Method for preparing immobilized bacteria and its use

The immobilization of a bacterial agent on biochar using Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas putida CICC23685, and Sphingobium sp. RS2 addresses the inefficiencies of existing PAH removal methods, achieving significant PAH reduction and CO2 fixation in soil.

JP7756286B1Active Publication Date: 2025-10-20NANJING AGRICULTURAL UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2025068526
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2025-04-09
Filing Date
2025-04-18
Publication Date
2025-10-20
Estimated Expiration
2045-04-18

AI Technical Summary

Technical Problem

Biological techniques for removing polycyclic aromatic hydrocarbons (PAHs) from soil are ineffective and do not simultaneously fix carbon dioxide, and existing methods are costly and inefficient.

Method used

A method involving the immobilization of a bacterial agent comprising Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas putida CICC23685, Sphingobium sp. RS2, and Acetobacter xylinum on biochar, which is prepared by mixing bacterial suspensions at specific ratios and conditions, followed by immobilization and drying, to create an effective PAH removal and CO2 fixation agent.

Benefits of technology

The immobilized bacterial agent effectively reduces PAH content in soil by up to 80.693% and fixes CO2, enhancing soil organic carbon content while being cost-effective and suitable for widespread application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007756286000009
    Figure 0007756286000009
  • Figure 0007756286000010
    Figure 0007756286000010
  • Figure 0007756286000011
    Figure 0007756286000011
Patent Text Reader

Abstract

The present invention provides a method for preparing and using an immobilized bacterial agent that can relatively effectively reduce the content of PAHs in soil, fix CO2, and increase the soil organic carbon content, and is safe, effective, and has low processing costs. [Solution] The method for preparing an immobilized bacterial agent includes preparing a bacterial liquid of a functional bacterial flora. The functional bacterial flora includes two new bacterial strains, Kocuria sp. BJ05 and Staphylococcus sp. BJ06. The bacterial liquid of the functional bacterial flora is immobilized on biochar to obtain an immobilized bacterial agent.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the technical field of microorganisms, and in particular to a method for preparing an immobilized bacterial agent and its use. . [Background technology]

[0002] Polycyclic Aromatic Hydrocarbo PAHs) are compounds in which two or more benzene rings are arranged in a linear, angular, or cluster configuration. PAHs are a type of organic compound that is mainly derived from incomplete combustion of organic matter. They are widely distributed in the environment and can be transmitted through soil, which can affect human health and ecosystems. vinegar. Microbial techniques are often used in the prior art to remediate soil contaminated with PAHs. For example, free microorganisms can be immobilized on a carrier (e.g., biochar) to obtain an immobilized agent, which can then be applied to soil. Applying immobilized bacteria removes PAHs from the soil. Biological techniques remain ineffective in removing PAHs from soil and are under-removed. During this process, carbon dioxide in the soil cannot be fixed at the same time. Summary of the Invention

[0003] The present invention provides a method for preparing an immobilized bacterial agent, which includes the steps of preparing a bacterial liquid of a functional bacterial flora. The functional flora was Kocuria sp. BJ05, Staphylococcus aureus, and Staphylococcus sp. BJ06, Pseudomonas sp. Pseudomonas putida. CICC23685, Sphingobi Sphingobium sp. RS2 and Acetobacter xylinum ( Acetobacter xylinum ATCC 23767, where Kocuria sp. BJ05 was identified as a Chinese microbial strain on February 27, 2025. It is kept at the General Microbiology Center of the Conservation Management Committee, and its preservation number is CGMCC No. 3367. 4, and Staphylococcus sp. BJ06 It was preserved at the Comprehensive Microbiology Center of the China Microbial Culture Collection on February 27, 2025. The storage number is CGMCC No. 33675. Immobilize the functional bacterial flora on biochar at a ratio of 5-50 mL:1 g to obtain an immobilized bacterial agent. a step of preparing an immobilized bacterial agent. In another aspect of the present invention, the step of preparing a bacterial solution of a functional bacterial flora comprises: Each bacterium in the functional flora was individually activated and cultured until it reached the logarithmic growth phase. The bacterial agents were collected and the OD of each agent was measured in an inorganic salt medium. 600 =1.0, respectively. Kocuria sp. BJ05 bacterial solution, Staphylococcus sp. BJ06 bacterial solution, Pseudomonas Putida CICC23685 fungal solution, Sphingobium RS2 fungal solution and acetonitrile Obtaining a bacterial solution of Bacter xylinum ATCC23767, 0.95~1.05:0.95~1.05:0.95~1.05:0.95~1.05: The volume ratio of Kocuria sp. BJ05 and Staphylococcus sp. BJ06 bacterial solution, Pseudomonas putida CICC23685 bacterial solution, Sphingobiu The bacterial suspension of Acetobacter sp. RS2 and the bacterial suspension of Acetobacter xylinum ATCC23767 were mixed. 2. A step of obtaining a bacterial liquid of functional bacterial flora. In another embodiment of the present invention, the immobilization method is as follows: Mix them in a ratio of 50 mL:1 g to obtain a mixture, and heat the mixture at 20 to 45°C, 140 to 160°C. The culture was cultured at a constant temperature under conditions of 11,000 rpm for 0.5 to 4 days to obtain a culture solution. Centrifuge at 13,000 rpm for 10 to 22 minutes, discard the supernatant, and store at 25 to 30°C. The mixture is then placed in an oven and dried for 6 to 10 hours to obtain the immobilized bacterial agent. The present invention simultaneously removes polycyclic aromatic hydrocarbons from soil and fixes carbon dioxide in the soil. In this regard, the present invention further provides uses of the immobilized bacterial agent prepared by the above-mentioned preparation method. In another embodiment of the present invention, the polycyclic aromatic hydrocarbon is naphthalene, acenaphthylene, acenaphthylene, Fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzoate It consists of one or more of anthracene, hydrazine, and benzopyrene. The preparation method provided by the present invention is a method for producing Kocuria sp. BJ05 and Staphylococcus sp. BJ06 2 The new strains were combined with three other strains to prepare immobilized bacteria. It can reduce the PAH content in the water relatively effectively and fix CO2. It is a safe and effective treatment that can increase the soil organic carbon (SOC) content. The processing costs are low and it is suitable for widespread promotion. [Brief explanation of the drawings]

