Materials and methods for protein production

Mutating the AOX1 promoter in Pichia pastoris cells to enhance expression levels in the absence of methanol addresses the limitations of existing methods, enabling safer and more efficient protein production.

JP7762567B2Active Publication Date: 2025-10-30IMPOSSIBLE FOODS INC
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
JP2021561699
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-17
Filing Date
2020-04-17
Publication Date
2025-10-30
Estimated Expiration
2040-04-17

AI Technical Summary

Technical Problem

Existing methods for recombinant protein production in Pichia pastoris cells, such as those using the AOX1 promoter, require the use of methanol, which is toxic and flammable, and expression levels are low in the absence of this inducer.

Method used

Introduction of specific mutations in the AOX1 promoter, such as at nucleotide positions 668-734, including T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A, to enhance expression levels in the absence of methanol.

Benefits of technology

The mutated AOX1 promoter allows for high-level expression of recombinant proteins in Pichia pastoris cells without the need for methanol, improving safety and efficiency in protein production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007762567000003
    Figure 0007762567000003
  • Figure 0007762567000004
    Figure 0007762567000004
  • Figure 0007762567000005
    Figure 0007762567000005
Patent Text Reader

Abstract

This document relates to materials and methods for protein production. In one aspect, this document provides a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 835,338, filed April 17, 2019, which is incorporated herein by reference in its entirety.

[0002] Description of electronically submitted text files The contents of a copy of the Sequence Listing in computer-readable format, as a text file submitted electronically herewith, with the file name 38767-0193WO1_SequenceListing.txt, with a file date of April 17, 2020, and a file size of approximately 53 kilobytes, are incorporated herein by reference in their entirety.

[0003] Technical Field The present disclosure relates generally to DNA constructs and methods of using such DNA constructs to genetically engineer cells, such as yeast cells or Pichia pastoris cells. [Background technology]

[0004] Recombinant expression of a product is a common method for producing said product. In some cases, proteins can be produced by recombinant production. Provided herein are constructs that can be used to efficiently express one or more products (e.g., proteins) in cells, such as yeast cells or Pichia pastoris cells. Summary of the Invention

[0005] This document is based, at least in part, on the identification of point mutations in the AOX1 promoter that can confer increased expression of linked coding sequences. The mutant AOX1 promoters described herein can be used for efficient expression of operably linked coding sequences, for example, in Pichia.

[0006] In one aspect of the present specification, there is provided a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28.

[0007] Implementations may have one or more of the following features: The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28. The first alcohol oxidase promoter element can comprise four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element can comprise five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO: 28.

[0008]

[0013] In another aspect herein, there is provided a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element may comprise one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28.

[0009] Implementations may include one or more of the following features: The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.The first alcohol oxidase promoter element may comprise two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.

[0010]

[0013] In another aspect herein, there is provided a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element may comprise one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28.

[0011] Implementations may include one or more of the following features: The first alcohol oxidase promoter element may include two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise one or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.The first alcohol oxidase promoter element may comprise two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.

[0012] Implementations of any of the nucleic acid constructs described herein may have one or more of the following features. The first alcohol oxidase promoter element may be an alcohol oxidase 1 promoter element. The first alcohol oxidase promoter element may have at least 90% sequence identity to SEQ ID NO:28. The first alcohol oxidase promoter element may have at least 95% sequence identity to SEQ ID NO:28. The nucleic acid construct may further comprise a nucleotide sequence encoding a first protein, wherein the nucleotide sequence encoding the first protein is operably linked to the first alcohol oxidase promoter element. The first protein may be exogenous to the Pichia pastoris cell. The first protein may be heterologous to the Pichia pastoris cell. The first protein may be selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, a cytokine inhibitor, and a heme-binding protein. The first protein may be a heme-binding protein. The heme-binding protein may be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein may be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein may be non-symbiotic hemoglobin. The heme-binding protein may be leghemoglobin. The heme-binding protein may comprise an amino acid sequence having at least 90% sequence identity to any of the amino acid sequences of SEQ ID NOs: 1-27. The first alcohol oxidase promoter element may comprise a recognition sequence for a transcription factor.

[0013] Also provided in another aspect herein is a Pichia pastoris cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is any nucleic acid construct described herein.

[0014] Implementations may have one or more of the following features: The Pichia yeast cell may be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. The Pichia yeast cell may be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The Pichia yeast cell may be a Pichia pastoris cell. The Pichia yeast cell may further comprise a second nucleic acid construct comprising a nucleotide sequence encoding a second protein, wherein the nucleotide sequence encoding the second protein is operably linked to the first alcohol oxidase promoter element or to a second promoter element. The nucleotide sequence encoding a second protein can be operably linked to a second promoter element having the same sequence as the first alcohol oxidase promoter element. The second protein can be a transcription factor. The nucleotide sequence encoding the second protein can be operably linked to a second promoter element, which can include a recognition sequence for the transcription factor. The first alcohol oxidase promoter element can include a recognition sequence for the transcription factor. The second protein can be a protein involved in heme biosynthesis. The protein involved in heme biosynthesis may be selected from the group consisting of aminolevulinic acid synthase (ALAS), δ-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coprotoporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and ferrochelatase (FC).

