleic acid molecules in the sample solution, such as before enzymatic extension of annealed capture primer nucleic acid molecules annealed to target nucleic acid sequences.

[0045] In one embodiment, the degradative enzyme becomes active at the degradative temperature after being inactive at a temperature higher than the degradative temperature (e.g., at the extension temperature). In this regard, in one embodiment, the degradative enzyme is configured to preferentially or selectively degrade sample nucleic acid molecules, such as single-stranded sample nucleic acid molecules, after being inactive at a temperature higher than the degradative temperature. Without being bound by theory, it is believed that the degradative enzyme is inactive at temperatures higher than the activity temperature, e.g., when the degradative enzyme adopts an inactive conformation, and that degradation is further activated when the temperature of the sample solution is maintained within the activity range and the degradative enzyme adopts an active conformation.

[0046] In one embodiment, enzymatic degradation of the single-stranded sample nucleic acid molecules includes degrading a portion of the universal adapter nucleic acid sequence present on the single-stranded sample nucleic acid molecules. Figure 1F schematically illustrates the sample solution of Figure 1E after enzymatic degradation of the single-stranded sample nucleic acid molecules, according to an embodiment of the present disclosure. In the illustrated embodiment, the degradative enzyme degrades the universal adapter sequence b that originally contained the target portion of the universal adapter nucleic acid sequence (shown here as an oval). * The single-stranded nucleic acid molecule is shown as having a portion thereof enzymatically degraded, which is distinct from the double-stranded sample nucleic acid, the latter of which contains the target nucleic acid sequence c * and undergoes enzymatic extension by an extension enzyme. In this regard, the double-stranded sample nucleic acid contains the intact universal adapter nucleic acid sequence b * is shown as having

[0047] In one embodiment, the universal adapter nucleic acid sequence is completely single-stranded. In this regard, the universal adapter nucleic acid sequence is not base-paired to any other nucleic acid sequence, such as on another nucleic acid molecule. In one embodiment, the universal adapter nucleic acid sequence is only partially single-stranded. In one embodiment, the universal adapter nucleic acid sequence is single-stranded at one or more nucleotides and is configured to be enzymatically degraded by a degradative enzyme when single-stranded.

[0048] Enzymatic degradation of single-stranded sample nucleic acid molecules can include multiple forms of degradation configured to render degraded sample nucleic acids, such as those containing universal adapter nucleic acid molecules, unsuitable for nucleic acid amplification reactions. In one embodiment, enzymatic degradation of single-stranded sample nucleic acid molecules includes cleaving the backbone of the universal adapter nucleic acid molecule of the single-stranded sample nucleic acid molecules. In one embodiment, enzymatic degradation of single-stranded sample nucleic acid molecules includes digesting a portion of the universal adapter nucleic acid molecule of the single-stranded sample nucleic acid molecules.

[0049] As described above, in one embodiment, the degradative enzyme is configured to perform enzymatic degradation of single-stranded nucleic acid molecules, such as single-stranded sample nucleic acid molecules. In one embodiment, the degradative enzyme is a ribonuclease. In one embodiment, the degradative enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of RNase T1, RNase A, and combinations thereof.

[0050] In one embodiment, the degradative enzyme is RNase T1. In one embodiment, the degradative enzyme is according to SEQ ID NO: 14. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 14. In one embodiment, the universal adapter nucleic acid sequence comprises riboguanine. In one embodiment, the universal adapter nucleic acid sequence comprises multiple riboguanines. Because RNase T1 selectively degrades single-stranded riboguanines, if the universal adapter nucleic acid sequence contains one or more riboguanines, the RNase T1 degradative enzyme is configured to degrade the universal adapter nucleic acid sequence, such as when the sample solution is maintained at an RNase T1 activity temperature.

[0051] In one embodiment, the degradative enzyme is RNase A. In one embodiment, the degradative enzyme is according to SEQ ID NO: 15. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 15. In one embodiment, the universal adapter nucleic acid sequence comprises a base selected from the group consisting of ribocytosine, ribouracil, and combinations thereof. In one embodiment, the universal adapter nucleic acid sequence comprises multiple ribocytosines, multiple ribouracils, and combinations thereof. Because RNase A selectively degrades single-stranded ribocytosines and ribouracils (e.g., at salt concentrations greater than 300 mM), when the universal adapter nucleic acid sequence comprises one or more ribocytosines and / or ribouracils, the RNase A degradative enzyme is configured to degrade the universal adapter nucleic acid sequence, such as when the sample solution is maintained at an RNase A activity temperature.

[0052] In one embodiment, the disclosed method includes repeated enzymatic extension of a capture primer nucleic acid molecule and enzymatic degradation of single-stranded sample nucleic acid molecules. By repeating the enzymatic extension and enzymatic degradation, the extension enzyme, capture primer nucleic acid molecule, and degradation enzyme can be used one or more additional times to selectively degrade sample nucleic acid molecules that do not contain the target nucleic acid sequence. As described above, in one embodiment, such degradation includes degradation of the universal adapter nucleic acid sequence, which can then be used in a nucleic acid amplification reaction. As further described herein with respect to Figures 1I and 1J, sequences containing an intact universal adapter nucleic acid sequence are preferentially enriched.

[0053] In one embodiment, the method further includes maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules, such as after enzymatic extension of the capture primer nucleic acid molecules and enzymatic degradation of the single-stranded sample nucleic acid molecules. In this regard, the sample solution containing the sample nucleic acid molecules with enzymatically degraded or intact universal adapter nucleic acid sequences is single-stranded and therefore configured for further enzymatic extension and degradation. Figure 1G schematically illustrates melting of nucleic acid molecules in the sample solution of Figure 1F, according to an embodiment of the present disclosure.

[0054] In one embodiment, the method of the present disclosure includes purifying a plurality of sample nucleic acid molecules in the enriched sample solution. Figure 1H schematically illustrates the sample solution of Figure 1G after removal of capture primer nucleic acid molecules, according to an embodiment of the present disclosure. Such purification may include, for example, purification using SPRI beads. In one embodiment, purifying a plurality of sample nucleic acid molecules in the enriched sample solution includes removing a reagent selected from the group consisting of capture primer nucleic acid molecules, enzymes, and combinations thereof from the enriched sample solution. Such purification of the sample solution can simplify sequencing data based on the sample solution by reducing the number of nucleic acid molecules present in the sample solution and, as a result, reducing the amount of sequencing data based on the sample solution, particularly by reducing the amount of sequencing data not related to the target nucleic acid sequence.

[0055] In one embodiment, a method according to the present disclosure comprises amplifying sample nucleic acid molecules after enzymatic degradation of single-stranded nucleic acid molecules. Thus, in one embodiment, the method comprises introducing a plurality of amplification primer nucleic acid molecules into an enriched sample solution. In one embodiment, the amplification primer nucleic acid molecules of the plurality of amplification primer nucleic acid molecules are complementary to a universal adapter nucleic acid sequence. Figure 1I illustrates a polymerase chain reaction (PCR) primer a *1H schematically illustrates the sample solution of FIG. 1H further comprising universal adapter sequences a and b of the sample nucleic acid molecules in the sample solution. As shown, the PCR primers are * and is complementary to b.

[0056] In one embodiment, the method includes providing an amplified enriched sample solution by performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in the enriched sample solution with a plurality of amplification primer nucleic acid molecules. Figure 1J schematically illustrates the sample solution of Figure 1I after PCR amplification of the sample nucleic acid molecules in the sample solution, according to an embodiment of the present disclosure. As shown, the sample solution contains target sequences c and c * The proportion of sample nucleic acid molecules containing nucleic acid sequences d and d * higher than in the case of

[0057] As described above and shown in Figure 1J, because at least some of the universal adapter nucleic acid sequences of the sample nucleic acid molecules are degraded, these degraded sample nucleic acid molecules do not participate in the nucleic acid amplification reaction, and therefore, the amplification-enriched sample solution is considered to have a low proportion of such sample nucleic acid molecules. In this regard, in one embodiment, the step of performing a nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the enriched sample solution does not amplify, or does not substantially amplify, the sample nucleic acid molecules that have been degraded by the degradative enzyme.