[0004] [Figure 1] 1 is a schematic diagram of the removal rate of Kocuria sp. BJ05 for 16 types of PAHs. [Figure 2] 1 is a schematic diagram of the removal efficiency of Staphylococcus sp. BJ06 for 16 types of PAHs. [Figure 3]Schematic diagram of the removal rate of Pseudomonas putida CICC23685 against 16 PAHs. [Figure 4] 1 is a schematic diagram of the removal rate of 16 types of PAHs by Sphingobium sp. RS2. [Figure 5] FIG. 1 is a schematic diagram of the removal efficiency of immobilized bacterial agents for different molecular weights and total PAHs with different immobilization times. [Figure 6] This is a schematic diagram of the 13C / 12C atomic percentage (a), SOC content (b), CO2 assimilation amount in SOC (c), and carbon fixation rate (d) in soil treated with immobilized fungi for different immobilization times. [Figure 7] This is a schematic diagram of the removal rates of different molecular weights and total PAHs by immobilized bacteria prepared by mixing bacterial suspensions of different functional bacterial flora and biochar at a fixed ratio. [Figure 8] Figure 1 shows a schematic diagram of the 13C / 12C atomic percentage (a), SOC content (b), CO2 assimilation amount in SOC (c), and carbon fixation rate (d) in soil treated with immobilized fungal agents prepared with different functional fungal flora solution and biochar fixation ratios. [Figure 9] 1 is a schematic diagram of the removal efficiency of immobilized bacterial agents for different molecular weights and total PAHs when the immobilization temperature is changed. [Figure 10] This is a schematic diagram of the 13C / 12C atomic percentage (a), SOC content (b), CO2 assimilation amount in SOC (c), and carbon fixation rate (d) in soil treated with immobilized fungi at different immobilization temperatures. DETAILED DESCRIPTION OF THE INVENTION

