Novel adeno-associated virus (AAV) clade F vectors and their uses
AAVhu68 capsids with specific amino acid modifications address the limitations of AAV9 by enhancing delivery efficiency and yield, enabling effective transduction of diverse tissues and organs, including improved blood-brain barrier crossing.
Patent Information
- Application Number
- JP2023064895
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-01-05
- Filing Date
- 2023-04-12
- Publication Date
- 2025-10-15
- Estimated Expiration
- 2038-02-27
AI Technical Summary
Existing AAV vectors, particularly AAV9, face challenges in efficiently delivering heterologous molecules to specific tissues and cells, including crossing the blood-brain barrier and achieving optimal transduction efficiency in various organs.
Development of AAVhu68 capsids with specific amino acid modifications, particularly at positions 67 and 157, and a heterogeneous population of vp1, vp2, and vp3 proteins, which enhance delivery efficiency and yield, allowing for improved transduction of a wide range of cell and tissue types, including lung, heart, muscle, liver, and brain.
The AAVhu68 capsids demonstrate enhanced transduction efficiency and yield, facilitating effective delivery of therapeutic molecules to target tissues and organs, including improved delivery across the blood-brain barrier.
Smart Images

Figure 0007754872000025 
Figure 0007754872000026 
Figure 0007754872000027
Abstract
Description
[Technical Field]
[0001] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This application includes work supported by the Defense Advanced Research Projects Agency (DARPA) under W911NF-13-2-0036. The U.S. Government may have certain rights in this invention. [Background technology]
[0002] Adeno-associated virus (AAV), a member of the Parvoviridae family, is a small, non-enveloped, icosahedral virus with a single-stranded linear DNA (ssDNA) genome approximately 4.7 kilobases (kb) in length. The wild-type genome contains inverted terminal repeats (ITRs) at both ends of the DNA strand and two open reading frames (ORFs): rep and cap. Rep consists of four overlapping genes encoding the rep proteins required for the AAV life cycle, and cap contains overlapping nucleotide sequences of the capsid proteins: VP1, VP2, and VP3, which self-assemble to form a capsid with icosahedral symmetry.
[0003] AAV is a member of the Dependovirus genus, due to its discovery as a contaminant in purified adenovirus materials. The AAV life cycle includes a latent phase in which the AAV genome integrates site-specifically into host chromosomes after infection, and an infectious phase in which the integrated genome is subsequently rescued, replicated, and packaged into infectious virus following infection with either adenovirus or herpes simplex virus. The nonpathogenicity, broad host range of infectivity, including non-dividing cells, and potential site-specific chromosomal integration make AAV an attractive tool for gene transfer.
[0004] Recombinant adeno-associated virus (rAAV) vectors, derived from replication-deficient human parvoviruses, have been demonstrated as suitable vehicles for gene delivery. Typically, functional rep and cap genes are removed from the vector, rendering it replication-incompetent. These functions are provided during the vector production system but are not present in the final vector.
[0005] To date, several different AAVs have been isolated and well characterized from humans or non-human primates (NHPs). Different AAV serotypes have been found to exhibit different transfection efficiencies and tropism for different cells or tissues. WO 2005 / 033321 describes many different AAV clades, including clade F, which has been identified as having only three members: AAV9, AAVhu31, and AAVhu32. A structural analysis of AAV9 is provided in MADiMattia et al., J. Virol. (June 2012) vol. 86 no. 12 6947-6958. This paper reports that AAV9 contains 60 copies (total) of three variable proteins (vp) encoded by the cap gene and with overlapping sequences. These include VP1 (87 kDa), VP2 (73 kDa), and VP3 (62 kDa), which are present in a predicted ratio of 1:1:10, respectively. The entire VP3 sequence is contained in VP2, and all of VP2 is contained in VP1. VP1 has a unique N-terminal domain. Precise coordinates and structure coefficients are available from the RCSB PDB database under accession number 3UX1.
[0006] Several different AAV9 variants have been engineered to detarget or target various tissues. See, e.g., N. Pulicheria, "Engineering Liver-detargeted AAV9 Vectors for Cardiac and Liver Tumors," in Musculoskeletal Gene Transfer”,Molecula See Neurology Therapy, Vol. 19, No. 6, pp. 1070-1078 (June 2011). The development of AAV9 variants for delivering genes across the blood-brain barrier has also been reported. See, e.g., BEDeverman et al., Nature Biotech, Vol. 34, No. 2, pp. 204-211 (published online February 1, 2016), and Caltech press release A. Wetherston, www.neurology-central.com / 2016 / 02 / 10 / successful-delivery-of-genes-through-the-blood-brain-barrier / , accessed May 10, 2016. See also WO2016 / 0492301 and US Pat. No. 8,734,809.
[0007] What is desired are AAV-based constructs for delivery of heterologous molecules. Summary of the Invention
[0008] Novel AAVhu68 capsid and rep sequences are described that are useful in production and in vectors for delivering nucleic acid molecules to host cells. In certain embodiments, recombinant AAVs are provided that have an AAVhu68 capsid encoded by the nucleic acid sequence of SEQ ID NO:1, or a nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:2 and that is at least 70% identical to SEQ ID NO:1, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO:1.
[0009] In one embodiment, (A)(1) an AAVhu68 vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:2, a vp1 protein produced from SEQ ID NO:1, or a vp1 protein produced from a nucleic acid sequence encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:2 and that is at least 70% identical to SEQ ID NO:1; an AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:2; a vp2 protein produced from a sequence comprising at least nucleotides 412-2211 of SEQ ID NO:1, or a vp2 protein produced from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:2 and that is at least 70% identical to at least nucleotides 412-2211 of SEQ ID NO:1; an AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding at least about amino acids 203-736 of SEQ ID NO:2. AAVhu68 capsid proteins, including vp3 proteins, vp3 proteins produced from a sequence comprising at least nucleotides 607-2211 of SEQ ID NO:1, or vp3 proteins produced from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203-736 of SEQ ID NO:2 and which is at least 70% identical to at least nucleotides 607-2211 of SEQ ID NO:1; and / or (2) AAV capsid proteins, including a heterogeneous population of vp1 proteins optionally comprising a valine at position 157 and / or a glutamic acid at position 67, a heterogeneous population of vp2 proteins optionally comprising a valine at position 157, and a heterogeneous population of vp3 proteins, wherein at least a subpopulation of vp1 and vp2 proteins comprises a valine at position 157 and optionally further comprises a glutamic acid at position 67 based on the vp1 capsid numbering of SEQ ID NO:2;and / or (3) a heterogeneous population of vp1 proteins that are the product of nucleic acid sequences encoding the amino acid sequence of SEQ ID NO:2, a heterogeneous population of vp2 proteins that are the product of nucleic acid sequences encoding the amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:2, and a heterogeneous population of vp3 proteins that are the product of nucleic acid sequences encoding at least about amino acids 203-736 of SEQ ID NO:2, wherein the vp1, vp2, and vp3 proteins contain subpopulations with amino acid modifications that include at least two highly deamidated asparagines (N) in the asparagine-glycine pairings of SEQ ID NO:2, and optionally further subpopulations that include other deamidated amino acids, wherein the deamidation is a; A recombinant adeno-associated virus (rAAV) is provided, comprising: (A) an AAV68 capsid containing an amino acid alteration; and (B) a vector genome within the AAVhu68 capsid, the vector genome comprising a nucleic acid molecule containing an AAV inverted terminal repeat sequence and a non-AAV nucleic acid sequence operably linked to a sequence encoding a product and promoting expression of the product in a host. For example, four residues (N57, N329, N452, N512) typically exhibit high levels of deamidation. Additional residues (N94, N253, N270, N304, N409, N477, and Q599) also exhibit deamidation levels of about 20% or less across various lots.
[0010] In certain embodiments, the deamidated asparagine is deamidated to aspartic acid, isoaspartic acid, an interconverted aspartic acid / isoaspartic acid pair, or a combination thereof, hi certain embodiments, the deamidated glutamine(s) is deamidated to (α)-glutamic acid, γ-glutamic acid, an interconverted (α)-glutamic acid / γ-glutamic acid pair, or a combination thereof.
[0011] In certain embodiments, the AAVhu68 capsids comprise a subpopulation having one or more of: (a) at least 65% of the asparagine (N) of the asparagine-glycine pair located at position 57 of the vp1 protein, based on the numbering of SEQ ID NO:2; (b) at least 75% of the N of the asparagine-glycine pair located at position 329 of the vp1, v2, and vp3 proteins, based on the residue numbering of the amino acid sequence of SEQ ID NO:2, are deamidated; (c) at least 50% of the N of the asparagine-glycine pair located at position 452 of the vp1, v2, and vp3 proteins, based on the residue numbering of the amino acid sequence of SEQ ID NO:2, are deamidated; and / or (d) at least 75% of the N of the asparagine-glycine pair located at position 512 of the vp1, v2, and vp3 proteins, based on the residue numbering of the amino acid sequence of SEQ ID NO:2, are deamidated. In certain embodiments, hu68 capsids comprise a subpopulation of vp1 proteins in which 75-100% of the Ns at position 57 of the vp1 protein are deamidated as determined using mass spectrometry. In certain embodiments, hu68 capsids comprise a subpopulation of vp1, vp2, and / or vp3 proteins in which 75-100% of the Ns at position 329 of the numbering of SEQ ID NO:2 are deamidated as determined using mass spectrometry. In certain embodiments, hu68 capsids comprise a subpopulation of vp1, vp2, and / or vp3 proteins in which 75-100% of the Ns at position 452 of the numbering of SEQ ID NO:2 are deamidated as determined using mass spectrometry. In certain embodiments, hu68 capsids comprise a subpopulation of vp1, vp2, and / or vp3 proteins in which 75-100% of the Ns at position 512 of the numbering of SEQ ID NO:2 are deamidated. In certain embodiments, the nucleic acid sequence encoding the protein is SEQ ID NO: 1, or a sequence that encodes the amino acid sequence of SEQ ID NO: 2 and is at least 80% to at least 90% identical to SEQ ID NO: 1. In certain embodiments, the sequence is at least 80% to 97% identical to SEQ ID NO: 1.In certain embodiments, the rAAVhu68 capsid further comprises at least a subpopulation of vp1, vp2, and / or vp3 proteins having amino acid modifications from SEQ ID NO:2 comprising at least about 50-100% deamidation at at least four positions selected from one or more of N57, 329, 452, 512, or a combination thereof. In certain embodiments, hu68 capsids comprise a subpopulation of vp1, vp2, and / or vp3 proteins that further comprise 1% to about 40% deamidation at at least one or more of positions N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, or a combination thereof. In certain embodiments, hu68 capsids comprise a subpopulation of vp1, vp2, and / or vp3 proteins that further comprise one or more modifications selected from one or more modifications at one or more of the following: acetylated lysine, phosphorylated serine, and / or sucrose. leonine, isomerized aspartic acid, oxidized tryptophan and / or methionine, or amidated amino acids. In certain embodiments, rAAVhu68 comprises about 60 total capsid proteins in a ratio of vp1 to vp2 to vp3 proteins of about 1 to about 1-1.5 to 3-10. In certain embodiments, an AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of vp1 to vp2 to vp3 proteins of about 1 to about 1 to 3-9. In certain embodiments, the vector genome comprises AAV ITR sequences from an AAV source other than AAVhu68.
[0012] In certain embodiments, a composition is provided comprising a mixed population of recombinant adeno-associated virus hu68 (rAAVhu68), each of which is independently selected from the rAAVhu68s described herein. In certain embodiments, an average AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of vp1 to vp2 to vp3 proteins of about 1 to about 1-1.5 to 3-10. In certain embodiments, an average AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of vp1 to vp2 to vp3 proteins of about 1 to about 1 to 3-6. In certain embodiments, the composition is formulated for intrathecal delivery, and the vector genome comprises a nucleic acid sequence encoding a product for delivery to the central nervous system. In certain embodiments, the composition is formulated for intravenous delivery. In certain embodiments, the vector genome comprises a nucleic acid sequence encoding an anti-HER2 antibody. In certain embodiments, the composition is formulated for intranasal or intramuscular delivery. In certain embodiments, the composition comprises at least the rAAVhu68 vector material and optional carriers, excipients, and / or preservatives.
[0013] In certain embodiments, provided is the use of rAAVhu68 or a composition described herein to deliver a desired gene product to a subject in need thereof.
[0014] In certain embodiments, an rAAV production system useful for producing recombinant AAVhu68 is provided. The production system includes: (a) an AAVhu68 capsid nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2; (b) a nucleic acid molecule suitable for packaging into an AAVhu68 capsid, the nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence operably linked to a sequence encoding a gene product and promoting expression of the product in a host cell; and (c) sufficient AAV rep and helper functions to enable packaging of the nucleic acid molecule into a recombinant AAVhu68 capsid. In certain embodiments, the nucleic acid sequence of (a) includes at least SEQ ID NO:1, or a sequence encoding the amino acid sequence of SEQ ID NO:2 that is at least 70% to at least 99% identical to SEQ ID NO:1. In certain embodiments, the system optionally further includes a nucleic acid sequence from about nt 607 to about nt 2211 of SEQ ID NO:1 encoding AAVhu68 vp3 from about aa 203 to about amino acid 736 of SEQ ID NO:2. In certain embodiments, the system comprises human embryonic kidney 293 cells or a baculovirus system.
[0015] In certain embodiments, methods are provided for reducing deamidation of AAVhu68 capsids. The methods include producing AAVhu68 capsids from a nucleic acid sequence containing a modified AAVhu68 vp codon, wherein the nucleic acid sequence contains a modified glycine codon at one to three of the arginine-glycine pairs located at positions 58, 330, 453, and / or 513 of SEQ ID NO:2, independently, to encode an amino acid other than glycine. In certain embodiments, the methods include producing AAVhu68 capsids from a nucleic acid sequence containing a modified AAVhu68 vp codon, wherein the nucleic acid sequence contains a modified arginine codon at one to three of the arginine-glycine pairs located at positions 57, 329, 452, and / or 512 of SEQ ID NO:2, independently, to encode an amino acid other than arginine. In certain embodiments, each modified codon encodes a different amino acid. In certain embodiments, two or more modified codons are The same amino acids are encoded. In certain embodiments, the mutant AAVhu68 capsids described herein contain a mutation in an arginine-glycine pair, changing glycine to alanine or serine. A mutant AAVhu68 capsid may contain one, two, or three mutations, where the reference AAVhu68 originally contains four NG pairs. In certain embodiments, a mutant AAVhu68 capsid contains only one mutation in an NG pair. In certain embodiments, a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAVhu68 capsid contains mutations in two different NG pairs that are structurally separated in the AAVhu68 capsid. In certain embodiments, the mutation is not in the VP1 unique region. In certain embodiments, one of the mutations is in the VP1 unique region. In some cases, the mutant AAVhu6 capsid does not contain a modification in the NG pair, but contains a mutation that minimizes or eliminates deamidation at one or more asparagines or glutamines located outside the NG pair.
[0016] In certain embodiments, a mutant rAAVhu68 is provided that comprises a modified rAAVhu68 capsid produced using the methods described herein and that has reduced deamidation relative to an unmodified AAVhu68 capsid.
[0017] In yet another aspect, methods are provided for improving the yield and / or packaging efficiency of recombinant adeno-associated (rAAV) vectors, comprising engineering an AAV capsid gene to express a vp1 protein, the numbering of which is based on the full-length vp1 of AAVhu68 [SEQ ID NO:2] and which has Val at amino acid position 157. In certain embodiments, clade F rAAVs are provided that have a glutamic acid (Glu or E) at amino acid position 67 based on the numbering of SEQ ID NO:2.
[0018] In yet another embodiment, an engineered rAAV provided according to this method is provided.
[0019] In a further embodiment, AAVhu68 particles expressing anti-HER2 antibodies that are useful for the treatment and / or prevention of HER2+ cancers are provided.
[0020] In yet another embodiment, a nucleic acid molecule is provided comprising a nucleic acid sequence encoding an AAVhu68 rep protein or a functional fragment thereof under the control of exogenous regulatory control sequences that drive its expression in a host cell, hi one embodiment, the rep protein has the amino acid sequence of SEQ ID NO:4, or a functional fragment thereof.
[0021] These and other aspects of the present invention will become apparent from the following detailed description of the invention. [Brief explanation of the drawings]
[0022] [Figure 1] An alignment is shown of the amino acid sequence of the vp1 capsid protein of AAVhu68 [SEQ ID NO:16] (labeled hu.68.vp1 in the alignment) with AAV9 [SEQ ID NO:6], AAVhu31 (labeled hu.31 in the alignment) [SEQ ID NO:10], and AAVhu32 (labeled hu.32 in the alignment) [SEQ ID NO:11]. Two mutations (A67E and A157V) were found to be essential in AAVhu68 compared to AAV9, AAVhu31, and AAVhu32 and are circled in the figure. [Figure 2] AC show alignments of the nucleic acid sequences encoding the vp1 capsid protein of AAVhu68 with AAV9, AAVhu31 [SEQ ID NO: 12], and AAVhu32 [SEQ ID NO: 13]. [Figure 3]Graphs A-B show the yield of AAVhu.68 compared to that of AAV9. Experiments were performed as described in Example 2. n=6. P values were calculated and indicated in the figures. A shows the yield of AAVhu.68 and AAV9 from total lysate. The P value was calculated to be 0.4173 and was determined to be not significant. B shows the yield of AAVhu.68 and AAV9 from culture supernatant. The yield of AAVhu.68 in the supernatant was significantly higher than that of AAV9, with a p value of 0.0003. [Figure 4] Figures A-C show immunohistochemical staining of various organs (heart, liver, lung, and muscle) from mice administered 5x10 GC of AAVhu68.CB7.nLacZ. Samples were prepared and processed as described in Example 3. Samples were counterstained with eosin, shown in red. Positive staining for LacZ, shown in blue, indicates successful AAVhu68 transduction. Figure A shows immunohistochemical staining of various organs (heart, liver, lung, and muscle) from mice administered 5x10 GC of AAVhu68.CB7.nLacZ intravenously (IV). All organs tested showed AAVhu68 transduction, with a preference for heart and liver over lung and muscle. Figure B shows immunohistochemical staining of various organs (heart, liver, lung, and muscle) from mice administered 5x10 GC of AAVhu68.CB7.nLacZ intramuscularly (IM). While the heart, liver, and muscle showed high transduction rates with AAVhu68, no detectable transduction was observed in the lungs. (C) Immunohistochemical staining of various organs (heart, liver, lungs, and muscle) from mice administered 5 x 10 GC of AAVhu68.CB7.nLacZ intranasally (IN). Diffuse transduction was observed in the heart, liver, muscle, and lungs. [Figure 5]Figures A-C show fluorescence microscopy images of various brain regions (hippocampus, Figure 5A; motor cortex, Figure 5B; and cerebellum, Figure 5C) from mice administered AAVhu68.GFP or AAV9.GFP at a dose of 1x10 GC or 1x10 GC. Samples were prepared and processed as described in Example 4. A positive signal from GFP, shown in green, indicates successful transduction of the AAV vector. Figure A shows a fluorescence microscopy image of a hippocampal slide from a mouse administered AAVhu68.GFP or AAV9.GFP at a dose of 1x10 GC or 1x10 GC. A corresponding sample from an untreated mouse stained with a nucleic acid dye, shown in blue, served as a negative control. Transduction of the AAV vector was observed in all test samples except for those from mice injected with 1x10 GC of AAV9.GFP. (B) Fluorescence microscopy images of the motor cortex from mice administered AAVhu68.GFP or AAV9.GFP at doses of 1 × 10 GC or 1 × 10 GC. Transduction of AAVhu68.GFP was observed to be better than that of AAV9. (C) Fluorescence microscopy images of cerebellar slides from mice administered AAVhu68.GFP or AAV9.GFP at doses of 1 × 10 GC or 1 × 10 GC. Transduction of AAVhu68.GFP was observed to be better when mice were injected with 1 × 10 GC of the vector. [Figure 6]Figures A-D show microscopic images of various organs (liver, kidney, heart, and pancreas) from mice intravenously administered AAVhu68.GFP. Samples were prepared and processed as described in Example 4. Positive signals from GFP, shown in green, indicate successful transduction of the AAV vector. Brightfield images, shown in black and white, were provided for organ morphology, while the corresponding red fluorescent channel served as a negative control where applicable. Figure A shows a microscopic image of a representative liver section from a mouse intravenously administered AAVhu68.GFP. Positive signals, shown in green, were observed. Figure B shows a microscopic image of a representative kidney section from a mouse intravenously administered AAVhu68.GFP. Positive signals, shown in green, were observed. Figure C shows a microscopic image of a representative heart section from a mouse intravenously administered AAVhu68.GFP. Positive signals, shown in green, were observed. Figure D shows a microscopic image of a representative pancreas section from a mouse intravenously administered AAVhu68.GFP. A positive signal was observed, shown in green. [Figure 7] 10 is an image of the equipment for intracisternal delivery including a 10cc vector syringe, a 10cc prefilled irrigation syringe, a T-connector extension set, a 22G x 5 inch spinal tap needle, and an optional 18G x 3.5 inch introducer needle with an optional introducer needle for coaxial insertion. [Figure 8] Figures 8A-8B show the production yields of two different AAVhu68 vectors produced at small scale (Figure 8A) and very large scale (giant, Figure 8B) compared with vectors with different capsids. Data for small-scale vector preparations were generated using vectors with AAVhu68, AAV9, AAV8, or AAV8triple capsids and vector genomes containing a cytomegalovirus promoter (CMV), firefly luciferase coding sequence, and SV40 polyA (CMV.ffLuciferase.SV40). Large-scale preparations were evaluated using AAVhu68, AAV9, AAV8, or AAV8triple vectors with vector genomes containing a CMV promoter, intron, immunoadhesin coding sequence (201IgIA), and SV40 polyA. [Figure 9]The production purity of AAVhu68 vectors produced at large scale is shown in comparison to vectors with different capsids, including AAV8triple, AAV9, and AAV8. Preparations were evaluated using AAVhu68, AAV9, AAV8, or AAV8triple vectors, which have vector genomes containing a CMV promoter, intron, immunoadhesin coding sequence (201IgIA), and SV40 polyA. [Figure 10] Figures 10A-B show the transgene expression levels of the AAVhu68 vector compared with those of vectors with different capsids, including AAV8triple, AAV9, and AAV8, in male RAG KO mice (n=5 / group) intramuscularly injected with either 3x10 GC / mouse (Figure 10A) or 3x10 GC / mouse (Figure 10B). The transgene expressed by the rAAV vector is an immunoadhesin coding sequence (201IgIA). The experiment was performed as described in detail in Example 8. [Figure 11] Figures 11A-B show the transgene expression levels of the AAVhu68 vector in either the liver (Figure 11A) or muscle (Figure 11B) of male C57BL / 6J mice (n=5 / group) intramuscularly injected with 3x10GC / mouse of vector, compared with those of vectors with different capsids, including AAV8triple, AAV9, and AAV8. The transgene expressed by the rAAV vector is firefly luciferase. The experiment was performed as described in detail in Example 9. [Figure 12] Figure 1 shows the transgene expression levels of the AAVhu68 vector in male and female cynomolgus monkeys intramuscularly injected with 1 x 10 GC / kg body weight of the vector, compared with those of vectors with different capsids, including AAV8triple, AAV9, and AAV8. The transgene expressed by the rAAV vector is an immunoadhesin coding sequence (201IgIA). The experiment was performed as described in detail in Example 10. DETAILED DESCRIPTION OF THE INVENTION
[0023] Provided herein are the nucleic acid and amino acid sequences of a newly isolated adeno-associated virus (AAV) within Clade F, designated herein as AAVhu68. AAVhu68 (previously designated herein as AAV3G2) differs from another Clade F virus, AAV9 (SEQ ID NO:5), by two amino acids encoded at positions 67 and 157 of vp1 of SEQ ID NO:2. In contrast, other Clade F AAVs (AAV9, hu31, hu31) have an Ala at position 67 and an Ala at position 157. Provided are novel AAVhu68 capsids and / or engineered AAV capsids that have a valine (Val or V) at position 157 and, optionally, a glutamic acid (Glu or E) at position 67 based on the numbering of SEQ ID NO:2. In certain embodiments, the ratio of vp3 protein to vp1 and vp2 proteins in AAVhu68 capsids is lower than that previously taught for capsids of AAV9 and other clade F AAVs. In certain embodiments, AAVhu68 capsids consist of AAVhu68 vp1 protein, AAVhu68 vp2 protein, and AAVhu68 vp3 protein in a ratio of vp1:vp2:vp3 of about 1:1 to about 1.5:3 to about 10. In certain embodiments, rAAVhu68 viral material or a population of rAAVhu68 is a composition having a total of about 60 vp1, vp2, and vp3 proteins present in the AAVhu68 capsid at an average ratio of vp1:vp2:vp3 of about 1:about 1:about 3 to about 6. These AAV capsids described herein are suitable for use in recombinant AAV (rAAV) vectors that provide good yields and / or packaging efficiencies. The present invention is useful for generating rAAV vectors useful for transducing a wide variety of cell and tissue types, including, but not limited to, lung, heart, muscle, liver, pancreas, kidney, brain, hippocampus, motor cortex, cerebellum, nasal epithelial cells, cardiac muscle cells or cardiomyocytes, hepatocytes, lung endothelial cells, myocytes, lung epithelial cells, pancreatic islet cells, acinar cells, kidney cells, and motor neurons.
