Composition for inhibiting melanin production, composition for promoting BMP4 expression, composition for inhibiting c-KIT expression, and skin-whitening cosmetic
A Zanthoxylum chinense pericarp extract-based composition inhibits melanin production and regulates melanocyte activity to address skin pigmentation issues by promoting BMP4 expression and suppressing c-KIT, offering a whitening solution.
Patent Information
- Application Number
- JP2021106308
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-06-28
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2041-06-28
AI Technical Summary
Existing compositions fail to effectively inhibit melanin production in melanocytes, which leads to skin pigmentation issues such as age spots and freckles, and there is a need for new components to suppress melanin production.
A composition containing an extract from the pericarp of Zanthoxylum chinense (Zanthoxylum japonicum) is used to inhibit melanin production, promote BMP4 expression, and inhibit c-KIT expression in melanocytes, utilizing a heat extraction process with ethanol as the solvent.
The composition effectively inhibits melanin production, promotes BMP4 expression, and suppresses c-KIT expression, thereby reducing skin pigmentation and providing a whitening effect.
Smart Images

Figure 0007736460000001 
Figure 0007736460000002 
Figure 0007736460000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to a composition for inhibiting melanin production, a composition for promoting BMP4 expression in melanocytes, a composition for inhibiting c-KIT expression in melanocytes, and a whitening cosmetic. [Background technology]
[0002] Various technologies using extracts from plants of the genus Zanthoxylum in the family Rutaceae have been proposed. For example, Patent Document 1 describes a tyrosinase activity promoter containing Zanthoxylum extract as an active ingredient. Patent Document 2 discloses a slimming composition containing a blood circulation promoter and amino acids, and describes Zanthoxylum extract as the blood circulation promoter. Patent Document 3 discloses a slimming composition containing a thermogenic protein expression promoter, and describes a plant extract from the genus Zanthoxylum in the family Rutaceae as the thermogenic protein expression promoter. Patent Document 4 describes an anti-inflammatory composition containing Sichuan pepper extract, which is an extract extracted from the pericarp of the fruit of Zanthoxylum chinense in the genus Zanthoxylum in the family Rutaceae. [Prior art documents] [Patent documents]
[0003] [Patent Document 1] Japanese Patent Application Publication No. 11-79951 [Patent Document 2] Japanese Patent Application Laid-Open No. 2008-69134 [Patent Document 3] Japanese Patent Application Laid-Open No. 2010-180165 [Patent Document 4] Japanese Patent Application Laid-Open No. 2011-93880 Summary of the Invention [Problem to be solved by the invention]
[0004] Pigmentation of the skin, such as age spots and freckles, can occur, for example, when melanin produced in excess by melanocytes is deposited in the skin. To prevent or improve pigmentation, various components capable of suppressing melanin production have been proposed, but the development of new components is desired. Therefore, a main object of the present invention is to provide a novel composition for inhibiting melanin production. [Means for solving the problem]
[0005] The present inventors have found that an extract from the pericarp of Zanthoxylum chinense (Zanthoxylum japonicum) of the Rutaceae family has an inhibitory effect on melanin production.The present inventors have also found that an extract from the pericarp of Zanthoxylum chinense has an inhibitory effect on BMP4 expression in melanocytes and an inhibitory effect on c-KIT expression in melanocytes.
[0006] That is, the present invention provides a composition for inhibiting melanin production, which contains an extract of Zanthoxylum chinense pericarp as an active ingredient. The present invention also provides a composition for promoting BMP4 expression in melanocytes, which contains an extract of Zanthoxylum chinense pericarp as an active ingredient. The present invention also provides a composition for inhibiting c-KIT expression in melanocytes, which comprises an extract of Zanthoxylum chinense pericarp as an active ingredient. The present invention also provides a whitening cosmetic composition containing any one of the above compositions. In the whitening cosmetic, the content of the extract of Zanthoxylum chinense pericarp may be 3 μg / mL or more in terms of dry solid content. [Effects of the Invention]
[0007] The present invention provides a novel composition for inhibiting melanin production. Note that the effects of the present invention are not limited to those described herein, and may be any of the effects described in this specification. [Brief explanation of the drawings]
[0008] [Figure 1] 1 is a graph showing the amount of melanin when a pepper extract-containing composition is added. [Figure 2] 1 is a graph showing the amount of melanin when a composition containing Japanese pepper extract is added. [Figure 3] 1 is a graph showing the amount of BMP4 mRNA expression when pepper extract was added. [Figure 4] 1 is a graph showing the amount of c-KIT protein when pepper extract was added. DETAILED DESCRIPTION OF THE INVENTION
[0009] Preferred embodiments for carrying out the present invention will be described below. The embodiments described below are representative embodiments of the present invention, and the scope of the present invention is not limited to these embodiments.
[0010] <1. Overview>
[0011] The present invention provides a composition for inhibiting melanin production, a composition for promoting BMP4 expression in melanocytes, and a composition for inhibiting c-KIT expression in melanocytes. All of these compositions contain an extract of Zanthoxylum chinense pericarp as an active ingredient. That is, the extract of Zanthoxylum chinense pericarp has the effects of inhibiting melanin production, promoting BMP4 expression in melanocytes, and inhibiting c-KIT expression in melanocytes. The relationship between melanin production and BMP4 and c-KIT is described below.