[0005] Example 1: This example describes the preparation method of immobilized bacterial agent, including S1 to S3. S1. Preparation of functional bacterial flora solution: Here, the functional flora is Kocuria sp. BJ05, Staphylococcus aureus, Staphylococcus sp. BJ06, Pseudomonas sp. Pseudomonas putida. CICC23685, Sphingobi Sphingobium sp. RS2 and Acetobacter xylinum ( Acetobacter xylinum ATCC23767, The above Kocuria sp. BJ05 and Staphylococcus sp. Staphylococcus sp. BJ06 is a novel bacterium obtained through this application. It is a stock, The above Kocuria sp. BJ05 was acquired by China Microbiology Laboratory on February 27, 2025. It is stored in the Comprehensive Microbiology Center of the Biological Strain Preservation and Management Committee, located in Beichen West, Chaoyang District, Beijing. It is Road No. 1, Court No. 3, and its preservation number is CGMCC No. 33674. The above Staphylococcus sp. BJ06 is 20 It was preserved at the Comprehensive Microbiology Center of the China Microbial Strain Preservation and Management Committee on February 27, 2013. The location is No. 3, Courtyard No. 1, Beichen West Road, Chaoyang District, Beijing, and the storage number is CGMCC No. 3367. 5, The above Pseudomonas putida CICC23685, Sphingobium sp. RS2, and Acetobacter xylinum ATCC23767 is an existing bacterium, and specifically, Monas putida CICC23685 was purchased from the China Center for Industrial Microorganisms. The above Sphingobium RS2 strain was collected from the Comprehensive Microbiology Center of the China Microbial Culture Collection. The above Acetobacter xylinum ATCC23767 was purchased from Beijing Baiou Bowei Biotechnology Co., Ltd. Purchased from Technology Co., Ltd. In addition, the above Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas putida CICC23685 and Sphingobium sp. RS2 were found to be highly polycyclic aromatic hydrocarbons. (Polycyclic Aromatic Hydrocarbons, PAHs) Acetobacter xylinum ATCC23767 is a carbon-fixing bacterium. The PAHs-degrading bacteria are used to remove PAHs from soil, and the carbon Fixing bacteria are used to fix carbon dioxide in the soil, The following is the enrichment culture process of the above Kocuria sp. BJ05 and Staphylococcus sp. BJ06. will be explained in detail. The PAHs concentration in soil from the pollutant outlet of a PAHs-contaminated factory in Nanjing ranged from 89.45 to 178. 0.35 mg kg -1 and pyrene concentrations were 0.95 to 2.32 mg kg -1 ) to three Healthy plant samples (Alopecurus aequalis) alis), Trifolium pratense L .), Conyza canadensis) to select pyrethrum Isolation, screening and characterization of pyrene (a polycyclic aromatic hydrocarbon)-degrading endophytic bacteria Identification work was carried out, The specific process of isolating, screening and identifying the above pyrene-degrading endophytic bacteria is as follows: As stated above, Plant samples were collected using deionized water (18.2 MΩ-cm). After cleaning the surface, add 75% ethanol and 0.1% NaClO solution in succession for 2-3 min. The surface-sterilized and sterilized plant samples were washed thoroughly three times with sterilized water and disinfected. The liquid was removed, and the mixture was placed in a new LB solid medium and cultured at a constant temperature of 30°C for 72 hours. Check that sterilization is complete. 0.5g of surface-sterilized plant sample was weighed into a sterilized mortar and then 10mL of sterilized Add water, crush thoroughly with a grinding pin, and use a sterilized gun tip to suck up 5 mL of the crushed liquid and make 100 mL. Pyrene-containing PAHs degradation medium (hereinafter referred to as PDM) (pyrene concentration 50 mg L -1 ) Inoculate, 30°C, 150 r·min -1 Shaking Incubator The mixture was cultured for 7 days in an incubator (HZ-X100) to obtain a concentrated culture medium. is added to the mineral salt medium (i.e., MSM medium) at 50 mg L -1 By adding pyrene The above PDM is obtained, Alternatively, the recipe for the mineral salts medium is as follows: potassium dihydrogen phosphate 0.8 g·L -1 , dipotassium hydrogen phosphate 0.2g L -1 , ammonium sulfate 1.0 g L -1 , magnesium sulfate 0.2 g L -1 , calcium chloride 0.01g L -1 , sodium chloride 0.1g L -1 , Trace element solution: 1mL L -1 The recipe for the trace element solution is as follows: is: ferrous sulfate 0.5g L -1 , zinc sulfate 0.4g L -1 , manganese sulfate 0.02 g·L -1 , copper sulfate 0.01g·L -1 , boric acid 0.01g·L -1 , sodium molybdate 0.01g L -1 The mineral salts medium may be prepared according to other recipes. is not limited to, 5 mL of concentrated culture was taken and re-introduced into PDM, and the concentrated culture was continued for four cycles, followed by gradient dilution and Using the plate coating method, functional endophytic bacteria (Tametal) with pyrene degradation properties were identified. ., 2002) were isolated and screened, and the diluted solution was plated onto a pyrene-containing solid PDM plate. The cells were then heated and incubated in an incubator (GNP-9050BS-III, C) at a constant temperature of 30°C. The cells were placed in an IMO (implanted membrane organotyping machine) and cultured for 3 to 7 days, and functional endogenous colonies with pyrene degradation properties were screened. Repeat the purification to obtain single colonies by cleaning the solid PDM plates above. Prepared using 1.6 to 1.8 g of agar and 100 mL of the above PDM. The specific steps for performing 16S rRNA sequence homology analysis of single colonies are as follows: and Single colony genomes were isolated using a DNA extraction kit (Axygen Company, USA). DNA was obtained and amplified by PCR. The forward primer for the PCR amplification was 16S rDNA-27F, and the reverse primer was The primer was 16S rDNA-1492R (Invitrogen, Shanghai, China) (Byers et al., 1998), where the above 16S r The nucleotide sequence of DNA-27F is SEQ ID NO:1 (5'-AGAGTTTGA TCCTGGCTCAG-3') and the nucleotide sequence of the above 16S rDNA-1492R The peptide sequence is shown in SEQ ID NO:2 (5'-TACCTTGTTACGACTT-3'). is shown, PCR reaction system (25 μL) for the above PCR amplification: Premix 12.5 μL, template 1 μL of ribosomal DNA, 0.5 μL each of primers 16S-27F and 16S-1492R, 10.5 μL of double distilled water, The amplification procedure for the PCR amplification was as follows: (a) pre-denaturation: 94°C, 4 min; (b) ) Denaturation: 94°C, 30s, (c) Annealing: 55°C, 30s, (d) Extension: 72°C, (e) Repeat steps (b), (c), and (d) 30 times. (f) Ultimate extension: 7 2℃, 10min, (g) Heat retention: 10℃, 10min, The PCR amplification products were confirmed by agarose gel electrophoresis and then purified by Nanjing GenScript The 16S rRNA gene sequence was determined by Biotechnology Co., Ltd. and submitted to NCBI Bla The GenBank database (http: / / blast.nc Compare sequencing results via Blast (bi.nlm.nih.gov / Blast.cgi) Analysis was performed using Clustalx 1.83 and MEGA 5.05 software. A phylogenetic tree was constructed using the above and strain species information was obtained. Kocuria sp. BJ 05 and