[0024] "Recombinant AAV" or "rAAV" is a DNAse-resistant viral particle containing two elements: an AAV capsid and a vector genome containing at least a non-AAV coding sequence packaged within the AAV capsid. Unless otherwise specified, this term can be used interchangeably with the phrase "rAAV vector." rAAV lacks any functional AAV rep or cap genes and is unable to produce progeny, making it a "proliferation-deficient virus" or "viral vector." In certain embodiments, the only AAV sequences are AAV inverted terminal repeats (ITRs), which are typically located at the farthest 5' and 3' ends of the vector genome to allow the genes and regulatory sequences located between the ITRs to be packaged within the AAV capsid.
[0025] As used herein, "vector genome" refers to a nucleic acid sequence packaged inside the rAAV capsid that forms the viral particle. Such a nucleic acid sequence contains AAV inverted terminal repeats (ITRs). In the example herein, the vector genome contains, from 5' to 3', at least the AAV 5' ITR, coding sequence(s), and the AAV 3' ITR. ITRs from AAV2, a different AAV source from the capsid, may be selected, or ITRs other than the full-length ITRs may be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV that provides the rep function during production or a complementary AAV. Additionally, other ITRs may be used. Additionally, the vector genome contains regulatory sequences that drive expression of gene products. Suitable components of a vector genome are described in more detail herein.
[0026] rAAVhu68 consists of an AAVhu68 capsid and a vector genome. The AAVhu68 capsid is a collection of a heterogeneous population of vp1, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins. As used herein, the term "heterologous," or any grammatical variant thereof, when used in reference to vp capsid proteins, refers to a population of non-identical elements, e.g., elements having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences. SEQ ID NO: 2 represents the sequence of the encoded AAVhu68 The amino acid sequence of the vp1 protein is provided.
[0027] The AAVhu68 capsid contains subpopulations within the vp1, vp2, and vp3 proteins that have modifications from the predicted amino acid residues of SEQ ID NO:2. These subpopulations contain, at a minimum, specific deamidated asparagine (N or Asn) residues. For example, specific subpopulations contain at least one, two, three, or four highly deamidated asparagine (N) positions in the asparagine-glycine pair of SEQ ID NO:2, and possibly additional deamidated amino acids, where deamidation results in amino acid changes and other optional modifications. SEQ ID NO:14 shows the amino acid sequence of a modified AAVhu68 capsid and exemplifies positions that may have some percentage of deamidated or modified amino acids. Various combinations of these and other modifications are described herein.
[0028] As used herein, unless otherwise specified, a "subpopulation" of vp proteins refers to a group of vp proteins that have at least one defined characteristic in common and that consist of at least one group member and less than all members of a reference group. For example, vp1 proteins. A "subpopulation" of proteins, unless otherwise specified, is at least one vp1 protein and less than all vp1 proteins in an assembled AAV capsid. A "subpopulation" of vp3 proteins, unless otherwise specified, can be one vp3 protein to less than all vp3 proteins in an assembled AAV capsid. For example, vp1 proteins can be a subpopulation of vp proteins, vp2 proteins can be another subpopulation of vp proteins, and vp3 can be yet another subpopulation of vp proteins in an assembled AAV capsid. In another example, vp1, vp2, and vp3 proteins can contain subpopulations with different modifications, e.g., at least one, two, three, or four highly deamidated asparagines, e.g., asparagine-glycine pairs.
[0029] Unless otherwise specified, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 97%, 99%, or up to about 100% deamidated at a reference amino acid position compared to the predicted amino acid sequence at the reference amino acid position (e.g., at least 80% of the asparagine at amino acid 57 of SEQ ID NO:2 may be deamidated relative to the entire vp1 protein, or 20% of the asparagine at amino acid 409 of SEQ ID NO:2 may be deamidated relative to all of the vp1, vp2, and vp3 proteins). Such percentages may be determined using 2D gels, mass spectrometry, or other suitable techniques.
[0030] Without wishing to be bound by theory, at least, deamidation of highly deamidated residues in the vp protein in AAVhu68 capsids is thought to be primarily nonenzymatic in nature, driven by functional groups in the capsid protein that deamidate selected asparagine residues and, to a lesser extent, glutamine residues. The efficient capsid assembly of the largely deamidated vp1 protein suggests that these events occur after capsid assembly or that deamidation in individual monomers (vp1, vp2, or vp3) is structurally well tolerated and generally does not affect assembly kinetics. Extensive deamidation in the VP1-unique (VP1-u) region (approximately aa 1–137), generally believed to be internally located prior to cell entry, suggests that VP deamidation may occur prior to capsid assembly.
[0031] Without wishing to be bound by theory, deamidation of N may occur through nucleophilic attack of the main chain nitrogen atom of the C-terminal residue on the side chain amide carbon atom of Asn. It is believed that an intermediate ring-closed succinimide residue is formed. The succinimide residue then undergoes rapid hydrolysis to the final product, aspartic acid (Asp) or isoaspartic acid (IsoAsp). Thus, in certain embodiments, deamidation of asparagine (N or Asn) leads to Asp or IsoAsp, which can be interconverted via the succinimide intermediate, for example, as illustrated below. [ka] As provided herein, each deamidated N in SEQ ID NO:2 can independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and / or an interconverted blend of Asp and isoAsp, or a combination thereof. The α- and isoaspartic acids can be present in any suitable ratio. For example, in certain embodiments, the ratio can be 10:1 to 1:10 aspartic acid to isoaspartic acid, about 50:50 aspartic acid:isoaspartic acid, or about 1:3 aspartic acid:isoaspartic acid, or another selected ratio.
[0032] In certain embodiments, one or more glutamines (Q) in SEQ ID NO:2 are deamidated to glutamic acid (Glu), i.e., α-glutamic acid, γ-glutamic acid (Glu), or a blend of α- and γ-glutamic acid, which can be interconverted via a common glutarimide intermediate. The α- and γ-glutamic acids can be present in any suitable ratio. For example, in certain embodiments, the ratio can be 10:1 to 1:10 α:γ, about 50:50 α:γ, or about 1:3 α:γ, or another selected ratio. [ka]
[0033] Thus, rAAVhu68 contains subpopulations of vp1, vp2, and / or vp3 proteins within the rAAVhu68 capsid that have deamidated amino acids, including, at a minimum, at least one subpopulation that contains at least one highly deamidated asparagine. In addition, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In yet other embodiments, modifications may include amidation at Asp positions.
[0034] In certain embodiments, AAVhu68 capsids contain subpopulations of vp1, vp2, and vp3 having at least 4 to at least about 25 deamidated amino acid residue positions, of which at least 1-10% are deamidated compared to the encoded amino acid sequence of SEQ ID NO: 2. The majority of these may be N residues; however, Q residues may also be deamidated.
[0035] In certain embodiments, the AAV68 capsid is further characterized by one or more of the following: The AAVhu68 capsid protein can be an AAVhu68 vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:2, a vp1 protein produced from SEQ ID NO:1, or a vp1 protein produced from a nucleic acid sequence encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:2 and that is at least 70% identical to SEQ ID NO:1; an AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:2, a vp2 protein produced from a sequence including at least nucleotides 412-2211 of SEQ ID NO:1, or a vp2 protein produced from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:2 and that is at least 70% identical to at least nucleotides 412-2211 of SEQ ID NO:1, and / or an AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203-736 of SEQ ID NO:2. vp3 protein, including vp3 protein produced from a sequence comprising at least nucleotides 607-2211 of SEQ ID NO:1, or vp3 protein produced from a nucleic acid sequence that encodes the predicted amino acid sequence of at least about amino acids 203-736 of SEQ ID NO:2 and is at least 70% identical to at least nucleotides 607-2211 of SEQ ID NO:1.
[0036] Additionally or alternatively, provided is an AAV capsid comprising a heterogeneous population of vp1 proteins optionally comprising a valine at position 157, a heterogeneous population of vp2 proteins optionally comprising a valine at position 157, and a heterogeneous population of vp3 proteins, wherein at least a subpopulation of vp1 and vp2 proteins comprises a valine at position 157 and optionally further comprises a glutamic acid at position 67 based on the vp1 capsid numbering of SEQ ID NO: 2. Additionally or alternatively, provided is an AAVhu68 capsid comprising a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding an amino acid sequence of at least about amino acids 138-736 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203-736 of SEQ ID NO: 2, wherein the vp1, vp2, and vp3 proteins comprise subpopulations with amino acid modifications.
[0037] The AAVhu68 vp1, vp2, and vp3 proteins are typically expressed as alternative splice variants encoded by the same nucleic acid sequence that encodes the full-length vp1 amino acid sequence (amino acids 1-736) of SEQ ID NO: 2. In some cases, the vp1 coding sequence is used alone to express the vp1, vp2, and vp3 proteins. Alternatively, this sequence may be combined with a nucleic acid sequence or complementary strand encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2 (approximately aa 203-736) without the vp1 unique region (approximately aa 1 to approximately aa 137) and / or the vp2 unique region (approximately aa 1 to approximately aa 202), or the corresponding mRNA. Alternatively, it may be co-expressed with one or more of the following sequences: tRNA (from about nt 607 to about nt 2211 of SEQ ID NO: 1), or a sequence encoding aa 203 to 736 of SEQ ID NO: 2, which is at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 1. Additionally or alternatively, the vp1- and / or vp2-coding sequences may be coexpressed with a nucleic acid sequence or its complementary strand encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO:2 (approximately aa 138-736) without the vp1-specific region (approximately aa 1 to approximately aa 137), the corresponding mRNA or tRNA (nt 412 to 22121 of SEQ ID NO:1), or a sequence encoding approximately aa 138-736 of SEQ ID NO:2 that is at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:1.
[0038] As described herein, rAAVhu68 has rAAVhu68 capsids produced in a production system that expresses capsids from an AAVhu68 nucleic acid encoding the vp1 amino acid sequence of SEQ ID NO:2, and optionally from an additional nucleic acid sequence encoding a vp3 protein, e.g., without the vp1 and / or vp2 unique regions. The resulting rAAVhu68 produced using the single nucleic acid sequence vp1 produces a heterogeneous population of vp1, vp2, and vp3 proteins. More specifically, AAVhu68 capsids contain subpopulations of vp1, vp2, and vp3 proteins that have modifications from the predicted amino acid residues of SEQ ID NO:2. These subpopulations contain, at a minimum, deamidated asparagine (N or Asn) residues. For example, the asparagine of an asparagine-glycine pair is highly deamidated.
[0039] In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 1 or a strand complementary thereto, e.g., the corresponding mRNA or tRNA. Additionally or alternatively, in certain embodiments, the vp2 and / or vp3 proteins may be expressed from a nucleic acid sequence different from vp1, e.g., to alter the ratio of vp proteins in a selected expression system. Certain embodiments further include the AAVhu68 of SEQ ID NO: 2, without the vp1 unique region (from about aa 1 to about aa 137) and / or the vp2 unique region (from about aa 1 to about aa 202). Also provided are nucleic acid sequences encoding the vp3 amino acid sequence (about aa 203-736), or their complementary strands, corresponding mRNAs or tRNAs (about nt 607 to about nt 2211 of SEQ ID NO: 1). In certain embodiments, also provided are nucleic acid sequences encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 2 (about aa 138-736), or their complementary strands, corresponding mRNAs or tRNAs (nt 412-2211 of SEQ ID NO: 1), without the vp1 unique region (about aa 1 to about aa 137).
[0040] However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO:2 may be selected for use in producing rAAVhu68 capsids. In certain embodiments, the nucleic acid sequence has a sequence that is at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO:1, or SEQ ID NO:1 encoding SEQ ID NO:2. In certain embodiments, the nucleic acid sequence has a sequence that is at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO:1, or to the portion of SEQ ID NO:1 from about nt 412 to about nt 2211 of SEQ ID NO:1 encoding the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO:2. In certain embodiments, the nucleic acid sequence is at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, or at least identical to the nucleic acid sequence from about nt 607 to about nt 2211 of SEQ ID NO: 1, or the nt encoding the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 2. also have sequences that are 95%, at least 97%, or at least 99% identical.
[0041] Designing nucleic acid sequences, including DNA (genomic or cDNA) or RNA (e.g., mRNA), encoding this AAVhu68 capsid is within the skill of those in the art. In certain embodiments, the nucleic acid sequence encoding the AAVhu68 vp1 capsid protein is set forth in SEQ ID NO: 1. See also Figures 1B-1D. In other embodiments, nucleic acid sequences having 70-99.9% identity to SEQ ID NO: 1 can be selected for expression of the AAVhu68 capsid protein. In other specific embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99%-99.9% identical to SEQ ID NO: 1. Such nucleic acid sequences may be codon-optimized for expression in a selected system (e.g., cell type) and can be designed by a variety of methods. This optimization can be performed using methods available online (e.g., GeneArt), publicly available methods, or companies that provide codon optimization services, such as DNA2.0 (Menlo Park, CA). One codon optimization method is described, for example, in U.S. International Patent Publication No. WO 2015 / 012924, which is incorporated herein by reference in its entirety. See also, for example, U.S. Patent Publication Nos. 2014 / 0032186 and 2006 / 0136184. It is preferred to modify the entire length of the open reading frame (ORF) for a product. However, in some embodiments, only a portion of the ORF may be altered. Using one of these methods, a frequency can be applied to any given polypeptide sequence to generate a nucleic acid fragment of a codon-optimized coding region that encodes the polypeptide. Many options are available for making the actual changes to codons or synthesizing a codon-optimized coding region designed as described herein. Such modification or synthesis can be carried out using standard and routine molecular biology procedures familiar to those skilled in the art. In one approach, a series of complementary oligonucleotide pairs, each 80-90 nucleotides in length and spanning the length of the desired sequence, are synthesized by standard methods.These oligonucleotide pairs are synthesized such that, upon annealing, they form 80-90 base pair double-stranded fragments containing cohesive ends; for example, each oligonucleotide in a pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond the region complementary to the other oligonucleotide in the pair. The single-stranded end of each pair of oligonucleotides is designed to anneal to the single-stranded end of another pair of oligonucleotides. The oligonucleotide pairs are annealed, and then approximately 5-6 of these double-stranded fragments are annealed via their cohesive single-stranded ends, after which they are ligated together and cloned into a standard bacterial cloning vector, such as the TOPO® vector available from Invitrogen Corporation, Carlsbad, Calif. The constructs are then sequenced using standard methods. Some of these constructs, consisting of 80-90 base pair fragments of 5-6 ligated fragments, i.e., approximately 500 base pair fragments, are generated so that the entire desired sequence is represented as a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Further methods will be readily apparent to those skilled in the art. In addition, gene synthesis is readily available commercially.
[0042] In certain embodiments, the asparagine (N) of NG pairs in the AAVhu68 vp1, vp2, and vp3 proteins is highly deamidated. In certain embodiments, the AAVhu68 capsid contains a subpopulation of AAV vp1, vp2, and / or vp3 capsid proteins having at least four asparagine (N) positions in the AAVhu68 capsid protein that are highly deamidated. In certain embodiments, the asparagine (N) of NN pairs (NN- About 20-50% of the N residues (excluding N triplets) exhibit deamidation. In certain embodiments, the first N is deamidated. In certain embodiments, the second N is deamidated. In certain embodiments, the deamidation is about 15% to about 25% deamidation. Deamidation at Q at position 259 of SEQ ID NO: 2 is a deamidation of the AAVhu68 protein. It accounts for approximately 8% to approximately 42% of the vp1, vp2, and vp3 capsid proteins.
[0043] In certain embodiments, the rAAVhu68 capsid is further characterized by amidation at D297 of the vp1, vp2, and vp3 proteins. In certain embodiments, about 70% to about 75% of the D at position 297 of the vp1, vp2, and / or vp3 proteins in the AAVhu68 capsid are amidated, based on the numbering of SEQ ID NO:2.
[0044] In certain embodiments, at least one Asp in vp1, vp2, and / or vp3 of the capsid is isomerized to D-Asp, and such isomers are typically present in an amount less than about 1% of the Asp at one or more of residue positions 97, 107, and 384 based on the numbering of SEQ ID NO:2.
[0045] In certain embodiments, rAAVhu68 has an AAVhu68 capsid with vp1, vp2, and vp3 proteins with subpopulations containing combinations of one, two, three, four, or more deamidated residues at the positions shown in the table below. Deamidation in rAAV can be determined using 2D gel electrophoresis and / or mass spectrometry and / or protein modeling techniques. Online chromatography may be performed using a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF (Thermo Fisher Scientific) equipped with an Acclaim PepMap column and a NanoFlex source. MS data were acquired using a data-dependent top-20 method for the Q Exactive HF, which dynamically selects the most abundant unsequenced precursor ions from the survey scan (m / z 200–2000). Sequencing was performed by higher-energy collisional dissociation fragmentation with a target of 1e5 ions determined using predictive automatic gain control, and precursor isolation was performed with a margin window of 4 m / z. Test scans were acquired at a resolution of 120,000 at m / z 200. The resolution of the HCD spectra may be set to 30,000 at m / z 200, with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The S-lens RF level may be set to 50 to optimize transmission of the m / z region occupied by peptides from the digest. Precursor ions may be excluded from fragmentation selection due to a single unassigned or six or more charge states. BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used to analyze the acquired data. For peptide mapping, searches are performed using a single-input protein FASTA database with carbamidomethylation set as a fixed modification, oxidation, deamidation, and phosphorylation set as variable modifications, a mass accuracy of 10 ppm, high protease specificity, and a confidence level of 0.8 for MS / MS spectra. Examples of suitable proteases may include trypsin or chymotrypsin.Because deamidation adds +0.984 Da (the mass difference between the -OH and -NH groups) to the mass of the intact molecule, identification of deamidated peptides by mass spectrometry is relatively straightforward. The percent deamidation of a particular peptide is calculated by dividing the determined mass area of the deamidated peptide by the combined area of the deamidated and original peptides. When considering the number of potential deamidation sites, isobaric species deamidated at different sites may converge into a single peak. As a result, fragment ions generated from peptides with multiple potential deamidation sites can be used to localize or distinguish between multiple sites of deamidation. In these cases, the relative intensities of the observed isotopic patterns can be used to specifically determine the relative abundances of various deamidated peptide isomers. This method allows for fragmentation analysis of all isomeric species. It is assumed that the deamidation efficiency is the same regardless of the site of deamidation. Those skilled in the art will understand that many modifications of these exemplary methods can be used. For example, suitable mass spectrometers can include quadrupole time-of-flight mass spectrometers (QTOF) such as the Waters Xevo or Agilent 6530, or orbitrap instruments such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Suitable liquid chromatography systems can include, for example, the Acquity UPLC system from Waters, or Agilent systems (series 1100 or 1200). Suitable data analysis software can include, for example, MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Further techniques may be described, for example, in X. Jin et al., Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online June 16, 2017. [Table 1-1] [Table 1-2]
[0046] In certain embodiments, AAVhu68 capsids are characterized by having capsid proteins in which at least 45% of the N residues are deamidated at at least one of positions N57, N329, N452, and / or N512, based on the numbering of the amino acid sequence of SEQ ID NO: 2. In certain embodiments, at least about 60%, at least about 70%, at least about 80%, or at least 90% of the N residues at one or more of these N-G positions (i.e., N57, N329, N452, and / or N512, based on the numbering of the amino acid sequence of SEQ ID NO: 2) are deamidated. In these and other embodiments, AAVhu68 capsids are further characterized by having a population of proteins in which about 1% to about 20% of the N residues are deamidated at one or more of positions N94, N253, N270, N304, N409, N477, and / or Q599, based on the numbering of the amino acid sequence of SEQ ID NO: 2. In certain embodiments, AAVhu68 comprises at least a subpopulation of vp1, vp2 and / or vp3 proteins that are deamidated at one or more, or a combination of, positions N35, N57, N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N329, N336, N409, N410, N452, N477, N515, N598, Q599, N628, N651, N663, N709, N735 based on the numbering of the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the capsid protein may have one or more amidated amino acids.
[0047] Additional modifications are possible, most of which do not result in the conversion of one amino acid residue to another. Optionally, at least one Lys in vp1, vp2, and vp3 of the capsid is acetylated. Optionally, at least one Asp in vp1, vp2, and / or vp3 of the capsid is isomerized to D-Asp. Optionally, at least one S (Ser, serine) in vp1, vp2, and / or vp3 of the capsid is phosphorylated. Optionally, at least one T (Thr, threonine) in vp1, vp2, and / or vp3 of the capsid is phosphorylated. Optionally, at least one W (trp, tryptophan) in vp1, vp2, and / or vp3 of the capsid is oxidized. Optionally, at least one M (Met, methionine) in vp1, vp2, and / or vp3 of the capsid is oxidized. In certain embodiments, the capsid protein has one or more phosphorylations, for example, a particular vp1 capsid protein may be phosphorylated at position 149.
[0048] In certain embodiments, the AAVhu68 capsid comprises a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2 and that contain a glutamic acid (Glu) at position 67 and / or a valine (Val) at position 157; a heterogeneous population of vp2 proteins that optionally contain a valine (Val) at position 157; and a heterogeneous population of vp3 proteins. The AAVhu68 capsid contains at least one subpopulation in which at least 65% of the asparagine (N) of the asparagine-glycine pair located at position 57 of the vp1 protein and at least 70% of the asparagine (N) of the asparagine-glycine pair located at positions 329, 452, and / or 512 of the vp1, v2, and vp3 proteins are deamidated, based on the residue numbering of the amino acid sequence of SEQ ID NO:2, where the deamidation results in an amino acid change.
[0049] As described in more detail herein, the deamidated asparagine can be deamidated to aspartic acid, isoaspartic acid, an interconverted aspartic acid / isoaspartic acid pair, or combinations thereof. In certain embodiments, rAAVhu68 is further characterized by one or more of the following: (a) each of the vp2 proteins is independently the product of a nucleic acid sequence encoding at least the vp2 protein of SEQ ID NO:2; (b) each of the vp3 proteins is independently the product of a nucleic acid sequence encoding at least the vp3 protein of SEQ ID NO:2; and (c) the nucleic acid sequence encoding the vp1 protein is SEQ ID NO:1, or a sequence encoding the amino acid sequence of SEQ ID NO:2 that is at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:1. In some cases, the sequences are used alone to express the vp1, vp2, and vp3 proteins. Alternatively, this sequence may be coexpressed with one or more of the following: a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO:2 (approximately aa 203-736) without the vp1-specific region (approximately aa 1 to approximately aa 137) and / or the vp2-specific region (approximately aa 1 to approximately aa 202), or a complementary strand thereof; the corresponding mRNA or tRNA (approximately nt 607 to approximately nt 2211 of SEQ ID NO:1); or a sequence encoding aa 203-736 of SEQ ID NO:2 that is at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:1.Additionally or alternatively, the vp1- and / or vp2-coding sequences may be co-expressed with a nucleic acid sequence or its complementary strand encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO:2 (approximately aa 138-736) without the vp1-specific region (approximately aa 1 to approximately aa 137), the corresponding mRNA or tRNA (nt 412-2211 of SEQ ID NO:1), or a sequence encoding approximately aa 138-736 of SEQ ID NO:2 that is at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:1.
[0050] Additionally, or alternatively, the rAAVhu68 capsid may comprise at least one of the following sequences: N57, N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N329, N336, N409, N410, N452, N477, N512, N515, N598, Q599, N6 (e) rAAVhu68 capsids comprise a subpopulation of vp1, vp2 and / or vp3 proteins that are deamidated at one or more of positions N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N310, N311, N312, N313, N314, N315, N316, N317, N318, N319, N320, N321, N322, N323, N324, N325, N326, N327, N328, N329, N330, N331, N332, N333, N334, N335, N336, N337, N338, N339, N340, N341, N342, N343, N344, N345, N346, N347, N348, N349, N350, N351, N352, N353, N354, N355, N356, N357, N358, N359, N360, N361, N362, N363, N364, N365, N366, N367, N368, N369, N370, N371, N372, N373, N374, N375, N376, N377, N378, N379, N380, N381, N382, N383, N384, N385, N386, N387, N388, N389, N389, N390, N391, N3 (f) rAAVhu68 capsids comprise a subpopulation of vp1 proteins in which 65-100% of the Ns at position 57 of the vp1 protein are deamidated based on the numbering of SEQ ID NO:2; (g) rAAVhu68 capsids comprise a subpopulation of vp1 proteins in which 75-100% of the Ns at position 57 of the vp1 protein are deamidated; (h) rAAVhu68 capsids comprise a subpopulation of vp1 proteins in which 80-100% of the Ns at position 329 of the vp1 protein are deamidated based on the numbering of SEQ ID NO:2. (i) rAAVhu68 capsids comprise a subpopulation of vp1, vp2, and / or vp3 proteins in which 80-100% of the N at position 452, based on the numbering of SEQ ID NO:2, are deamidated; (j) rAAVhu68 capsids comprise a subpopulation of vp1, vp2, and / or vp3 proteins in which 80-100% of the N at position 512, based on the numbering of SEQ ID NO:2, are deamidated; (k) rAAVs comprise a total of about 60 capsid proteins in a ratio of vp1 to vp2 to vp3 proteins of about 1 to about 1-1.5 to 3-10; (l) rAAVs comprise a total of about 60 capsid proteins in a ratio of vp1 to vp2 to vp3 proteins of about 1 to about 1 to 3-9.