[0058] In one embodiment, the method includes preparing an enriched sample solution for use in sequencing, such as a next-generation sample preparation, by performing one or more enzymatic reactions on the amplification-enriched sample solution. Thus, in one embodiment, the method of the present disclosure includes performing a reaction on the amplification-enriched sample solution selected from a nucleic acid fragmentation reaction, enzymatic end repair, A-tailing, adapter ligation, polymerase chain reaction, and combinations thereof.

[0059] In one embodiment, a method according to the present disclosure includes sequencing nucleic acid molecules in an enriched sample solution. In one embodiment, sequencing nucleic acid molecules in the enriched sample solution includes generating sample nucleic acid information based on a plurality of sample nucleic acid molecules in the enriched sample solution. As described above, in certain embodiments, the universal adapter nucleic acid molecule comprises an adapter tag nucleic acid molecule. In one embodiment, sequencing nucleic acid molecules in the enriched sample solution includes generating adapter tag nucleic sequence information based on the adapter tag nucleic acid sequence.

[0060] Deficiency method In one embodiment, the present disclosure provides a method for depleting a target nucleic acid sequence, the method comprising: (a) introducing a capture primer nucleic acid molecule, complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of a plurality of sample nucleic acid molecules, each sample nucleic acid molecule comprising a universal adapter nucleic acid sequence comprising a ribonucleotide, to a sample solution comprising the plurality of sample nucleic acid molecules; (b) enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically cleaving double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a depleted sample solution having a lower proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution.

[0061] Methods for depleting a target nucleic acid sequence according to embodiments of the present disclosure are described below. In this regard, attention is directed to Figures 2A-2J, which schematically illustrate methods for depleting a target nucleic acid sequence according to embodiments of the present disclosure.

[0062] 2A is a schematic illustration of a sample solution containing enriched and depleted nucleic acid molecules. As shown, the sample solution includes a starting pool of nucleic acid molecules containing enriched and depleted double-stranded nucleic acid molecules. The enriched double-stranded sample nucleic acid molecules are separated by a universal adaptor nucleic acid sequence a, a *, b, and b * and target nucleic acid sequences c and c * The double-stranded nucleic acid molecule to be depleted is shown to include universal adaptor nucleic acid sequences a, a * , b, and b * and nucleic acid sequences c and c * target nucleic acid sequences d and d * and a) and b) are shown to contain universal adaptor nucleic acid sequences a, a, and b in both the enriched and depleted nucleic acid molecules. * , b, and b * are depicted as including common features, shown schematically as ovals in the figure. As further described herein with respect to Figure 2F, such common features are suitable for enzymatic degradation under certain conditions, such as when the universal adapter nucleic acid sequence is double-stranded.

[0063] The method of the present disclosure is suitable for enriching multiple sample solutions containing nucleic acid molecules. In one embodiment, the sample solution is selected from the group consisting of a WGS library, a WES library, an ATAC-seq library, a ChIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, a single-cell RNA-seq library, a DNA data accumulation library, or any other library with universal adapters at both ends. The mixture of DNA molecules may be pre-amplified or unamplified, enzymatically generated, or chemically synthesized. The universal adapters (domain a and domain b) are used to enrich the DNA molecules. * ) may comprise DNA and / or RNA nucleotides. As further described herein, at least one of the ribonucleotides may be guanine. In one embodiment, a universal adaptor nucleic acid sequence is present on all or substantially all nucleic acid molecules in the library.

[0064] In one embodiment, the sample solution includes double-stranded or single-stranded sample nucleic acid molecules containing 3' modifications configured to prevent or limit self-annealing and extension, such as from a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, and an RNA-seq library. In one embodiment, such 3' modifications include dideoxynucleotides (ddNTPs), inverted 3'dT, or nucleotide sequences that reduce binding energy (e.g., adenine, thymine, or uracil). In one embodiment, the starting sample solution includes double-stranded sample nucleic acid molecules, such as a WGS library, a WES library, an ATAC-seq library, a CHIP-seq library, a WTS library, a Bisulfite-seq library, and an RNA-seq library, generated by using PCR primers containing poly-T or poly-A overhangs at their 5' ends.

[0065] In one embodiment, the universal adapter nucleic acid sequence is added by PCR, transposition, reverse transcription, ligation, chemical synthesis, or other well-known methods for adding adapters to DNA sequences, e.g., as further described herein with respect to the kits of the present disclosure.

[0066] In one embodiment, the universal adapter nucleic acid sequence comprises a nucleic acid sequence adjacent to the 3' or 5' end that is configured not to bind to itself, such as in a hairpin configuration, thus avoiding self-priming. In one embodiment, the universal adapter nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof. See, e.g., Figures 6 and 7.

[0067] In one embodiment, the nucleotides in the sample solution include ribonucleotides or deoxynucleotides. In one embodiment, such nucleotides include nucleotides selected from the group consisting of locked nucleic acids, peptide nucleic acids, 2'-O-methyl RNA, 2'-O-methoxyethyl RNA, and phosphorothioate-modified nucleic acids. Thus, in one embodiment, a degradative enzyme such as RNase HII is replaced with a degradative enzyme configured to selectively cleave modified ribonucleotides or deoxynucleotides having a double-stranded conformation. In one embodiment, the sample nucleic acid molecules include methylated DNA, and the degradative enzyme includes a restriction enzyme that specifically cleaves methylated (or hemimethylated) double-stranded DNA.

[0068] As described above, in one embodiment, the method includes introducing into the sample solution one or more capture primer nucleic acid molecules that are complementary or partially complementary to target nucleic acid sequences of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules. Figure 2B shows a capture primer nucleic acid molecule d' according to an embodiment of the present disclosure. 1 and d' 2* 2B is a schematic illustration of the sample solution of FIG. 2A further comprising a capture primer nucleic acid molecule d' as shown. 1 and d' 2* is the target nucleic acid sequence d on the sample nucleic acid molecule to be depleted, but not on the sample nucleic acid molecule to be enriched. * and d is complementary or partially complementary to d.

[0069] In one embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to the universal adapter nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule contains a plurality of bases, such as 1 to 5, that are not complementary to the universal adapter nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is 90% or more complementary to the universal adapter sequence. However, such partially complementary capture primer nucleic acid molecules are configured to bind to the target nucleic acid sequence depending on, for example, the annealing temperature and / or other reaction conditions described herein.

[0070] In one embodiment, the method includes maintaining the temperature of the sample solution above the melting temperature of the plurality of sample nucleic acid molecules. Figure 2C schematically illustrates the sample solution of Figure 2B after melting the enriched and depleted sample nucleic acid molecules, according to an embodiment of the present disclosure. In one embodiment, the melting temperature is 95°C or higher. At the melting temperature of the plurality of sample nucleic acid molecules, the temperature of the sample solution is sufficient to fully or partially cleave Watson-Crick bonds between the sample nucleic acid molecules, thereby increasing the number of single-stranded or partially single-stranded sample nucleic acid molecules in the sample solution. As shown, such melting results in the formation of target nucleic acid sequences d and d. * and nucleic acid sequences c and c * is exposed, and the capture primer nucleic acid molecule d' 1 and d' 2* The resulting nucleic acid sequence can then be linked to other nucleic acid sequences such as:

[0071] In one embodiment, the method includes maintaining the sample solution at a temperature near or below the annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence. Such an annealing temperature is generally suitable for annealing at least a portion of the capture primer nucleic acid molecule to the target nucleic acid sequence. In one embodiment, the annealing temperature ranges from about 50°C to about 72°C. Figure 2D illustrates a depletion of a sample nucleic acid molecule from a target sequence d in accordance with an embodiment of the present disclosure. * and d is a capture primer nucleic acid molecule d' 1 and d' 2* 2C after annealing the capture primer nucleic acid molecule d'. 1 and d' 2* is the target nucleic acid sequence d of the sample nucleic acid molecule to be depleted * and is bonded to d.