Staphylococcus sp. BJ06 and named it, The following are Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas puta Degradation ability of Sphingobium sp. CICC23685 and Sphingobium sp. RS2 against PAHs Verify the Specifically, experiments have shown that the above-mentioned Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas putida CICC23685 and Sphingobium sp. RS2 11 The decomposition ability of the above 11 PAHs was verified, and naphthalene (NAP ), acenaphthylene (ANA), acenaphthene (ANY), fluorene (FLU), phenanthene Nanthrene (PHE), anthracene (ANT), fluoranthene (FLT), pyrene ( PYR), benzo(a)anthracene (BaA), hydrazine (CHR) and BaP-benzyl It is benzo(a)pyrene(BbF), Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas putida C ICC23685 and Sphingobium sp. RS2. The test process is as follows: The concentration of each of the 11 PAHs was adjusted to 3 mg / L. Add 1 mL of the above bacterial solution (OD of the bacterial solution) to 19 mL of PDM. 600nm is 1 On the fifth day, 20 mL of methanol was added to the PDM and sonicated for 1 hour. The solution was filtered through a 2 μm organic filter membrane and then analyzed by high performance liquid chromatography (hereinafter referred to as H The concentration of 11 types of PAHs was measured using a PLC (abbreviated as PLC), and the removal rate of PAHs was calculated. The formula for calculating the removal rate of the PAHs is as follows: RE=(PC0-PC1) / PC0 where RE is the removal rate of PAHs, and PC0 is the concentration of PAHs in the soil on day 0. PC1 is the concentration of PAHs in the soil after treatment with immobilized bacteria, The final experimental results are shown in Table 1. Table 1: Removal rates of PAHs by PAH-degrading bacteria As can be seen from Table 1, the above Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas putida CICC23685 and Sphingobium sp. RS2 were It has good decomposition effect against all 11 types of PAHs. Based on this, in the examples of the present application, the Kocuria sp. BJ05, Staphylococcus sp. BJ06, Pseudomonas putida CICC23685, and The degradation effect of Sphingobium sp. RS2 on 16 kinds of PAHs was measured. AHs are NAP-naphthalene, ANA-acenaphthene, ANY-acenaphthylene, FLU- Fluorene, PHE-phenanthrene, ANT-anthracene, FLT-fluoranthene, PYR-pyrene, BaA-benzo(a)anthracene, CHR-hydrazine, BbF-benzo( b) Fluoranthene, BkF-benzo(k)fluoranthene, BaP-benzo(a)pyrene, D BA-dibenz(ah)anthracene, BPE-benzo(ghi)perylene and IPY-yne deno(1,2,3-cd)pyrene, The above experimental results are shown in Figures 1 to 4. Figure 1 shows the 16 P species of Kocuria sp. BJ05. Figure 2 shows the removal rate of 16 species of Staphylococcus sp. BJ06. Figure 3 shows the removal rate of Pseudomonas putida CICC2. 3685 for 16 PAHs, and Fig. 4 shows the removal rate of Sphingobium sp. 1 to 4 show the removal rates of 16 types of PAHs by the bacterium RS2. In addition, Pseudomonas putida CICC23685, Sphingobium sp. RS2, Kocuria sp. BJ05 and Staphylococcus sp. BJ06 were found to be highly resistant to the above 16 PAHs. In contrast, both have good decomposition effects, In this example, the preparation of the bacterial solution of the functional bacterial flora includes S11 to S12: S11: Each bacterium in the functional flora is individually activated until it reaches the logarithmic growth phase. The bacterial agent of each bacterium was collected and the OD of the agent of each bacterium was measured using an inorganic salt medium. 600 =1 0.0, and the bacterial solution of Kocuria sp. BJ05 and Staphylococcus sp. BJ06 Bacterial solution of Pseudomonas putida CICC23685, Bacterial solution of Sphingobium sp. R A bacterial solution of S2 and a bacterial solution of Acetobacter xylinum ATCC23767 were obtained. Here, the above OD 600= 1.0 means that the bacterial solution of each bacterium in the functional flora is This means that the optical density at In this example, the process of individually activating and culturing each bacterium in the functional bacterial flora is as follows: Step 1: Kocuria sp. BJ05, Staphylococcus sp. BJ06, and Scheuer sp. BJ07 Domonas putida CICC23685 and Sphingobium sp. RS2 were grown in LB medium. Acetobacter xylinum ATCC23767 was cultured in acetic acid medium. Each bacterium was then cultured for 12 hours at 30°C with constant temperature shaking at 150 rpm. The mixture was centrifuged at 8000 rpm for 5 minutes at 4°C, and the supernatant was discarded. The recipe for the LB medium is as follows: tryptone 10.0 g L -1 , yeast powder 5 0.0g·L -1 , NaCl 10.0 g L -1 , the pH value of LB medium is 7.0, The recipe for the acetic acid bacteria medium is as follows: polypeptone 5.0 g L -1 , yeast extract 5.0g·L -1 , glucose 5.0 g L -1 , mannitol 5.0 g L -1 , Mg SO4 7H2O 1.0g L -1 , ethanol 5.0 mL L -1 , this acetic acid bacteria medium pH is 6.6 to 7.0, Step 2: Resuspend the bacterial agent in mineral salt medium and then rotate at 8000 rpm. The bacterial preparations were centrifuged for 5 minutes. Step 3: Repeat step 2. Resuspend each bacterial preparation in mineral salts medium and vortex. The OD of the resulting bacterial suspension was measured. 600 Adjust the value to 1.0, and add the bacterial solution of each bacteria. That is, the bacterial solution of Kocuria sp. BJ05, the bacterial solution of Staphylococcus sp. BJ06, Domonas putida CICC23685 bacterial suspension, Sphingobium sp. RS2 bacterial suspension and and Acetobacter xylinum ATCC23767 bacterial suspension was obtained. S12, Kocuria sp. BJ05 bacterial solution, Staphylococcus aureus, according to a volume ratio of 1:1:1:1:1 Bacterial suspension of Lococcus sp. BJ06, Bacterial suspension of Pseudomonas putida CICC23685, Sphingobium sp. RS2 bacterial suspension and Acetobacter xylinum ATCC23767 The bacterial liquids are mixed to obtain a bacterial liquid of functional bacterial flora, and the bacterial liquid is prepared under a temperature condition of 4°C. S2, Biochar preparation: In this example, the plant material used to prepare biochar was corn stover, as described above in S2 The specific process is as follows: Corn stalks were washed and placed in an oven at 105°C for 30 minutes. After drying, the powder is crushed in a crusher. The corn stover was heated at a rate of 5°C / min under a nitrogen atmosphere until it reached 800°C (i.e., After the pyrolysis temperature reached 800°C, the mixture was burned at a constant temperature for 2 hours, cooled, and then crushed to a temperature of 60°C. The carbonaceous material was obtained by passing it through a mesh sieve, and the obtained carbonaceous material was washed with a 0.1% HCl solution to obtain tar. After removing the ash and other impurities, the mixture is washed several times with ultrapure water and finally dried to obtain biochar. The biochar used in the present application may be commercially available biochar. It should be understood that the source of biochar is not limited. S3: Immobilized bacterial solution of functional bacterial flora on biochar at a ratio of 5-50 mL:1 g. Get: The biochar was weighed and