[0051] In certain embodiments, AAVhu68 is modified to change the glycine of an asparagine-glycine pair to reduce deamidation. In other embodiments, the asparagine is changed to another amino acid that deamidates at a slower rate, such as glutamine; or an amino acid lacking an amide group (e.g., glutamine and asparagine contain amide groups); and / or an amine group (e.g., lysine, arginine, and histidine contain amide groups). As used herein, an amino acid lacking an amide or amine side group refers to, for example, glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan and / or proline. The described modifications can be made in one, two, or three of the asparagine-glycine pairs found in the encoded AAVhu68 amino acid sequence. In certain embodiments, not all four asparagine-glycine pairs are modified in this manner. Thus, methods for reducing deamidation of AAVhu68 and / or engineered AAVhu68 variants that have a slower deamidation rate Additionally or alternatively, one or more other amide amino acids may be changed to a non-amide amino acid to reduce deamidation of AAVhu68.
[0052] These amino acid modifications can be made by conventional genetic engineering techniques. For example, one to three of the codons encoding glycine (arginine-glycine pairs) at positions 58, 330, 453, and / or 513 of SEQ ID NO:2 can be modified to generate a nucleic acid sequence containing a modified AAVhu68 vp codon encoding an amino acid other than glycine. In certain embodiments, a nucleic acid sequence containing a modified arginine codon can be engineered such that one to three of the arginine-glycine pairs located at positions 57, 329, 452, and / or 512 of SEQ ID NO:2 encode an amino acid other than arginine. Each modified codon can encode a different amino acid. Alternatively, one or more of the altered codons can encode the same amino acid. In certain embodiments, these modified AAVhu68 nucleic acid sequences can be used to generate mutant rAAVhu68 capsids with less deamidation than native hu68 capsids. Such mutant rAAVhu68 may have reduced immunogenicity and / or may have improved stability upon storage, particularly upon storage in suspension form. As used herein, "codon" refers to three nucleotides that code for an amino acid in a sequence.
[0053] As used herein, "encoded amino acid sequence" refers to predicted amino acids based on translation of known DNA codons of a reference nucleic acid sequence into amino acids. The table below shows the DNA codons and 20 common amino acids, showing both the single letter code (SLC) and the three letter code (3LC). [Table 2]
[0054] AAVhu68 capsids may be useful in certain embodiments. For example, such capsids may be used to generate monoclonal antibodies and / or reagents useful in assays to track and assess AAVhu68 levels in gene therapy patients. Techniques for generating useful anti-AAVhu68 antibodies, labeling of such antibodies or empty capsids, and suitable assay configurations are known to those of skill in the art.
[0055] In certain embodiments, sequences are provided that encode at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% of the nucleic acid sequence of SEQ ID NO: 1 or the vp1 amino acid sequence of SEQ ID NO: 2 with a modification described herein (e.g., deamidated amino acid). In certain embodiments, the vp1 amino acid sequence is reproduced in SEQ ID NO: 14.
[0056] As used herein, the term "clade" with respect to a group of AAVs refers to a group of AAVs that are phylogenetically related to one another as determined using a neighbor-joining algorithm based on an alignment of AAV vp1 amino acid sequences with a bootstrap value of at least 75% (of at least 1000 replicates) and a Poisson-corrected distance measure of 0.05 or less. Neighbor-joining algorithms have been described in the literature. See, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs that can be used to implement this algorithm are available. For example, the MEGA v2.1 program uses a modified N The ei-Gojobori method is implemented. Using these techniques and computer programs and the sequence of the AAV vp1 capsid protein, one of skill in the art can readily determine whether a selected AAV falls within one of the clades identified herein, another clade, or falls outside these clades. See, for example, G Gao, et al., J Virol, 2004 Jun;78(10:6381-6388, which identifies clades A, B, C, D, E, and F and provides nucleic acid sequences of novel AAVs, GenBank accession numbers AY530553 to AY530629. See also WO2005 / 033321.
[0057] In one embodiment, the invention provides an engineered molecule comprising a spacer sequence between the AAVhu68 vp1 coding sequence and the AAVhu68 rep coding sequence, which is atgacttaaaccaggt, SEQ ID NO: 9. The coding sequence for AAVhu68 rep52 is reproduced in SEQ ID NO: 3. The rep52 protein sequence is reproduced in SEQ ID NO: 4.
[0058] In one embodiment, a method is provided for improving rAAV yield, thereby increasing the amount of rAAV present in the supernatant, without prior or requiring cell lysis. The method comprises engineering an AAV VP1 capsid gene to express a capsid protein with Glu at position 67 and no Val at position 157 based on an alignment with the amino acid numbering of the AAVhu68 vp1 capsid protein. In another embodiment, the method comprises engineering an AAVhu68 VP1 capsid gene to express a capsid protein with Val at position 157 and no Glu at position 67. Such other AAVs can easily be selected from other Clade F AAVs, or AAVs of Clades A, B, C, D, or E. In certain embodiments, the AAV is selected from Clades C, D, E, or F. In other embodiments, the AAV is selected from Clades C, D, or E.
[0059] In other embodiments, the method includes improving rAAV yield, thus increasing the amount of rAAV present in the supernatant, without or before the need for cell lysis. The method includes engineering the AAV VP1 capsid gene to express a capsid protein with Glu at position 67, Val at position 157, or both, based on an alignment with the amino acid numbering of the AAVhu68 vp1 capsid protein. In other embodiments, the method includes engineering the VP2 capsid gene to express a capsid protein with Val at position 157. In yet other embodiments, the rAAV has a modified capsid that includes both vp1 and vp2 capsid proteins with Glu at position 67 and Val at position 157.
[0060] In yet other embodiments, AAVhu68 can be engineered to have Ser, Gly, Ser, or Thr at position 67 relative to vp1 numbering [SEQ ID NO:2] while retaining Val at position 157. In yet other embodiments, AAVhu68 can be engineered to have Ile or Leu at position 157 relative to vp1 numbering [SEQ ID NO:2]. In yet another embodiment, AAVhu68 can be engineered to have Ser, Gly, Ser, or Thr at position 67 and Ile or Leu at position 157 relative to vp1 numbering [SEQ ID NO:2].
[0061] In a further embodiment, a method of packaging a transgene into a clade F AAV that results in at least a 15% increase in yield of packaged vector compared to AAV9 comprises culturing a host cell culture under suitable conditions. In certain embodiments, the increase is at least a 90% increase in yield. In other embodiments, the increase is at least a 200% increase in yield.
[0062] When comparing AAVhu68 and AAVrh10, lower doses (e.g., approximately 1 × 10 9) AAVhu68 was found to result in better transduction efficiency than AAVrh10. Furthermore, when comparing AAVhu68 with AAV9, the transduction efficiency was significantly higher in the cerebellum, motor cortex, and hippocampus of the brain (e.g., approximately 1 × 10 11 GC), AAVhu68 was found to result in better transduction efficiency than AAV9.
[0063] In certain embodiments, the present invention provides AAVhu68 vectors comprising a vector genome expressing an antibody directed against the HER2 receptor, such vectors being useful for the treatment and / or prevention of cancer.
[0064] As used herein, an "AAV9 capsid" refers to a self-assembling AAV capsid composed of multiple AAV9 vp proteins. AAV9 vp proteins are typically expressed as alternative splice variants encoded by the nucleic acid sequence of SEQ ID NO:5, or a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical thereto and encodes the vp1 amino acid sequence of SEQ ID NO:6 (GenBank accession: AAS99264). These splice variants result in proteins of various lengths of SEQ ID NO:6. In certain embodiments, "AAV9 capsid" includes an AAV having an amino acid sequence that is 99% identical to AAS99264 or 99% identical to SEQ ID NO:6. See also US7906111 and WO2005 / 033321. As used herein, "AAV9 variants" include those described, for example, in WO2016 / 049230, US8,927,514, US2015 / 0344911, and US8,734,809.
[0065] Methods for generating capsids, coding sequences therefor, and methods for producing rAAV viral vectors have been taught, see, e.g., Gao, et al., Proc. Natl. Acad. Sci. USA 100(10), 6081-6086 (2003) and US2013 / 0045186A1.
[0066] The terms "substantial homology" or "substantial similarity," when referring to a nucleic acid or a fragment thereof, indicate that, upon optimal alignment with another nucleic acid (or its complementary strand), with appropriate nucleotide insertions or deletions, there is at least about 95-99% nucleotide sequence identity in the aligned sequences. Preferably, the homology is over the full-length sequence or its open reading frame, or another suitable fragment at least 15 nucleotides in length. Examples of suitable fragments are described herein.
[0067] The terms "sequence identity," "percent sequence identity," or "percent identical" with respect to nucleic acid sequences refer to residues in two sequences that are identical when aligned for maximum correspondence. The length of sequence identity comparison can range over the full length of a genome, the full length of a gene coding sequence, or a fragment of at least about 500-5000 nucleotides is preferred. However, identity of smaller fragments, e.g., at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 or more nucleotides, may also be desired. Similarly, "percent sequence identity" can be readily determined for amino acid sequences over the full length of a protein or fragments thereof. Preferred fragments are at least about 8 amino acids in length and may be up to about 700 amino acids in length. Examples of suitable fragments are described herein.
[0068] When referring to an amino acid or a fragment thereof, the term "substantial homology" or "substantial similarity" refers to the ability to substitute another amino acid (or its complement) with appropriate amino acid insertions or deletions. When optimally aligned with a target sequence (e.g., a nucleotide sequence), there is at least about 95-99% amino acid sequence identity between the aligned sequences. Preferably, the homology is over the full-length sequence or a protein thereof, e.g., cap protein, rep protein, or a fragment thereof that is at least 8 amino acids in length, or more preferably at least 15 amino acids in length. Examples of suitable fragments are described herein.
[0069] The term "highly conserved" means at least 80% identity, preferably at least 90% identity, and more preferably greater than 97% identity. Identity is readily determined by those skilled in the art using algorithms and computer programs known to those skilled in the art.
[0070] Generally, when referring to "identity," "homology," or "similarity" between two different adeno-associated viruses, the "identity," "homology," or "similarity" is determined with respect to "aligned" sequences. An "aligned" sequence, or "alignment," refers to multiple nucleic acid or protein (amino acid) sequences, often containing missing or additional base or amino acid corrections compared to a reference sequence. In an example, an AAV alignment is performed using the publicly available AAV9 sequence as a reference point. Alignment is performed using any of a variety of publicly or commercially available multiple sequence alignment programs. Examples of such programs include "Clustal Omega," "Clustal W," "CAP Sequence Assembly," "MAP," and "MEME," which are available through web services on the Internet. Other sources of such programs are known to those of skill in the art. Alternatively, the Vector NTI utility can be used. There are also many algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the programs mentioned above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG version 6.1. Fasta™ provides alignments and percent sequence identity of the regions of best overlap between the query and search sequences. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with default parameters (word size of 6, NOPAM coefficient for the scoring matrix) as provided in GCG version 6.1, which is incorporated herein by reference. Additionally, several sequence alignment programs are available for amino acid sequences, such as the "Clustal Omega," "Clustal X," "MAP," "PIMA," "MSA," "BLOCKMAKER," "MEME," and "Match-Box" programs.Typically, one of these programs is used with default settings, although one of skill in the art can modify these settings as needed. Alternatively, one of skill in the art can utilize a different algorithm or computer program that produces a level of identity or alignment at least comparable to that produced by the reference algorithm and program. See, e.g., J.D. Thomson et al., Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments," 27(13):2682-2690 (1999).
[0071] I. rAAV vector As indicated above, the novel AAVhu68 sequences and proteins are useful in the production of rAAV and in recombinant AAV vectors, which may be antisense delivery vectors, gene therapy vectors, or vaccine vectors. Furthermore, the engineered AAV capsids described herein, e.g., those with mutant amino acids at positions 67, 157, or both relative to the numbering of the vp1 capsid protein of SEQ ID NO: 2, can be used as targets for many suitable nucleic acid molecules. It can be used to engineer rAAV vectors for delivery to cells and tissues.
[0072] The genomic sequence packaged within an AAV capsid and delivered to a host cell typically consists, at a minimum, of a transgene and its regulatory sequences, as well as AAV inverted terminal repeats (ITRs). Both single-stranded and self-complementary (sc) AAVs are encompassed by rAAV. A transgene is a nucleic acid coding sequence heterologous to the vector sequence that encodes a polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest. The nucleic acid coding sequence is operably linked to regulatory components to enable transcription, translation, and / or expression of the transgene in cells of the target tissue.
[0073] The AAV sequences of the vector typically contain cis-acting 5' and 3' inverted repeat sequences (see, e.g., BJ Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequences are approximately 145 bp in length. It is preferred that substantially the entire ITR-encoding sequence be used in the molecule, although some minor modifications of these sequences are acceptable. The ability to modify these ITR sequences is within the skill of one in the art (see, e.g., Sambrook et al., "Molecular Cloning. A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, New York (1989), and K. Fisher et al., J. Virol., 70:520-532 (1996)). One example of such a molecule employed in the present invention is a "cis-acting" plasmid containing a transgene in which the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. In one embodiment, the ITRs are from an AAV other than the one providing the capsid. In one embodiment, the ITR sequences are from AAV2. A shortened form of the 5' ITR, termed ΔITR, lacking the D-sequence and terminal resolution site (trs) is taught. In other embodiments, full-length AAV 5' and 3' ITRs are used. However, ITRs from other AAV sources may also be selected. When the source of the ITRs is AAV2 and the AAV capsid is from another AAV source, the resulting vector may be referred to as pseudotyped. However, other arrangements of these elements may be suitable.
[0074] In addition to the key elements identified above for recombinant AAV vectors, the vectors also contain the necessary general control elements operably linked to the transgene to permit transcription, translation, and / or expression of the transgene in cells produced according to the invention and transfected with the plasmid vector or infected with the virus. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans, or at a distance, to regulate the gene of interest.
[0075] Regulatory control elements typically contain a promoter sequence as part of the expression control sequence, for example, located between a selected 5'ITR sequence and the coding sequence. Constitutive promoters, regulatable promoters [see, e.g., WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters responsive to physiological cues may be used and utilized in the vectors described herein. The promoter(s) may come from a variety of sources, such as the human cytomegalovirus (CMV) immediate-early enhancer / promoter, the SV40 early enhancer / promoter, the JC polyomavirus promoter, the myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, the herpes simplex virus (HSV-1) latency-associated promoter (LAP), the Rous sarcoma virus (RSV) long terminal repeat promoter, or the like. The promoter can be selected from a long-transfer repeat (LTR) promoter, a neuron-specific promoter (NSE), a platelet-derived growth factor (PDGF) promoter, hSYN, a melanin-concentrating hormone (MCH) promoter, CBA, a matrix metalloprotein promoter (MPP), and a chicken β-actin promoter. In addition to the promoter, the vector may contain one or more other appropriate transcription initiation, transcription termination, and enhancer sequences, efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA, such as WPRE; sequences that improve translation efficiency (i.e., Kozak consensus sequences); sequences that improve protein stability; and, optionally, sequences that enhance secretion of the encoded product. One example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those appropriate for the desired target tissue indication. In one embodiment, the expression cassette contains one or more expression enhancers. In one embodiment, the expression cassette contains two or more expression enhancers. These enhancers may be the same or different from each other. For example, the enhancer may include a CMV immediate-early enhancer. This enhancer may be present as two copies located adjacent to each other. Alternatively, the duplicated enhancer copies may be separated from each other by one or more sequences. In yet another embodiment, the expression cassette further contains an intron, such as a chicken beta-actin intron. Other suitable introns include those known in the art, such as those described in WO2011 / 126808. Examples of suitable poly(A) sequences include SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic poly(A). In some cases, one or more sequences may be selected to stabilize mRNA. One example of such a sequence is a modified WPRE sequence, which may be engineered upstream of the poly(A) sequence and downstream of the coding sequence (see, e.g., MA Zanta-Boussif, et al., Gene Therapy (2009) 16:605-619).
[0076] These rAAVs are particularly well suited for gene delivery for therapeutic purposes and immunization, including inducing protective immunity. Furthermore, the compositions of the present invention may be used for the in vitro production of a desired gene product. For in vitro production, the desired product (e.g., a protein) can be obtained from the culture after transfection of host cells with rAAV containing a molecule encoding the desired product and culturing the cell culture under conditions allowing expression. The expressed product can then be purified and isolated, if desired. Suitable techniques for transfection, cell culture, purification, and isolation are known to those skilled in the art.
[0077] In certain embodiments, the rAAV or compositions provided herein do not contain an anti-influenza antibody or immunoglobulin construct. In certain embodiments, the rAAV or compositions provided herein do not contain an SMN coding sequence.
[0078] Therapeutic Genes and Gene Products Useful products encoded by transgenes include various gene products that replace deficient or defective genes, inactivate or "knock out," or "knock down" or reduce the expression of genes that are expressed at undesirably high levels, or deliver gene products with a desired therapeutic effect. In most embodiments, the treatment will be "somatic cell gene therapy," i.e., the transfer of genes into somatic cells that do not produce sperm or eggs. In certain embodiments, the transgene expressing the protein has a sequence of a native human sequence. However, in other embodiments, a synthetic protein is expressed. Such proteins may be intended for human treatment, or in other embodiments, may be designed for the treatment of animals, including companion animals such as dog or cat populations, or for the treatment of livestock or other animals that come into contact with the human population.
[0079] Examples of suitable gene products may include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare or orphan diseases. Examples of such rare diseases may include, among others, spinal muscular atrophy (SMA), Huntington's disease, Rett syndrome (e.g., methyl-CpG binding protein 2 (MeCP2); UniProtKB-P51608), amyotrophic lateral sclerosis (ALS), Duchenne muscular dystrophy, Friedreich's ataxia (e.g., frataxin), and progranulin (PRGN) (associated with non-Alzheimer's brain degeneration, including frontotemporal dementia (FTD), progressive non-fluent aphasia (PNFA), and semantic dementia). See, for example, www.orpha.net / consor / cgi-bin / Disease_Search_List.php; rarediseases.info.nih.gov / diseases.
[0080] Examples of suitable genes include, but are not limited to, insulin, glucagon, glucagon-like peptide-1 (GLP1), growth hormone (GH), parathyroid hormone (PTH), growth hormone-releasing factor (GRF), follicle-stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietin, angiostatin, granulocyte colony-stimulating factor (GCSF), erythropoietin (EPO) (including, for example, human, canine, or feline EPO), connective tissue growth factor (CTGF), neurotrophic factors, such as basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin growth factor I and II (IGF-I and IGF-II), and the like. 1), transforming growth factor alpha, for example, any one of TGFα, activin, inhibin, or bone morphogenetic proteins (BMPs) (any of BMPs 1-15), any one of the heregulin / neuregulin / ARIA / neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4 / 5, ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), neurturin, agrin, any one of the semaphorin / collapsin family, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog, and tyrosine hydroxylase.
[0081] Other useful transgene products include proteins that regulate the immune system, including, but not limited to, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 through IL-36 (including, for example, human interleukins IL-1, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-6, IL-8, IL-12, IL-11, IL-12, IL-13, IL-18, IL-31, and IL-35), monocyte chemotactic protein, leukemia inhibitory factor, granulocyte-macrophage colony-stimulating factor, Fas ligand, tumor necrosis factors α and β, interferons α, β, and γ, stem cell factor, and flk-2 / flt3 ligand. Gene products produced by the immune system are also useful in the present invention. These include, but are not limited to, immunoglobulins IgG, IgM, IgA, IgD, and IgE, chimeric immunoglobulins, humanized antibodies, single-chain antibodies, T cell receptors, chimeric T cell receptors, single-chain T cell receptors, class I and class II MHC molecules, and engineered immunoglobulins and MHC molecules. For example, in certain embodiments, rAAV antibodies can be designed to deliver canine or feline antibodies, such as anti-IgE, anti-IL31, anti-CD20, anti-NGF, anti-GnRH, etc. Useful gene products also include complement regulatory proteins, such as complement regulatory protein, membrane cofactor protein (MCP), decay-accelerating factor (DAF), CR1, CF2, CD59, and C1 esterase inhibitor (C1-INH).
[0082] Still other useful gene products include hormones, growth factors, cytokines, lymphokines, The present invention includes any one of receptors for cholesterol regulation and / or lipid modulation, such as low-density lipoprotein (LDL) receptors, high-density lipoprotein (HDL) receptors, very-low-density lipoprotein (VLDL) receptors, and scavenger receptors. The present invention also encompasses gene products such as members of the steroid hormone receptor superfamily, including glucocorticoid receptors and estrogen receptors, vitamin D receptors, and other nuclear receptors. Additionally, useful gene products include transcription factors such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD, and myogenin, ETS box-containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C / EBP, SP1, CCAAT box-binding proteins, interferon regulatory factor (IRF-1), Wilms tumor protein, ETS-binding proteins, STATs, GATA box-binding proteins such as GATA-3, and the forkhead family of winged-helix proteins.
[0083] Other useful gene products include carbamoyl synthetase I, ornithine transcarbamylase (OTC), argininosuccinate synthetase, argininosuccinate lyase (ASL) for the treatment of argininosuccinate lyase deficiency, arginase, fumarylacetoacetate hydrolase, phenylalanine hydroxylase, α1-antitrypsin, rhesus α-fetoprotein (AFP), rhesus chorionic gonadotrophin (CG), glucose-6-phosphatase, porphobilinogen deaminase, and cystadenomatase. These include thione β-synthase, branched-chain ketoacid decarboxylase, albumin, isovalerate-CoA dehydrogenase, propionate-CoA carboxylase, methylmalonyl-CoA mutase, glutarate-CoA dehydrogenase, insulin, β-glucosidase, pyruvate carboxylase, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, cystic fibrosis transmembrane conductance regulator (CFTR) sequence, and dystrophin gene products (e.g., mini- or micro-dystrophin). Still other useful gene products include enzymes useful for various conditions caused by a deficiency in enzyme activity, such as those that may be useful in enzyme replacement therapy. For example, enzymes containing mannose-6-phosphate can be used in therapy for lysosomal storage diseases (e.g., suitable genes include those encoding β-glucuronidase (GUSB)).
[0084] In certain embodiments, rAAVs can be used in gene editing systems, which can include the co-administration of one rAAV or multiple rAAV materials. For example, rAAVs can be engineered to deliver SpCas9, SaCas9, ARCUS, Cpf1, and other suitable gene editing constructs.
[0085] Still other useful gene products include those used for the treatment of hemophilia, including hemophilia B (including factor IX) and hemophilia A (including factor VIII and variants thereof, e.g., heterodimeric light and heavy chains and the deleted B domain; U.S. Pat. Nos. 6,200,560 and 6,221,349). In some embodiments, the minigene contains the first 57 base pairs of the factor VIII heavy chain, encoding a 10-amino acid signal sequence and the human growth hormone (hGH) polyadenylation sequence. In alternative embodiments, the minigene further contains the A1 and A2 domains, and 5 amino acids from the N-terminus of the B domain and / or the C-terminal 85 amino acids of the B domain, as well as the A3, C1, and C2 domains. In yet other embodiments, nucleic acids encoding the factor VIII heavy and light chains are provided as a single minigene, separated by 42 nucleic acids encoding the 14 amino acids of the B domain [U.S. Pat. No. 6,200,560].
[0086] Other useful gene products include non-naturally occurring polypeptides, e.g., polypeptides with insertions, deletions, or These include chimeric or hybrid polypeptides with non-naturally occurring amino acid sequences containing amino acid substitutions. For example, single-chain engineered immunoglobulins may be useful for certain immunodeficient patients. Other types of non-naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which can be used to alleviate overexpression of targets.
[0087] Reducing and / or modulating gene expression is particularly desirable for treating hyperproliferative conditions characterized by hyperproliferative cells, such as cancer and psoriasis. Target polypeptides include polypeptides produced exclusively or at higher levels in hyperproliferative cells compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation genes bcr / abl, ras, src, p53, neu, trk, and EGRF. In addition to oncogene products as target antigens, target polypeptides for anticancer therapy and protective regimens include the variable regions of antibodies produced by B-cell lymphomas and the variable regions of T-cell receptors in T-cell lymphomas, which in some embodiments are also used as target antigens for autoimmune diseases. Other tumor-associated polypeptides can be used as target polypeptides, such as the polypeptide recognized by monoclonal antibody 17-1A and polypeptides found at higher levels in tumor cells, including folate-binding polypeptides.
[0088] Other suitable therapeutic polypeptides and proteins include those that may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad, protective immune response against targets associated with autoimmunity, including cellular receptors and cells that produce "self"-directed antibodies. T cell-mediated autoimmune diseases include rheumatoid arthritis (RA), multiple sclerosis (MS), Sjögren's syndrome, sarcoidosis, insulin-dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease, and ulcerative colitis. Each of these diseases is characterized by a T cell receptor (TCR), which binds to endogenous antigens and initiates the inflammatory cascade associated with autoimmune disease.