[0072] In one embodiment, the capture primer nucleic acid molecule is configured to be predominantly single-stranded at the annealing temperature. In this regard, the capture primer nucleic acid molecule is configured to be predominantly single-stranded at the annealing temperature and therefore to bind to the target nucleic acid sequence most of the time. In one embodiment, the capture primer nucleic acid molecule is configured to be predominantly at least partially double-stranded at the annealing temperature. In this regard, the capture primer nucleic acid molecule is in a configuration suitable for binding to the target nucleic acid sequence less often than at the annealing temperature. Thus, binding of such double-stranded capture primer nucleic acid molecules to target nucleic acid sequences is generally more selective than that of single-stranded capture primer nucleic acid molecules.

[0073] In one embodiment, the capture primer nucleic acid molecule further comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule. Such double-stranded capture primer nucleic acid molecules are generally double-stranded at the annealing temperature and are therefore less likely to bind to the target nucleic acid sequence. In this regard, such double-stranded capture primer nucleic acid molecules are more likely to bind to the target nucleic acid sequence.

[0074] In one embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules of the plurality of sample nucleic acid molecules, and the second target nucleic acid sequence is different from the target nucleic acid sequence. In this regard, by maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, the capture primer nucleic acid molecule can bind to various target nucleic acid sequences. As further described herein with reference to Figures 2E and 2F, sample nucleic acid molecules containing various target sequences complementary or partially complementary to the capture primer nucleic acid molecule can undergo enzymatic extension and be labeled for degradation.

[0075] In one embodiment, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In one embodiment, the phosphorothioate bond is located between the 3'-terminal base of the capture primer nucleic acid molecule and the base immediately adjacent to the 3'-terminal base. Such a phosphorothioate bond is configured to withstand 3' exonuclease activity, such as that in a proofreading polymerase.

[0076] As described above, the sample nucleic acid molecule comprises a universal adapter nucleic acid sequence. In one embodiment, the universal adapter nucleic acid sequence of the plurality of sample nucleic acid molecules comprises an adapter tag nucleic acid sequence. In one embodiment, the adapter tag nucleic acid sequence defines a unique nucleic acid sequence. Such a unique sequence can be used to determine the origin of the sample nucleic acid molecule (e.g., the cell, tissue, or suspension from which it originated) if such a unique nucleic acid sequence has a different sequence than another adapter tag nucleic acid sequence used to tag sample nucleic acid molecules in other samples, such as other cells, tissues, or cell suspensions.

[0077] Such adaptor tag nucleic acid sequences are suitable for enumerating multiple nucleic acid molecules in a sample, such as by sequencing the sample solution. In one embodiment, each adaptor tag nucleic acid molecule comprises multiple degenerate bases suitable for enumerating amplified sample nucleic acid molecules after a nucleic acid amplification reaction.

[0078] In one embodiment, the annealing temperature of the capture primer nucleic acid molecules and the second target nucleic acid sequence is relatively close to the annealing temperature of the capture primer nucleic acid molecules and the target nucleic acid sequence such that at least some of the capture primer nucleic acid molecules can bind to the second target nucleic acid sequence by maintaining the sample solution at the annealing temperature of the capture primer nucleic acid molecules and the target nucleic acid sequence. Thus, in one embodiment, the capture primer nucleic acid molecules and the second target nucleic acid sequence have a second annealing temperature within about 1°C to about 5°C of the annealing temperature.

[0079] In one embodiment, the sample solution is maintained at a temperature near, but possibly not exactly at, the annealing temperature. In this regard, capture primer nucleic acid molecules may have varying binding specificities, such that the capture primer nucleic acid molecule may bind to multiple target nucleic acid sequences, e.g., having relatively similar sequences, thereby depleting multiple different sample nucleic acid molecules. Thus, in one embodiment, maintaining the sample solution at a temperature near or below the annealing temperature of the capture primer nucleic acid molecule includes maintaining the sample solution at a temperature within about 1°C to about 5°C of the annealing temperature of the capture primer nucleic acid molecule.

[0080] As described above, in one embodiment, the method includes enzymatically extending a capture primer nucleic acid molecule that is annealed to a target nucleic acid sequence of one or more sample nucleic acid molecules. * and a capture primer nucleic acid molecule d' annealed to d. 1 and d' 2* 2D after enzymatic extension of the capture primer nucleic acid molecule d'. 1 and d' 2* is the target sequence d on the sample nucleic acid molecule to be depleted * and d. Also, as shown, target nucleic acid sequences d and d * The nucleic acid sequence annealed to the universal adaptor nucleic acid sequences a and b is extended to form the universal adaptor nucleic acid sequences a and b. * As further described herein, the universal adaptor nucleic acid sequences a and b * By binding to the extended capture primer nucleic acid molecule, the extended capture primer nucleic acid molecule activates enzymatic degradation of the double-stranded sample nucleic acid molecule.

[0081] The extending enzyme can include any enzyme configured to perform enzymatic extension of a capture primer nucleic acid molecule that is annealed to another nucleic acid molecule, hi one embodiment, the extending enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and combinations thereof.

[0082] In one embodiment, the step of enzymatically extending the capture primer nucleic acid molecule comprises maintaining the sample solution at or near an extension temperature of the extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence with the extension enzyme. Such extension temperature may be the same as or different from the annealing temperature. In one embodiment, the annealing temperature is in the range of about 50°C to about 72°C.

[0083] As described above, the method according to the present disclosure includes a step of enzymatically cleaving double-stranded ribonucleic acid molecules of the sample nucleic acid molecules. Figure 2F is a schematic illustration of the sample solution of Figure 2E after enzymatic degradation of the double-stranded nucleic acid molecules according to an embodiment of the present disclosure. In the illustrated embodiment, the universal adapter nucleic acid sequences a and b bound to the capture primer nucleic acid molecules that have undergone enzymatic extension are shown. * are degraded. In this regard, the oval of the capture primer nucleic acid molecule is shown as being degraded. As further described herein with respect to Figure 2F, such degradation can include cleavage or degradation of the backbone of the universal adaptor nucleic acid sequence of the double-stranded sample nucleic acid molecule.

[0084] In the illustrated embodiment, the degradative enzyme is a nucleic acid sequence encoding universal adapter sequences a and b, which contain the target portion of the universal adapter nucleic acid sequence (shown here as an oval). * A portion of a double-stranded nucleic acid molecule comprising target nucleic acid sequences d and d is shown enzymatically degraded. * A sample nucleic acid molecule containing universal adapter sequences a and b * is enzymatically degraded. This differs from the single-stranded sample nucleic acid, which contains nucleic acid sequences c and c *and has the universal adapter sequence intact. In this regard, the single-stranded sample nucleic acid is depicted as having the universal adapter nucleic acid sequence intact.

[0085] Enzymatic degradation of double-stranded sample nucleic acid molecules can include multiple forms of degradation configured to render degraded sample nucleic acids, such as those containing universal adapter nucleic acid molecules, unsuitable for nucleic acid amplification reactions. In one embodiment, performing enzymatic degradation of double-stranded sample nucleic acid molecules includes cleaving the backbone of the universal adapter nucleic acid molecule of the double-stranded sample nucleic acid molecules. In one embodiment, performing enzymatic cleavage of double-stranded sample nucleic acid molecules includes degrading a portion of the universal adapter nucleic acid sequence on the double-stranded sample nucleic acid molecules. In one embodiment, performing enzymatic cleavage of double-stranded sample nucleic acid molecules includes cleaving the backbone of the universal adapter nucleic acid sequence of the double-stranded sample nucleic acid molecules. In one embodiment, performing enzymatic cleavage of double-stranded sample nucleic acid molecules includes digesting a portion of the universal adapter nucleic acid sequence of the double-stranded sample nucleic acid molecules.

[0086] In one embodiment, the step of enzymatically degrading the double-stranded sample nucleic acid molecules comprises maintaining the temperature of the sample solution at the decomposition temperature of the decomposition enzyme. In one embodiment, the decomposition temperature is lower than the annealing temperature. In one embodiment, the decomposition temperature is lower than the extension temperature. In one embodiment, the decomposition temperature is about 60°C or less.