placed in a conical flask. After sterilization, it was cooled to room temperature and the functional flora was analyzed. The liquid and biochar were mixed in a ratio of 10 mL:1 g to obtain a mixture, and the mixture was then shaken at a constant temperature. The sample was placed in an incubator and heated at 30°C (i.e., a fixed temperature of 30°C) and 150 rpm for 1 minute. After culturing for 1 day (i.e., fixation time is 1 day), the cells were removed and transferred to a centrifuge tube. Centrifuge at 100 rpm for 20 minutes, discard the supernatant, and place in an oven at an internal temperature of 28°C. The mixture is then placed in a container and dried for 8 hours to obtain the immobilized bacterial agent. Alternatively, the ambient temperature of the mixture in a constant temperature shaking incubator is 20°C or It may be at 45°C and the shaking speed may be 140 rpm or 160 rpm. The rotation speed of the culture medium may be 11,000 rpm or 13,000 rpm. The drying time may be 10 minutes or 22 minutes. The drying temperature may be 25°C or 30°C. ℃, and the drying time may be 6 hours or 10 hours. It is sufficient to set it as described above, and it is not limited to this in the embodiment of the present application. Example 2: This example differs from Example 1 in the following respects: In S2, the thermal decomposition temperature is 400 °C. Example 3: This example differs from Example 1 in the following respects: In S2, the thermal decomposition temperature is 600 °C. Example 4: This example differs from Example 1 in the following respects: In S3, the fixed time is 0.5 days. It is between. Example 5: This example differs from Example 1 in the following respects: In S3, the fixation time was 2 days. be. Example 6: This example differs from Example 1 in the following respects: In S3, the fixation time was 3 days. be. Example 7: This example differs from Example 1 in the following respects: In S3, the fixation time was 4 days. be. Example 8: This example differs from Example 1 in the following respects: in S3, the bacterial liquid of the functional bacterial flora The ratio of biochar was 5ml:1g. Example 9: This example differs from Example 1 in the following respects: In S3, the functional bacterial flora The ratio of biochar was 20ml:1g. Example 10: This example differs from Example 1 in the following respects: In S3, the bacterial liquid of the functional bacterial flora and biochar in a ratio of 30ml:1g. Example 11: This example differs from Example 1 in the following respects: In S3, the bacterial liquid of the functional bacterial flora and biochar in a ratio of 40ml:1g. Example 12: This example differs from Example 1 in the following respects: In S3, the bacterial liquid of the functional bacterial flora The ratio of biochar to water was 50ml:1g. Example 13: This example differs from Example 1 in the following respects: In S3, the fixed temperature is 20°C. is. Example 14: This example differs from Example 1 in the following respects: In S3, the fixed temperature is 25°C. is. Example 15: This example differs from Example 1 in the following respects: In S3, the fixed temperature is 35°C. is. Example 16: This example differs from Example 1 in the following respects: In S3, the fixed temperature is 40°C. is. Example 17: This example differs from Example 1 in the following respects: In S3, the fixed temperature is 45°C. is. Example 18: This example differs from Example 1 in the following respects: in S2, the plant material is wheat straw; is. Example 19: This example differs from Example 1 in the following respects: in S2, the plant material is rice straw; is. Example 20: This example differs from Example 1 in the following respects: In S12, the volume ratio is 0.9 The ratio is 5:1.05:1.05:1.05:1.05. Example 21: This example differs from Example 1 in the following respects: In S12, the volume ratio is 1.0 The ratio is 5:0.95:0.95:0.95:0.95. Example 22: This example shows the use of immobilized bacteria to remove polycyclic aromatic hydrocarbons from soil. and fixation of carbon dioxide in soil simultaneously, using the preparation method provided by Example 1. The present invention provides uses of the immobilized bacterial agent prepared by the above method. In this example, the immobilized bacterial agent was applied as follows: the immobilized bacterial agent was applied to the soil (polycyclic aromatic The immobilized bacteria agent was added to the soil (soil contaminated with aromatic hydrocarbons) at a mass ratio of 0.95%:1. The soil is mixed with the fertilizer to remove polycyclic aromatic hydrocarbons and carbon dioxide (CO) from the soil. Here, the polycyclic aromatic hydrocarbons (hereinafter referred to as PAHs) are fixed. Phthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene , fluoranthene, pyrene, benzanthracene, hydrazine and benzopyrene do. After 20 days of mixing the immobilized bacteria with the soil, the residual concentration of PAHs in the soil was measured. By calculating the removal rate, the ability of the immobilized bacteria to remove PAHs in soil was evaluated. , δ in soil 13 C value and soil organic carbon (SO C) content was measured, 13 C / 12 C atomic percentage, CO2 assimilation amount in SOC and The CO2 fixation capacity of the experimental subjects is evaluated by calculating the carbon fixation rate. The measurement results of PAHs removal and CO2 fixation in soil by the above immobilized bacteria are as follows: Shown in Table 2. Table 2: Measurement results of PAH removal in soil by immobilized bacteria and CO2 fixation in soil TIFF0007756286000002.tif52137 As can be seen from Table 2, the immobilized bacteria prepared by the preparation method provided in Example 1 The total removal rate of PAHs was 80.693% on the 20th day. This indicates that CO2 assimilation in SOC can better remove PAHs in soil. The amount reached 48.751 mg / Kg, and the carbon fixation rate reached 2.438 mg / (Kg·d). This indicates that the immobilized bacteria agent is also effective in fixing CO2 in the soil. Therefore, the immobilized bacteria agent can simultaneously remove PAHs from soil and fix CO2 in the soil. It turns out that it is possible. Specifically, the specific process for measuring the residual concentration of PAHs in the soil is as follows: Step 1: Dry the soil, crush it, mix it evenly, and add n-hexane and dichloromethane. Mix 2g of silica gel and 2g of sodium sulfate anhydride in a 1:1 ratio to obtain a mixed solution. Weigh out sodium and place it on a chromatography column. Step 2: Activate the column twice with the mixture and add 2 g of soil to 10 mL of the mixture. , obtain a measurement sample, Step 3: The sample is vortexed and ultrasonically extracted for 30 minutes, then the measurement is performed. The sample was centrifuged at 2000 rpm for 5 minutes, and then the sample was The supernatant was collected and poured into the column, and subsequently used as the measurement sample. Step 4: Repeat step 3 twice. Step 5: Add 10 mL of the mixture to the chromatography column to elute the sample. The extract was completely evaporated using a rotary evaporator, and then 2 mL of methanol was added. The eluate was filtered through a 2 μm organic filter membrane and separated into 11 types by HPLC. The concentration of PAHs is measured to obtain the residual PAH concentration. For the calculation formula of the removal rate of the PAHs, please refer to the corresponding description in Example 1. 