[0089] Further examples of genes that can be delivered by rAAV include, but are not limited to, glucose-6-phosphatase, associated with glycogen storage disease or deficiency syndrome type 1A (GSD1), phosphoenolpyruvate carboxykinase (PEPCK), associated with PEPCK deficiency; cyclin-dependent kinase-like 5 (CDKL5), also known as serine / threonine kinase 9 (STK9), associated with epilepsy and severe neurodevelopmental disorders; galactose-1-phosphate uridyltransferase, associated with galactosemia; phenylalanine hydroxylase, associated with phenylketonuria (PKU); branched-chain α-ketoacid dehydrogenase, associated with maple syrup urine disease; fumarylacetoacetate hydrolase, associated with tyrosinemia type 1; methylmalonyl-CoA mutase, associated with methylmalonic acidemia; and medium-chain acetyl-CoA deficiency. ornithine transcarbamylase (OTC) associated with ornithine transcarbamylase deficiency; argininosuccinate synthase (ASS1) associated with citrullinemia; lecithin-cholesterol acyltransferase (LCAT) deficiency; methylmalonic acidemia (MMA); Niemann-Pick disease type C1; propionic acidemia (PA); low-density lipoprotein receptor (LDLR) protein associated with familial hypercholesterolemia (FH); UDP-glucuronosyltransferase associated with Crigler-Najjar disease; adenosine deaminase associated with severe combined immunodeficiency; hypoxanthine guanine phosphoribosyltransferase associated with gout and Lesch-Nyhan syndrome; biotimidase associated with biotimidase deficiency; α-galactosidase A (α-Gal) associated with Fabry disease A); ATP7B associated with Wilson disease; β-glucocerebrosidase associated with Gaucher disease types 2 and 3; peroxisomal membrane protein 70 kDa associated with Zellweger syndrome; arylsulfatase A (ARSA) associated with metachromatic leukodystrophy; and galactosidase associated with Krabbe disease. α-Glucosidase (GALC) enzyme, associated with Pompe disease; sphingomyelinase (SMPD1) gene associated with Niemann-Pick disease type A; argininosuccinate synthase associated with adult-onset type II citrullinemia (CTLN2); carbamoyl phosphate synthase 1 (CPS1) associated with urea cycle disorders; survival of motor neuron (SMN) protein associated with spinal muscular atrophy; ceramidase associated with Farber lipogranulomatosis; GM2 ganglion b-Hexosaminidase associated with eosinophilia, Tay-Sachs disease, and Sandhoff disease; aspartylglucosaminidase associated with aspartyl-glucosaminuria; a-Fucosidase associated with fucosidosis; α-Mannosidase associated with α-Mannosidosis; Porphobilinogen deaminase associated with acute intermittent porphyria (AIP); α-1 Antitrypsin for the treatment of α-1 Antitrypsin Deficiency (Emphysema); Anemia due to thalassemia or renal failure thrombomodulin and tissue factor pathway inhibitors for the treatment of blocked blood vessels, such as those found in atherosclerosis, thrombosis, or embolism; aromatic amino acid decarboxylase (AADC) and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease; beta-adrenergic receptors, antisense or mutant forms of phospholamban, (sarco)endoplasmic reticulum adenosine triphosphatase-2 (SERCA2), and cardiac adenylate cyclase for the treatment of congestive heart failure; tumor suppressor genes such as p53 for the treatment of various cancers; cytokines, such as one of the various interleukins, for the treatment of inflammatory and immune disorders and cancer; dystrophin or mini-dystrophin and utrophin or mini-utrophin for the treatment of muscular dystrophy; and insulin or GLP-1 for the treatment of diabetes.
[0090] Additional genes and diseases of interest include, for example, dystonin gene-related diseases, such as hereditary sensory and autonomic neuropathy type VI (the DST gene encodes dystonin; due to the size of the protein (approximately 7570 aa), dual AAV vectors may be required); and SCN9A-related diseases, such as erythromelalgia, where loss-of-function mutations result in the loss of pain sensation and gain-of-function mutations result in pain symptoms. Another condition is Charcot-Marie-Tooth disease types 1F and 2E, caused by mutations in the NEFL gene (neurofilament light chain), which is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical and electrophysiological manifestations.
[0091] In certain embodiments, the rAAVs described herein can be used to treat mucopolysaccharidosis (MPS) disorders. Such rAAVs can include nucleic acid sequences encoding α-L-iduronidase (IDUA) for treating MPS I (Hurler, Hurler-Scheie, and Scheie syndromes); iduronate-2-sulfatase (IDS) for treating MPS II (Hurler syndrome); sulfamidase (SGSH) for treating MPS III A, B, C, and D (Sanfilippo syndromes); and MPS The nucleic acid sequence may contain or possess a nucleic acid sequence encoding N-acetylgalactosamine-6-sulfate sulfatase (GALNS) for treating MPS IV A and B (Morquio syndrome); a nucleic acid sequence encoding arylsulfatase B (ARSB) for treating MPS VI (Maroto-Lamy syndrome); a nucleic acid sequence encoding hyaluronidase for treating MPS I IX (hyaluronidase deficiency); and a nucleic acid sequence encoding β-glucuronidase for treating MPS VII (Sly syndrome).
[0092] Immunogenic transgene In some embodiments, rAAV vectors containing nucleic acids encoding gene products associated with cancer (e.g., tumor suppressors) can be used to treat cancer by administering the rAAV vector containing the rAAV to a subject with cancer. In some embodiments, small interfering nucleic acids (e.g., nucleotides) that inhibit the expression of gene products associated with cancer (oncogenes) can be used to treat cancer. rAAV vectors containing nucleic acids encoding a gene product associated with cancer (e.g., shRNA, miRNA) can be used to treat cancer by administering the rAAV containing the rAAV vector to a subject with cancer. In some embodiments, rAAV vectors containing nucleic acids encoding a gene product associated with cancer (or functional RNA that inhibits expression of a gene associated with cancer) can be used for research purposes, e.g., to study cancer or identify therapies to treat cancer. Non-limiting examples of genes (e.g., oncogenes and tumor suppressors) known to be associated with the development of cancer are listed below: AARS, ABCB1, ABCC4, ABI2, ABL1, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7, AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP 5B, ATP5O, AXL, BARD1, BAX, BCL2, BHLHB2, BLMH, BRAF, BRCA1, BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB , CCL2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B, CDC2L5, CDK10, CDK 4, CDK5, CDK9, CDKL1, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2D, CEBPG, CENPC1, CGRRF1, CHAF1A, CIB1, CKMT1, CLK1, CLK2, CLK3, CLNS1A, CLTC, COL1A1, COL6A3, COX6C, COX7A2, CRAT, CRHR1, CSF1R, CSK, CSNK1G2, CTNNA1, CTNNB1, CT PS, CTSC, CTSD, CUL1, CYR61, DCC, DCN, DDX10, DEK, DHCR7, DHRS2, DHX8, DLG3, DVL1, DVL3, E2F1, E2F3, E2F5, EGFR, EGR1 , EIF5, EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETV3, ETV6, F2R, FASTK, FBN1, FBN2, FES, FGFR1, FGR, FKBP8, FN1, FOS,FOSL1、FOSL2、FOXG1A、FOXO1A、FRAP1、FRZB、FTL、FZD2、FZD5、FZD9、G22P1、 GAS6、GCN5L2、GDF15、GNA13、GNAS、GNB2、GNB2L1、GPR39、GRB2、GSK3A、GSPT 1、GTF2I、HDAC1、HDGF、HMMR、HPRT1、HRB、HSPA4、HSPA5、HSPA8、HSPB1、HSPH 1、HYAL1、HYOU1、ICAM1、ID1、ID2、IDUA、IER3、IFITM1、IGF1R、IGF2R、IGFBP3 、IGFBP4、IGFBP5、IL1B、ILK、ING1、IRF3、ITGA3、ITGA6、ITGB4、JAK1、JARID1A、JUN、JUNB、JUND、K-ALPHA-1、KIT、KITLG、KLK10、KPNA2、KRAS2、KRT18、K RT2A、KRT9、LAMB1、LAMP2、LCK、LCN2、LEP、LITAF、LRPAP1、LTF、LYN、LZTR1、 MADH1、MAP2K2、MAP3K8、MAPK12、MAPK13、MAPKAPK3、MAPRE1、MARS、MAS1、MCC 、MCM2、MCM4、MDM2、MDM4、MET、MGST1、MICB、MLLT3、MME、MMP1、MMP14、MMP17 、MMP2、MNDA、MSH2、MSH6、MT3、MYB、MYBL1、MYBL2、MYC、MYCL1、MYCN、MYD88、 MYL9、MYLK、NEO1、NF1、NF2、NFKB1、NFKB2、NFSF7、NID、NINE、NMBR、NME1、NM E2、NME3、NOTCH1、NOTCH2、NOTCH4、NPM1、NQO1、NR1D1、NR2F1、NR2F6、NRAS、N RG1、NSEP1、OSM、PA2G4、PABPC1、PCNA、PCTK1、PCTK2、PCTK3、PDGFA、PDGFB、 PDGFRA、PDPK1、PEA15、PFDN4、PFDN5、PGAM1、PHB、PIK3CA、PIK3CB、PIK3CG、 PIM1、PKM2、PKMYT1、PLK2、PPARD、PPARG、PPIH、PPP1CA、PPP2R5A、PRDX2、PR DX4、PRKAR1A、PRKCBP1、PRNP、PRSS15、PSMA1、PTCH、PTEN、PTGS1、PTMA、PTN、PTPRN、R、 AB5A, RAC1, RAD50, RAF1, RALBP1, RAP1A, RARA, RARB, RASGRF1, RB1, RBBP4, RBL2 REA, REL, RELA, RELB, RET, RFC2, RGS19, RHOA, RHOB, RHOC, RHOD, RIPK1, RPN2, RPS6 KB1, RRM1, SARS, SELENBP1, SEMA3C, SEMA4D, SEPP1, SERPINH1, SFN, SFPQ, SFRS7, SHB, SHH, SIAH2, SIVA, SIVA TP53, SKI, SKIL, SLC16A1, SLC1A4, SLC20A1, SMO 1) SNAI2, SND1, SNRPB2, SOCS1, SOCS3, SOD1, SORT1, SPINT2, SPRY2, SRC, SRPX, S TAT1, STAT2, STAT3, STAT5B, STC1, TAF1, TBL3, TBRG4, TCF1, TCF7L2, TFAP2C, TFD P1, TFDP2, TGFA, TGFB1, TGFBI, TGFBR2, TGFBR3, THBS1, TIE, TIMP1, TIMP3, TJP1 TK1, TLE1, TNF, TNFRSF10A, TNFRSF10B, TNFRSF1A, TNFRSF1B, TNFRSF6, TNFSF7 TNK1, TOB1, TP53, TP53BP2, TP5313, TP73, TPBG, TPT1, TRADD, TRAM1, TRRAP, TSG1 01 TUFM TXNRD1 TYRO3 UBC UBE2L6 UCHL1 USP7 VDAC1 VEGF VHL VIL2 WEE1 WNT1, WNT2, WNT2B, WNT3, WNT5A, WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70, and ZNF9.
[0093] The rAAV vector may contain, as a transgene, a nucleic acid encoding a protein or functional RNA that regulates apoptosis. Genes related to apoptosis are listed below, but are not limited thereto. Nucleic acids encoding the products of these genes and their homologs, as well as small interfering nucleic acids (e.g., shRNA, miRNA) that inhibit the expression of these genes and their homologs, are useful as transgenes in certain embodiments of the present invention: RPS27A, ABL1, AKT1, APAF1, BAD, BAG1, BAG3, BAG4, BAK1, BAX, BCL10, BCL2, BCL2A1, BCL2A2, BCL2B1, BCL2C1, BCL2D1, BCL2E1, BCL2F1, BCL2F2, BCL2F3, BCL2F4, BCL2F5, BCL2F6, BCL2F7, BCL2F8, BCL2F9, BCL2F9, BCL2F10, BCL2F11, BCL2F12, BCL2F13, BCL2F14, BCL2F15, BCL2F16, BCL2F17, BCL2F18, BCL2F19, BCL2F20, BCL2F21, BCL2F22, BCL2F23, BCL2F24, BCL2F35, BCL2F36, BCL2F47, BCL2F58, BCL2F59, BCL2F60, BCL2F61, BCL2F72, BCL2F83, BCL2F94, BCL2F19 ... CL2L1, BCL2L10, BCL2L11, BCL2L12, BCL2L13, BCL2L2, BCLAF1, BFAR, BID, BIK, NAIP, BIRC2, BIRC3, XIAP, BIRC5, BIRC6, BIRC7, BI RC8, BNIP1, BNIP2, BNIP3, BNIP3L, BOK, BRAF, CARD10, CARD11, NLRC4, CARD14, NOD2, NOD1, CARD6, CARDS, CARDS, CASP1, CASP10, CA SP14, CASP2, CASP3, CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CFLAR, CIDEA, CIDEB, CRADD, DAPK1, DAPK2, DFFA, DFFB, FADD, GAD D45A, GDNF, HRK, IGF1R, LTA, LTBR, MCL1, NOL3, PYCARD, RIPK1, RIPK2, TNF, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, TNFRSF 11B, TNFRSF12A, TNFRSF14, TNFRSF19, TNFRSF1A, TNFRSF1B, TNFRSF21, TNFRSF25, CD40, FAS, TNFRSF6B, CD27, TNFRSF9, TNFSF10, TNFSF14, TNFSF18, CD40LG, FASLG, CD70, TNFSF8, TNFSF9, TP53, TP53BP2, TP73, TP63, TRADD, TRAF1, TRAF2, TRAF3, TRAF4 and TRAF5.
[0094] Useful gene products also include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression by target RNA transcript cleavage / degradation or translational repression of target messenger RNAs (mRNAs). miRNAs are typically naturally expressed as ultimate untranslated RNA products. miRNAs exert their activity through sequence-specific interactions with the 3' untranslated region (UTR) of target mRNAs. These endogenously expressed miRNAs The miRNA forms a hairpin precursor that is subsequently processed into a miRNA duplex and then into a "mature" single-stranded miRNA molecule. This mature miRNA guides the multiprotein complex miRISC, which recognizes target sites in target mRNAs, e.g., in the 3'UTR region, based on complementarity with the mature miRNA.
[0095] The following non-limiting list of miRNA genes and their homologs are useful as genes or as targets for small interfering nucleic acids (e.g., miRNAs, sponges, antisense oligonucleotides, TuD RNAs) encoded by the genes in certain embodiments of the method: hsa-let-7a, hsa-let-7a * , hsa-let-7b, hsa-let-7b * , hsa-let-7c, hsa-let-7c * , hsa-let-7d, hsa-let-7d * , hsa-let-7e, hsa-let-7e * , hsa-let-7f, hsa-let-7f-1 * , hsa-let-7f-2 * , hsa-let-7g, hsa-let-7g * , hsa-let-71, hsa-let-71 * , hsa-miR-1, hsa-miR-100, hsa-miR-100 * , hsa-miR-101, hsa-miR-101 * , hsa-miR-103, hsa-miR-105, hsa-miR-105 * , hsa-miR-106a, hsa-miR-106a *hsa-miR-106b hsa-miR-106b * hsa-miR-107, hsa-miR-10a, hsa-miR-10a * hsa-miR-10b hsa-miR-10b * hsa-miR-1178, hsa-miR-1179, hsa-miR-1180, hsa-miR-1181, hsa-miR-1182, hsa-miR-1183, hsa-miR-1184, hsa-miR-1185, hsa-miR-1197, hsa-miR-1200, hsa-miR -1201、hsa-miR-1202、hsa-miR-1203、hsa-miR-1204、hsa-miR-1205、hsa-miR-1206、hsa-miR-1207-3p、hsa-miR-1207-5p、hsa-miR-1208、hsa-miR-122、hsa-miR-122 * hsa-miR-1224-3p, hsa-miR-1224-5p, hsa-miR-1225-3p, hsa-miR-1225-5p, hsa-miR-1226, hsa-miR-1226 * hsa-miR-1227, hsa-miR-1228, hsa-miR-1228 * hsa-miR-1229, hsa-miR-1231, hsa-miR-1233, hsa-miR-1234, hsa-miR-1236, hsa-miR-1237, hsa-miR-1238, hsa-miR-124, hsa-miR-124 * hsa-miR-1243, hsa-miR-1244, hsa-miR-1245, hsa-miR-1246, hsa-miR-1247, hsa-miR-1248, hsa-miR-1249, hsa-miR-1250, hsa-miR-1251, hsa-miR-1252, hsa-miR-1253, hsa- miR-1254、hsa-miR-1255a、hsa-miR-1255b、hsa-miR-1256、hsa-miR-1257、hsa-miR-125 8、hsa-miR-1259、hsa-miR-125a-3p、hsa-miR-125a-5p、hsa-miR-125b、hsa-miR-125b-1* hsa-miR-125b-2 * hsa-miR-126 hsa-miR-126 * hsa-miR-1260, hsa-miR-1261, hsa-miR-1262, hsa-miR-1263, hsa-miR-1264, hsa-miR-1265, hsa-miR-1266, hsa-miR-1267, hsa-miR-1268, hsa-miR-1269, hsa-miR-1270, hsa-miR-1271, hsa-miR-1272, hsa-miR-1273, hsa-miR-127-3p hsa-miR-1274a, hsa-miR-1274b, hsa-miR-1275, hsa-miR-127-5p, hsa-miR-1276, hsa-miR-1277, hsa-miR-1278, hsa-miR-1279, hsa-miR-128, hsa-miR-1280, hsa-miR-1281, hsa-miR-1282, hsa-miR-1283, hsa-miR-1284, hsa-miR-1285 hsa-miR-1286, hsa-miR-1287, hsa-miR-1288, hsa-miR-1289, hsa-miR-129 * hsa-miR-1290, hsa-miR-1291, hsa-miR-1292, hsa-miR-1293, hsa-miR-129-3p, hsa-miR-1294, hsa-miR-1295, hsa-miR-129-5p, hsa-miR-1296, hsa-miR-1297, hsa-miR-1298, hsa -miR-1299, hsa-miR-1300, hsa-miR-1301, hsa-miR-1302, hsa-miR-1303, hsa-miR-1304, hsa-miR-1305, hsa-miR-1306, hsa-miR-1307, hsa-miR-1308, hsa-miR-130a, hsa-miR-130a * 、hsa-miR-130b、hsa-miR-130b * hsa-miR-132 hsa-miR-132 *hsa-miR-1321, hsa-miR-1322, hsa-miR-1323, hsa-miR-1324, hsa-miR-133a, hsa-miR-133b, hsa-miR-134, hsa-miR-135a, hsa-miR-135a * hsa-miR-135b hsa-miR-135b * hsa-miR-136 hsa-miR-136 * hsa-miR-137, hsa-miR-138, hsa-miR-138-1 * hsa-miR-138-2 * hsa-miR-139-3p, hsa-miR-139-5p, hsa-miR-140-3p, hsa-miR-140-5p, hsa-miR-141, hsa-miR-141 * hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143, hsa-miR-143 * hsa-miR-144 hsa-miR-144 * hsa-miR-145 hsa-miR-145 * hsa-miR-146a hsa-miR-146a * hsa-miR-146b-3p, hsa-miR-146b-5p, hsa-miR-147, hsa-miR-147b, hsa-miR-148a, hsa-miR-148a * hsa-miR-148b hsa-miR-148b * hsa-miR-149 hsa-miR-149 * hsa-miR-150 hsa-miR-150 * hsa-miR-151-3p, hsa-miR-151-5p, hsa-miR-152, hsa-miR-153, hsa-miR-154, hsa-miR-154 * hsa-miR-155 hsa-miR-155 * hsa-miR-15a hsa-miR-15a * hsa-miR-15b hsa-miR-15b * hsa-miR-16, hsa-miR-16-1* hsa-miR-16-2 * hsa-miR-17 hsa-miR-17 * 、hsa-miR-181a、hsa-miR-181a * hsa-miR-181a-2 * hsa-miR-181b, hsa-miR-181c, hsa-miR-181c * hsa-miR-181d, hsa-miR-182, hsa-miR-182 * hsa-miR-1825, hsa-miR-1826, hsa-miR-1827, hsa-miR-183, hsa-miR-183 * hsa-miR-184, hsa-miR-185, hsa-miR-185 * hsa-miR-186 hsa-miR-186 * hsa-miR-187 hsa-miR-187 * hsa-miR-188-3p, hsa-miR-188-5p, hsa-miR-18a, hsa-miR-18a * hsa-miR-18b hsa-miR-18b * hsa-miR-190, hsa-miR-190b, hsa-miR-191, hsa-miR-191 * hsa-miR-192 hsa-miR-192 * 、hsa-miR-193a-3p、hsa-miR-193a-5p、hsa-miR-193b、hsa-miR-193b * hsa-miR-194 hsa-miR-194 * hsa-miR-195 hsa-miR-195 * 、hsa-miR-196a、hsa-miR-196a * hsa-miR-196b, hsa-miR-197, hsa-miR-198, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a, hsa-miR-19a * hsa-miR-19b hsa-miR-19b-1 *hsa-miR-19b-2 * hsa-miR-200a hsa-miR-200a * hsa-miR-200b hsa-miR -200b * 、hsa-miR-200c、hsa-miR-200c * hsa-miR-202 hsa-miR-202 * hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-206, hsa-miR-208a, hsa-miR-208b, hsa-miR-20a, hsa-miR-20a * hsa-miR-20b hsa-miR-20b * hsa-miR-21 hsa-miR-21 * hsa-miR-210, hsa-miR-211, hsa-miR-212, hsa-miR-214, hsa-miR-214 * hsa-miR-215, hsa-miR-216a, hsa-miR-216b, hsa-miR-217, hsa-miR-218, hsa-miR-218-1 * hsa-miR-218-2 * 、hsa-miR-219-l-3p、hsa-miR-219-2-3p、hsa-miR-219-5p、hsa-miR-22、hsa-miR-22 * hsa-miR-220a, hsa-miR-220b, hsa-miR-220c, hsa-miR-221, hsa-miR-221 * hsa-miR-222 hsa-miR-222 * hsa-miR-223 hsa-miR-223 * 、hsa-miR-224、hsa-miR-23a、hsa-miR-23a * hsa-miR-23b hsa-miR-23b * hsa-miR-24, hsa-miR-24-1 * hsa-miR-24-2 * hsa-miR-25 hsa-miR-25 *、hsa-miR-26a、hsa-miR-26a-l * hsa-miR-26a-2 * hsa-miR-26b hsa-miR-26b * hsa-miR-27a hsa-miR-27a * hsa-miR-27b hsa-miR-27b * hsa-miR-28-3p, hsa-miR-28-5p, hsa-miR-296-3p, hsa-miR-296-5p, hsa-miR-297, hsa-miR-298, hsa-miR-299-3p, hsa-miR-299-5p, hsa-miR-29a, hsa-miR-29a * hsa-miR-29b, hsa-miR-296-1 * hsa-miR-296-2 * hsa-miR-29c hsa-miR-29c * hsa-miR-300, hsa-nuR-301a, hsa-miR-301b, hsa-miR-302a, hsa-miR-302a * 、hsa-miR-302b、hsa-miR-302b * 、hsa-miR-302c、hsa-miR-302c * hsa-miR-302d hsa-miR-302d * 、hsa-miR-302e、hsa-miR-302f、hsa-miR-30a、hsa-miR-30a * hsa-miR-30b hsa-miR-30b * hsa-miR-30c, hsa-miR-30c-l * hsa-miR-30c-2 * hsa-miR-30d hsa-miR-30d * hsa-miR-30e hsa-miR-30e * hsa-miR-31 hsa-miR-31 * hsa-miR-32 hsa-miR-32 *hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-323-3p, hsa-miR-323-5p, hsa-miR-324-3p, hsa-miR-324-5p, hsa-miR-325, hsa-miR-326, hsa-miR-328, hsa-miR-329, hsa-miR-330-3p, hsa-miR-330-5p, hsa-miR-331-3p, hsa-miR-331-5p, hsa-miR-335, hsa-miR-335 * hsa-miR-337-3p, hsa-miR-337-5p, hsa-miR-338-3p, hsa-miR-338-5p, hsa-miR-339-3p, hsa-miR-339-5p, hsa-miR-33a, hsa-nuR-33a * hsa-miR-33b hsa-miR-33b * hsa-miR-340 hsa-miR-340 * hsa-miR-342-3p, hsa-miR-342-5p, hsa-miR-345, hsa-miR-346, hsa-miR-34a, hsa-miR-34a * hsa-miR-34b hsa-miR-34b * hsa-miR-34c-3p, hsa-miR-34c-5p, hsa-miR-361-3p, hsa-miR-361-5p, hsa-miR-362-3p, hsa-miR-362-5p, hsa-miR-363, hsa-miR-363 * hsa-miR-365, hsa-miR-3 67、hsa-miR-367 * hsa-miR-369-3p, hsa-miR-369-5p, hsa-miR-370, hsa-miR-371-3p, hsa-miR-371-5p, hsa-miR-372, hsa-miR-373, hsa-miR-373 * 、hsa-miR-374a、hsa-miR-374a * 、hsa-miR-374b、hsa-miR-374b *hsa-miR-375, hsa-miR-376a, hsa-miR-376a * hsa-miR-376b, hsa-miR-376c, hsa-miR-377, hsa-miR-377 * hsa-miR-378 hsa-miR-378 * hsa-miR-379 hsa-miR-379 * hsa-miR-380 hsa-miR-380 * hsa-miR-381, hsa-miR-382, hsa-miR-383, hsa-miR-384, hsa-miR-409-3p, hsa-miR-409-5p, hsa-miR-410, hsa-miR-411, hsa-miR-411 * hsa-miR-412, hsa-miR-421, hsa-miR-422a, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424, hsa-miR-424 * hsa-miR-425 hsa-miR-425 * hsa-miR-429, hsa-miR-431, hsa-miR-431 * hsa-miR-432 hsa-miR-432 * hsa-miR-433, hsa-miR-448, hsa-miR-449a, hsa-miR-449b, hsa-miR-450a, hsa-miR-450b-3p, hsa-miR-450b-5p, hsa-miR-451, hsa-miR-452, hsa-miR-452 * hsa-miR-453, hsa-miR-454, hsa-miR-454 * hsa-miR-455-3p, hsa-miR-455-5p, hsa-miR-483-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-486-3p, hsa-miR-486-5p, hsa-miR-487a, hsa-miR-487b, hsa-miR-488, hsa-miR-488 *hsa-miR-489, hsa-miR-490-3p, hsa-miR-490-5p, hsa-miR-491-3p, hsa-miR-491-5p, hsa-miR-492, hsa-miR-493, hsa-miR-493 * hsa-miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-497, hsa-miR-497 * hsa-miR-498, hsa-miR-499-3p, hsa-miR-499-5p, hsa-miR-500, hsa-miR-500 * hsa-miR-501-3p, hsa-miR-501-5p, hsa-miR-502-3p, hsa-miR-502-5p, hsa-miR-503, hsa-miR-504, hsa-miR-505, hsa-miR-505 * hsa-miR-506, hsa-miR-507, hsa-miR-508-3p, hsa-miR-508-5p, hsa-miR-509-3-5p, hsa-miR-509-3p, hsa-miR-509-5p, hsa-miR-510, hsa-miR-511, hsa-miR-512-3p, hsa-miR-512-5p hsa-miR-513a-3p, hsa-miR-513a-5p, hsa-miR-513b, hsa-miR-513c, hsa-miR-514, hsa-miR-515-3p, hsa-miR-515-5p, hsa-miR-516a-3p, hsa-miR-516a-5p, hsa-miR-516b, hsa-miR-517 * 、hsa-miR-517a、hsa-miR-517b、hsa-miR-517c、hsa-miR-518a-3p、hsa-miR-518a-5p、hsa-miR-518b、hsa-miR-518c、hsa-miR-518c * 、hsa-miR-518d-3p、hsa-miR-518d-5p、hsa-miR-518e、hsa-miR-518e * 、hsa-miR-518f、hsa-miR-518f *hsa-miR-519a, hsa-miR-519b-3p, hsa-miR-519c-3p, hsa-miR-519d, hsa-miR-519e, hsa-miR-519e * 、hsa-miR-520a-3p、hsa-miR-520a-5p、hsa-miR-520b、hsa-miR-520c-3p、hsa-miR- 520d-3p, hsa-miR-520d-5p, hsa-miR-520e, hsa-miR-520f, hsa-miR-520g, hsa-miR-520h, hsa-miR-521, hsa-miR-522, hsa-miR-523, hsa-miR-524-3p, hsa-miR-524-5p, hsa-miR-525-3p, hsa-miR-525-5p, hsa-miR-526b, hsa-miR-526b * hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-539, hsa-miR-541, hsa-miR-541 * hsa-miR-542-3p, hsa-miR-542-5p, hsa-miR-543, hsa-miR-544, hsa-miR-545, hsa-miR-545 * .hsa-miR-548a-3p、hsa-miR-548a-5p、hsa-miR-548b-3p、hsa-miR-5486-5p、hsa-miR-548c-3p 、hsa-miR-548c-5p、hsa-miR-548d-3p、hsa-miR-548d-5p、hsa-miR-548e、hsa-miR-548f、hsa-m iR-548g, hsa-miR-548h, hsa-miR-548i, hsa-miR-548j, hsa-miR-548k, hsa-miR-5481, hsa-miR-548m, hsa-miR-548n, hsa-miR-548o, hsa-miR-548p, hsa-miR-549, hsa-miR-550, hsa-miR-550 * 、hsa-miR-55la、hsa-miR-551b、hsa-miR-551b *.hsa-miR-552、hsa-miR-553、hsa-miR-554、hsa-miR-555、hsa-miR-556-3p、hsa-miR-556-5p、hsa-miR-557、hsa-miR-558、hsa-miR-559、hsa-miR-561、hs a-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa-miR-573 hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-575, hsa-miR-576-3p, hsa-miR-576-5p, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, hsa-miR- 581, hsa-miR-582-3p, hsa-miR-582-5p, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-586, hsa-miR-587, hsa-miR-588, hsa-miR-589, hsa-miR-589 * hsa-miR-590-3p, hsa-miR-590-5p, hsa-miR-591, hsa-miR-592, hsa-miR-593, hsa-miR-593 * hsa-miR-595, hsa-miR-596, hsa-miR-597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hs a-miR-607, hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR-612, hsa-miR-613, hsa-miR-614, hsa-miR-615-3p, hsa-miR-615-5p, hsa-miR-616, hsa-miR-616 *hsa-miR-617, hsa-miR-618, hsa-miR-619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624, hsa-miR-624 * hsa-miR-625 hsa-miR-625 * hsa-miR-626, hsa-miR-627, hsa-miR-628-3p, hsa-miR-628-5p, hsa-miR-629, hsa-miR-629 * hsa-miR-630, hsa-miR-631, hsa-miR-632, hsa-miR-633, hsa-miR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639, hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR-645 5, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hsa-miR-652, hsa-miR-653, hsa-miR-654-3p, hsa-miR-654-5p, hsa-miR- 655, hsa-miR-656, hsa-miR-657, hsa-miR-658, hsa-miR-659, hsa-miR-660, hsa-miR-661, hsa-miR-662, hsa-miR-663, hsa-miR-663b, hsa-miR-664, hsa-miR-664 * hsa-miR-665, hsa-miR-668, hsa-miR-671-3p, hsa-miR-671-5p, hsa-miR-675, hsa-miR-7, hsa-miR-708, hsa-miR-708 * hsa-miR-7-1 * hsa-miR-7-2 * hsa-miR-720, hsa-miR-744, hsa-miR-744 *, hsa-miR-758, hsa-miR-760, hsa-miR-765, hsa-miR-766, hsa-miR-767-3p, hsa-miR-767-5p, hsa-miR-768-3p, hsa-miR-768-5p, hsa-miR-769-3p, hsa-miR-769-5p, hsa-miR-770-5p, hsa-miR-802, hsa-miR-873, hsa-miR-874, hsa-miR-875-3p, hsa-miR-875-5p, hsa-miR-876-3p, hsa-miR-876-5p, hsa-miR-877, hsa-miR-877 * , hsa-miR-885-3p, hsa-miR-885-5p, hsa-miR-886-3p, hsa-miR-886-5p, hsa-miR-887, hsa-miR-888, hsa-miR-888 * , hsa-miR-889, hsa-miR-890, hsa-miR-891a, hsa-miR-891b, hsa-miR-892a, hsa-miR-892b, hsa-miR-9, hsa-miR-9 * , hsa-miR-920, hsa-miR-921, hsa-miR-922, hsa-miR-923, hsa-miR-924, hsa-miR-92a, hsa-miR-92a-1 * , hsa-miR-92a-2 * , hsa-miR-92b, hsa-miR-92b * , hsa-miR-93, hsa-miR-93 * , hsa-miR-933, hsa-miR-934, hsa-miR-935, hsa-miR-936, hsa-miR-937, hsa-miR-938, hsa-miR-939, hsa-miR-940, hsa-miR-941, hsa-miR-942, hsa-miR-943, hsa-miR-944, hsa-miR-95, hsa-miR-96, hsa-miR-96 * , hsa-miR-98, hsa-miR-99a, hsa-miR-99a * , hsa-miR-99b, and hsa-miR-99b *For example, miRNAs targeting chromosome 8 open reading frame 72 (C9orf72), which expresses superoxide dismutase (SOD1), associated with amyotrophic lateral sclerosis (ALS), may be of interest.