[0087] In one embodiment, the decomposition temperature is the activity temperature of the decomposition enzyme. Thus, by maintaining the sample solution at or near the decomposition temperature, the decomposition enzyme becomes active, for example, active in decomposing double-stranded nucleic acid molecules. In one embodiment, the decomposition enzyme is inactive at a temperature selected from the extension temperature, melting temperature, annealing temperature, and combinations thereof. In this regard, the decomposition enzyme does not, or does not substantially, enzymatically decompose double-stranded nucleic acid molecules in the sample solution, such as before enzymatic extension of annealed capture primer nucleic acid molecules annealed to target nucleic acid sequences.

[0088] In one embodiment, the degradative enzyme becomes active at the degradative temperature after being inactive at a temperature higher than the degradative temperature (e.g., extension temperature). In this regard, in one embodiment, the degradative enzyme is configured to preferentially or selectively degrade sample nucleic acid molecules, such as double-stranded sample nucleic acid molecules, after being inactive at a temperature higher than the degradative temperature. Without being bound by theory, it is believed that the degradative enzyme is inactive at temperatures higher than the activity temperature, e.g., when the degradative enzyme adopts an inactive conformation, and that degradation is further activated when the temperature of the sample solution is maintained within the activity range and the degradative enzyme adopts an active conformation.

[0089] As described above, in one embodiment, the degradative enzyme is configured to perform enzymatic degradation of double-stranded nucleic acid molecules, such as double-stranded sample nucleic acid molecules. In one embodiment, the degradative enzyme is not a restriction endonuclease. In one embodiment, the degradative enzyme is a ribonuclease. In one embodiment, the degradative enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of RNase HII, RNase H, RNase III, and combinations thereof.

[0090] In one embodiment, the degradative enzyme is Rnase HII. In one embodiment, the degradative enzyme is according to SEQ ID NO: 16. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 16.

[0091] In one embodiment the degradative enzyme is Rnase H. In one embodiment the degradative enzyme is according to SEQ ID NO: 17. In one embodiment the degradative enzyme has greater than 90%, greater than 95% or greater than 99% sequence identity to SEQ ID NO: 17.

[0092] In one embodiment, the degradative enzyme is Rnase III. In one embodiment, the degradative enzyme is according to SEQ ID NO: 18. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 18.

[0093] In one embodiment, the method of the present disclosure includes repeating the enzymatic extension of the capture primer nucleic acid molecule and the enzymatic degradation of the double-stranded sample nucleic acid molecule. The repeating enzymatic extension and enzymatic degradation results in the target sequences d and d * The extension enzyme, capture primer nucleic acid molecule, and degradative enzyme can be further used one or more times to selectively degrade sample nucleic acid molecules containing target nucleic acid sequences, such as (I, II, III, III, IV ...

[0094] In one embodiment, the method further includes maintaining the temperature of the sample solution above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules, such as after enzymatic extension of the capture primer nucleic acid molecules to enzymatically degrade the double-stranded sample nucleic acid molecules. In this regard, the sample solution containing the sample nucleic acid molecules with the enzymatically degraded or intact universal adapter nucleic acid sequences is single-stranded and thus configured to subsequently bind with the capture primer nucleic acid molecules. Figure 2G schematically illustrates melting of nucleic acid molecules in the sample solution of Figure 2F, according to an embodiment of the present disclosure.

[0095] In one embodiment, a method according to the present disclosure includes purifying a plurality of sample nucleic acid molecules in a depleted sample solution. Figure 2H shows a capture primer nucleic acid molecule d' according to an embodiment of the present disclosure. 1 and d' 2* 2G schematically illustrates the sample solution of FIG. 2G after removal of the target nucleic acid sequence. Such purification can include, for example, purification using SPRI beads. In one embodiment, purifying the plurality of sample nucleic acid molecules in the depleted sample solution includes removing a reagent selected from a capture primer nucleic acid molecule, an enzyme, and a combination thereof from the depleted sample solution. Such purification of the sample solution can simplify the sequencing data based on the sample solution, such as by reducing the number of nucleic acid molecules present in the sample solution and reducing the amount of sequencing data based on the sample solution, particularly by reducing the amount of sequencing data not related to the target nucleic acid sequence.

[0096] In one embodiment, a method according to the present disclosure includes amplifying sample nucleic acid molecules after enzymatic degradation of double-stranded nucleic acid molecules. Accordingly, in one embodiment, the method includes introducing a plurality of amplification primer nucleic acid molecules into a depleted sample solution. In one embodiment, the amplification primer nucleic acid molecules of the plurality of amplification primer nucleic acid molecules are complementary to a universal adapter nucleic acid sequence. Figure 2I illustrates polymerase chain reaction (PCR) primers a and b. *2H schematically illustrates the sample solution of FIG. 2H further comprising a universal adapter sequence a of a nucleic acid molecule in the sample solution, according to an embodiment of the present disclosure. As shown, the PCR primers * and is complementary to b.

[0097] In one embodiment, the method includes providing an amplification-deficient sample solution by performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in a depleted sample solution with a plurality of amplification primer nucleic acid molecules. Figure 2J schematically illustrates the sample solution of Figure 2I after PCR amplification of the nucleic acid molecules in the sample solution, according to an embodiment of the present disclosure. As shown, the sample solution contains nucleic acid sequences c and c * The proportion of sample nucleic acid molecules containing target nucleic acid sequences d and d * higher than the sample containing nucleic acid molecules.

[0098] As described above and shown in Figure 2J, because at least some of the universal adapter nucleic acid sequences of the sample nucleic acid molecules are degraded, these degraded sample nucleic acid molecules do not participate in the nucleic acid amplification reaction, and therefore, the amplification-deficient sample solution is considered to have a low proportion of such sample nucleic acid molecules. In this regard, in one embodiment, performing a nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the depleted sample solution does not amplify, or substantially does not amplify, the sample nucleic acid molecules degraded by the degrading enzyme. Thus, the amplification-deficient sample solution has a low proportion of the sequence c or c compared to the original sample solution shown in Figure 2A. * The proportion of nucleic acid molecules containing d or d * Higher than.

[0099] In one embodiment, the method includes preparing a depleted sample solution for use in sequencing, such as a next-generation sample preparation, by performing one or more enzymatic reactions on the amplification-deficient sample solution. Thus, in one embodiment, a method according to the present disclosure includes performing a reaction on the amplification-deficient sample solution selected from a nucleic acid fragmentation reaction, enzymatic end repair, A-tailing, adapter ligation, polymerase chain reaction, and combinations thereof.

[0100] In one embodiment, the method of the present disclosure includes sequencing nucleic acid molecules in a depleted sample solution. In one embodiment, sequencing nucleic acid molecules in the depleted sample solution includes generating sample nucleic acid information based on a plurality of sample nucleic acid molecules in the depleted sample solution. As described above, in certain embodiments, the universal adapter nucleic acid molecule comprises an adapter tag nucleic acid molecule. In one embodiment, sequencing nucleic acid molecules in the depleted sample solution includes generating adapter tag nucleic sequence information based on the adapter tag nucleic acid sequence.

[0101] In one embodiment, the capture primer nucleic acid molecule is a blocked capture primer nucleic acid molecule. In this regard, attention is directed to Figures 3A-3J, which illustrate methods according to embodiments of the present disclosure. Figures 3A-3D are similar to Figures 1A-1D, described elsewhere herein, except that the capture primer nucleic acid molecule includes a capture primer nucleic acid molecule d' that is a blocked capture primer nucleic acid molecule. In this regard, in one embodiment, the blocked capture primer nucleic acid molecule d' is configured to block enzymatic extension by an extending enzyme at the 3' end of the blocked capture primer nucleic acid molecule d'. As shown, the sample solution further includes a non-blocked capture primer nucleic acid molecule a.