13 The C value and SOC content were measured by isotope ratio mass spectrometry and elemental analysis. The measurement methods of the isotope ratio mass spectrometer and elemental analyzer are generally used in the art. Since this belongs to the technical means used, it will not be repeated in this embodiment. Specifically, δ in the soil 13 After measuring the C value and SOC content, the microbial C in the above SOC was The formula for calculating the amount of O2 assimilation is as follows: TIFF0007756286000003.tif9136 where, 13 CC soc is the amount of microbial CO2 assimilation in SOC, in mg kg -1 , SOC is the organic carbon content, measured in g kg -1 , AT%(labeled) is the post-processing in soil 13 C / 12 C atomic percentage, and AT% (unlabeled) is the untreated Not in soil 13 C / 12 C atomic percentage. The formula for calculating the carbon fixation rate is as follows: CFR=( 13 C-C soc ) / T where CFR is the carbon fixation rate, T is the culture time in days, e.g., 2 It's day 0. Example 23: This example differs from Example 21 in the following respects: the mass ratio of immobilized bacteria to soil is 1. %:1. Example 24: This example differs from Example 21 in the following respects: the mass ratio of immobilized bacteria to soil is 1. The ratio is .05%:1. Example 25: This example differs from Example 21 in the following respects: the PAHs is pyrene. Example 26: This example differs from Example 21 in the following respects: PAHs were naphthalene and pyrene. It consists of: Example 27: This example differs from Example 21 in the following respects: PAHs are acenaphthylene, acenaphthylene, Cenaphthene, fluorene, phenanthrene, anthracene, fluoranthene and pyrene It consists of: Experimental Example 1: This experimental example was prepared by the preparation method provided by Examples 1 to 3. The soil immobilized bacteria were prepared based on the biochar-based bacteria, and the pyrolysis temperature was changed. The effects of soil on PAH removal and CO2 fixation were investigated. Four experimental groups were set up, and the experimental subject of the first experimental group was the immobilized bacterial agent prepared in Example 1. The experimental subject of the second experimental group was the immobilized bacterial agent prepared in Example 2, and the experimental subject of the third experimental group was the immobilized bacterial agent prepared in Example 2. The experiment subject of the fourth experiment group was the immobilized bacterial agent prepared in Example 3, and the experiment subject of the fourth experiment group was S1 in Example 1. This is a bacterial solution of functional bacterial flora (i.e., free bacterial flora) prepared in the above manner. For each experimental group, the experimental equipment consisted of a serum bottle (100 mL capacity) containing 10 g of soil (farm soil). ) and the soil contained 11 types of PAHs, each with a concentration of 3 mg / kg. There are 11 types of PAHs: naphthalene, acenaphthylene, acenaphthene, fluorene, Phenanthrene, anthracene, fluoranthene, pyrene, benzanthracene, hydra These are benzopyrene and benzopyrene. Furthermore, in the serum bottle 13 The CO2 content is 5%. Specifically, 9% of the CO2 in the serum bottle After 0% was consumed, the top of the serum bottle was filled with pressurized synthetic air (20% O2, 80% N2) for 1 min. Wash and maintain aerobic conditions. 13 CO2 was added. In the experiment, sterilized water was added to the soil in the serum bottle until the soil moisture content reached 60%. Then, 0.1 g of the test substance was added to the soil. The serum bottle was then incubated at 28°C. Inside 13 The gas in the serum bottle was renewed every 5 days to maintain a CO2 content of 5%. The soil in the serum bottle was collected and freeze-dried, and the dried soil was stored at -20°C. Finally, by measuring the residual concentration of PAHs in the soil and calculating the removal rate of PAHs, The removal capacity of PAHs in the soil under test was evaluated, and the δ 13 C value and SOC content Measure 13 C / 12 Calculate the C atomic percentage, CO2 assimilation amount in SOC, and carbon fixation rate The CO2 fixation capacity of the experimental subjects was evaluated by this method. For each treatment in the above experiment, three replicate experiments were set up, and three replicates were performed. The average of the experimental results was used as the final result for each treatment. A method for measuring the residual concentration of PAHs in the soil and calculating the removal rate of PAHs. 13 C / 1 2 The method for calculating the C atomic percentage, the amount of CO2 assimilated in SOC, and the carbon fixation rate was the same as in Example 21. The relevant description can be referred to, and will not be repeated in this experimental example. The experimental results of the above four sets of experiments are shown in Table 5 below. Table 5: Comparison of PAH removal and CO2 fixation effects in four experimental groups TIFF0007756286000004.tif104145 As can be seen from Table 5, the total removal rate of PAHs was 800 ℃), the second experimental group (thermal decomposition temperature 400℃) and the third experimental group (thermal decomposition temperature 600℃) The total PAH removal rates of each group were higher than those of the fourth experimental group (free bacterial flora). 13 C / 12 Considering the C atomic percentage, SOC content, CO2 assimilation amount in SOC, and carbon fixation rate comprehensively, The CO2 fixation in the first, second and third experimental groups was also superior to that in the fourth experimental group. The PAHs removal and CO2 fixation effects of the first, second, and third experimental groups were compared. As can be seen, the effect of the immobilized bacteria agent in the first experimental group is the best. As shown in the figure, when the thermal decomposition temperature is 800°C in the preparation process of the immobilized bacteria, The preferred pyrolysis temperature is 800°C, as this is the optimum temperature for PAH removal and CO2 fixation. be. Experimental Example 2: This experimental example is based on Examples 1, 4, 5, 6 and 7. Based on the biochar-based fungicide prepared by the preparation method provided in the The effects of the immobilized bacteria prepared from the soil on PAH removal and CO2 fixation were investigated. . Five experimental groups were set up, and the experimental subject of the first experimental group was the immobilized bacterial agent prepared in Example 1. The experimental subject of the second experimental group was the immobilized bacterial