[0096] miRNAs inhibit the function of their target mRNAs, thereby inhibiting the expression of the polypeptides encoded by the mRNAs. Therefore, blocking the activity of miRNAs (partially or completely) (silencing the miRNA) can effectively induce or restore the expression of the inhibited polypeptides (derepressing the polypeptides). In one embodiment, derepression of the polypeptides encoded by the mRNA targets of miRNAs is achieved by inhibiting miRNA activity in cells by any one of a variety of methods. For example, blocking the activity of miRNAs can be achieved by hybridizing with a small interfering nucleic acid (e.g., an antisense oligonucleotide, miRNA sponge, TuD RNA) that is complementary or substantially complementary to the miRNA, thereby blocking the interaction of the miRNA with its target mRNA. As used herein, a small interfering nucleic acid that is substantially complementary to a miRNA refers to one that can hybridize with the miRNA and block the activity of the miRNA. In some embodiments, the short interfering nucleic acid substantially complementary to the miRNA is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3 A small interfering nucleic acid is complementary to a miRNA at all but 4, 15, 16, 17, or 18 bases. An "miRNA inhibitor" is a drug that blocks the function, expression, and / or processing of a miRNA. For example, these molecules include, but are not limited to, microRNA-specific antisense molecules, microRNA sponges, tough decoy RNAs (TuD RNAs), and microRNA oligonucleotides (short double-stranded hairpin oligonucleotides) that inhibit the interaction of miRNA with the Drosha complex.
[0097] Still other useful genes may include those encoding immunoglobulins that confer passive immunity to pathogens. An "immunoglobulin molecule" is a protein that contains the immunologically active portions of a covalently linked immunoglobulin heavy chain and an immunoglobulin light chain and specifically binds to an antigen. Immunoglobulin molecules may be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass. The terms "antibody" and "immunoglobulin" may be used interchangeably herein.
[0098] An "immunoglobulin heavy chain" is a polypeptide that contains at least a portion of an antigen-binding domain of an immunoglobulin and at least a portion of a variable region of an immunoglobulin heavy chain or at least a portion of a constant region of an immunoglobulin heavy chain. Thus, an immunoglobulin-derived heavy chain has significant regions of amino acid sequence homology with members of the immunoglobulin gene superfamily. For example, the heavy chain in a Fab fragment is an immunoglobulin-derived heavy chain.
[0099] An "immunoglobulin light chain" is a polypeptide that contains at least a portion of the antigen-binding domain of an immunoglobulin and at least a portion of the variable region or at least a portion of the constant region of an immunoglobulin light chain. Thus, immunoglobulin-derived light chains have significant regions of amino acid homology with members of the immunoglobulin gene superfamily.
[0100] "Immunoadhesins" are chimeric antibody-like molecules that combine functional domains of a binding protein, most often a receptor, ligand or cell adhesion molecule, with immunoglobulin constant domains, most often including the hinge and Fc regions.
[0101] The "antigen-binding fragment" (Fab) fragment is the region of an antibody that binds to an antigen. It consists of one constant domain and one variable domain of each of the heavy and light chains.
[0102] Anti-pathogen constructs are selected based on the causative agent (pathogen) of the disease against which protection is sought. These pathogens may be of viral, bacterial or fungal origin and may be used to prevent infection in humans against human disease or in non-human mammals or other animals to prevent veterinary disease.
[0103] The rAAV may contain genes encoding antibodies, specifically neutralizing antibodies against viral pathogens. Such anti-viral antibodies may include anti-influenza antibodies directed against one or more of influenza A, influenza B, and influenza C. Type A viruses are the most virulent human pathogens. Influenza A serotypes associated with pandemics include H1N1, which caused the 1918 Spanish flu and the 2009 swine flu; H2N2, which caused the 1957 Asian flu; H3N2, which caused the 1968 Hong Kong flu; H5N1, which caused the 2004 avian flu; H7N7; H1N2; H9N2; H7N2; H7N3; and H10N7. Other target pathogenic viruses include arenaviruses (including Junin, Machupo, and Lassa), filoviruses (including Marburg and Ebola), hantaviruses, picornaviridae (including rhinoviruses and echoviruses), coronaviruses, paramyxoviruses, morbilliviruses, respiratory syncytial viruses, togaviruses, coxsackieviruses, These include JC virus, parvovirus B19, parainfluenza, adenovirus, reovirus, and poxviruses (variola major (smallpox)) and vaccinia (cowpox), as well as varicella-zoster (pseudorabies). Viral hemorrhagic fevers are caused by members of the Arenaviridae family (which is also associated with lymphocytic choriomeningitis (LCM)), filoviruses (Ebola virus), and hantaviruses (Puremala). Members of the picornavirus family (subfamily of Rhinoviruses) are associated with the common cold in humans. The Coronaviridae family includes many non-human viruses, such as infectious bronchitis virus (poultry), transmissible porcine gastroenteritis virus (pigs), porcine hemocoagulant encephalomyelitis virus (pigs), feline infectious peritonitis virus (cats), feline enteric coronavirus (cats), and canine coronavirus (dogs). Human respiratory coronaviruses are presumably associated with the common cold, hepatitis A, B, or C, and sudden acute respiratory syndrome (SARS). The Paramyxoviridae family includes parainfluenza virus type 1, parainfluenza virus type 3, bovine parainfluenza virus type 3, rubulavirus (mumps virus), parainfluenza virus type 2, parainfluenza virus type 4, Newcastle disease virus (chicken), rinderpest, morbillivirus (including measles and canine distemper), and pneumovirus (including respiratory syncytial virus (RSV)). The Parvoviridae family includes feline parvovirus (feline enteritis), feline panleukopenia virus, canine parvovirus, and porcine parvovirus. The Adenoviridae family includes viruses that cause respiratory diseases (EX, AD7, ARD, OB). Thus, in certain embodiments, the rAAV vectors described herein can be engineered to express anti-Ebola antibodies, e.g., 2G4, 4G7, 13C6, anti-influenza antibodies, e.g., FI6, CF8033, and anti-RSV antibodies, e.g., palivizumab, motavizumab.
[0104] Neutralizing antibody constructs against bacterial pathogens may also be selected for use in the present invention. In one embodiment, the neutralizing antibody construct is directed against the bacteria itself. In another embodiment, the neutralizing antibody construct is directed against a toxin produced by the bacteria. Examples of airborne bacterial pathogens include, for example, Neisseria meningitidis (meningitis), Klebsiella pneumonia (pneumonia), Pseudomonas aeruginosa (pneumonia), Pseudomonas pseudomallei (pneumonia), Pseudomonas mallei (pneumonia), Acinetobacter (pneumonia), Moraxella catarrhalis, Moraxella lacunata, Alkaligenes, Cardiobacterium, Haemophilus influenzae (cold), Haemophilus parainfluenzae, Bordetella pertussis (whooping cough), Francisella tularensis (pneumonia / fever), Legionella pneumonia (Legionnaires' disease), Chlamydia psittaci (pneumonia), Chlamydia pneumoniae (pneumonia), Mycobacterium tuberculosis (tuberculosis (TB)), Mycobacterium kansasii (TB), Mycobacterium avium (pneumonia), Nocardia asteroides (pneumonia), Bacillus anthracis (anthrax), Staphylococcus aureus (pneumonia), Streptococcus pyogenes (scarlet fever), Streptococcus pneumoniae (pneumonia), Corynebacteria diphtheria (diphtheria), and Mycoplasma pneumoniae (pneumonia).
[0105] rAAVs can contain genes encoding antibodies, specifically neutralizing antibodies against bacterial pathogens, such as the toxin produced by Bacillius anthracis, the causative agent of anthrax. Neutralizing antibodies against protective agent (PA), one of three peptides that form the toxoid, have been taught. The other two polypeptides constitute lethal factor (LF) and edema factor (EF). Anti-PA neutralizing antibodies can be used for passive immunization against anthrax. It has been taught that these antibodies are effective in neutralizing anthrax toxins. See, e.g., U.S. Patent No. 7,442,373; R. Sawada-Hirai et al., J Immune Based Ther Vaccines. 2004;2:5 (online May 12, 2004). Still other anti-anthrax toxin neutralizing antibodies have been taught and / or could be generated. Similarly, neutralizing antibodies against other bacteria and / or bacterial toxins could be used to generate the AAV-delivered anti-pathogen constructs described herein.
[0106] Antibodies against infectious diseases can be caused by parasites or fungi, such as Aspergillus species, Absidia corymbifera, Rhixpus stolonifer, Mucor plumbeaus, Cryptococcus neoformans, Histoplasma capsulatum, Blastomyces dermatitidis, Coccidioides immitis, Penicillium species, Micropolyspora faeni, Thermoactinomyces vulgaris, Alternaria alternate, Cladosporium species, Helminthosporium, and Stachybotrys species.
[0107] rAAV may contain genes encoding antibodies, particularly neutralizing antibodies, against pathogenic factors of diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), GBA-Parkinson's disease, rheumatoid arthritis (RA), irritable bowel syndrome (IBS), chronic obstructive pulmonary disease (COPD), cancer, tumors, systemic sclerosis, asthma, and other diseases. Such antibodies include, but are not limited to, alpha-synuclein, anti-vascular endothelial growth factor (VEGF) (anti-VEGF), anti-VEGFA, anti-PD-1, anti-PDL1, anti-CTLA-4, anti-TNFα, anti-IL-17, anti-IL-23, anti-IL-21, anti-IL-6, anti-IL-6 receptor, anti-IL-5, anti-IL-7, anti-factor XII, anti-IL-2, anti-HIV, anti-IgE, anti-tumor necrosis factor receptor-1 (TNFR1), anti-notch2 / 3, anti-notch1, anti-OX40, anti-erb-b2 receptor tyrosine kinase 3 (ErbB3), anti-ErbB2, and anti-beta cell maturation antibodies. The antibody may be an antigen, anti-B lymphocyte stimulating factor, anti-CD20, anti-HER2, anti-granulocyte-macrophage colony-stimulating factor, anti-oncostatin M (OSM), anti-lymphocyte activation gene 3 (LAG3) protein, anti-CCL20, anti-serum amyloid P component (SAP), anti-prolyl hydroxylase inhibitor, anti-CD38, anti-glycoprotein IIb / IIIa, anti-CD52, anti-CD30, anti-IL-1β, anti-epidermal growth factor receptor, anti-CD25, anti-RANK ligand, anti-complement system protein C5, anti-CD11a, anti-CD3 receptor, anti-alpha-4 (α4) integrin, anti-RSV F protein, and anti-integrin α4β7. Still other pathogens and diseases will be apparent to those skilled in the art. Other suitable antibodies can include those useful for treating Alzheimer's disease, such as, among others, anti-beta amyloid (e.g., crenezumab, solanezumab, aducanumab), anti-beta amyloid fibrils, anti-beta amyloid plaques, anti-tau, bapineuzumab, etc. Other suitable antibodies for treating various indications include, for example, those described in PCT / US2016 / 058968, filed October 27, 2016, published as WO2017 / 075119A1.
[0108] II. rAAV Vector Production For use in producing AAV viral vectors (e.g., recombinant (r)AAV), the expression cassette can be carried on any suitable vector, e.g., a plasmid, that is delivered to a packaging host cell. Plasmids useful in the present invention can be engineered to be suitable for in vitro replication and packaging in prokaryotic, insect, or mammalian cells, among others. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one of skill in the art.
[0109] Methods for generating and isolating AAV suitable for use as a vector are known in the art. See, e.g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99:119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med. 10:717-733, and the references cited below in their entirety, each of which is incorporated herein by reference in its entirety. In order to package a gene into virions, the ITRs are the only AAV components required in cis in the same construct as the nucleic acid molecule containing the expression cassette(s). The cap and rep genes can be supplied in trans.
[0110] In one embodiment, the expression cassettes described herein are engineered to become genetic elements (e.g., shuttle plasmids) that transfer the immunoglobulin construct sequences they carry into packaging host cells for viral vector production. In one embodiment, selected genetic elements can be delivered to AAV packaging cells by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Stable AAV packaging cells can also be generated. Alternatively, expression cassettes can be used to generate viral vectors other than AAV or to produce mixtures of antibodies in vitro. Methods used to generate such constructs are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
[0111] The term "AAV intermediate" or "AAV vector intermediate" refers to an assembled rAAV capsid that lacks the desired genomic sequence to be packaged therein. These may also be referred to as "empty" capsids. Such capsids may not contain detectable genomic sequences of an expression cassette or may contain only partially packaged genomic sequences that are insufficient to achieve expression of a gene product. These empty capsids are non-functional for transferring a gene of interest into a host cell.
[0112] The recombinant adeno-associated viruses (AAVs) described herein can be produced using known techniques. See, for example, WO 2003 / 042397, WO 2005 / 033321, WO 2006 / 110689, and US 7,588,772 B2. Such methods include culturing host cells containing a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; an expression cassette consisting of at least the AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to enable packaging of the expression cassette into the AAV capsid protein. Methods for generating capsids, coding sequences therefor, and methods for producing rAAV viral vectors have been taught. See, for example, Gao, et al., Proc. Natl. Acad. Sci. USA 100(10), 6081-6086 (2003) and US 2013 / 0045186 A1.
[0113] In one embodiment, a production cell culture is provided that is useful for producing recombinant AAVhu68. Such cell cultures contain a nucleic acid that expresses AAVhu68 capsid proteins in a host cell; a nucleic acid molecule suitable for packaging into an AAVhu68 capsid, e.g., a vector genome containing AAV ITRs and a non-AAV nucleic acid sequence operably linked to a sequence that encodes a gene product and drives expression of that product in the host cell. and sufficient AAV rep and adenovirus helper functions to allow packaging of the nucleic acid molecule into a recombinant AAVhu68 capsid. In one embodiment, the cell culture consists of mammalian cells (e.g., human embryonic kidney 293 cells, among others) or insect cells (e.g., baculovirus).
[0114] Optionally, the rep function is provided by an AAV other than hu68. In certain embodiments, at least a portion of the rep function is from AAVhu68. See, for example, the rep sequence encoding the rep protein of SEQ ID NO:4, or a functional fragment thereof. AAV rep may be encoded by the nucleic acid sequence of SEQ ID NO:3. In another embodiment, the rep protein is a heterologous rep protein other than AAVhu68rep, such as, but not limited to, AAV1 rep protein, AAV2 rep protein, AAV3 rep protein, AAV4 rep protein, AAV5 rep protein, AAV6 rep protein, AAV7 rep protein, AAV8 rep protein; or rep78, rep68, rep52, rep40, rep68 / 78, and rep40 / 52; or fragments thereof; or another source. Optionally, the rep and cap sequences are on the same genetic element in cell culture. There may be a spacer between the rep sequence and the cap gene. Optionally, the spacer is atgacttaaaccaggt, SEQ ID NO:9. Any of these AAVhu68 or mutant AAV capsid sequences can be under the control of exogenous regulatory control sequences that drive its expression in a host cell.
[0115] In one embodiment, the cells are produced in a suitable cell culture (e.g., HEK293) cell. Methods for producing gene therapy vectors described herein include methods well known in the art, such as generating the plasmid DNA used for gene therapy vector production, vector production, and vector purification. In some embodiments, the gene therapy vector is an AAV vector, and the generated plasmids are an AAV cis plasmid encoding the AAV genome and gene of interest, an AAV trans plasmid containing the AAV rep and cap genes, and an adenovirus helper plasmid. The vector production process can include method steps such as initiating cell culture, passaging cells, seeding cells, transfecting cells with plasmid DNA, replacing the medium with serum-free medium after transfection, and harvesting vector-containing cells and culture medium. The harvested vector-containing cells and culture medium are referred to herein as crude cell harvests. In yet another system, gene therapy vectors are introduced into insect cells by infection with baculovirus-based vectors. For a review of these production systems, see, for example, Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant See generally, "Adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of each of which are incorporated herein by reference in their entirety. Additionally, methods of making and using these and other AAV production systems are described in the following U.S. patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065.
[0116] The crude cell harvest may then be subjected to various procedures, including concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of the microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation to prepare a bulk vector. Subject to a process step such as filtration.
[0117] The vector drug product is purified to remove empty capsids using a two-step affinity chromatography purification at high salt concentrations followed by anion exchange resin chromatography. These methods are described in International Patent Application No. PCT / US2016 / 065970, filed December 9, 2016, and its priority documents, U.S. Patent Application No. 62 / 322,071, filed April 13, 2016, and U.S. Patent Application No. 62 / 226,357, filed December 11, 2015, entitled "Scalable Purification Method for AAV9," which are incorporated herein by reference. A method for purifying AAV8 is described in International Patent Application No. PCT / US2016 / 065976, filed December 9, 2016, and its priority documents, U.S. Patent Application No. 62 / 322,098, filed April 13, 2016, and U.S. Patent Application No. 62 / 266,341, filed December 11, 2015. A method for purifying rh10 is described in International Patent Application No. PCT / US16 / 66013, filed December 9, 2016, and its priority documents, U.S. Patent Application No. 62 / 322,055, filed April 13, 2016, and "Scalable Purification Method for AAV8 Purification." AAV1 is further described in International Patent Application No. PCT / US2016 / 065974, filed December 9, 2016, and its priority documents, U.S. Patent Application No. 62 / 322,083, filed April 13, 2016, and U.S. Patent Application No. 62 / 26,351, filed December 11, 2015, entitled "Scalable Purification Method for AAV1," all of which are incorporated herein by reference.