[0012] Melanin is produced in melanocytes, and BMP4 (Bone Morphogenetic Protein 4) is known to have the function of suppressing melanin production in melanocytes.
[0013] c-KIT is a receptor for SCF (Stem Cell Factor), a melanocyte activator. When c-KIT expression is promoted in melanocytes, the melanocytes become more susceptible to SCF activation, resulting in enhanced melanin production. Thus, c-KIT is known to promote melanin production in melanocytes.
[0014] The extract of Zanthoxylum kantansis pericarp used in the present invention is thought to inhibit melanin production by promoting the expression of BMP4 and suppressing the expression of c-KIT in melanocytes.
[0015] The composition according to the present invention will be described in detail below.
[0016] <2. Composition for inhibiting melanin production>
[0017] (1) Ingredients
[0018] (1-1) Zanthoxylum chinense peel extract
[0019] A composition for inhibiting melanin production according to one embodiment of the present invention contains an extract of Zanthoxylum bungeanum pericarp as an active ingredient. Zanthoxylum bungeanum is a deciduous shrub of the genus Zanthoxylum in the family Rutaceae, and is also known as Flower Pepper.
[0020] In this embodiment, the extract of Zanthoxylum japonicum pericarp is obtained by an extraction process including contacting an extraction raw material containing Zanthoxylum japonicum pericarp with a solvent. The extraction raw material used in the extraction process may include raw materials other than Zanthoxylum japonicum pericarp. The extraction raw material may include, for example, parts of Zanthoxylum japonicum other than the pericarp (e.g., fruit, seeds, leaves, trunk, branches, roots, and stems). The extraction raw material preferably does not include raw materials other than Zanthoxylum japonicum pericarp. This allows for efficient extraction of active ingredients. As used herein, "not including raw materials other than Zanthoxylum japonicum pericarp" means that the extract does not include any raw materials other than Zanthoxylum japonicum pericarp, and that the extract is substantially free of raw materials other than Zanthoxylum japonicum pericarp. "Substantially free of raw materials other than Zanthoxylum japonicum pericarp" means that no extract raw materials other than Zanthoxylum japonicum pericarp have been intentionally added.
[0021] The pericarp of Zanthoxylum japonicum used in the extraction process may be processed after being collected from the fruit of Zanthoxylum japonicum. The post-collection process may be, for example, at least one process selected from washing, drying, shredding, and pulverization. The process may be carried out by a method known to those skilled in the art. From the viewpoint of ease of acquisition, the pericarp of Zanthoxylum japonicum used in the extraction process may be dried, i.e., may be a dried product.
[0022] The solvent used in the extraction process may be a solvent known to those skilled in the art. Examples of solvents used in the extraction process include water, alcohols, glycols, ketones, esters, ethers, and hydrocarbons. Examples of alcohols include ethanol, methanol, and propanol. Examples of glycols include ethylene glycol, diethylene glycol, butylene glycol, and propylene glycol. Examples of ketones include acetone and methyl ethyl ketone. Examples of esters include ethyl acetate, propyl acetate, and ethyl formate. Examples of ethers include diethyl ether and tetrahydrofuran. Examples of hydrocarbons include hexane and benzene. One or a combination of two or more of these solvents may be used in the extraction process. The solvent used in the extraction process is preferably an alcohol solution (a mixed solvent of water and alcohol) or alcohol, more preferably an ethanol solution (a mixed solvent of water and ethanol) or ethanol, and even more preferably an ethanol solution. When the solvent used in the extraction process is an ethanol solution, the ethanol concentration may be, for example, 50% by volume or more, preferably 70% by volume or more, more preferably 80% by volume or more, even more preferably 85% by volume or more, and particularly preferably 90% by volume or more, or 95% by volume or more.
[0023] The extraction treatment is carried out by contacting the extraction raw material containing the pericarp of Zanthoxylum japonicum with the solvent. The contact may be, for example, by immersing the extraction raw material containing the pericarp of Zanthoxylum japonicum in the solvent.
[0024] The extraction process is preferably a heat extraction process, which involves immersing an extraction raw material containing Zanthoxylum chinense pericarp in a solvent and heating it. This heat extraction process is suitable for extracting the active ingredient of the composition for inhibiting melanin production according to this embodiment. The lower limit of the extraction temperature (solvent temperature) in the heat extraction process is preferably a temperature above room temperature (20°C) (i.e., above 20°C), more preferably 30°C or higher, even more preferably 40°C or higher, and particularly preferably 50°C or higher. The upper limit of the extraction temperature in the heat extraction process is preferably below the boiling point of the solvent. A preferred numerical range for the extraction temperature in the heat extraction process may be a combination selected from the lower and upper limits described above. When the solvent used in the extraction process has a low boiling point (e.g., a boiling point below 100°C), the heat extraction is preferably a heat reflux extraction. Specifically, when the solvent used in the extraction process is, for example, an ethanol solution or ethanol, the heat extraction is preferably a heat reflux extraction. This allows the extraction process to be carried out efficiently. The preferred lower and upper limits of the extraction temperature in the heated reflux extraction may be the same as the preferred lower and upper limits of the extraction temperature in the heated extraction described above. In addition, the preferred numerical range of the extraction temperature in the heated reflux extraction may be a combination selected from the lower and upper limits.