agent prepared in Example 4, and the experimental subject of the third experimental group was the immobilized bacterial agent prepared in Example 4. The experimental subject of the fourth experimental group was the immobilized bacterial agent prepared in Example 5, and the experimental subject of the fourth experimental group was the immobilized bacterial agent prepared in Example 6. The experimental subject of the fifth experimental group was the immobilized bacterial agent prepared in Example 7. . The above experimental process and the measurement methods required for PAHs removal and CO2 fixation effect are the same as those in Experimental Example 1 above. , and will not be repeated in this experimental example. The experimental results of the above five sets of experiments are shown in Figures 5 and 6. As can be seen from Figure 5, In terms of Hs removal rate, the experimental data for the third experiment (fixation time 2 days) showed that low, medium and high molecular weight The amount and total PAHs removal rate were significantly higher than those of other fixation times. As can be seen from Figure 6 , SOC content, CO2 assimilation amount in SOC, and carbon fixation rate at different fixation times. Overall, the carbon fixation effect of the third experiment group (fixation time: 2 days) was the most significant. As can be seen from the figure, in the preparation process of the immobilized bacteria, when the immobilization time is 2 days, the immobilized bacteria Two days is the preferred fixation time because it optimizes the PAH removal and CO2 fixation effects of the fungicide. . Specifically, low, medium and high molecular weight PAHs are low molecular weight PAHs among 11 types of PAHs, This refers to the medium molecular weight PAHs in the 11 types of PAHs and the high molecular weight PAHs in the 11 types of PAHs. Among the 11 types of PAHs, the low molecular weight PAHs are naphthalene, acenaphthylene, and acenaphthylene. Among the 11 PAHs, phenanthrene, fluorene, phenanthrene, and anthracene The medium molecular weight PAHs are fluoranthene, pyrene, benzanthracene, and hydrazine. Among the 11 types of PAHs, the highest molecular weight PAH is benzopyrene. Experimental Example 3: This experimental example is a comparison of Example 1, Example 8, Example 9, Example 10, Example 11, and Based on the biochar-based fungicide prepared by the preparation method provided in Example 12, The P content of the immobilized bacteria in the soil was measured by changing the immobilization ratio of the bacterial suspension of the potential bacterial flora and biochar. The effects on AHs removal and CO2 fixation were investigated. Six experimental groups were set up, and the experimental subject of the first experimental group was the immobilized bacterial agent prepared in Example 1. The experimental subject of the second experimental group was the immobilized bacterial agent prepared in Example 8, and the experimental subject of the third experimental group was the immobilized bacterial agent prepared in Example 8. The experimental subject of the fourth experimental group was the immobilized bacterial agent prepared in Example 9, and the experimental subject of the fourth experimental group was the immobilized bacterial agent prepared in Example 10. The experimental subject of the fifth experimental group was the immobilized bacterial agent prepared in Example 11. The sixth experimental group was the immobilized bacterial agent prepared in Example 12. The above experimental process and the measurement methods required for PAHs removal and CO2 fixation effect are the same as those in Experimental Example 1 above. , and will not be repeated in this experimental example. The experimental results of the above six sets of experiments are shown in Figures 7 and 8. As can be seen from Figure 7, In terms of Hs removal rate, the fixed ratio of functional bacterial flora solution to biochar was 20 mL:1 g (third When the amount of PAHs added was 100 mg / kg, the removal rate of low, medium and high molecular weight PAHs and total PAHs was more effective than other addition amounts. As can be seen from Figure 8, the SOC content, the amount of CO2 assimilated in the SOC, and the carbon Looking at the overall immobilization rate, the immobilization ratio of functional bacterial flora to biochar was 20 mL:1 g. (corresponding to the third experimental group), the carbon fixation ability is most prominent. In the process of preparing the immobilized bacteria, the immobilization ratio of the functional bacterial flora solution to biochar was 20 mL. :1g, the PAHs removal and CO2 fixation effects of the immobilized bacteria are optimal, so 20 mL:1g is the fixed ratio of the preferred functional flora solution to biochar. Experimental Example 4: This experimental example is similar to Example 1, Example 13, Example 14, Example 15, Example 16, and and Example 17. The effects of the immobilized bacteria on the removal of PAHs and CO2 fixation in soil were investigated at different temperatures. The effect on was investigated. Six experimental groups were set up, and the experimental subject of the first experimental group was the immobilized bacterial agent prepared in Example 1. The second experimental group was the immobilized bacterial agent prepared in Example 13, and the third experimental group was The subject of the experiment was the immobilized bacterial agent prepared in Example 14, and the subject of the experiment in the fourth experiment was the immobilized bacterial agent prepared in Example 15. The immobilized bacteria prepared in Example 16 were used as the experimental subject in the fifth experimental group. The experimental subject of the sixth experimental group was the immobilized bacterial agent prepared in Example 17. The above experimental process and the measurement methods required for PAHs removal and CO2 fixation effect are the same as those in Experimental Example 1 above. , and will not be repeated in this experimental example. The experimental results of the above six sets of experiments are shown in Figures 9 and 10. As can be seen from Figure 9, P In terms of AHs removal rate, when the fixed temperature was 35°C (corresponding to the fourth experimental group), Both molecular weight and total PAHs removal rates were significantly higher than those of other fixed temperatures. As can be seen, when SOC content, CO2 assimilation amount in SOC, and carbon fixation rate are considered comprehensively, From this, it can be seen that the effect of carbon fixation capacity is most significant when the fixation temperature is 35°C. As shown above, when the immobilization temperature is 35°C during the preparation process of the immobilized bacterial agent, 35°C is the preferred fixation temperature because it provides optimal PAHs removal and CO2 fixation effects. [Copy of receipt of deposit of microorganism] JPEG0007756286000005.jpg182129JPEG0007756286000006.jpg182129JPEG0007756286000007.jpg182129JPEG0007756286000008.jpg182129