[0118] To calculate the empty and filled particle content, the VP3 band volume of a selected sample (e.g., in the example herein, an iodixanol gradient-purified GC number = particle number preparation) is plotted against the input GC particles. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test article peak. The number of particles (pt) per 20 μL input volume is then multiplied by 50 to obtain particles (pt) / mL. Dividing Pt / mL by GC / mL gives the particle-to-genome copy (pt / GC) ratio. Pt / mL - GC / mL gives empty pt / mL. Dividing empty pt / mL by pt / mL and multiplying by 100 gives the percentage of empty particles.
[0119] In general, methods for examining empty capsids and AAV vector particles containing packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, the method involves subjecting the treated AAV material to SDS-polyacrylamide gel electrophoresis using any gel capable of separating the three capsid proteins, such as a gradient gel containing 3-8% Tris-acetate in buffer, followed by running the gel until the sample material is separated and blotting the gel onto a nylon or nitrocellulose membrane, preferably nylon. An anti-AAV capsid antibody, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody, is then used as the primary antibody that binds to the denatured capsid protein (Wobus et al., 2003). (e.g., et al., J. Virol. (2000) 74:9281-9293). A secondary antibody that binds to the primary antibody and contains a means for detecting binding to the primary antibody is then used; more preferably, an anti-IgG antibody that contains and is covalently bound to a detection molecule, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase. The binding between the primary and secondary antibodies is determined semi-quantitatively using a method for detecting binding; the detection method preferably detects radioisotope radiation, electromagnetic waves, or colorimetric changes, and most preferably. A chemiluminescent detection kit is preferred. For example, for SDS-PAGE, samples can be taken from column fractions and heated in SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), while capsid proteins are separated on a precast gradient polyacrylamide gel (e.g., Novex). Silver staining can be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, such as SYPRO Ruby or Coomassie stain. In one embodiment, the concentration of AAV vector genome (vg) in column fractions can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove extraneous DNA. After inactivating the nuclease, the sample is further diluted and amplified using primers and a TaqMan™ fluorogenic probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is determined for each sample using Applied Biosystems (ABI). The titer is measured using a Biosystems Prism 7700 sequence detection system. Plasmid DNA containing the same sequence as the AAV vector is used to generate a standard curve for the Q-PCR reaction. The cycle threshold (Ct) value obtained from the sample is used to determine the vector genome titer by normalizing it to the Ct value of the plasmid standard curve. A digital PCR-based endpoint analysis method can also be used.
[0120] In one embodiment, an optimized q-PCR method is used that targets a wide range of serine proteases, such as proteinase K (e.g., commercially available from Qiagen). More specifically, the optimized qPCR genomic titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with proteinase K buffer and treated with proteinase K, followed by heat inactivation. The sample is preferably diluted with a volume of proteinase K buffer equal to the sample size. The proteinase K buffer can be concentrated two-fold or more. Typically, proteinase K treatment is at about 0.2 mg / mL, but can be varied from 0.1 mg / mL to about 1 mg / mL. The treatment step is often performed at about 55°C for about 15 minutes, but can also be performed at lower temperatures (e.g., about 37°C to about 50°C) for longer periods (e.g., about 20 to about 30 minutes) or at higher temperatures (e.g., about 60°C or less) for shorter periods (e.g., about 5 to 10 minutes). Similarly, heat inactivation is typically at about 95°C for about 15 minutes, although lower temperatures (e.g., about 70 to about 90°C) and longer times (e.g., about 20 to about 30 minutes) may be used. The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in the standard assay.
[0121] Additionally or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been taught. See, e.g., M. Lock et al., Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2):115-25. doi:10.1089 / hgtb.2013.131. Epub 2014 Feb 14.
[0122] Briefly, a method for separating rAAVhu68 particles containing packaged genome sequences from genome-less AAVhu68 intermediates involves subjecting a suspension containing recombinant AAVhu68 viral particles and AAVhu689 capsid intermediates to high-performance liquid chromatography, where the AAVhu68 viral particles and AAVhu689 intermediates bind to a strong anion exchange resin equilibrated to a pH of 10.2 and subjected to a salt gradient while monitoring the UV absorbance of the eluate at about 260 and about 280. While suboptimal for rAAV9hu68, the pH can range from about 10.0 to 10.4. In this method, AAVhu68-filled capsids are recovered from fractions eluting when the A260 / A280 ratio reaches an inflection point. In one example, the diafiltered product efficiently captures the AAV2 / hu68 serotype for an affinity chromatography step. Capture Select(TM) Poros-AAV2 / 9 Affinity Resin (Life Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while AAV particles are efficiently captured.
[0123] III. Compositions and Uses Provided herein are compositions containing at least one rAAV material (e.g., rAAVhu68 material or mutant rAAV material) and optional carriers, excipients, and / or preservatives. rAAV material refers to multiple rAAV vectors, e.g., in the same amounts, such as those described below in the discussion of concentrations and dosage units.
[0124] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce allergic or similar undesirable reactions when administered to a host. Delivery vehicles, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, can be used to introduce the compositions of the present invention into suitable host cells. Specifically, the vector genome delivered by the rAAV vector can be formulated for delivery encapsulated in any of lipid particles, liposomes, vesicles, nanospheres, nanoparticles, or the like.
[0125] In one embodiment, the composition is a final formulation suitable for delivery to a subject, for example, an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition can be delivered as a concentrate that is diluted for administration to a subject. In other embodiments, the composition can be lyophilized and reconstituted at the time of administration.
[0126] A suitable surfactant or surfactant combination can be selected from non-toxic non-ionic surfactants. In one embodiment, a difunctional block copolymer surfactant terminated with a primary hydroxyl group is selected, such as Pluronic® F68 (BASF), also known as Poloxamer 188, which has a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers, i.e., non-ionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), may also be selected, such as SOLUTOL HS 15 (Macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylic acid glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are commonly named with the letter "P" (for poloxamer) followed by three numbers, the first two of which are multiplied by 100 to give the approximate molecular weight of the polyoxypropylene core, and the last number is multiplied by 10 to give the polyoxyethylene content as a percentage. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension.
[0127] The vector is administered in an amount sufficient to transfect cells and provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects or with a medically acceptable physiological effect, which amount can be determined by one skilled in the medical arts. Common and pharmaceutically acceptable routes of administration include, but are not limited to, intravenous administration to a desired organ (e.g., liver (optionally via the hepatic artery), lung, These routes of administration include direct delivery to the body (heart, eye, kidney), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal and other parenteral routes. Routes of administration may be combined if desired.
[0128] The dosage of a viral vector will depend primarily on factors such as the condition being treated, age, weight, and health of the patient, and may therefore vary between patients. For example, a therapeutically effective human dosage of a viral vector is usually about 1×10 9 ~1×10 16 The volume of the solution containing the genomic viral vector ranges from about 25 to about 1000 microliters to about 100 mL. The dosage will be adjusted to balance the therapeutic benefit with any side effects, and such dosage may vary depending on the therapeutic application for which the recombinant vector is employed. The expression level of the transgene product can be monitored to determine the dosage frequency for resulting in a minigene-containing viral vector, preferably an AAV vector. In some cases, dosage regimens similar to those described for therapeutic purposes may be utilized for immunization using the compositions of the present invention.
[0129] The replication-deficient virus composition is administered in a dose of approximately 1.0 x 10 (to treat an average subject weighing 70 kg). 9 GC~approx. 1.0×10 16 GC is an amount within the range, including any integer or fractional amount within the range, preferably 1.0 x 10 12 ~1.0×10 14 The composition can be formulated for a human patient in dosage units containing an amount of the replication-deficient virus that falls within the range of GC. In one embodiment, the composition contains at least 1 x 10, including any integer or fractional amount within the range. 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 or 9×10 9 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including any integer or fraction within the range. 10 , 2 × 10 10 , 3×10 10 , 4×10 10, 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 or 9×10 10 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including any integer or fraction within the range. 11 , 2 × 10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 or 9×10 11 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including any integer or fraction within the range. 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 or 9×10 12 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including any integer or fraction within the range. 13 , 2 × 10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 or 9×10 13 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including any integer or fraction within the range. 14 , 2 × 10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 or 9×10 14In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including any integer or fraction within the range. 15 , 2 × 10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 or 9×10 15 In one embodiment, when applied to humans, the dose range is 1 x 10, including any integer or fraction within the range. 10 ~Approx. 1×10 12 It can be GC.
[0130] These above doses may be administered in various volumes of carrier, excipient, or buffer formulation ranging from about 25 to about 1000 microliters or more, including any number within the range, depending on the size of the treatment area, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 μL. In yet another embodiment, the volume is about 300 μL. In yet another embodiment, the volume is about 325 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 375 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is about 700-1000 μL.
[0131] In certain embodiments, the dose is about 1 x 10 9 GC / g brain mass ~ approx. 1×10 12 GC / g brain mass. In certain embodiments, the dose is about 3×10 10 GC / g brain mass ~ approx. 3×10 11 GC / g brain mass. In certain embodiments, the dose is about 5×10 10 GC / g brain mass ~ approx. 1.85×10 11 It can be in the range of GC / g brain mass.
[0132] In one embodiment, the viral construct comprises at least about 1 x 10 9 GC~approx. 1×10 15 , or approximately 1 × 10 11 ~5×10 13The GC may be delivered in doses of GC. Appropriate volumes for delivering these doses and concentrations can be determined by one of skill in the art. For example, a volume of about 1 μL to 150 mL may be selected, with higher volumes being selected for adults. Typically, a volume suitable for newborns is about 0.5 mL to about 10 mL, and for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, a volume of about 30 mL or less may be selected. For preteens and teenagers, a volume of about 50 mL or less may be selected. In still other embodiments, a volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL, may be administered intrathecally to a patient. Other suitable volumes and dosages may also be determined. The dosage will be adjusted to balance the therapeutic benefit with any side effects, and such dosages may vary depending on the therapeutic application for which the recombinant vector is employed.
[0133] The recombinant vector can be delivered to host cells according to published methods. The rAAV can be administered to a human patient or non-human mammal, preferably suspended in a physiologically compatible carrier. In certain embodiments, for administration to a human patient, the rAAV is preferably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts. The formulation is preferably adjusted to a physiologically acceptable pH, such as pH 6-9, pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. Because the pH of cerebrospinal fluid is approximately 7.28 to approximately 7.32, a pH within this range may be desirable for intrathecal delivery, while a pH of approximately 6.8 to approximately 7.2 may be desirable for intravenous delivery. However, other pH values within the broadest range and subranges of these may be selected for other delivery routes.
[0134] In another embodiment, the composition comprises a carrier, diluent, excipient, and / or adjuvant. One skilled in the art can easily select a suitable carrier taking into account the indication for which the imported virus is intended. For example, one suitable carrier includes saline, which may be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from adhering to infusion tubing but do not interfere with rAAV binding activity in vivo. A suitable surfactant or surfactant combination can be selected from non-toxic non-ionic surfactants. In one embodiment, a bifunctional blocker terminated with a primary hydroxyl group is used. A guanylate copolymer surfactant is selected, such as Pluronic® F68 (BASF), also known as Poloxamer 188, which has a neutral pH and an average molecular weight of 8400. Other surfactants and poloxamers, i.e., nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), may also be selected, such as SOLUTOL HS 15 (Macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylic acid glyceride), polyoxy-oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are commonly named with the letter "P" (for poloxamer) followed by three numbers; the first two numbers are multiplied by 100 to obtain the approximate molecular weight of the polyoxypropylene core, and the last number is multiplied by 10 to obtain the percentage polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension. In one example, the formulation may contain a buffered saline solution containing, for example, one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate·7H2O), potassium chloride, calcium chloride (e.g., calcium chloride·2H2O), dibasic sodium phosphate, and mixtures thereof, in water. For intrathecal delivery, osmolality is preferably within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com / article / 2093316-overview. In some cases, commercially available diluents for intrathecal delivery may be used as suspending agents or in combination with other suspending agents and other optional excipients. See, e.g., Elliot B® Solution [Lukare Medical]. In other embodiments, the formulation may contain one or more penetration enhancers.Examples of suitable penetration enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.
[0135] In addition to the rAAV and carrier(s), the compositions of the invention may optionally contain other common pharmaceutical ingredients, such as preservatives or chemical stabilizers. Examples of suitable preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.
[0136] The compositions of the present invention may include a pharmaceutically acceptable carrier, such as those defined above. Preferably, the compositions described herein include an effective amount of one or more AAVs suspended in a pharmaceutically suitable carrier and / or mixed with a suitable excipient designed for delivery to a subject via injection, osmotic pump, intrathecal catheter, or another device or route. In one example, the composition is formulated for intrathecal delivery.
[0137] As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to a route of administration in which a drug is administered by injection into the spinal canal, more specifically into the subarachnoid space, so that it reaches the cerebrospinal fluid (CSF). Intrathecal delivery can include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital / intracisternal, and / or C1-2 puncture. For example, a material may be introduced by lumbar puncture for diffusion throughout the subarachnoid space. In another example, injection may be made into the cisterna magna.
[0138] As used herein, the term "intracisternal delivery" or "intracisternal administration" refers to the route of administering a drug directly into the cerebrospinal fluid of the cisternal-medullary cistern, more specifically by suboccipital puncture, or by direct injection into the cisterna magna, or via a permanently placed tube.
[0139] IV. DEVICES AND METHODS FOR DELIVERY OF PHARMACEUTICAL COMPOSITIONS INTO THE CEREBROSPINAL FLUID In one aspect, the vectors provided herein can be administered intrathecally by the methods and / or devices provided in this section and further described in Figure 7. Alternatively, other devices and methods may be selected. The method includes the steps of advancing a spinal tap needle into the patient's cisterna magna, connecting a length of flexible tubing to the proximal hub of the spinal tap needle and connecting the proximal end of the flexible tubing to an outlet port of a valve, and, after the advancing and connecting steps and after the tubing is initially self-primed with the patient's cerebrospinal fluid, connecting a first container containing a quantity of isotonic solution to the irrigation inlet port of the valve, and thereafter connecting a second container containing a quantity of a pharmaceutical composition to the vector inlet port of the valve. After connecting the first and second containers to the valve, a fluid flow path between the vector inlet and outlet ports of the valve is opened and the pharmaceutical composition is injected through the spinal tap needle and into the patient; after injection of the pharmaceutical composition, a fluid flow path through the irrigation inlet and outlet ports of the valve is opened and an isotonic solution is injected into the spinal tap needle to force the pharmaceutical composition into the patient.
[0140] In another aspect, a device for intracisternal delivery of a pharmaceutical composition is provided. The device includes a first container containing a quantity of the pharmaceutical composition, a second container containing an isotonic solution, and a spinal tap needle through which the pharmaceutical composition can be dispensed from the device directly into the cerebrospinal fluid in the cisterna magna of a patient. The device further includes a valve having a first inlet port interconnected to the first container, a second inlet port interconnected to the second container, an outlet port interconnected to the spinal tap needle, and a luer lock for controlling the flow of the pharmaceutical composition and the isotonic solution through the spinal tap needle.
[0141] As used herein, the term computed tomography (CT) refers to x-ray imaging in which a three-dimensional image of a body structure is constructed by a computer from a series of planar cross-sectional images made along an axis.
[0142] 7 includes one or more containers 12 and 14 interconnected via a valve 16. Containers 12 and 14 provide a fresh source of a pharmaceutical composition, drug, vector, or similar substance, and a fresh source of an isotonic solution, such as saline, respectively. Containers 12 and 14 may be any form of medical device that allows for the infusion of fluids into a patient.
[0143] By way of example, each container 12 and 14 may be provided in the form of a syringe, cannula, or the like. For example, in the illustrated embodiment, container 12 is provided as a separate syringe containing a quantity of pharmaceutical composition, referred to herein as a "vector syringe." By way of example only, container 12 may hold approximately 10 cc of pharmaceutical composition or the like.
[0144] Similarly, container 14 may be provided in the form of a separate syringe, cannula, or the like, containing a quantity of saline solution, which may be referred to as a “washing syringe.” By way of example only, container 14 may contain approximately 10 cc of saline solution.
[0145] Alternatively, containers 12 and 14 may be provided in forms other than syringes and may be incorporated into a single device, such as an integrated medical injection device having a pair of separate chambers, one for the pharmaceutical composition and one for the saline solution. Additionally, the size of the chambers or containers may be provided as needed to accommodate the desired volume of fluid.
[0146] In the illustrated embodiment, valve 16 is provided as a four-way stopcock with a swivel male luer lock 18. Valve 16 interconnects container 12 and container 14 (i.e., the vector syringe and wash syringe in the illustrated embodiment), and the swivel male luer lock allows the passage through valve 16 to be opened and closed for each of containers 12 and 14. In this manner, the passage through valve 16 may be closed to both the vector syringe and wash syringe, or may be open to a selected one of the vector syringe and wash syringe. Instead of a four-way stopcock, the valve may be a three-way stopcock or a fluid control device.
[0147] In the illustrated embodiment, the valve 16 is connected to one end of a length of extension tubing 20 or similar fluid conduit. The tubing 20 may be selected based on the desired length or internal volume. By way of example only, the tubing may be approximately 6-7 inches in length.
[0148] In the illustrated embodiment, the opposite end 22 of the tubing 12 is connected to a T-connector extension set 24, which in turn is connected to a spinal tap needle 26. By way of example, the needle 26 may be a 5-inch, 22- or 25-gauge spinal tap needle. Optionally, the spinal tap needle 26 may further be connected to an introducer needle 28, such as a 3.5-inch, 18-gauge introducer needle.
[0149] In use, the spinal needle 26 and / or optional introducer needle 28 may be advanced into the patient toward the cisterna magna. After the needles have been advanced, a computed tomography (CT) image may be acquired, allowing visualization of the needles 26 and / or 28 and associated soft tissues (e.g., paraspinal muscles, bone, brainstem, and spinal cord). Correct needle placement is confirmed by observation of cerebrospinal fluid (CSF) within the needle hub and visualization of the needle tip within the cisterna magna. A relatively short length of extension tubing 20 may then be attached to the inserted spinal needle 26, and a four-way stopcock 16 may then be attached to the opposite end of the tubing 20.
[0150] The assembly is "primed" with the patient's CSF. A pre-filled saline flush syringe 14 is then attached to the flush inlet port of the four-way stopcock 16, and then the vector syringe 12 containing the pharmaceutical composition is attached to the vector inlet port of the four-way stopcock 16. The outlet port of the stopcock 16 is then opened to the vector syringe 12, and the contents of the vector syringe can be slowly infused through the valve 16 and the assembled device into the patient over a period of time. By way of example only, this period can be approximately 1-2 minutes and / or any other desired time.
[0151] After injecting the contents of the vector syringe 12, the swivel lock 18 on the stopcock 16 is rotated to a second position so that the attached prefilled rinse syringe 14 can be used to rinse the stopcock 16 and needle assembly with a desired amount of saline. By way of example only, 1-2 cc of saline may be used, although more or less may be used as needed. The saline urges all or most of the pharmaceutical composition to pass through the assembled device and into the patient, thereby ensuring that little or none of the pharmaceutical composition remains within the assembled device.
[0152] After flushing the assembled device with saline, the entire assembled device, including the needle(s), extension tubing, stopcock, and syringe, is slowly removed from the subject and placed on a surgical tray for disposal in a biohazard waste container or rigid container (e.g., for the needle(s)).
[0153] The screening process, which may ultimately lead to an intracisternal (IC) procedure, may be undertaken by the principal investigator, who must ensure that the subject (or designated caregiver) is fully informed. The process, procedure, administration procedure itself, and any possible safety risks may be described to ensure the safety of the patient. Medical history, concomitant medications, physical examination, vital signs, electrocardiogram (ECG), and laboratory test results will be obtained or performed and provided to the neuroradiologist, neurosurgeon, and anesthesiologist for use in screening assessment of the subject's eligibility for the IC procedure.
[0154] To allow sufficient time to review eligibility, the following procedures may be performed any time from the first screening visit until one week prior to the study visit. For example, on "Day 0," a head / neck magnetic resonance image (MRI) may be obtained with or without gadolinium (i.e., eGFR > 30 mL / min / 1.73 m2). In addition to the head / neck MRI, the investigator may determine the need for any further evaluation of the neck with flexion / extension testing. The MRI protocol may include T1, T2, DTI, FLAIR, and CINE protocol images.
[0155] Additionally, a head / neck MRA / MRV may be obtained according to institutional protocol to allow for a full assessment of CSF flow and identification of possible blockages or lack of communication between CSF spaces (i.e., subjects with a history of intradural / transdural surgery may be excluded or further testing (e.g., radionucleotide cisternography) may be required).
[0156] Neuroradiologists, neurosurgeons, and anesthesiologists ultimately discuss and determine each subject's eligibility for the IC procedure based on all available information (scans, medical history, physical exam, studies, etc.) Keeping in mind the special physiological needs of MPS subjects, a preoperative anesthesia evaluation may also be obtained from "Day -28" to "Day 1" providing a detailed assessment of the airway, (short / thick) neck, and head range of motion (degree of cervical flexion).
[0157] Prior to the IC procedure, the following equipment and medications will be ensured in the CT suite: an adult lumbar puncture (LP) kit (supplied by the facility) prepared according to a separate medication manual and delivered to the CT / operating room (OR); a BD (Becton Dickinson) 22 or 25 gauge x 3-7 inch spinal puncture needle (Quincke) bevel); a coaxial introducer needle (for introduction of the spinal tap needle) to be used at the discretion of the interventionalist; a four-way small-bore stopcock with a swivel (spin) male luer lock; a T-connector extension set (tubing) approximately 6.7 inches long with a female luer lock adapter; Omnipaque 180 (iohexol) for intrathecal administration; iodinated contrast agent for intravenous (IV) administration; 1% lidocaine solution for injection (if not provided in the adult LP kit); a pre-filled 10cc saline (sterile) irrigation syringe; radiopaque marker(s); surgical prep equipment / shaving razor; a pillow / support to allow proper positioning of the subject to be intubated; endotracheal intubation equipment, general anesthesia machine and mechanical ventilator; intraoperative neurophysiological monitoring (IONM) equipment (and necessary personnel); and a 10cc syringe with vector.
[0158] Informed consent for the procedure is verified and entered into the medical record and / or study file. Separate consent for the procedure by radiology and anesthesiology personnel is obtained according to facility requirements. The subject is provided with intravenous access (e.g., two IV access sites) in an appropriate hospital care room according to facility guidelines. Intravenous fluids are administered at the discretion of the anesthesiologist. At the discretion of the anesthesiologist and according to facility guidelines, endotracheal intubation may be induced and administered to the subject along with the administration of general anesthesia in an appropriate patient care room, holding area, or surgical / CT procedure room.
[0159] A lumbar puncture is performed to first remove 5 cc of cerebrospinal fluid (CSF), followed by intrathecal injection of contrast agent (Omnipaque 180) to aid in visualization of the cisterna magna. Appropriate target placement maneuvers can be performed to facilitate diffusion of the contrast agent into the cisterna magna.
[0160] The subject will be fitted with intraoperative neurophysiological monitoring (IONM) equipment. The subject will be positioned on the CT scanner table in either a prone or lateral position. Qualified personnel must be present to ensure the subject's safety during transport and positioning. If deemed appropriate, the subject may be positioned to provide a degree of neck flexion that results in normal neuromonitoring signals being recorded after positioning and is deemed safe during preoperative evaluation.
[0161] The presence of the following personnel may be confirmed and identified on-site: the interventionalist / neurosurgeon who will perform the procedure; the anesthesiologist and respiratory technician(s); nurses and physician assistants; CT (or OR) technicians; neurophysiology technicians; and a site coordinator. A "time-out" may be completed per joint review board / hospital protocol to confirm the correct subject, procedure, location, placement, and presence of all necessary equipment in the room. The lead site investigator may then confirm with the personnel that he / she may proceed with preparing the subject.
[0162] The subject's skin below the skull is appropriately shaved. If deemed necessary by the interventionalist to locate the target and image the vasculature, a CT scout image is performed, followed by a pre-planning CT with IV contrast. After the target site (cisterna magna) is identified and the needle trajectory is planned, the skin is prepared and draped using aseptic technique according to institutional guidelines. A radiopaque marker is placed at the target skin location as directed by the interventionalist. The skin below the marker is anesthetized by infiltration with 1% lidocaine. A 22G or 25G spinal puncture needle is then advanced toward the cisterna magna, possibly using a coaxial introducer.
[0163] After needle advancement, CT images are acquired using the thinnest CT slice thickness feasible using the facility's equipment (ideally 2.5 mm or less). Serial CT images are acquired using the lowest radiation dose possible that allows for adequate visualization of the needle and involved soft tissues (e.g., paraspinal muscles, bone, brainstem, and spinal cord). Correct needle placement is confirmed by observation of CSF within the needle hub and visualization of the needle tip within the cisterna magna.
[0164] The interventionalist ensures that the vector syringe is located near but outside the sterile field. Gloves, masks, and eye protection are worn by personnel assisting with the procedure within the sterile field prior to handling or administering the pharmaceutical composition in the vector syringe.