[0102] In one embodiment, the blocked capture primer nucleic acid molecule comprises a reverse nucleic acid. In one embodiment, the blocked capture primer nucleic acid molecule comprises one or more adenine or thymine overhangs at the 3' end.

[0103] As shown in FIG. 3E, the blocked capture primer nucleic acid molecule is a target nucleic acid sequence d * In enzymatic extension, the extending enzyme cannot extend beyond the blocked capture primer nucleic acid molecule, but on other sample nucleic acid molecules, the extending enzyme can extend beyond the target nucleic acid sequence d. * The nucleic acid molecule can be extended over the entire molecule that does not contain the nucleic acid (e.g., the enriched sample nucleic acid molecule).

[0104] As shown in Figure 3F, the degradative enzyme enzymatically degrades the single-stranded universal adaptor molecules of the depleted sample nucleic acid. In this regard, the sample solution is subsequently thawed (Figure 3G), purified (Figure 3H), and amplified (Figures 3I and 3J) to obtain the target nucleic acid sequence d. * The sample solution is depleted of molecules containing sequences c and c * The proportion of sample nucleic acid molecules having target nucleic acid sequences d and d * Therefore, the sample solution is depleted of sample nucleic acid molecules having the target nucleic acid sequence.

[0105] Although the blocked capture primer nucleic acid molecules are illustrated as being used in combination with a degradative enzyme configured to degrade single-stranded nucleic acid molecules to deplete sample nucleic acid molecules, according to embodiments of the present disclosure, the blocked capture primer nucleic acid molecules can be used in combination with a degradative enzyme configured to degrade double-stranded sample nucleic acid molecules to enrich for sample nucleic acid molecules having target nucleic acid sequences complementary to the blocked capture primer nucleic acid molecules.

[0106] kit In another aspect, the present disclosure provides kits comprising reagents for enriching and / or depleting target nucleic acid sequences, such as target nucleic acid sequences present in a complex sample solution comprising nucleic acid molecules that do not contain the target nucleic acid sequence.

[0107] Enrichment Kit In one embodiment, the present disclosure provides a kit for enriching a sample nucleic acid molecule comprising a target nucleic acid sequence, the kit comprising a capture primer nucleic acid molecule complementary or partially complementary to the target sequence and a degradative enzyme configured to degrade single-stranded nucleic acid molecules.

[0108] As described above, the kit includes a capture primer nucleic acid molecule. In one embodiment, the capture primer nucleic acid molecule is fully complementary to a target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to one or more target nucleic acid molecules. As further described herein, the capture primer nucleic acid molecule can be at least partially complementary to multiple target nucleic acid sequences, and thus the kit of the present disclosure can be configured to enrich sample nucleic acid molecules having multiple different target nucleic acid sequences, depending on the reaction conditions used.

[0109] As further described herein with respect to Figure ID, the capture primer nucleic acid molecule can be single-stranded, at least partially double-stranded, or double-stranded, such as at the annealing temperature between the capture primer nucleic acid molecule and its target nucleic acid sequence.

[0110] In one embodiment, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In one embodiment, the phosphorothioate bond is located between the 3'-terminal base of the capture primer nucleic acid molecule and the base immediately adjacent to the 3'-terminal base. Such a phosphorothioate bond is configured to withstand 3' exonuclease activity, such as that in a proofreading polymerase.

[0111] In one embodiment, the kit further comprises a plurality of universal adapter nucleic acid molecules configured to bind to the sample nucleic acid molecules, the universal adapter nucleic acid molecules being suitable for use in a nucleic acid amplification reaction, as further described herein with respect to the methods of the present disclosure.

[0112] In one embodiment, the universal adapter nucleic acid molecule comprises riboguanine, such as when the degradative enzyme is Rnase T1. In one embodiment, the universal adapter nucleic acid molecule comprises ribocytosine, ribouracil, or a combination thereof, such as when the degradative enzyme is Rnase A.

[0113] In one embodiment, a universal adapter nucleic acid molecule comprises a nucleic acid sequence adjacent to the 3' or 5' end that is configured so that it does not bind to itself, such as in a hairpin configuration, thus avoiding self-priming. In one embodiment, a universal adapter nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof.

[0114] In one embodiment, the kit further comprises a reagent for attaching a universal adapter nucleic acid molecule to a sample nucleic acid molecule. In one embodiment, the kit comprises a reagent selected from the group consisting of a transposase incorporating an oligonucleotide comprising the universal adapter nucleic acid molecule; a restriction endonuclease; an oligonucleotide or oligonucleotide complex comprising the universal adapter nucleic acid molecule; an oligonucleotide or oligonucleotide complex comprising a T7 promoter; an antibody or antibody fragment against a transcription factor; and combinations thereof.

[0115] The kit according to this embodiment includes a degradative enzyme. In one embodiment, the degradative enzyme is configured to degrade single-stranded nucleic acid molecules. In one embodiment, the degradative enzyme is configured to degrade single-stranded nucleic acid molecules comprising a universal adapter nucleic acid molecule. In one embodiment, the degradative enzyme is a ribonuclease. In one embodiment, the degradative enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of RNase T1, RNase A, and combinations thereof.

[0116] In one embodiment, the degradative enzyme is RNase T1. In one embodiment, the degradative enzyme is according to SEQ ID NO: 14. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 14. In one embodiment, the universal adapter nucleic acid sequence comprises a riboguanine. In one embodiment, the universal adapter nucleic acid sequence comprises multiple riboguanines. Because RNase T1 selectively degrades single-stranded riboguanines, when the universal adapter nucleic acid sequence comprises one or more riboguanines, the RNase T1 degradative enzyme is configured to degrade the universal adapter nucleic acid sequence, such as when the sample solution is maintained at an RNase T1 activity temperature.

[0117] In one embodiment, the degradative enzyme is RNase A. In one embodiment, the degradative enzyme is according to SEQ ID NO: 15. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 15. In one embodiment, the universal adapter nucleic acid sequence comprises a base selected from the group consisting of ribocytosine, ribouracil, and combinations thereof. In one embodiment, the universal adapter nucleic acid sequence comprises a plurality of ribocytosines, a plurality of ribouracils, and combinations thereof. Because RNase A selectively degrades single-stranded ribocytosines and ribouracils (e.g., at salt concentrations greater than 300 mM), when the universal adapter nucleic acid sequence comprises one or more ribocytosines and / or ribouracils, the RNase A degradative enzyme is configured to degrade the universal adapter nucleic acid sequence, such as when the sample solution is maintained at an RNase A activity temperature.

[0118] In one embodiment, the degradative enzyme is inactive in degrading single-stranded nucleic acid molecules above its active temperature range, and after becoming inactive, becomes active in degrading single-stranded nucleic acid molecules within its active temperature range. As further described herein, in one embodiment, the degradative enzyme is inactive at elevated temperatures, such as the enzymatic extension temperature, but becomes active when the temperature of the sample solution is increased and then decreased.

[0119] In one embodiment, the kit further comprises an extending enzyme configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence, hi one embodiment, the extending enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and a combination thereof.

[0120] In one embodiment, the kit further includes instructions for enriching a target nucleic acid sequence, such as in a sample containing sample nucleic acid molecules. In one embodiment, the kit includes instructions for enriching a sample nucleic acid molecule containing a target nucleic acid sequence. In one embodiment, the instructions include instructions that include the steps of: (a) introducing a capture primer nucleic acid molecule that is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules to a sample solution containing a plurality of sample nucleic acid molecules, each sample nucleic acid molecule containing a universal adapter nucleic acid sequence; (b) enzymatically extending the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically degrading single-stranded sample nucleic acid molecules to provide an enriched sample solution having a higher proportion of sample nucleic acid molecules that contain the target nucleic acid sequence than the sample solution. In one embodiment, the instructions further include repeating steps (b) and (c) one or more times on the enriched sample solution. In one embodiment, the instructions further comprise maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules.