[0025] The extraction time (the time for which the extraction material is in contact with the solvent) can be adjusted as appropriate by those skilled in the art depending on factors such as the amount of Zanthoxylum chinense peel contained in the extraction material and the type of solvent. In the case of heat extraction (including heat reflux extraction), the extraction time may be, for example, 30 minutes to 24 hours, 30 minutes to 15 hours, 30 minutes to 10 hours, 30 minutes to 5 hours, or 1 hour to 5 hours.
[0026] The active ingredient of the composition for inhibiting melanin production is dissolved from the Zanthoxylum japonicum peel into the solvent by the extraction process. The Zanthoxylum japonicum peel extract used in the composition for inhibiting melanin production may be the solvent itself (raw extract) into which the active ingredient is dissolved by the extraction process, or may be obtained by subjecting the raw extract to further treatment after the extraction process. The treatment applied to the raw extract after the extraction process may be, for example, at least one treatment selected from purification, concentration, dilution, drying, and solvent substitution. That is, the Zanthoxylum japonicum peel extract used in the composition for inhibiting melanin production may be, for example, a purified product, concentrate, dilution, dried product, or solvent-substituted product of the Zanthoxylum japonicum peel extract. Treatment after the extraction process may be performed by a method known to those skilled in the art. Furthermore, the purification process may include, for example, filtration, washing, bleaching, deodorization, sterilization, and other treatments.
[0027] The extract of Zanthoxylum chinense pericarp used in the composition for inhibiting melanin production may be, for example, obtained by redissolving the dried extract of Zanthoxylum chinense pericarp in a solvent. The solvent used for redissolution may be the same as or different from the solvent used in the extraction treatment.
[0028] The extract of Zanthoxylum chinense pericarp used in the composition for inhibiting melanin production is preferably one that has been subjected to at least a purification treatment after extraction, i.e., it is preferably a purified extract of Zanthoxylum chinense pericarp.
[0029] (1-2) Content of Zanthoxylum chinense peel extract
[0030] In the composition for inhibiting melanin production of this embodiment, the lower limit of the content of the extract of Zanthoxylum japonicum pericarp may be, for example, 1 μg / mL or more, preferably 3 μg / mL or more, more preferably 6 μg / mL or more, even more preferably 10 μg / mL or more, and particularly preferably 15 μg / mL or more, 20 μg / mL or more, 25 μg / mL or more, 30 μg / mL or more, 40 μg / mL or more, or 50 μg / mL or more, calculated on a dry solids basis. Such a content may result in a composition with a higher melanin production inhibitory effect. The upper limit of the content of the extract of Zanthoxylum japonicum pericarp may be appropriately adjusted by those skilled in the art depending on the application and form of the composition for inhibiting melanin production. The upper limit of the content may be, for example, 10 mg / mL or less, 5 mg / mL or less, or 2 mg / mL or less, calculated on a dry solids basis. A preferred range of the content may be a combination selected from the lower and upper limits described above. In this specification, "dry solids equivalent" refers to converting the amount of extract of Zanthoxylum chinense peel into dry solids, which is the amount of the extract excluding water. In this specification, the dry solids amount is measured according to the evaporation residue test method, a general test method specified in the Quasi-drug Ingredients Standards 2021.
[0031] (1-3) Ingredients other than the extract of Zanthoxylum chinense peel
[0032] The composition for inhibiting melanin production of this embodiment may be a composition comprising an extract of Zanthoxylum chinense pericarp. That is, the composition for inhibiting melanin production may be a composition containing no components other than the extract of Zanthoxylum chinense pericarp.
[0033] The melanin production-inhibiting composition may contain ingredients other than the extract of Zanthoxylum chinense pericarp. These ingredients may be ingredients known in the art, such as bases, solvents (e.g., water, alcohols, etc.), oils, preservatives, emulsifiers, colorants, antiseptics, surfactants, antioxidants, moisturizers, UV absorbers, thickeners, powders, chelating agents, pH adjusters, and fragrances. These ingredients may be included in the melanin production-inhibiting composition to the extent that they do not impair the effects of the present invention.
[0034] (2) Dosage form
[0035] The dosage form of the composition for inhibiting melanin production of this embodiment may be appropriately selected by those skilled in the art depending on the application, purpose, etc. The dosage form may be, for example, a liquid, emulsion, cream, solid, gel, paste, or powder.
[0036] (3) Manufacturing method
[0037] The composition for inhibiting melanin production of this embodiment is produced by using the extract of Zanthoxylum chinense pericarp. That is, the method for producing the composition for inhibiting melanin production includes using the extract of Zanthoxylum chinense pericarp. The production method may include steps known in the art other than using the extract of Zanthoxylum chinense pericarp.
[0038] The extract of Zanthoxylum chinense pericarp used in the above production method is obtained by the extraction process described above in "(1-1) Extract of Zanthoxylum chinense pericarp." That is, the details of the extraction process are as described above in "(1-1) Extract of Zanthoxylum chinense pericarp."