[0165] Extension tubing is attached to the inserted spinal tap needle, which is then attached to a four-way stopcock. Once the device is "primed" with the subject's CSF, a 10cc pre-filled saline irrigation syringe is attached to the irrigation inlet port of the four-way stopcock. A vector syringe is then provided to the interventionist and attached to the vector inlet port of the four-way stopcock.
[0166] After opening the stopcock outlet port to the vector syringe by placing the stopcock swivel lock in the first position, slowly inject (approximately 1-2 minutes) the contents of the vector syringe, taking care not to apply excessive force to the syringe plunger during injection. After the vector syringe contents have been injected, rotate the stopcock swivel lock to the second position so that the attached prefilled rinse syringe can be used to rinse the stopcock and needle assembly with 1-2 cc of saline.
[0167] When ready, the interventionist then informs the practitioner that he / she will remove the equipment from the subject. In one motion, slowly remove the needle, extension tubing, stopcock, and syringe from the subject and place them on a surgical tray for disposal in a biohazard waste container or hard container (for needles).
[0168] The needle insertion site was inspected for signs of bleeding or CSF leakage, as directed by the investigator. The area is protected using gauze, surgical tape, and / or Tegaderm dressings as directed. The subject is then removed from the CT scanner and placed supine on a stretcher. Qualified personnel are present to ensure the subject's safety during transport and placement.
[0169] Anesthesia will be discontinued and the subject will be cared for according to institutional guidelines for post-anesthesia care. Neurophysiological monitoring equipment will be removed from the subject. During recovery, the head end of the gurney on which the subject is lying should be slightly elevated (approximately 30 degrees). The subject will be transported to a suitable post-anesthesia care unit according to institutional guidelines. Once the subject is sufficiently conscious and stable, they will be admitted to the appropriate floor / room for evaluation as defined by protocol. Neurological evaluation will be monitored according to protocol, and the Principal Investigator will oversee the subject's care in collaboration with hospital and study personnel.
[0170] In one embodiment, a method of delivering a composition provided herein comprises advancing a spinal tap needle into a patient's cisterna magna; connecting a length of flexible tubing to the proximal hub of the spinal tap needle and connecting an outlet port of a valve to the proximal end of the flexible tubing; after the advancing and connecting steps and after the tubing is initially self-primed with the patient's cerebrospinal fluid, connecting a first container containing a quantity of isotonic solution to the irrigation inlet port of the valve and thereafter connecting a second container containing a quantity of a pharmaceutical composition to the vector inlet port of the valve; after connecting the first and second containers to the valve, opening a fluid flow path between the vector inlet and outlet ports of the valve and injecting the pharmaceutical composition through the spinal tap needle and into the patient; and after injection of the pharmaceutical composition, opening a fluid flow path through the irrigation inlet and outlet ports of the valve and injecting the isotonic solution into the spinal tap needle to force the pharmaceutical composition into the patient. In certain embodiments, the method further includes confirming proper placement of the distal tip of the spinal tap needle within the cisterna magna prior to connecting the tubing and valve to the hub of the spinal tap needle. In certain embodiments, the confirming step includes visualizing the distal tip of the spinal tap needle within the cisterna magna by performing a computed tomography (CT) scan. In certain embodiments, the confirming step includes observing the presence of the patient's cerebrospinal fluid within the hub of the spinal tap needle.
[0171] In the above method, the valve can be a stopcock with a swivel luer lock adapted to swivel to a first position to allow flow from the vector inlet port to the outlet port while blocking flow through the irrigation inlet port and to swivel to a second position to allow flow from the irrigation inlet port to the outlet port while blocking flow through the vector inlet port, the swivel luer lock being disposed in the first position when the pharmaceutical composition is injected into the patient and in the second position when the pharmaceutical composition is flushed into the patient with an isotonic solution. In certain embodiments, after the isotonic solution is injected into the spinal tap needle to flush the pharmaceutical composition into the patient, the spinal tap needle is withdrawn from the patient while still connected as an assembly to the tubing, the valve, and the first and second containers. In certain embodiments, the valve is a four-way stopcock with a swivel male luer lock. In certain embodiments, the first and second containers are separate syringes. In certain embodiments, a T-shaped connector is disposed on the hub of the spinal tap needle and interconnects the tubing and the spinal tap needle. Optionally, the spinal tap needle includes an introducer needle at the distal end of the spinal tap needle. The spinal tap needle can be a 5-inch, 22- or 24-gauge spinal tap needle. In certain embodiments, the introducer needle is a 3.5-inch, 18-gauge introducer needle.
[0172] In certain aspects, the method utilizes a device comprising, at a minimum, a first container for containing a quantity of the pharmaceutical composition; a second container for containing an isotonic solution; a spinal tap needle through which the pharmaceutical composition can be expelled from the device directly into the cerebrospinal fluid in the patient's cisterna magna; and a valve having a first inlet port interconnected to the first container, a second inlet port interconnected to the second container, an outlet port interconnected to the spinal tap needle, and a luer lock for controlling the flow of the pharmaceutical composition and the isotonic solution through the spinal tap needle. In certain embodiments, the valve swivels to open the first The valve is a stopcock with a swivel luer lock adapted to be rotated to a first position to allow flow from the first inlet port to the outlet port while blocking flow through the second inlet port, and to be rotated to a second position to allow flow from the second inlet port to the outlet port while blocking flow through the first inlet port. Optionally, the valve is a four-way stopcock with a swivel male luer lock. In certain embodiments, the first and second containers are separate syringes. In certain embodiments, the spinal tap needle is interconnected to the valve via a length of flexible tubing. A T-connector may interconnect the tubing and the spinal tap needle. In certain embodiments, the spinal tap needle can be a 5-inch, 22- or 24-gauge spinal tap needle. In certain embodiments, the device further includes an introducer needle connected to the distal end of the spinal tap needle. Optionally, the introducer needle is a 3.5-inch, 18-gauge introducer needle.
[0173] This method and this device can each optionally be used for intrathecal delivery of the compositions provided herein, or other methods and devices can be used for such intrathecal delivery.
[0174] In certain embodiments, compositions are provided comprising rAAVhu68.anti-HER2 antibody, such that the AAV vector carries a nucleic acid expression cassette encoding an immunoglobulin construct and regulatory sequences that drive expression of the immunoglobulin in selected cells. After administration of the vector into the CNS, the vector delivers the expression cassette to the CNS and expresses the proteinaceous immunoglobulin construct in vivo. The use of the compositions described herein in anti-neoplastic methods is taught similarly to the use of these compositions in anti-neoplastic drug regimens, but may optionally include the delivery of one or more other anti-neoplastic drugs or other active agents.
[0175] The composition may contain one AAVhu68 vector described herein, which contains an expression cassette for delivering an anti-neoplastic immunoglobulin construct in vivo. Alternatively, the composition may contain two or more different AAV vectors, each packaging a different expression cassette. For example, two or more different AAVs may have different expression cassettes expressing immunoglobulin polypeptides that assemble in vivo to form a single functional immunoglobulin construct. In another example, two or more AAVs may have different expression cassettes expressing immunoglobulin polypeptides directed against different targets, e.g., two providing two functional immunoglobulin constructs (e.g., an anti-Her2 immunoglobulin construct and another anti-neoplastic immunoglobulin construct). In yet another alternative, two or more different AAVs may express immunoglobulin constructs directed against the same target, one of which is modified to cleave FcRn binding, while the other immunoglobulin construct retains or has improved ability to bind FcRn. Such compositions may be useful to simultaneously provide antibodies with increased retention in brain regions and for systemic delivery of immunoglobulin constructs.
[0176] In some cases, one or both of these immunoglobulin constructs have enhanced ADCC activity. The therapeutic regimens described herein may include, in addition to one or more of the combinations described herein, further combinations with one or more of antineoplastic biopharmaceuticals, antineoplastic small molecule drugs, chemotherapeutic agents, immune enhancing drugs, radiation, surgery, and the like. The biopharmaceuticals described herein may be based on peptides, polypeptides, proteins, enzymes, nucleic acid molecules, vectors (including viral vectors), or the like.
[0177] The compositions described herein suitably comprise an antineoplastically effective amount of one or more AAVhu68 molecules suspended in a pharmaceutically suitable carrier designed for delivery to a subject by injection, osmotic pump, intrathecal catheter, or by another device or route. In one example, the composition is formulated for intrathecal delivery. As used herein, intrathecal delivery includes injection into the spinal canal, more specifically into the subarachnoid space. However, other delivery routes may be selected, including, for example, intracranial, intranasal, intracisternal, delivery into the cerebrospinal fluid or Ommaya reservoir, among other suitable direct or systemic routes, and pharmaceutically acceptable carriers for the AAV composition.
[0178] The composition contains approximately 1 x 10 9 Genome copies (GC) ~ approx. 5 x 10 13 AAV can be formulated into dosage units containing an amount within the range of GC. In one embodiment, a spinal tap is performed in which about 15 mL (or less) to about 40 mL of CSF is withdrawn, the vector is mixed with the CSF, and / or suspended in a compatible carrier, and delivered to the subject. In one example, the vector concentration is about 3×10 13 GC, but other amounts, for example, about 1 × 10 9 GC, approx. 5×10 9 GC, approx. 1×10 10 GC, approx. 5×10 10 GC, approx. 1×10 11 GC, approx. 5×10 11 GC, approx. 1×10 12 GC, approx. 5×10 12 GC or approximately 1.0 x 10 13 GC is one example.
[0179] In one embodiment, the compositions described herein are used in a method for slowing tumor growth. In yet another embodiment, the compositions described herein are useful for reducing tumor size in a subject. In a further embodiment, the compositions described herein are useful for reducing the number of cancer cells in non-solid tumor cancers. In another embodiment, the compositions described herein are used in a method for improving overall patient survival and / or progression-free survival. The anti-neoplastic immunoglobulin construct is selected taking into account the neoplasm to be treated. For example, for the treatment of metastatic breast cancer in the brain, an expression cassette for an anti-HER antibody may be engineered into a recombinant rAAV described herein. Optionally, the AAV compositions described herein are administered in the absence of additional exogenous drugs or chemicals or other physical blood-brain barrier disruption. In combination therapy, the AAV-delivered immunoglobulin constructs described herein are administered before, during, or after initiating therapy with another agent, and in combinations thereof, i.e., before and during, before and after, during and after, or before, during, and after initiating anti-neoplastic agent therapy. For example, AAV may be administered 1 to 30 days, preferably 3 to 20 days, and more preferably 5 to 12 days prior to the initiation of radiation therapy. In another embodiment of the present invention, chemotherapy is administered concurrently with, or more preferably subsequent to, AAV-mediated immunoglobulin (antibody) therapy. In yet other embodiments, the compositions of the present invention may be combined with other biologics, such as recombinant monoclonal antibody drugs, antibody-drug conjugates, or the like. Furthermore, combinations of different AAV-delivered immunoglobulin constructs, such as those described above, may be used in such therapeutic regimens. Any suitable method or route can be used to administer the AAVhu68.anti-Her2-containing compositions described herein, and, optionally, antineoplastic agents and / or antagonists of other receptors can be co-administered. Anti-neoplastic agent dosing regimens utilized in accordance with the present invention include any regimen believed to be optimal for treating the patient's neoplastic symptoms. Various malignancies may require the use of specific anti-tumor antibodies and specific antineoplastic agents, which will be determined on a patient-by-patient basis. Administration modes include, for example, systemic, oral, intravenous, intraperitoneal, subcutaneous, or intramuscular administration.The dose of antagonist administered will depend on a number of factors, including, for example, the type of antagonist, the type and severity of the tumor being treated, and the route of administration of the antagonist.
[0180] It should be noted that the terms "a" or "an" refer to one or more. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.
[0181] The words "comprise," "comprises," and "comprising" are to be interpreted inclusively rather than exclusively. The words "consisting of," "consisting of," and variations thereof are to be interpreted exclusively rather than inclusively. Although various embodiments in the specification are expressed using the phrase "comprising," under other circumstances the embodiment in question may be construed and interpreted using the phrase "consisting of" or "consisting essentially of." It is also intended to be illustrative and explanatory.
[0182] As used herein, the term "about" means a variation of 10% (±10%) from a given reference, unless otherwise specified.
[0183] As used herein, "disease," "disorder," and "condition" are used interchangeably to refer to an abnormal state in a subject.
[0184] Unless defined elsewhere herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to published literature that provides those skilled in the art with general guidance for many of the terms used in this application.
[0185] The term "expression" is used herein in its broadest sense and includes the production of RNA, or the production of RNA and protein. With respect to RNA, the terms "expression" or "translation" specifically relate to the production of peptides or proteins. Expression may be transient or stable.
[0186] As used herein, the term "NAb titer" refers to the measurement of the production of neutralizing antibodies (e.g., anti-AAV Nabs) that neutralize the physiological effects of a targeted epitope (e.g., AAV). Anti-AAV NAb titers can be measured, for example, as described in Calcedo, R., et al., "Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses." Journal of Infectious Diseases, 2009, 199(3):381-390.
[0187] As used herein, "expression cassette" refers to a nucleic acid molecule that includes a coding sequence, a promoter, and may include other regulatory sequences therefor. In certain embodiments, a vector genome may contain two or more expression cassettes. In other embodiments, the term "transgene" may be used interchangeably with "expression cassette." Typically, such expression cassettes for generating viral vectors contain coding sequences for gene products described herein, flanked by packaging signals for the viral genome and other expression control sequences, such as those described herein.
[0188] The abbreviation "sc" refers to self-complementary. "Self-complementary AAV" refers to a construct in which the coding region of the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. During infection, the complementary halves of the scAAV associate to form a single double-stranded DNA (dsDNA) unit ready for immediate replication and transcription, without waiting for cell-mediated synthesis of the second strand. See, for example, DM McCarty et al., "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient See, "Transduction Independently of DNA Synthesis," Gene Therapy, (August 2001), Vol. 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated by reference in its entirety.
[0189] As used herein, the term "operably linked" refers not only to expression control sequences that are contiguous with a gene of interest, but also to expression control sequences that act in trans, or at a distance, to regulate a gene of interest.
[0190] The term "heterologous," when used with respect to a protein or nucleic acid, indicates that the protein or nucleic acid comprises two or more sequences or subsequences that are not found in nature in the same relationship to each other. For example, nucleic acids are typically produced recombinantly, in which two or more sequences from unrelated genes are arranged to create a new functional nucleic acid. For example, in one embodiment, the nucleic acid is arranged so that a promoter from one gene drives expression of a coding sequence from another gene. Thus, the promoter is heterologous with respect to the coding sequences.
[0191] A "replication-deficient virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged within the viral capsid or envelope, and any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient, i.e., they are unable to produce progeny virions but retain the ability to affect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless," containing only the gene of interest flanked by signals required for amplification and packaging of the artificial genome), although these genes can be supplied during production. It is therefore considered safe for use in gene therapy because replication and infection by progeny virions of the viral enzymes cannot occur unless they are in the presence of the viral enzymes required for replication.
[0192] rAAV particles are often referred to as DNase-resistant. However, in addition to this endonuclease (DNase), other endo- and exo-nucleases may be used in the purification steps described herein to remove contaminating nucleic acids. Such nucleases may be selected to degrade single- and / or double-stranded DNA as well as RNA. Such steps may contain a single nuclease or a mixture of nucleases, which may be endonucleases or exonucleases directed to different targets.
[0193] The term "nuclease-resistant" indicates that the AAV capsid perfectly assembles around the expression cassette designed to deliver genes into the host cell and protects these packaged genomic sequences from degradation (digestion) during nuclease incubation steps intended to remove contaminating nucleic acids that may be present due to the production process.
[0194] As used herein, "effective amount" refers to the amount of an rAAV composition that delivers and expresses a certain amount of gene product from the vector genome in a target cell. Effective amounts may be determined based on animal models rather than human patients. An example of a suitable mouse model is described herein.
[0195] In certain embodiments, the rAAV or compositions provided herein exclude anti-influenza antibody or immunoglobulin constructs. In certain embodiments, the rAAV or compositions provided herein exclude spinal muscular atrophy (SMA) genes or SMN coding sequences.
[0196] In the context of the present invention, the term "translation" relates to the process in the ribosome whereby an mRNA chain controls the assembly of an amino acid sequence to produce a protein or peptide.
[0197] As used throughout this specification and claims, the terms "comprising," "containing," "including," and variations thereof, are intended to encompass all other Conversely, the term "consisting of" and its variations is exclusive of other components, elements, integers, steps, and the like.
[0198] It should be noted that the terms "a" or "an" refer to one or more; for example, "an enhancer" is understood to refer to one or more enhancer(s). Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.
[0199] As used above, the term "about" when modifying a numerical value means a variation of ±10% unless otherwise specified.
[0200] The following examples are illustrative only and are not intended to limit the invention. [Example]
[0201] In certain embodiments, AAVhu68 capsids have been observed to have better yields than AAV9, which also falls within clade F. One or both of the amino acid changes, glutamic acid (Glu) at position 67 and valine (Val) at position 157, may confer this increased yield. In certain embodiments, vectors with AAVhu68 capsids provide at least a 15% increase in packaged vector yield compared to vectors based on AAV9. Comparing AAVhu68 to AAVrh10, AAVhu68 is more efficient at lower doses (e.g., about 1 x 10 9 ) was found to result in better transduction efficiency than AAVrh10 after intracerebroventricular administration.
[0202] Example 1 A. Identification of AAVhu68 Tissue DNA as a PCR template was extracted from human tissue samples using a QIAamp column (Qiagen) according to the manufacturer's recommendations with the following modifications: Q5 DNA polymerase (Q5® Hot Start High-Fidelity 2X Master Mix, NEB) was selected for its high fidelity and robust efficiency in recovering the full-length VP1 gene of potential AAV in samples, as described by Gao et al. [Proc Natl Acad Sci USA, 2002 Sep 3, 99(18):11854-11859 (electronic publication August 21, 2002)], and a primer set modified as follows was used: primer prm504 (SEQ ID NO: 7) was used instead of AV1NS, and reverse primer prm505 (CGCAGAGACCAAGTTCAACTGAAACGA [SEQ ID NO: 8] was used instead of AV2CAS. PCR conditions were modified as follows: [Table 3] PCR program [Table 4]
[0203] The approximately 3 kb band from the PCR was excised from the gel, and DNA was extracted using a QIAquick Gel Extraction Kit (Qiagen) and cloned into a Zero Blunt® TOPO® PCR Cloning Kit (Thermo Fisher Scientific). Plasmids were sequenced to obtain the full length of the AAV VP1 gene. For the majority of samples, at least three plasmids were fully sequenced, and a consensus sequence was derived as the final AAV sequence for that sample.
[0204] The resulting nucleic acid sequence encoding the vp1 capsid protein of AAVhu68 is shown in SEQ ID NO: 1. See also Figures 2A-C. The vp1 amino acid sequence of AAVhu68 is shown in Figure 1 and SEQ ID NO: 2. Two mutations (A67E and A157V) were identified as essential in AAVhu68 compared to AAV9, AAVhu31, and AAVhu32 (circled in Figure 1).
[0205] This amplification method also provided a spacer sequence between the vp1 and rep coding sequences, which is atgacttaaaccaggt, SEQ ID NO: 9. The coding sequence for rep52 of AAVhu68 is reproduced in SEQ ID NO: 3, and the rep52 protein sequence is reproduced in SEQ ID NO: 4.
[0206] To evaluate packaging efficiency, yield, and transduction properties, we then constructed the pAAV2 / hu68 transfection plasmid by incorporating the hu68 VP1 gene into the pAAV2 / 9 backbone in place of the AAV9 VP1 gene. The pAAV2 / 9 plasmid contains the 5' and 3' ITRs of AAV2 flanking the capsid gene and is expressed in the Penn Vector. The vectors are available from the University of Pennsylvania, Philadelphia, PA US, pennvectorcore.med.upenn.edu.
[0207] B. Characterization of AAVhu68 Although this phenomenon has not been previously observed or described in adeno-associated virus capsids, other proteins and peptides have been found to be susceptible to a variety of chemical modifications in vitro as well as in vivo. The most frequent modification is asparagine deamidation, a spontaneous, nonenzymatic reaction. Generally, the half-life of asparaginyl deamidation under physiological conditions (pH 7.4, 37°C) varies between approximately 1 and 1,000 days. A similar series of reactions occurs at glutamine to give glutamate residues, but these reactions are slower than those of their asparagine counterparts.
[0208] In short peptides, the formation of cyclic intermediates is controlled by the primary sequence, but in proteins, secondary, tertiary, and quaternary structures have additional influences. Therefore, the deamidation rate of each protein amide is unique. Identification of deamidated peptides by mass spectrometry is relatively straightforward, since deamidation adds +0.984 Da (the mass difference between the -OH and -NH2 groups) to the mass of the intact molecule. Because deamidation is a stable modification in the gas phase, MS / MS spectra can reveal the location of deamidation even when several potential deamidation sites are present.
[0209] Four AAVhu68 vectors were produced in 293 cells using one of four vector genomes unrelated to this study, each using a conventional triple transfection method. For an overview of these techniques, see, e.g., Bell CL, et al., "The AAV9 receptor and its modification to See "Improve in vivo lung gene transfer in mice," J Clin Invest. 2011;121:2427-2435. Briefly, a plasmid encoding the packaged sequence (the gene product expressed from the chicken β-actin promoter, an intron, and growth hormone polyA) flanked by AAV2 inverted terminal repeats was packaged by triple transfection of HEK293 cells with a plasmid encoding the AAV2 rep gene and the AAVhu68 cap gene and an adenovirus helper plasmid (pAdΔF6). The resulting AAV viral particles could be purified using CsCl gradient centrifugation, concentrated, and frozen for later use.
[0210] Denaturation and alkylation: 2 μl of 1 M dithiothreitol (DTT) and 2 μl of 8 M guanidine hydrochloride (GndHCl) are added to 100 μg of thawed virus preparation (protein solution) and incubated at 90°C for 10 minutes. The solution is allowed to cool to room temperature, after which 5 μl of freshly prepared 1 M iodoacetamide (IAM) is added and incubated in the dark at room temperature for 30 minutes. After 30 minutes, the alkylation reaction is stopped by adding 1 μl of 1 M DTT.
[0211] Digestion: Add 20 mM ammonium bicarbonate (pH 7.5-8) to the denatured protein solution to dilute the final GndHCl concentration to 800 mM. Add protease solution (trypsin or chymotrypsin) at a 1:20 ratio of protease to protein and incubate overnight at 37°C. After digestion, add TFA to a final concentration of 0.5% to stop the digestion reaction.
[0212] Mass spectrometry: Approximately 1 microgram of the combined digest mixture was analyzed by UHPLC-MS / MS. LC was performed on an UltiMate 3000RS LC nano system (Thermo Scientific). Mobile phase A was MilliQ water with 0.1% formic acid. Mobile phase B was acetonitrile with 0.1% formic acid. The LC gradient was 4% B to 6% B over 15 minutes, followed by 10% B for 25 minutes (40 minutes total), and then 30% B for 46 minutes (86 minutes total). The sample was loaded directly onto the column. The column dimensions were 75 cm x 15 μm internal diameter and packed with 2-micron C18 media (Acclaim PepMap). The LC was interfaced with a quadrupole-orbitrap mass spectrometer (Q-Exactive HF, Thermo Scientific) via nanoflex electrospray ionization using the source. The column was heated to 35 °C and an electrospray voltage of 2.2 kV was applied. The mass spectrometer was programmed to acquire tandem mass spectra from the top 20 ions. The maximum MS resolution was 120,000 and the MS / MS resolution was 30,000. The normalized collision energy was set to 30, the automatic gain control was set to 1e5, the maximum fill MS was set to 100 ms, and the maximum fill MS / MS was set to 50 ms.
[0213] Data processing: Raw mass spectrometer data files were analyzed with BioPharma Finder 1.0 (Thermo Scientific). Briefly, all searches were performed with a precursor mass tolerance of 10 ppm, a fragment mass tolerance of 5 ppm, tryptic cleavage, up to one under-cleavage, fixed modifications of cysteine alkylation, and methionine / tryptophan. Variable modifications of fan oxidation, asparagine / glutamine deamidation, phosphorylation, methylation, and amidation were required.
[0214] In the table below, T refers to trypsin and C refers to chymotrypsin. [Table 5-1] [Table 5-2] [Table 5-3]
[0215] In the case of the AAVhu68 capsid protein, four residues (N57, N329, N452, N512) typically exhibit high levels of deamidation, often exceeding 90% across various lots. Additional asparagine residues (N94, N253, N270, N304, N409, N477) and Q599) also exhibit levels of deamidation of approximately 20% or less across various lots. The deamidation level was initially identified using trypsin digestion and confirmed using chymotrypsin digestion.
[0216] Example 2 - AAVhu68 Vector Yield AAVhu68 and AAV9 vectors carrying various tags, such as GFP and LacZ, were generated and evaluated. Gao et al. [Gao, Guang-Ping, et al. "Novel adeno-associated viruses from rhesus monkeys as vectors for human genes"] Each of the vectors was generated using triple transfection in 293 cells as described by [Davidson et al., "Antibody therapy." Proceedings of the National Academy of Sciences 99.18(2002):11854-11859].