[0121] In one embodiment, for enzymatically extending capture primer nucleic acid molecules, the instructions include maintaining the temperature of a sample solution at or above the melting temperature of a plurality of sample nucleic acid molecules; introducing to the sample solution an extension enzyme configured to extend capture primer nucleic acid molecules annealed to target nucleic acid sequences; maintaining the sample solution at a temperature near or below an annealing temperature of the capture primer nucleic acid molecules suitable for annealing the capture primer nucleic acid molecules to the target nucleic acid sequences; and maintaining the sample solution near an extension temperature of the extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecules annealed to the target nucleic acid sequences with the extension enzyme.

[0122] In one embodiment, for performing enzymatic degradation of single-stranded sample nucleic acid molecules, the instructions include introducing into the sample solution a degradative enzyme configured to degrade single-stranded nucleic acid molecules comprising a universal adapter nucleic acid sequence, and maintaining the temperature of the sample solution at the decomposition temperature of the degradative enzyme.

[0123] In one embodiment, the instructions further comprise instructions for attaching a universal adaptor molecule to a sample nucleic acid molecule in a sample solution.

[0124] Deficiency Kit In one embodiment, the present disclosure provides a kit for depleting a sample nucleic acid molecule comprising a target nucleic acid sequence, the kit comprising a capture primer nucleic acid molecule complementary or partially complementary to the target sequence and a degradative enzyme configured to degrade double-stranded nucleic acid molecules.

[0125] As described above, the kit includes a capture primer nucleic acid molecule. In one embodiment, the capture primer nucleic acid molecule is fully complementary to a target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to one or more target nucleic acid molecules. As further described herein, the capture primer nucleic acid molecule can be at least partially complementary to multiple target nucleic acid sequences, and thus the kit of the present disclosure can be configured to enrich sample nucleic acid molecules having multiple different target nucleic acid sequences, depending on the reaction conditions used.

[0126] As further described herein with respect to Figure 2D, the capture primer nucleic acid molecule can be single-stranded, at least partially double-stranded, or double-stranded, such as at the annealing temperature between the capture primer nucleic acid molecule and its target nucleic acid sequence.

[0127] In one embodiment, the capture primer nucleic acid molecule comprises a phosphorothioate bond. In one embodiment, the phosphorothioate bond is located between the 3'-terminal base of the capture primer nucleic acid molecule and the base immediately adjacent to the 3'-terminal base. Such a phosphorothioate bond is configured to withstand 3' exonuclease activity, such as that in a proofreading polymerase.

[0128] In one embodiment, the kit further comprises a plurality of universal adapter nucleic acid molecules configured to bind to the sample nucleic acid molecules, the universal adapter nucleic acid molecules being suitable for use in a nucleic acid amplification reaction, as further described herein with respect to the methods of the present disclosure.

[0129] In one embodiment, a universal adapter nucleic acid molecule comprises a nucleic acid sequence adjacent to the 3' or 5' end that is configured so that it does not bind to itself, such as in a hairpin configuration, thus avoiding self-priming. In one embodiment, a universal adapter nucleic acid molecule comprises a poly-T sequence, a poly-A sequence, or a combination thereof.

[0130] In one embodiment, the kit further comprises a reagent for attaching a universal adapter nucleic acid molecule to a sample nucleic acid molecule. In one embodiment, the kit comprises a reagent selected from the group consisting of a transposase incorporating an oligonucleotide comprising the universal adapter nucleic acid molecule; a restriction endonuclease; an oligonucleotide or oligonucleotide complex comprising the universal adapter nucleic acid molecule; an oligonucleotide or oligonucleotide complex comprising a T7 promoter; an antibody or antibody fragment against a transcription factor; and combinations thereof.

[0131] The kit according to this embodiment includes a degradative enzyme. In one embodiment, the degradative enzyme is configured to cleave a double-stranded nucleic acid molecule comprising a universal adapter nucleic acid molecule. In one embodiment, the degradative enzyme is configured to degrade a double-stranded nucleic acid molecule comprising a universal adapter nucleic acid molecule. In one embodiment, the degradative enzyme is a ribonuclease. In one embodiment, the degradative enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the degradative enzyme is not a restriction endonuclease. In one embodiment, the degradative enzyme is a ribonuclease. In one embodiment, the degradative enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of RNase HII, RNase H, RNase III, and combinations thereof.

[0132] In one embodiment, the degradative enzyme is Rnase HII. In one embodiment, the degradative enzyme is according to SEQ ID NO: 16. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 16.

[0133] In one embodiment the degradative enzyme is Rnase H. In one embodiment the degradative enzyme is according to SEQ ID NO: 17. In one embodiment the degradative enzyme has greater than 90%, greater than 95% or greater than 99% sequence identity to SEQ ID NO: 17.

[0134] In one embodiment, the degradative enzyme is Rnase III. In one embodiment, the degradative enzyme is according to SEQ ID NO: 18. In one embodiment, the degradative enzyme has greater than 90%, greater than 95%, or greater than 99% sequence identity to SEQ ID NO: 18.

[0135] In one embodiment, the kit further comprises an extending enzyme configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence, hi one embodiment, the extending enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and a combination thereof.

[0136] In one embodiment, the kit further includes instructions for depleting a target nucleic acid sequence, such as in a sample containing sample nucleic acid molecules. In one embodiment, the instructions include instructions for performing a depletion method according to the present disclosure. In one embodiment, the instructions include the steps of: (a) introducing a capture primer nucleic acid molecule complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules to a sample solution containing a plurality of sample nucleic acid molecules, each sample nucleic acid molecule comprising a universal adapter nucleic acid sequence comprising a ribonucleotide; (b) enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) enzymatically cleaving double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a depleted sample solution having a lower proportion of sample nucleic acid molecules comprising the target nucleic acid sequence than the sample solution. In one embodiment, the instructions further include repeating steps (b) and (c) one or more times on the enriched sample solution. In one embodiment, the instructions further comprise maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules.

[0137] In one embodiment, for enzymatically extending capture primer nucleic acid molecules, the instructions include maintaining the temperature of a sample solution at or above the melting temperature of a plurality of sample nucleic acid molecules; introducing to the sample solution an extension enzyme configured to extend capture primer nucleic acid molecules annealed to target nucleic acid sequences; maintaining the sample solution at a temperature near or below an annealing temperature of the capture primer nucleic acid molecules suitable for annealing the capture primer nucleic acid molecules to the target nucleic acid sequences; and maintaining the sample solution near an extension temperature of the extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecules annealed to the target nucleic acid sequences with the extension enzyme.

[0138] In one embodiment, for performing enzymatic cleavage of double-stranded sample nucleic acid molecules, the instructions include introducing to the sample solution a degradative enzyme configured to cleave double-stranded nucleic acid molecules comprising a universal adaptor nucleic acid sequence, and maintaining the temperature of the sample solution at the decomposition temperature of the degradative enzyme.

[0139] In one embodiment, the instructions further include introducing a plurality of amplification primer nucleic acid molecules into the depleted sample solution, wherein the amplification primer nucleic acid molecules of the plurality of amplification primer nucleic acid molecules are complementary to a universal adapter nucleic acid sequence, and performing a nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the depleted sample solution having the plurality of amplification primer nucleic acid molecules.

[0140] In one embodiment, the instructions further comprise instructions for attaching a universal adaptor molecule to a sample nucleic acid molecule in a sample solution. [Example]

[0141] Example Example 1: Results of an exemplary enrichment scheme using selection probes: Two different amplicons of different lengths and containing universal adapters were generated by amplifying sequences from the plasmids (AmpR 421 bp, Hygro 774 bp). Primers BC_0328 and BC_0330 were used to generate the AmpR amplicon (Figure 6). Primers BC_0332 and BC_0334 were used to generate the Hygro amplicon (Figure 4).

[0142] Equal amounts of these two amplicons (0.2 ng each) were added to a 20 μL reaction.

[0143] The following mixture was used to enrich for the AmpR amplicon, where BC_306_amp_capture is an oligonucleotide complementary to the AmpR amplicon but not to the Hygro amplicon.