[0039] In a preferred embodiment, the extract of Zanthoxylum japonicum pericarp used in the above-mentioned production method may be obtained by heat extraction (particularly heat reflux extraction) in which an extraction raw material containing Zanthoxylum japonicum pericarp (particularly dried Zanthoxylum japonicum pericarp) is contacted (particularly immersed) with an ethanol solution or ethanol and heated. The ethanol concentration of the ethanol solution is preferably 70% by volume or more, more preferably 80% by volume or more, even more preferably 85% by volume or more, particularly preferably 90% by volume or more, or even 95% by volume or more. The lower limit of the extraction temperature in the heat extraction (particularly heat reflux extraction) is preferably a temperature above room temperature (20°C) (i.e., above 20°C), more preferably 30°C or more, even more preferably 40°C or more, and particularly preferably 50°C or more. The upper limit of the extraction temperature in the heat extraction (particularly heat reflux extraction) is preferably below the boiling point of the solvent. A preferred numerical range of the extraction temperature may be a combination selected from these lower and upper limits.
[0040] In the above production method, the extract of Zanthoxylum chinense pericarp may be used so as to achieve the content described above in "(1-2) Content of extract of Zanthoxylum chinense pericarp." That is, the details of the amount of extract of Zanthoxylum chinense pericarp used in the above production method are as described above in "(1-2) Content of extract of Zanthoxylum chinense pericarp."
[0041] (4)Applications
[0042] The composition for inhibiting melanin production of this embodiment may be, for example, a cosmetic, a makeup product, a quasi-drug, a pharmaceutical product, or a food or drink product for inhibiting melanin production, and is preferably a cosmetic or makeup product for inhibiting melanin production. Note that, in this specification, "cosmetics" refers to cosmetics and quasi-drugs (e.g., medicated cosmetics).
[0043] The melanin production-inhibiting composition may be used as a raw material for melanin production inhibition in, for example, cosmetics, beauty products, quasi-drugs, pharmaceuticals, or food and beverage products. That is, the melanin production-inhibiting composition may be, for example, a raw material for melanin production inhibition for cosmetics, beauty products, quasi-drugs, pharmaceuticals, or food and beverage products, and is preferably a raw material for melanin production inhibition for cosmetics or cosmetics. The content of the extract of Zanthoxylum chinense pericarp in these cosmetics, beauty products, quasi-drugs, pharmaceuticals, or food and beverage products may be adjusted, for example, within the numerical range described above in "(1-2) Content of extract of Zanthoxylum chinense pericarp."
[0044] The composition for inhibiting melanin production may be a whitening composition because it has the effect of inhibiting melanin production. Therefore, the composition for inhibiting melanin production may be, for example, a whitening cosmetic, a whitening cosmetic product, a whitening quasi-drug, a whitening pharmaceutical product, or a whitening food or beverage, and is preferably a whitening cosmetic or whitening cosmetic. In this specification, "whitening" refers to preventing and / or improving skin pigmentation (e.g., age spots, freckles, uneven skin tone, etc.) caused by excessive melanin production, or maintaining a uniform skin tone.
[0045] (5) Effect
[0046] The composition for inhibiting melanin production has the effect of inhibiting melanin production. This effect can be confirmed by a decrease in melanin production when the composition for inhibiting melanin production according to this embodiment is used compared to when the composition is not used. The amount of melanin production can be measured, for example, by the procedure shown in Example 1 described below.
[0047] <3. Composition for promoting BMP4 expression in melanocytes>
[0048] (1) Ingredients, dosage form and manufacturing method
[0049] A composition for promoting BMP4 expression in melanocytes according to one embodiment of the present invention contains an extract of Zanthoxylum chinense pericarp as an active ingredient. The ingredients, dosage form, and manufacturing method of the composition for promoting BMP4 expression may be the same as those described in "(1) Ingredients," "(2) Dosage Form," and "(3) Manufacturing Method" in "2. Composition for inhibiting melanin production" above.
[0050] (2)Applications
[0051] The composition for promoting BMP4 expression in melanocytes may be, for example, a cosmetic, beauty product, quasi-drug, pharmaceutical, or food or beverage product for promoting BMP4 expression in melanocytes, and is preferably a cosmetic or beauty product for promoting BMP4 expression in melanocytes.
[0052] The composition for promoting BMP4 expression in melanocytes may be used as a raw material for promoting BMP4 expression in melanocytes in, for example, cosmetics, quasi-drugs, pharmaceuticals, or food and beverage products. That is, the composition for promoting BMP4 expression in melanocytes may be, for example, a raw material for promoting BMP4 expression in melanocytes for cosmetics, quasi-drugs, pharmaceuticals, or food and beverage products, and is preferably a raw material for promoting BMP4 expression in melanocytes for cosmetics or cosmetics. The content of the extract of Zanthoxylum chinense pericarp in these cosmetics, cosmetics, quasi-drugs, pharmaceuticals, or food and beverage products may be adjusted, for example, within the numerical range described above in "(1-2) Content of extract of Zanthoxylum chinense pericarp."
[0053] The composition for promoting BMP4 expression in melanocytes can suppress melanin production through promoting BMP4 expression. Therefore, the composition for promoting BMP4 expression in melanocytes may be a whitening composition. Furthermore, the composition for promoting BMP4 expression in melanocytes may be, for example, a whitening cosmetic, a whitening cosmetic product, a whitening quasi-drug, a whitening pharmaceutical product, or a whitening food or beverage, and is preferably a whitening cosmetic or whitening cosmetic product.