[0217] A. Production of pAAVhu68 trans-plasmid The nucleic acid sequence encoding the vp1 capsid protein is shown in SEQ ID NO:1. To evaluate packaging efficiency, yield, and transduction properties, we constructed the pAAV2 / hu68 transfectant plasmid by incorporating the hu68 VP1 gene into the pAAV2 / 9 backbone in place of the AAV9 VP1 gene. The pAAV2 / 9 plasmid contains the AAV2 5' and 3' ITRs flanking the capsid gene and is available from the Penn Vector Core (University of Pennsylvania, Philadelphia, PA, USA; pennvectorcore.med.upenn.edu).
[0218] B. AAVhu68 Vector Yield 293 cells were cultured and maintained in 1X DMEM (Dulbecco's modification of Eagle's minimum essential medium) supplemented with 10% fetal bovine serum and containing 4.5 g / L glucose, L-glutamine, and sodium pyruvate at 37°C in a 5% CO atmosphere. Transfection was performed as described by Gao et al. [Gao, Guang-Ping, et al. "Novel adeno-associated viruses from rhesus monkeys"], replacing the vector plasmid with pAAV2 / hu68 or pAAV2 / 9. The transfection was carried out as described by Gao et al. [Gao, Guangping, et al. "Purification of recombinant adeno-associated virus vectors by column chromatography and its performance in vivo." Human gene therapy 11.15(2000):2079-2091.] using a TaqMan (Applied Chromatography) probe and primers targeting the rabbit beta-globin poly(A) region of the transgene (expression cassette). Total cell lysates and supernatants were harvested for virus quantification by the ELISA (Biosystems) assay. The yields of the six pAAV2 / 9 and six pAAV2 / hu.68 plasmids were directly compared in six-well plates for both supernatant and total lysate titers. Each plasmid was obtained from an individual bacterial colony.
[0219] The yield of AAVhu68 was found to be similar to that of AAV9 in the total lysate (Fig. 3A, n = 6, p = 0.42). However, the yield of AAVhu68 in the supernatant was significantly higher than that of AAV9 (Fig. 3B, n = 6, p = 0.0003). Therefore, AAVhu68 was demonstrated to be a better vector compared to AAV9 from a production standpoint because supernatants were collected during cell stack scale and virus production.
[0220] Example 3 - In vivo transduction of AAVhu68.LacZ AAVhu68.CB7.nLacZ (also referred to as AAVhu68.LacZ) was generated by inserting a sequence encoding nuclear-localized bacterial β-galactosidase (nLacZ) and subsequently produced as described in Example 2. To assess the packaging efficiency, yield, transduction properties, transduction efficiency, and in vivo tropism of AAVhu68, 5 × 10 vectors were injected into mice by various administration methods, e.g., intravenous, intramuscular, and intranasal administration. 11 The mice were injected with a genomic copy of the AAVhu68.LacZ vector. Two weeks after vector administration, the mice were sacrificed, and muscle, lung, liver, and heart were harvested. Frozen sections of each organ were prepared, processed, and analyzed using a conventional protocol to detect LacZ gene expression [Bell, Peter, et al. "An optimized protocol for detection of E. coli β-galactosidase in lung tissue following gene transfer." Histochemistry and Cell Biology 124.1 (2005): 77-85.]. Positive staining for LacZ, shown in blue (Figure 4A-C), indicates successful transduction with AAVhu68.
[0221] As shown in Figure 4A, after vector introduction into mice by intravenous injection (IV), all organs (heart, liver, lungs, and muscle) demonstrated AAVhu68 transduction, with a preference for heart and liver over lung and muscle. After vector introduction into mice by intramuscular injection (IM), the heart, liver, and muscle demonstrated high transduction rates of AAVhu68, while no detectable transduction was observed in the lungs. When intranasal administration was performed, scattered transduction was observed in the heart, liver, muscle, and lungs.
[0222] These results revealed that AAVhu68 demonstrated high transduction efficiency and broad tissue / organ tropism.
[0223] Example 4 - In vivo transduction of AAVhu68.GFP compared to AAV9.GFP AAVhu68.GFP and AAV9.GFP were generated by inserting a gene encoding green fluorescent protein (GFP) into the vector, which was then produced as described in Example 2. To assess the packaging efficiency, yield, transduction properties, transduction efficiency, and in vivo tropism of AAVhu68 and AAV9, 1 × 10 mice were transfected with 1 × 10 10 GC or 1 × 10 11 AAVhu68.GFP or AAV9.GFP was administered at a dose of GC. Two weeks after vector administration, the mice were sacrificed and the brain, muscle, lung, liver, and heart were collected. Wang et al. [Wang L, et al., Hum Gene Ther.2011 Nov;22(11):1389-401, Wang Cryosections of each organ were prepared and processed to visualize GFP expression as described by [L, et al., Mol Ther. 2010 Jan;18(1):126-34]. Positive staining for GFP, shown in green (Figures 5A-C and 6A-D), indicates successful transduction of the tested vectors.
[0224] Sections from various brain regions (hippocampus, motor cortex, and cerebellum) of mice that had received intracerebroventricular injections of the vector were examined. 10 Transduction of AAV vectors was observed in all hippocampal samples tested, except for those from mice injected with AAV9.GFP in the GC. In the motor cortex, transduction of AAVhu68.GFP was observed to be better than that of AAV9. Furthermore, transduction of AAVhu68.GFP in the cerebellum was significantly improved when mice were injected with 1 × 10 11 This was only observed when GCs were injected with the vector. It exhibited higher transduction efficiency and broader tropism in the brain compared to AAV9.
[0225] In further experiments, various organs, such as the liver, kidney, heart, and pancreas, from mice intravenously administered AAVhu68.GFP were prepared and processed as described by Wang et al. [Wang L, Calcedo R, Bell P, Lin J, Grant RL, Siegel DL, Wilson JM, Hum Gene Ther. 2011 Nov;22(11):1389-401; Wang L, Calcedo R, Wang H, Bell P, Grant R, Vandenberghe LH, Sanmiguel J, Morizono H, Batshaw ML, Wilson JM, Mol Ther. 2010 Jan;18(1):126-34]. A positive GFP signal, shown in green, indicates successful transduction of the AAV vector. Brightfield images, shown in black and white, were used for organ morphology, while the corresponding red fluorescent channel served as a negative control.
[0226] A strong positive signal, shown in green, was observed in the liver, but the kidney, heart, and pancreas also showed transduction of the vector, demonstrating the broad tissue / organ tropism of the AAVhu68 vector.
[0227] Example 5 - Yield and in vivo transduction of AAV vectors carrying the A67E and A157V mutations To improve the yield and / or packaging efficiency of recombinant adeno-associated (rAAV) vectors, AAV capsid genes expressing vp1 proteins having Glu at amino acid position 67 and / or Val at amino acid position 157 are engineered into AAV vectors, e.g., AAV9, AAVhu31, and AAVhu32, where the amino acid residue numbering is based on AAVhu68 [SEQ ID NO: 5].
[0228] The AAV vectors described above are produced and the yield is assessed for each vector according to Example 2. The transduction efficiency and tissue / organ / region tropism in vivo are further assessed by conventional methods, such as those described in Example 3.
[0229] Example 6 - Intrathecal AAVhu68.CMV.PI.htrastuzumab.SV40 for the prevention of human HER2+ breast cancer brain metastases [Table 6]
[0230] A. Overview The purpose of this study was to test the therapeutic efficacy of AAVhu68.CMV.PI.htrastuzumab.SV40 (AAVhu68.trastuzumab), a recombinant adeno-associated virus of serotype AAVhu68 containing a trastuzumab expression cassette, for the prevention of human HER2+ breast cancer brain metastases in a xenograft mouse model. Trastuzumab (Herceptin®, Roche) is a humanized monoclonal antibody (mAb) directed against HER2 that extends patient survival when used intravenously with chemotherapy to treat systemic HER2+ disease. However, the blood-brain barrier prevents intravenously administered Herceptin® from entering the central nervous system, preventing it from effectively treating HER2+ breast cancer brain metastases. Several case reports have shown that intrathecally administered Herceptin® can increase survival in patients with HER2+ leptomeningeal disease or halt the progression of HER2+ locally metastatic cancer [JC Bendell, et al., Central nervous system metastases in women who receive trastuzumab-based therapy for metastatic breast carcinoma. Cancer. 97, 2972-2977 (2003); DJ Lamon, et al., Use of Chemotherapy plus a Monoclonal Antibody against HER2 for Metastatic Breast Cancer That Overexpresses HER2.N.Engl.J.Med.344,783-792(2001),MACobleigh,et al,Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease.J.Clin.Oncol.17,2639-2648(1999),Zagouri F,et al,(2013).Intrathecal administration of trastuzumab for the treatment of meningeal carcinomatosis in HER2-positive metastatic breast cancer: a systematic review and pooled analysis.Breast Cancer Res Treat,139(1):13-22.,Bousquet G,et al.(2016).Intrathecal Trastuzumab Halts Progression of CNS Metastases in Breast Cancer. J Clin Oncol. 34(16):e151-155]. However, CSF changes rapidly, potentially compromising the therapeutic efficacy of IT Herceptin® due to highly variable CSF pharmacokinetic profiles. The goal of AAVhu68.trastuzumab treatment is to prevent development, delay growth, improve survival, or increase clinical quality of life measures associated with HER2+ BCBM by providing localized, long-term expression of AAVhu68.trastuzumab in the brain parenchyma itself.
[0231] Four different doses (1.00 × 10 10 , 3.00×10 10 , 1.00×10 11 , and 3.00 x 10 11 AAVhu68.trastuzumab (GC / animal) was administered to 6-9 week old RAG1 mice. - / - Mice were administered intracranial intracerebroventricular injection (ICV). BT474.M1.ffluc cells, derived from a HER2+ human ductal carcinoma cell line, were implanted at least 21 days later. Mice were observed daily and euthanized at the end of the study. Brain tissue was collected at necropsy to measure tumor volume. HER2+ breast cancer brain metastasis RAG1 - / - Prophylactic ICV administration of AAVhu68.CMV.PI.htrastuzumab.SV40 in a xenograft model resulted in significantly reduced tumor volume at all doses tested in this study. It was concluded that: Collectively, these results demonstrated the potential therapeutic efficacy of AAVhu68.trastuzumab in improving survival in patients with HER2+ BCBM.
[0232] B. The purpose of this study is to identify RAG1 in HER2+ BCBM. - / - The aim of this study was to investigate the minimum essential dose (MED) of AAVhu68.trastuzumab for tumor prevention by examining tumor volume in xenograft models. The vectors were AAVhu68.CMV.PI.htrastuzumab.SV40 or AAVhu68.trastuzumab. ddPCR titer: 7.38 x 10 13 GC / ml Endotoxin: Less than 2.0EU / ml Purity: 100% Phosphate-buffered saline (PBS) (no treatment control)
[0233] The ability of AAVhu68.trastuzumab to confer tumor protection was confirmed by the RAG1 - / -The mouse xenograft model was evaluated. The immunodeficient mouse model allows for the growth of human-derived orthotopic tumors in mice without rejection by the mouse immune system. Furthermore, RAG1 - / - Mice have no inherent IgG, allowing trastuzumab to be quantified by protein A ELISA. Table: Research design [Table 7]
[0234] Test articles and negative controls were diluted to the appropriate concentrations in sterile phosphate-buffered saline (PBS). Vectors were administered ICV into the left lateral ventricle.
[0235] Intrathecal AAV delivery can be performed using various routes for CSF access. The ICV route was chosen because it is the least invasive and does not require a surgical procedure in mice (compared to the cisternal route, which requires an incision of the neck skin and muscles). Previously, our laboratory and others have demonstrated that a single injection of AAV9 vectors into the cerebrospinal fluid (ICV or cisterna magna) targets neurons throughout the brain in mice and in larger animals [Dirren at al. (2014). Intracerebroventricular Injection of AAV9 vectors into the cerebrospinal fluid (ICV or cisterna magna)] targets neurons throughout the brain. eno-Associated Virus 6 And 9 Vectors For Cell Type-Specific Transgene Expression In The Spinal Cord. Hum. Gene. Ther 25, 109 - 120, Snyder et al. (2011). Comparison Of Adeno - Associated Viral Vector Serotypes For Spinal Cord And Motor Neuron Gene Delivery. Hum. Gene Ther 22, 1129 - 1135, Bucher et al. (2014). Intracistemal Delivery Of AAV9 Results In Oligodendrocyte And Motor Neuron Transduction In The Whole Central Nervous System Of Cats. Gene Therapy 21, 522 - 528, Hinderer et al. (2014). Intrathecal Gene Therapy Corrects CNS Pathology In A Feline Model Of Mucopolysaccharidosis I. Mol Ther: 22, 2018 - 2027].
[0236] C.RAG1 - / - Tumor cell transplantation in mice To generate a mouse xenograft model of HER2+ BCBM, we employed a human HER2+ ductal cell carcinoma cell line transduced with firefly luciferase (BT474-M1.ffluc). For the injection procedure, mice were anesthetized with ketamine / xylazine. Hair on the scalp and neck was shaved. A time-release 17-β estradiol pellet (1.7 mg, 90-day release, Innovative Research of America) was implanted subcutaneously on the dorsum of the neck and re-administered every 90 days throughout the study. Mice were fixed in a stereotaxic apparatus. The exposed skin was cleaned with povidone-iodine and 70% ethanol. A 1-cm anterior-posterior incision was made at the top of the skull. The bregma was identified. A pneumatic drill was placed at the bregma and then moved 0.8 mm posterior and 2.2 mm left of the bregma to create a burr hole in the skull. A 25 μL Hamilton syringe was loaded with 5 μL of tumor cell suspension (100,000 cells total in 50:50 MatriGel®:PBS). The needle was brought to bregma and moved to the coordinates shown above, then inserted 4.0 mm into the brain parenchyma. The needle was then raised 1.0 mm back along its trajectory to create a hole for tumor cell injection. The needle was held in place for 5 minutes. Next, 5 μL of cell suspension was injected over 10 minutes using a monitored injection device. After the injection was complete, the needle was held in place for 5 minutes and then slowly removed. The incision over the skull was sutured with 4.0 vicryl, and mice were given 15 mg / kg enrofloxacin (Bayer) in sterile PBS along with 0.3 mg / kg buprenorphine in sterile PBS, both subcutaneously.
[0237] Mice were monitored daily. If moribund, they were euthanized by CO2 overdose followed by cervical dislocation. At necropsy, brains were isolated and sectioned coronally along the tumor injection needle track.
[0238] Tumor volume: Measurement of tumor diameter on day 35 was performed using a digital vernier caliper (Thermo-Fisher). Brains were harvested at necropsy. Tumors were isolated from surrounding brain tissue using blunt dissection at the tumor injection needle trajectory. Tumor diameters were then measured in three dimensions (x, y, and z), and tumor volume was calculated as the volume of an ellipse, 4 / 3*π*x / 2*y / 2*z / 2. The right hemisphere, contralateral to vector injection and tumor implantation, was stored in formalin. Dissected tumors were pooled by dose cohort and stored in formalin. GraphPad Tumor volume comparisons were performed using the Mann-Whitney test in Prism7
[0239] D. Results Tumor volume: IT AAVhu68.trastuzumab tumor prophylaxis delays tumor growth To determine whether tumors were associated with a median tumor volume (0.4 mm) in the group receiving the highest dose of AAVhu68.trastuzumab tumor prophylaxis, we measured tumor diameters 35 days after implantation. 3 , n = 10) compared with untreated mice (26.1 mm 3 , n=9). All mice receiving the lower dose of AAVhu68.trastuzumab had significantly smaller tumors than untreated mice. 10 The median tumor volume of mice given GC / mouse was 3.00 × 10 10 The median tumor volume was calculated to be statistically similar to that of mice receiving GC / mouse (p=0.6029). Of note, two mice in group 1, one mouse in group 2, three mice in group 3, and three mice in group 4 had no macroscopically evident tumors at the time of dissection. [Table 8]
[0240] RAG1 in HER2+ BCBM using the HER2+ BT474.M1 human ductal carcinoma cell line - / -When administered prophylactically in a mouse xenograft model, IT administration of AAVhu68.trastuzumab at all doses led to significantly smaller median tumor volumes at D35 after tumor implantation. The AAVhu68.trastuzumab MED measured in this study was 1.00 × 10 10 GC / mouse.
[0241] Example 7 - AAVhu68 Vector Production Yield and Purity To compare the production yield and / or purity of recombinant adeno-associated (rAAV) vectors with different capsids, two different sets of vectors with different capsids were generated and engineered, including AAVhu68, AAV8triple, AAV8, and AAV9.
[0242] Briefly, a set of vectors containing the capsids shown and a vector genome (CMV.ffLuciferase.SV40) containing a cytomegalovirus promoter (CMV), a firefly luciferase coding sequence, and SV40 poly(A) was produced on a small scale, and the yield of each vector was assessed. Results show that the AAV9 vector exhibited the highest yield, followed by the AAVhu68 vector (Figure 8A). The AAV8 and AAV8triple vectors also produced 4 × 10 13 The yield was higher than that of GC (Figure 8A).
[0243] Another set of vectors containing the indicated capsids and a vector genome containing a CMV promoter, intron, immunoadhesin coding sequence (201IgIA), and SV40 polyA (CMV.PI.201IgIA.SV40) were produced on a large scale according to conventional methods, and the yield and purity of each vector were assessed. The results are shown in Figures 8B and 9.
[0244] Similar to the yield of small-scale production, approximately 5.7 x 10 AAV9 vectors were obtained. 14 Highest yield with GC While the AAVhu68 vector showed approximately 3.8 × 10 14 GC came in second (Figure 8B). AAV8 vectors were approximately 3.6 × 1014 The GC yield for AAV8 triplet was approximately 1.8 x 10 14 The GC yields are shown in Figure 8B. The purity of the tested preparations was comparable, ranging from approximately 97.4% to approximately 98.6%.
[0245] Example 8 - rAAV vectors in male RAG KO mice. Gene expression was tested in vivo using rAAV vectors with different capsids, including AAVhu68, AAV8triple, AAV8, and AAV9, expressing the secreted transgene product 201IgIA.
[0246] 3 × 10 sputum was injected into the gastrocnemius muscle of 6-8 week-old male RAG KO mice (n = 5 / group) using a Hamilton syringe. 11 GC / mouse or 3 × 10 10 GC / mice were intramuscularly injected with the test vector. Serum was collected weekly from mice receiving vectors expressing secreted proteins by submandibular bleeding into serum collection tubes. Transgene expression levels in serum were measured by ELISA as described in Greig et al., Intramuscular Injection of AAV8 in Mice and Macaques Is Associated with Substantial Hepatic Targeting and Transgene Expression, PLoS One. 2014 Nov 13;9(1l):e112268. doi:10.1371 / journal.pone.0112268.eCollection 2014.
[0247] As shown in Figures 10A and 10B, after IM injection in mice, the AAVhu68, AAV8, and AAV9 vectors expressed the transgene at similar levels, while the AAV8triple vector expressed it better. 10 GC / mouse), the difference in expression compared to AAV8triple is significant.
[0248] Example 9 - Transgene expression of rAAV vectors in male C57BL / 6J mice. In vivo expression in liver and muscle was tested using rAAV vectors with different capsids, including AAVhu68, AAV8triple, AAV8, and AAV9, which express firefly luciferase (ffLuc) as a transgene.
[0249] Inject 3 × 10 ml of cerebrospinal fluid into the gastrocnemius muscle of 6-8 week-old male C57BL / 6J mice (n = 5 / group) using a Hamilton syringe. 11 GC / mice were intramuscularly injected with the test vector, and ffLuc expression was visualized weekly by whole-body bioluminescence imaging as previously described (Greig et al., PLos One 2014, cited above).
[0250] As shown in Figures 11A and 11B, the AAVhu68, AAV8, and AAV9 vectors were expressed at similar levels in both muscle and liver, while the AAV8triple vector showed reduced expression in liver and increased expression in muscle.
[0251] Example 10 - rAAV vectors in male and female cynomolgus monkeys. Transgene expression in cynomolgus monkeys was tested using rAAV vectors with different capsids, including AAVhu68, AAV8triple, AAV8, and AAV9, expressing the secreted transgene 201IgIA.
[0252] For vector biodistribution studies, male and female cynomolgus monkeys with NAb titers of less than 1:5 to the injected vector at the start of the study were inoculated with 10 mAbs of vector expressing 201IgIA from one of four vector capsids (AAV8triple, AAVhu68, AAV9, or AAV8). 13 GC / kg body weight at a dose of 1 ml per kg body weight (1 0 13The vector was administered intramuscularly into the vastus lateralis of both the left and right legs at a vector concentration of 1000 GC / ml. Blood samples were collected by venipuncture of the femoral vein before and weekly throughout the study. Transgene expression levels in serum were measured by ELISA as previously described (Greig et al., PLos One 2014, cited above).
[0253] As shown in Figure 12, AAVhu68 and AAV8triple are better expressed than AAV9 and AAV8 vectors after IM injection.
[0254] All documents cited herein are incorporated by reference, as are U.S. Provisional Patent Application No. 62 / 614,002, filed January 5, 2018; U.S. Provisional Patent Application No. 62 / 591,001, filed November 27, 2017; and U.S. Provisional Patent Application No. 62 / 464,748, filed February 28, 2017. The Sequence Listing filed herewith, entitled "17-7986 Seq Listing_ST25.txt," and the sequences and text therein, are incorporated by reference. While the present invention has been described with respect to specific embodiments, it will be recognized that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.
[0255] (Sequence listing free text) The following information is a numeric identifier <223> Below is provided for sequences containing free text. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5]
Table 9-6
Table 9-7
Table 9-8
Table 9-9
Table 9-10
Table 9-11
Claims
1. 1. A rAAV production system useful for producing recombinant AAVhu68, comprising: The rAAV production system comprises: (a) a nucleic acid molecule comprising an AAVhu68 capsid nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2; (b) a nucleic acid molecule suitable for packaging into the AAVhu68 capsid, the nucleic acid molecule comprising a 5′ AAV inverted terminal repeat (ITR), a non-AAV nucleic acid sequence operably linked to a sequence encoding a gene product and facilitating expression of the product in a host cell, and a 3′ AAV ITR; and (c) AAV rep and helper functions sufficient to allow packaging of the nucleic acid molecule into recombinant AAVhu68 capsids; comprising in culture an rAAV packaging cell comprising The rAAV production system.
2. (i) the nucleic acid sequence of (a) comprises at least a sequence encoding the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2, which sequence is at least 70% to at least 99% identical to SEQ ID NO:1; and / or (ii) the system further comprises a nucleic acid molecule comprising the nucleic acid sequence from nucleotide 607 to nucleotide 2211 of SEQ ID NO:1 encoding the AAVhu68 vp3 from amino acid 203 to amino acid 736 of SEQ ID NO:2; The system of claim 1 .
3. 3. The system of claim 1 or 2, wherein the cell culture comprises human embryonic kidney 293 cells.
4. The AAV rep is (i) is from AAV2; (ii) AAVhu68rep characterized by the amino acid sequence of SEQ ID NO:4; or (iii) the AAV rep is encoded by the nucleic acid sequence of SEQ ID NO:
3. The system according to any one of claims 1 to 3.
5. 5. The system of any one of claims 1 to 4, wherein the AAV rep coding sequence and cap gene are on the same nucleic acid molecule, and optionally there is a spacer between the rep sequence and the cap gene; and optionally the spacer is atgacttaaaccaggt SEQ ID NO:
9.
6. A cell culture for producing recombinant AAVhu68 outside the human body, the cells comprising: (a) a nucleic acid molecule comprising an AAVhu68 capsid nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2; (b) a nucleic acid molecule suitable for packaging into the AAVhu68 capsid, the nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence operably linked to a sequence encoding a gene product that facilitates expression of the product in a host cell; and (c) AAV rep and helper functions sufficient to allow packaging of the nucleic acid molecule into the recombinant AAVhu68 capsid. The cell culture comprising:
7. 7. The cell culture of claim 6, wherein the nucleic acid sequence of (a) comprises at least a sequence encoding the amino acid sequence of SEQ ID NO:1, or SEQ ID NO:2, which sequence is at least 70% to at least 99% identical to SEQ ID NO:
1.
8. 7. The cell culture of claim 6, wherein the cells further comprise a nucleic acid sequence from nucleotide (nt) 607 to nt 2211 of SEQ ID NO:1 encoding an AAVhu68 vp3 having the amino acid sequence from amino acid 203 to amino acid 736 of SEQ ID NO:
2.
9. 7. The cell culture of claim 6, wherein the cell culture comprises human embryonic kidney 293 cells.
10. The cell culture of claim 7 , wherein the AAV rep are from different AAVs.
11. The cell culture of claim 10, wherein the AAV rep is from AAV2.
12. 7. The cell culture of claim 6, wherein the AAV rep coding sequence and the AAVhu68 capsid coding sequence are on the same nucleic acid molecule, optionally with a spacer between the rep sequence and the cap gene.
13. 13. The cell culture of claim 12, wherein the spacer is atgacttaaaccaggt SEQ ID NO:
9.
14. 7. The cell culture of claim 6, wherein the AAV rep is AAVhu68rep characterized by the amino acid sequence of SEQ ID NO:
4.
15. 15. The cell culture of claim 14, wherein the AAV rep is encoded by the nucleic acid sequence of SEQ ID NO:3.
Citation Information
Patent Citations
Methods of viral neutralizing antibody epitope mapping
WO2015164757A1
Adeno-associated virus vector variants for high efficiency genome editing and methods thereof
WO2016049230A1