[0006] [Sequence table] <st26sequencelisting dtdversion="V1_3" filename="固定化菌剤の調製方法およびその 用途.xml" softwarename="WIPO Sequence" softwareversion="2.3.0" productiondate="2 025-04-17"> <applicationidentification> <ipofficecode> JP< / ipofficecode> <applicationnumbertext / > <filingdate / > < / applicationidentification> <applicantfilereference> 210095< / applicantfilereference> <earliestpriorityapplicationidentification> <ipofficecode> CN< / ipofficecode> <applicationnumbertext> 202510436686.7< / applicationnumbertext> <filingdate> 2025-04-09< / filingdate> < / earliestpriorityapplicationidentification> <applicantname languagecode="ja"> Nanjing Agricultural University< / applicantname> <applicantnamelatin> Nanjing Agricultural University< / applicantnamelatin> <inventiontitle languagecode="ja">Method for preparing immobilized bacteria and its use < / InventionT itle> <sequencetotalquantity> 2< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q2"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> agagtttgatcctggctcag< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq> <INSDSeq_length>16< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..16< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q4"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>taccttgttacgactt< / INSDSeq_sequence> < / insdseq> < / sequencedata> < / inventiontitle> < / st26sequencelisting>

[0007]

Claims

1. preparing a bacterial solution of a functional bacterial flora; The functional bacterial flora includes Kocuria sp. BJ05, Staphylococcus aureus, Staphylococcus sp. BJ06, Pseudomonas putii Pseudomonas putida. CICC23685, Sphingobium Sphingobium sp. RS2 and Acetobacter xylinum (Ac etobacter xylinum. ATCC 23767, wherein Kocuria sp. BJ05 was acquired by the Chinese Microbial Strain It is kept at the General Microbiology Center of the Conservation Management Committee, and its storage number is CGMCC No. 3367. 4, and the Staphylococcus sp. BJ 06 was preserved at the Comprehensive Microbiology Center of the China Microbial Strain Preservation and Management Committee on February 27, 2025. The storage number is CGMCC No. 33675. The bacterial solution of the functional bacterial flora was immobilized on biochar at a ratio of 5 to 50 mL:1 g to form an immobilized bacterial agent. obtaining A method for preparing an immobilized bacterial agent, comprising:

2. The step of preparing a bacterial liquid of the functional bacterial flora includes: Each bacterium in the functional flora is individually cultured until it reaches the logarithmic growth phase. After activation culture, the agent for each bacterium was collected and the OD of the agent for each bacterium was measured in an inorganic salt medium. 600 =1. 0, and the bacterial solution of Kocuria sp. BJ05 and Staphylococcus sp. BJ06 were Bacterial solution, Pseudomonas putida CICC23685 bacterial solution, Sphingobium sp. RS Obtaining a bacterial suspension of No. 2 and a bacterial suspension of Acetobacter xylinum ATCC 23767; 0.95~1.05:0.95~1.05:0.95~1.05:0.95~1.05 : The bacterial solution of the Kocuria sp. BJ05, Staphylococcus aureus, Bacterial solution of Pseudomonas putida BJ06, bacterial solution of Pseudomonas putida CICC23685, Gobium RS2 fungal solution and Acetobacter xylinum ATCC23767 fungal solution and mixing to obtain a bacterial solution of the functional bacterial flora; 2. The method of claim 1 .

3. The fixing method includes: The bacterial solution of the functional bacterial flora and the biochar were mixed in a ratio of 5 to 50 mL:1 g to obtain a mixture. The mixture is heated at a constant temperature of 20 to 45°C and 140 to 160 rpm for 0.5 to 4 days. The culture medium is then cultured for 10-20 minutes at a rotation speed of 11,000-13,000 rpm. Centrifuge for 2 minutes, discard the supernatant, and place in an oven at 25-30°C to dry for 6-10 hours.

2. The method according to claim 1, wherein the objective is to obtain an immobilized bacterial agent.

Citation Information

Patent Citations

  • Immobilized microbial inoculum of polycyclic aromatic hydrocarbon degrading strain and preparation method of immobilized microbial inoculum

    CN115491372A

  • Microbial agent for intensively degrading polycyclic aromatic hydrocarbon in soil as well as preparation method and application of microbial agent

    CN117126780A

  • Method for cleaning contaminated soil

    JP2003320366A

  • Migration accelerator of hydrophobic organic pollutant used for clarifying polluted soil by planting plant, and method for clarifying polluted soil using the accelerator

    JP2010213646A

  • Method for decomposing polycyclic aromatic hydrocarbons using a complex decomposition bacterial consortium

    JP7620786B1