[0054] (3) Effect
[0055] The composition for promoting BMP4 expression in melanocytes has the effect of promoting BMP4 expression in melanocytes. This effect can be confirmed by an increase in the expression level of BMP4 in melanocytes when the composition for promoting BMP4 expression in melanocytes according to this embodiment is used compared to when the composition is not used. The expression level of BMP4 can be the expression level of BMP4 protein or the expression level of the gene encoding BMP4. The expression level of the protein or gene can be measured by methods known in the art. For example, the expression level of the gene encoding BMP4 can be measured according to the procedure for measuring the expression level of BMP4 mRNA, as shown in Example 2 below.
[0056] <4. Composition for inhibiting c-KIT expression in melanocytes>
[0057] (1) Ingredients, dosage form and manufacturing method
[0058] A composition for inhibiting c-KIT expression in melanocytes according to one embodiment of the present invention contains an extract of Zanthoxylum chinense pericarp as an active ingredient. The components, dosage form, and manufacturing method of the composition for inhibiting c-KIT expression may be the same as those described in "(1) Components," "(2) Dosage Form," and "(3) Manufacturing Method" in "2. Composition for inhibiting melanin production" above.
[0059] (2)Applications
[0060] The composition for suppressing c-KIT expression in melanocytes may be, for example, a cosmetic, beauty product, quasi-drug, pharmaceutical, or food or beverage product for suppressing c-KIT expression in melanocytes, and is preferably a cosmetic or beauty product for suppressing c-KIT expression in melanocytes.
[0061] The composition for inhibiting c-KIT expression in melanocytes may be used as a raw material for inhibiting c-KIT expression in, for example, cosmetics, quasi-drugs, pharmaceuticals, or food and beverage products. That is, the composition for inhibiting c-KIT expression in melanocytes may be, for example, a raw material for inhibiting c-KIT expression in cosmetics, quasi-drugs, pharmaceuticals, or food and beverage products, and is preferably a raw material for inhibiting c-KIT expression in cosmetics or cosmetics. The content of the extract of Zanthoxylum chinense pericarp in the cosmetics, quasi-drugs, pharmaceuticals, or food and beverage products may be adjusted, for example, within the numerical range described above in "(1-2) Content of extract of Zanthoxylum chinense pericarp."
[0062] The composition for inhibiting c-KIT expression in melanocytes can inhibit melanin production through the inhibition of c-KIT expression. Therefore, the composition for inhibiting c-KIT expression in melanocytes may be a whitening composition. Furthermore, the composition for inhibiting c-KIT expression in melanocytes may be, for example, a whitening cosmetic, whitening cosmetics, whitening quasi-drug, whitening pharmaceutical, or whitening food or beverage, and is preferably a whitening cosmetic or whitening cosmetics.
[0063] (3) Effect
[0064] The composition for inhibiting c-KIT expression in melanocytes has the effect of inhibiting c-KIT expression in melanocytes. This effect can be confirmed by a decrease in the expression level of c-KIT in melanocytes when the composition for inhibiting c-KIT expression in melanocytes of this embodiment is used compared to when the composition is not used. The expression level of c-KIT can be the expression level of the c-KIT protein or the expression level of the gene encoding c-KIT. The expression level of the protein or gene can be measured by methods known in the art. For example, the expression level of the c-KIT protein can be measured according to the procedure shown in Example 3 below.
[0065] <5. Whitening cosmetics>
[0066] The above-mentioned composition for inhibiting melanin production, composition for promoting BMP4 expression in melanocytes, and composition for inhibiting c-KIT expression in melanocytes are all suitable for use in whitening cosmetics. Therefore, the present invention also provides a whitening cosmetic containing any one of the composition for inhibiting melanin production, composition for promoting BMP4 expression in melanocytes, and composition for inhibiting c-KIT expression in melanocytes.
[0067] (1) Ingredients
[0068] A whitening cosmetic according to one embodiment of the present invention may be a cosmetic comprising a composition for inhibiting melanin production, a cosmetic comprising a composition for promoting BMP4 expression in melanocytes, or a cosmetic comprising a composition for inhibiting c-KIT expression in melanocytes. In other words, the whitening cosmetic may be a cosmetic containing no ingredients other than the composition for inhibiting melanin production, the composition for promoting BMP4 expression in melanocytes, and the composition for inhibiting c-KIT expression in melanocytes.
[0069] The whitening cosmetic of this embodiment may be a cosmetic containing ingredients other than the composition for inhibiting melanin production, the composition for promoting BMP4 expression in melanocytes, and the composition for inhibiting c-KIT expression in melanocytes. These ingredients may be ingredients known in the art. For example, the whitening cosmetic may contain, in addition to these compositions, one or more ingredients known to have a melanin production inhibitory effect or a whitening effect.
[0070] In the whitening cosmetic, the lower limit of the content of the extract of Zanthoxylum japonicum pericarp may be, for example, 1 μg / mL or more, preferably 3 μg / mL or more, more preferably 6 μg / mL or more, even more preferably 10 μg / mL or more, and particularly preferably 15 μg / mL or more, 20 μg / mL or more, 25 μg / mL or more, 30 μg / mL or more, 40 μg / mL or more, or 50 μg / mL or more, calculated on a dry solids basis. Such a content may result in a composition with a higher melanin production inhibitory effect. The upper limit of the content of the extract of Zanthoxylum japonicum pericarp may be appropriately adjusted by those skilled in the art depending on the intended use and form of the whitening cosmetic. The upper limit of the content may be, for example, 10 mg / mL or less, 5 mg / mL or less, or 2 mg / mL or less, calculated on a dry solids basis. A preferred range of the content may be a combination selected from the lower and upper limits described above.