[0144] [Table 1]

[0145] The following mixture was used to enrich for Hygro amplicons, where BC_301_hygro_capture is an oligonucleotide complementary to the Hygro amplicon but not the AmpR amplicon.

[0146] [Table 2]

[0147] The samples were then cycled through the following conditions: Thermocycle samples for 1 or 3 cycles using the following protocol: 1.95℃, 30 seconds 2.58℃, 20 seconds 3.68℃, 20 seconds 4. 37℃, 42℃, or 50℃, 15 minutes The samples were then quickly placed on ice.

[0148] 2 μL of each reaction was then added to a 25 μL qPCR reaction with universal primers. Once the reactions began to plateau, they were transferred from the qPCR to a 1.25% agarose gel and run. The results are shown in Figure 8. Top row, left to right: 1. 100 base pair ladder (New England Biolabs) 2. Amp capture, 1 cycle, step 4 at 37°C 3. Amp capture, 1 cycle, step 4 at 42°C 4. Amp capture, 1 cycle, step 4 is at 50℃ 5. Hygro capture, 1 cycle, step 4 at 37°C 6. Hygro capture, 1 cycle, step 4 at 42°C 7. Hygro capture, 1 cycle, step 4 at 50°C 8. Control: DNA only Bottom row, left to right: 9. 100 base pair ladder (New England Biolabs) 10. Amp capture, 3 cycles, step 4 at 37°C 11. Amp capture, 3 cycles, step 4 at 42°C 12. Amp capture, 3 cycles, step 4 at 50°C 13. Hygro capture, 3 cycles, step 4 at 37°C 14. Hygro capture, 3 cycles, step 4 at 42°C 15. Hygro capture, 3 cycles, step 4 at 50°C 16. Control: DNA only

[0149] Oligonucleotide sequence: Figure 5: See AmpR_amplicon-sequence.pdf Figure 4: See Hygro_amplicon-sequence.pdf BC_0108_TSO_PCR AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO: 12) BC_0062_Primer_Bind CAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 13) BC_0328_amp_fwd_3ribo AAGCAGTGGTATCAACrGCArGAGTrGAATGGGTACCAAACGACGAGCGTGACA (SEQ ID NO: 1) BC_0330_amp_rev_3ribo GTGACTGGAGTTCAGACrGTGTrGCTCTTCCrGATCTCCAATGCTTAATCAGTGAGGCACC (SEQ ID NO: 2) BC_0306_Amp_capture ACGGGGAGTCAGGCAACTATGGATGA (SEQ ID NO: 19) BC_0359_amp_ribo_dT_fwd TTTTTTTTTTAAGCAGTGGTATCAACrGCArGAGTrGAATGGGTACCAAACGACGAGCGTGACA (SEQ ID NO: 20) BC_0360_amp_ribo_dT_rev TTTTTTTTTTCAGACrGTGTrGCTCTTCCrGATCTCCAATGCTTAATCAGTGAGGCACC (SEQ ID NO: 21) BC_0332_hygro_fwd_3ribo AAGCAGTGGTATCAACrGCArGAGTrGAATGGGCCCGCTGTTCTGCAGCC (SEQ ID NO: 3) BC_0334_hygro_rev_3ribo GTGACTGGAGTTCAGACrGTGTrGCTCTTCCrGATCTATTCCTTTGCCCTCGGACG (SEQ ID NO: 4) BC_0301_hygro_capture AGAAGTACTCGCCGATAGTGGAAACCGA (SEQ ID NO: 22)

[0150] The gel images in Figure 8 show enrichment of the desired target molecules under various conditions. Lanes 2–4 and 10–12 show enrichment of AmpR molecules. Lanes 5–7 and 13–15 show enrichment of Hygro molecules. Enrichment occurs over a wide range of temperatures (37°C–50°C) during the degradation step. The gel also shows that multiple cycles of nucleic acid melting, capture primer annealing, capture primer extension, and degradation of single-stranded riboguanine can achieve enrichment equal to or greater than that achieved with a single cycle (compare lanes 10–12 with lanes 4–6, and lanes 13–15 with lanes 5–7).

[0151] Example 2: In this example, single-cell RNA sequencing libraries (derived from expanded primary T cells) were enriched for specific sequences matching portions of the following genes: ACTB (ATGGCCCAGTCCTCTCCCAA, SEQ ID NO: 5), GAPDH (AGGAGTAAGACCCCTGGACCAC, SEQ ID NO: 6), TRAC (AGAACCCTGACCCTGCCG, SEQ ID NO: 7), TRBC1 (CTGAAAAACGTGTTCCCACCCGAG, SEQ ID NO: 8), and TRBC2 (ACCTGAACAAGGTGTTCCCACC, SEQ ID NO: 9).

[0152] TRAC corresponds to the constant region of the T cell receptor alpha chain, and TRBC1 and TRCB2 correspond to two constant regions that can exist in the T cell receptor beta chain.Because the alpha chain and beta chain of T cell receptor are produced by VJ and VDJ recombination, the sequence variation that can occur for each is very high.However, by enriching the nucleic acid sequence that contains a part of the TRAC sequence, it is possible to enrich all or almost all of the nucleic acid sequences that code for the T cell receptor alpha chain; similarly, by enriching the nucleic acid sequence that contains a part of either TRBC1 or TRBC2, it is possible to enrich all or almost all of the nucleic acid sequences that code for the T cell receptor beta chain.

[0153] A single-cell RNA sequencing library of the amplified cDNA was generated using the published SPLiT-seq method. One ng of the amplified cDNA was amplified again using 11 cycles of PCR with primers BC_385 and BC_386 to introduce riboguanosine at each 5' end of the double-stranded DNA molecules. The resulting PCR product was purified using SPRI beads (Kapa Pure Beads) at a 2:1 ratio of beads to PCR product according to the manufacturer's instructions. The concentration of the purified PCR product was measured using the Qubit dsDNA HS Assay Kit.

[0154] A total of 12 different enrichment variations were compared: three different polymerase mixtures were tested, two different polymerase extension times were tested, and two Rnase T1 concentrations were tested (3 x 2 x 2 = 12 combination variations). Variation 1 (Hot start Taq, 1x Standard Taq Buffer, 30 seconds of polymerase extension, 100u of Rnase T1) Variation 2 (Hot start Taq, 1x Standard Taq Buffer, polymerase extension for 120 seconds, RNase T1 at 100u) Variation 3 (Hot start Taq, 1x Standard Taq Buffer, 30 seconds of polymerase extension, 20u of Rnase T1) Variation 4 (Hot start Taq, 1x Standard Taq Buffer, polymerase extension for 120 seconds, RNase T1 20u) Variation 5 (OneTaq Hot start, 1x OneTaq Standard Reaction Buffer, 30 sec polymerase extension, 100u Rnase T1) Variation 6 (OneTaq Hot start, 1x OneTaq Standard Reaction Buffer, 120 sec polymerase extension, 100u Rnase T1) Variation 7 (OneTaq Hot start, 1x OneTaq Standard Reaction Buffer, 30 sec polymerase extension, 20u Rnase T1) Variation 8 (OneTaq Hot start, 1x OneTaq Standard Reaction Buffer, 120 sec polymerase extension, 20u Rnase T1) Variation 9 (Deep Vent Exo-, 1× ThermoPol Reaction Buffer, 30 sec polymerase extension, 100 μl Rnase T1) Variation 10 (Deep Vent Exo-, 1x ThermoPol Reaction Buffer, polymerase extension for 120 seconds, RNase T1 at 100u) Variation 11 (Deep Vent Exo-, 1× ThermoPol Reaction Buffer, 30 sec polymerase extension, 20 μl Rnase T1) Variation 12 (Deep Vent Exo-, 1x ThermoPol Reaction Buffer, polymerase extension for 120 seconds, RNase T1 20u)

[0155] Each reaction was prepared with: (2 μL 10× Standard Taq Buffer / 4 μL OneTaq Standard Reaction Buffer / 2 μL ThermoPol Reaction Buffer), 1.6 μL 2.5 mM dNTPs, (0.1 μL HotStart Taq Polymerase / 0.1 μL OneTaq® Hot Start DNA Polymerase / 0.1 μL Deep Vent® (exo-)DNA Polymerase), 1 μL pooled capture primers (10 μM total, 2 μM each), (11.3 / 13.3 μL water), 1 μL amplified cDNA (from PCR using BC_385 and BC_386), and 1 μL Rnase T1 (diluted to 100 μL or 20 μL). Primers BC_0344_ACTB_probe (SEQ ID NO: 5), BC_0343_GAPDH_probe (SEQ ID NO: 6), BC_0391_TRAC_probe (SEQ ID NO: 7), BC_0392_TRBC1_probe (SEQ ID NO: 8), BC_0393_TRBC2_probe (SEQ ID NO: 9) were used as pool capture primers.