[0071] (2) Form
[0072] The form of the whitening cosmetic may be appropriately selected by those skilled in the art depending on the application and purpose, etc. The form may be, for example, basic cosmetics such as face wash, lotion, emulsion, gel, cream, serum, cosmetic oil, and pack; makeup cosmetics such as makeup base, foundation, face powder, lipstick, lip gloss, lip balm, eye shadow, and eye cream; sun care products such as sunscreen cream, sunscreen lotion, and sunscreen spray; body cosmetics such as body cream and body lotion; etc. [Example]
[0073] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.
[0074] <Preparation of Zanthoxylum chinense peel extract>
[0075] A 95% by volume ethanol solution (ethanol:water = 95:5) was added to dried peel of Zanthoxylum japonicum (Zanthoxylum japonicum) of the Rutaceae family, and extraction was performed under reflux for 3 hours, followed by cooling. The mixture was filtered through filter paper, and an equal volume of water was added to the filtrate. The mixture was then left to stand at 4°C and then filtered through a membrane filter. An equal volume of 1,3-butylene glycol was added to the filtrate, stirred thoroughly, and filtered through a membrane filter again to prepare an extract of Zanthoxylum japonicum peel with a final solids concentration of 0.4 w / v% (hereinafter also referred to as "Zanthoxylum japonicum extract"). The membrane filter used in the above membrane filtration was PTFE 0.5 μm (manufactured by Advantec Co., Ltd.).
[0076] <Preparation of Zanthoxylum chinense extract>
[0077] Dry peel of Japanese pepper (Zanthoxylum piperitum) of the Rutaceae family was extracted with absolute ethanol, and then filtered to prepare a Japanese pepper extract (hereinafter also referred to as "Zanthoxylum piperitum extract") with a final solids concentration of 2.0 w / v%.
[0078] <Example 1: Verification of the effect of suppressing melanin production in cultured cells>
[0079] B16 melanoma cells were seeded into 10% FBS-containing MEM medium (Nissui Pharmaceutical Co., Ltd.) in a 6-well plate and cultured at 37°C in a 5% carbon dioxide atmosphere. The following day, the pepper extract was diluted with a 50% ethanol solution (ethanol:water = 50:50) to prepare six pepper extract-containing compositions with different concentrations. Each pepper extract-containing composition was added and mixed so that the concentration of the pepper extract in the medium was 0 μg / mL (control), 3.125 μg / mL, 6.25 μg / mL, 12.5 μg / mL, 25 μg / mL, or 50 μg / mL. Two days after addition, the medium was replaced, and the above composition was added again at the same concentration. The following day, the medium was removed, and the cells were washed with phosphate buffer and then harvested. Sodium hydroxide solution was added to the harvested cells to dissolve melanin, and the amount of melanin in the cells was quantified by measuring the absorbance. The effect of the addition of the pepper extract-containing composition on the amount of melanin was confirmed by standardizing the total amount of melanin in the cells by the number of cells.
[0080] As a comparative example, Zanthoxylum piperitum extract was also diluted with a 50% ethanol solution (ethanol:water = 50:50) by volume to prepare three Zanthoxylum piperitum extract-containing compositions with different concentrations of Zanthoxylum piperitum extract. Each Zanthoxylum piperitum extract-containing composition was added and mixed so that the concentration of Zanthoxylum piperitum extract in the medium was 0 μg / mL (control), 3.125 μg / mL, or 6.25 μg / mL. Tests were then conducted using the same procedures as for the Zanthoxylum piperitum extract-containing compositions described above. Note that when the concentration of Zanthoxylum piperitum extract in the medium exceeded 6.25 μg / mL, a decrease in cell growth rate was observed. Therefore, when the concentration of Zanthoxylum piperitum extract in the medium exceeded 6.25 μg / mL, melanin levels were not examined.
[0081] Figure 1 is a graph showing the amount of melanin when a pepper extract-containing composition was added. In Figure 1, the vertical axis shows the relative amount when the amount of melanin per cell in the control group is set to 1. As shown in Figure 1, the addition of the pepper extract-containing composition reduced the amount of melanin concentration-dependently. This result shows that the pepper extract-containing composition can suppress melanin production.
[0082] Figure 2 is a graph showing the amount of melanin when a composition containing Japanese pepper extract was added. In Figure 2, the vertical axis shows the relative amount when the amount of melanin per cell in the control group is set to 1. As shown in Figure 2, the amount of melanin increased slightly by adding the composition containing Japanese pepper extract. This result shows that the composition containing Japanese pepper extract cannot suppress melanin production, but rather has the effect of promoting melanin production.
[0083] <Example 2: Verification of the effect of promoting BMP4 expression in human epidermal melanocytes>
[0084] Normal human epidermal melanocytes (Sigma) were seeded in a 6-well plate containing human epidermal melanocyte medium (Medium 254 medium, Thermofisher) containing HMGS growth additive (Thermofisher) and cultured at 37°C in a 5% CO2 atmosphere. After 3 days, pepper extract was added to the medium at a concentration of 0 μg / mL (control), 100 μg / mL, or 200 μg / mL. After 24 hours, the cells (normal human epidermal melanocytes) were washed with phosphate buffer and then harvested. mRNA was extracted from the harvested cells using an RNeasy Plus Mini Kit (QIAGEN). Human BMP4 mRNA expression levels were then measured by quantitative real-time PCR using cDNA generated using the iScript Advanced cDNA Synthesis Kit for RT-qPCR (BioRad). The quantitative real-time PCR used the BMP4 forward primer (actgcaaccgttcagaggtc) and the BMP4 reverse primer (aaacttgctggaaaggctca). The BMP4 mRNA expression level was normalized to the β-actin mRNA level and calculated as a ratio to the control mRNA level.
[0085] Figure 3 is a graph showing the expression level of BMP4 mRNA when pepper extract was added. In Figure 3, the vertical axis shows the relative amount when the mRNA expression level of the control group is set to 1. As shown in Figure 3, the addition of pepper extract increased the expression level of BMP4 mRNA in melanocytes. This result shows that pepper extract can promote the expression of BMP4 in melanocytes.
[0086] <Example 3: Verification of the effect of suppressing c-KIT expression in human epidermal melanocytes>
[0087] A 35 mm dish was filled with a medium for human epidermal melanocytes (Medium 254 medium, Thermofisher) containing HMGS growth additive (Thermofisher), and normal human epidermal melanocytes (Human Epidermal Melanocytes, Sigma) were seeded and cultured at 37°C in a carbon dioxide concentration of 5 vol%. After 2 days, pepper extract was added to the medium to a concentration of 0 μg / mL (control), 100 μg / mL, or 200 μg / mL. After 24 hours, 80 mJ / cm 2 The cells were irradiated with 1000 uV of UVB. After 24 hours, the cells were washed with phosphate buffer and then harvested. Proteins were harvested from the cells and analyzed for protein content using Western blotting. The primary antibody used was a c-KIT antibody (IBL), and the secondary antibody was an anti-mouse secondary antibody (Protein Simple). The amount of c-KIT protein obtained was normalized to the amount of β-actin protein and calculated as a ratio to the amount of the target protein.
[0088] Figure 4 is a graph showing the amount of c-KIT protein when pepper extract was added. In Figure 4, the vertical axis shows the relative amount when the protein amount in the control group is set to 1. As shown in Figure 4, the addition of pepper extract reduced the amount of c-KIT protein in melanocytes. This result indicates that pepper extract can suppress the expression of c-KIT in melanocytes.
[0089] Example 4: Preparation of lotion
[0090] (Component) (%) 1. Glycerin 5.0 2.1,3-butylene glycol 6.5 3. Polyoxyethylene (20E.O.) Sorbitan Monolaurate 1.2 4. Ethanol 12.0 5. Lactic acid 0.05 6. Sodium lactate 0.1 7. Ascorbic Acid Glucoside 2.0 8.Castor extract 0.01 9. Methyl parahydroxybenzoate 0.1 10.Fragrance (appropriate amount) 11. Remaining purified water
[0091] (Manufacturing method) A: Components 3, 4, 9, and 10 were mixed and dissolved. B: Components 1, 2, 5 to 8, and 11 were mixed and dissolved. C: A and B were mixed and homogenized to obtain a lotion.
[0092] Example 5: Preparation of oil-in-water emulsion
[0093] (Component) (%) 1. Polyoxyethylene (6E.O.) Sorbitan Monostearate 1.0 2. Polyoxyethylene tetraoleate (60E.O.) sorbitol 0.5 3. Glyceryl Monostearate 1.0 4. Stearic acid 0.5 5. Behenyl alcohol 0.5 6. Squalane 8.0 7. Arbutin 3.0 8. Ethanol 5.0 9.Castor extract 0.05 10. Remaining purified water 11. Methyl parahydroxybenzoate 0.1 12. Carboxyvinyl polymer 0.2 13. Sodium hydroxide 0.1 14. Hyaluronic Acid 0.1 15.Fragrance (appropriate amount)
[0094] (Manufacturing method) A: Ingredient 10 was heated and maintained at 70°C. B: Components 1 to 6, 8 and 11 were heated and mixed and maintained at 70°C. C: A was added to B and mixed to form a uniform emulsification. D: After cooling C, ingredients 7, 9, and 12 to 15 were added and mixed uniformly to obtain an oil-in-water emulsion.