[0156] Variations 1, 3, 5, and 7 were subjected to the following cycles: a. 95°C for 30 seconds, b. 95°C for 30 seconds, c. 53°C for 20 seconds, d. 68°C for 30 seconds, e. 37°C for 15 minutes, f. Repeat steps b to e two more cycles (3 cycles including the first cycle). Variations 2, 4, 6, and 8 were subjected to the following cycles: a. 95°C for 30 seconds, b. 95°C for 30 seconds, c. 53°C for 20 seconds, d. 68°C for 2 minutes, e. 37°C for 15 minutes, f. Repeat steps b to e two more cycles (3 cycles including the first cycle). Variations 9 and 11 were subjected to the following cycles: a. 95°C for 30 seconds, b. 95°C for 30 seconds, c. 55°C for 20 seconds, d. 72°C for 30 seconds, e. 37°C for 15 minutes, f. Repeat steps b to e two more times (3 cycles including the first cycle). Variations 10 and 12 were subjected to the following cycles: a. 95°C for 30 seconds, b. 95°C for 30 seconds, c. 55°C for 20 seconds, d. 72°C for 2 minutes, e. 37°C for 15 minutes, f. Repeat steps b to e two more cycles (3 cycles including the first cycle).

[0157] All 12 reactions were then purified using single-sided SPRI cleanup (Kapa Pure Beads) according to the manufacturer's instructions (at a 2x bead to PCR product ratio). Each of the 12 purified reactions was then amplified by PCR using primers BC_0062 (SEQ ID NO: 12) and BC_0108 TSO_PCR (SEQ ID NO: 12). The amplified PCR products were then prepared for next-generation sequencing on an Illumina sequencer by fragmentation, end repair (including A-tailing), adapter ligation, and PCR using primers to add indexed Illumina adapters (P7 and P5).

[0158] The original amplified cDNA library (which had not undergone any enrichment) was also prepared for next-generation sequencing using the same method: fragmentation, end repair (including A-tailing), adapter ligation, and primer-assisted PCR to add indexed Illumina adapters (P7 and P5).

[0159] All 13 libraries (12 enriched variations and the original non-enriched library) were sequenced together on an Illumina NextSeq. The resulting libraries were sorted according to the index added in the final PCR.

[0160] The fold-change enrichment of each of the 12 enrichment variations relative to the non-enriched library was then calculated for each of the five sequences to be enriched: ACTB (ATGGCCCAGTCCTCTCCCAA, SEQ ID NO: 5), GAPDH (AGGAGTAAGACCCCTGGACCAC, SEQ ID NO: 6), TRAC (AGAACCCTGACCCTGCCG, SEQ ID NO: 7), TRBC1 (CTGAAAAACGTGTTCCCACCCGAG, SEQ ID NO: 8), and TRBC2 (ACCTGAACAAGGTGTTCCCACC, SEQ ID NO: 9).

[0161] [Table 3]

[0162] The results in Table 3 show the enrichment of desired target molecules under various conditions. For each of the five target sequences, nucleic acids containing the given sequence are enriched under different experimental conditions. By adjusting the concentration of RNase T1, the type of polymerase, and the polymerase extension time, different target sequence fold-change enrichment can be achieved.

[0163] While exemplary embodiments have been illustrated and described, it will be appreciated that these embodiments can be varied in many ways without departing from the spirit and scope of the invention.

[0164] The embodiments of the invention in which an exclusive property or right is claimed are defined as follows:

Claims

1. 1. A method for enriching DNA molecules containing a target nucleic acid sequence, comprising: (a) introducing a capture primer nucleic acid molecule, which is complementary or partially complementary to a target nucleic acid sequence of one or more sample DNA molecules among the plurality of sample DNA molecules, into a sample solution containing a plurality of sample DNA molecules, each of which contains a universal adapter nucleic acid sequence containing one or more ribonucleotides at its 5' end; (b) performing enzymatic extension of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample DNA molecules, wherein the extension copies the universal adapter nucleic acid sequence comprising the one or more ribonucleotides present at the 5' end of the strand of the one or more sample DNA molecules, thereby rendering the universal adapter nucleic acid sequence comprising the one or more ribonucleotides double-stranded; (c) using an endoribonuclease to enzymatically degrade single-stranded sample DNA molecules in the sample solution that comprise a universal adapter nucleic acid sequence at their 5' ends that comprises one or more ribonucleotides, thereby producing an enriched sample solution in which the proportion of undegraded sample DNA molecules comprising the target nucleic acid sequence is higher than the proportion in the sample solution, wherein the endoribonuclease is introduced into the sample solution after the extension of step (b) and / or has a decomposition temperature below the annealing temperature, and the endoribonuclease is configured to cleave the single-stranded sample DNA molecules at the one or more ribonucleotides in the universal adapter nucleic acid sequence but not cleave double-stranded sample DNA molecules, and the endoribonuclease is configured to cleave single-stranded DNA molecules at one or more ribonucleotides in the universal adapter nucleic acid sequence, demonstrating that the endoribonuclease can selectively degrade one or more ribonucleotides present in the universal adapter nucleic acid sequence.

2. The step of enzymatically extending the capture primer nucleic acid molecule comprises: maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample DNA molecules; introducing into the sample solution an extending enzyme configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence; maintaining the sample solution at a temperature near or below the annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence; and maintaining the sample solution at or near an extension temperature of the extending enzyme suitable for enzymatic extension by the extending enzyme of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence.

3. 3. The method of claim 2, wherein the extending enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and a combination thereof.

4. The step of enzymatically digesting single-stranded sample DNA molecules comprises: introducing the endoribonuclease into the sample solution; The method according to any one of claims 1 to 3, further comprising a step of maintaining the temperature of the sample solution at the decomposition temperature of the endoribonuclease.

5. The method of any one of claims 1 to 4, wherein the endoribonuclease is selected from the group consisting of RNase T1, RNase A, and combinations thereof.

6. 6. The method of claim 5, wherein the endoribonuclease is RNase T1 and the universal adapter nucleic acid sequence present within the same strand of the sample DNA molecule annealed by the capture primer comprises riboguanine.

7. 6. The method of claim 5, wherein the endoribonuclease is RNase A and the universal adapter nucleic acid sequence present within the same strand of the sample DNA molecule annealed by the capture primer comprises a base selected from the group consisting of ribocytosine, ribouracil, and combinations thereof.

8. The method of any one of claims 1 to 7, further comprising repeating steps (b) and (c) on the enriched sample solution one or more times.

9. introducing a plurality of amplification primer nucleic acid molecules into the enriched sample solution, wherein an amplification primer nucleic acid molecule of the plurality of amplification primer nucleic acid molecules is complementary to the universal adapter nucleic acid sequence; 9. The method of claim 1, further comprising the step of: providing an amplified enriched sample solution by performing a nucleic acid amplification reaction on the plurality of sample DNA molecules in the enriched sample solution with the plurality of amplification primer nucleic acid molecules.

10. The method of claim 9, wherein the step of performing the nucleic acid amplification reaction on the plurality of sample DNA molecules in the enriched sample solution does not amplify, or does not substantially amplify, sample DNA molecules degraded by the endoribonuclease.

11. The method of any one of claims 1 to 10, further comprising sequencing sample DNA molecules in the enriched sample solution.

Images