[0095] Example 6: Preparation of oil-in-water emulsion
[0096] (Component) (%) 1.1,3-Butylene glycol 12.0 2. Tranexamic acid 4.0 3. Remaining purified water 4. Polyethylene glycol monostearate (40E.O.) 0.5 5. Sorbitan sesquioleate 0.1 6. Hydrogenated lecithin 0.1 7. Cholesteryl hydroxystearate (Note 1) 3.0 8. Vaseline 2.0 9. α-olefin oligomer 5.0 10. Shea Butter 2.0 11. Dimethylpolysiloxane (10CS) 1.0 12. Ceramide 3 0.1 13. Astaxanthin 0.1 14. Tocopherol 0.01 15. Cetostearyl Alcohol 2.0 16. Behenyl Alcohol 1.0 17. Methyl parahydroxybenzoate 0.1 18. Acrylic acid-alkyl methacrylate copolymer (Note 2) 0.1 19. Xanthan gum 0.1 20. Sodium hydroxide 0.03 21.Castor extract 0.1 22.Fragrance (appropriate amount) (Note 1) Salakos HS (manufactured by Nisshin Oillio Co., Ltd.) (Note 2) Carbopol ULTREZ21 (manufactured by LUBRIZOL)
[0097] (Manufacturing method) A: Components 1 to 3 were uniformly dissolved and mixed at 70°C. B: Components 4 to 16 were uniformly dissolved and mixed at 80°C. C: B was added to A and emulsified at 70°C. D: Components 17 to 22 were added to C and mixed, then cooled to 40°C to obtain an oil-in-water emulsion.
[0098] Example 7: Preparation of oil-in-water emulsion serum
[0099] (Component) (%) 1.1,3-Butylene Glycol 5.0 2. Tranexamic acid 1.0 3. Tripropylene Glycol 3.0 4. Remaining purified water 5. Polyoxyethylene sorbitan monooleate (20E.O.) 0.1 6. Polyethylene glycol monostearate (55E.O.) 0.25 7. Macadamia nut oil fatty acid phytosteryl (Note 3) 2.0 8. Light liquid isoparaffin (Note 4) 3.0 9. Dimethylpolysiloxane (6CS) 3.0 10. Cholesterol 0.1 11. Tocopherol 0.01 12. Cetostearyl alcohol 0.5 13. Methyl parahydroxybenzoate 0.1 14. Carbomer (Note 5) 0.15 15. (Sodium acrylate / sodium acryloyldimethyltaurate) Copolymer (Note 6) 0.1 16. Sodium hydroxide 0.05 17. Ethanol 5.0 18. Collagen 0.1 19. Elastin 0.1 20. Hyaluronic Acid 0.1 21.Castor extract 0.1 22.Fragrance 0.05 (Note 3) PLANDOOL-MAS (manufactured by Nippon Fine Chemicals Co., Ltd.) (Note 4) Chloratum LES (manufactured by Croda) (Note 5) CARBOPOL 980 (manufactured by LUBURIZOL) (Note 6) SIMULGEL EG (SEPIC)
[0100] (Manufacturing method) A: Components 1 to 4 were uniformly dissolved and mixed at 70°C. B: Components 5 to 11 were uniformly dissolved and mixed at 80°C. C: B was added to A and emulsified at 70°C. D: Components 12 to 22 were added to C and mixed, then cooled to 40°C to obtain an oil-in-water emulsion serum.
[0101] Example 8: Preparation of sheet-type pack cosmetic
[0102] (Component) (%) 1. Isostearic acid 0.05 2. Polyoxyethylene (60 mol) hydrogenated castor oil 0.3 3. 2-Ethylhexyl methoxycinnamate 0.05 4. Glycerin 3.0 5.1,3-Butylene Glycol 5.0 6. Ethanol 8.0 7. Sodium citrate 0.02 8. Citric acid 0.05 9. Dipotassium glycyrrhizinate 0.1 10. Phenoxyethanol 0.05 11. Niacinamide 4.0 12. Diethylenetriaminepentaacetic acid pentasodium 40% aqueous solution 0.15 13.Castor extract 0.02 14. Remaining purified water
[0103] (Manufacturing method) A: Components 1 to 6 were mixed and dissolved. B: Components 7 to 14 were mixed and dissolved. C: A was added to B and mixed. D: C was impregnated into a nonwoven fabric to obtain a sheet-type pack cosmetic.
[0104] <Example 9: Preparation of ointment>
[0105] (Component) (%) 1. Triethanolamine 2.0 2. Glycerin 8.0 3. Remaining purified water 4.Castor extract 0.001 5. Cetyl alcohol 6.0 6. Vaseline 32.0 7. Tocopherol 0.01 8. Glycyrrhetinic acid stearyl 0.1 9. Stearic acid 18.0 10. Sorbitan Sesquioleate 1.5
[0106] (Manufacturing method) A. Components 5 to 10 were dissolved uniformly at 75°C. B. Components 1 to 4 were dissolved uniformly at 75°C. B was gradually added to CA, emulsified at 75°C, and cooled to room temperature to obtain an ointment.
[0107] When the lotion, emulsion, serum, sheet pack cosmetic, and ointment produced in Examples 4 to 9 were applied to human skin, the effects of preventing age spots and freckles were confirmed. These results demonstrate that the composition containing the above-mentioned pepper extract has an inhibitory effect on melanin production, and that the cosmetic containing the composition has a whitening effect.
Claims
1. A composition for promoting BMP4 expression in melanocytes, comprising an extract of Zanthoxylum chinense pericarp as an active ingredient.
2. A composition for inhibiting c-KIT expression in melanocytes, comprising an extract of Zanthoxylum chinense pericarp as an active ingredient.
Citation Information
Patent Citations
New application of active ingredient WGX50 in pepper extract
CN111568794A
Tyrosinase activity promoter
JP1999079951A
Composition for slimming body
JP2008069134A
Expression promoter for thermogenetic protein
JP2010180165A
Anti-inflammatory composition, and skin preparation for external use, cosmetic and health food containing the same
JP2011093880A