[0015]

[0013] In another aspect herein, there is provided a method of making a protein in a Pichia pastoris cell, the method comprising: expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28.

[0016] Implementations may include one or more of the following features: The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28. The first alcohol oxidase promoter element can comprise four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element can comprise five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO: 28.

[0017] Also provided herein in another aspect is a method of making a protein in a Pichia pastoris cell, the method comprising: expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862, relative to SEQ ID NO:28.

[0018] Implementations may include one or more of the following features: The first alcohol oxidase promoter element may include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.The first alcohol oxidase promoter element may comprise two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.

[0019]

[0013] In another aspect herein, there is provided a method of making a protein in a Pichia pastoris cell, the method comprising: expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A, relative to SEQ ID NO:28.

[0020] Implementations may include one or more of the following features: The first alcohol oxidase promoter element may include two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. The first alcohol oxidase promoter element may comprise five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.The first alcohol oxidase promoter element may comprise three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. The first alcohol oxidase promoter element may comprise mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.

[0021] Implementations of any of the methods described herein may have one or more of the following features. The first alcohol oxidase promoter element may be an alcohol oxidase 1 promoter element. The first alcohol oxidase promoter element may have at least 90% sequence identity to SEQ ID NO:28. The first alcohol oxidase promoter element may have at least 95% sequence identity to SEQ ID NO:28. The first protein may be exogenous to the Pichia pastoris cell. The first protein may be heterologous to the Pichia pastoris cell. The first protein may be selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, and a heme-binding protein. The first protein may be a heme-binding protein. The heme-binding protein may be selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase. The heme-binding protein may be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein may be non-symbiotic hemoglobin. The heme-binding protein may be leghemoglobin. The heme-binding protein may comprise an amino acid sequence having at least 90% sequence identity to any of the amino acid sequences of SEQ ID NOs: 1-27. The first alcohol oxidase promoter element may contain one or more recognition sequences for transcription factors. The method may further include expressing a second nucleic acid construct comprising a nucleotide sequence encoding a second protein, wherein the nucleotide sequence encoding the second protein is operably linked to the first alcohol oxidase promoter element or to a second promoter element.The nucleotide sequence encoding a second protein can be operably linked to a second promoter element having the same sequence as the first alcohol oxidase promoter element. The second protein can be a transcription factor. The nucleotide sequence encoding the second protein can be operably linked to a second promoter element, which can include a recognition sequence for the transcription factor. The first alcohol oxidase promoter element can include a recognition sequence for the transcription factor. The second protein can be a protein involved in heme biosynthesis. The protein involved in heme biosynthesis can be selected from the group consisting of ALAS, ALAD, PBGD, UPG3S, UPG3D, COPROX, PROTOX, and FC. The method can be performed in the absence of added methanol.

[0022]

[0010] Another aspect of the present disclosure provides a Pichia pastoris cell comprising a nucleic acid construct comprising a nucleotide sequence encoding a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. In some embodiments, the one or more mutations may be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.

[0023] Also provided in another aspect herein is a method of making leghemoglobin, the method comprising expressing a nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. In some embodiments, the method can be performed in the absence of added methanol. In some embodiments, the one or more mutations may be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO:28.

[0024]

[0010] In another aspect herein, there is provided a Pichia pastoris cell comprising a first nucleic acid construct comprising a nucleotide sequence with at least 90% sequence identity to SEQ ID NO:28, wherein the first nucleic acid construct comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. In some embodiments, the one or more mutations may be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO:28.

[0025] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. In the practice of the present invention, methods and materials similar to or equivalent to those described herein may be used, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0026] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. In the claims, the word "comprising" may be replaced with "consisting essentially of" or "consisting of," in accordance with standard practice in patent law. [Brief explanation of the drawings]

[0027] [Figure 1-1] FIG. 1 provides sequences of exemplary heme-binding proteins (SEQ ID NOs: 1-27). [Figure 1-2] This is a continuation of Figure 1-1. [Figure 1-3] This is a continuation of Figure 1-1. [Figure 1-4] This is a continuation of Figure 1-1. [Figure 1-5] This is a continuation of Figure 1-1. [Figure 1-6] This is a continuation of Figure 1-1. [Figure 1-7] This is a continuation of Figure 1-1. [Figure 1-8] This is a continuation of Figure 1-1. [Figure 1-9] This is a continuation of Figure 1-1. [Figure 1-10] This is a continuation of Figure 1-1. [Figure 1-11]This is a continuation of Figure 1-1. [Figure 1-12] This is a continuation of Figure 1-1. [Figure 1-13] This is a continuation of Figure 1-1. [Figure 1-14] This is a continuation of Figure 1-1. [Figure 1-15] This is a continuation of Figure 1-1. [Figure 1-16] This is a continuation of Figure 1-1. [Figure 1-17] This is a continuation of Figure 1-1. [Figure 1-18] This is a continuation of Figure 1-1. [Figure 1-19] This is a continuation of Figure 1-1. [Figure 1-20] This is a continuation of Figure 1-1. [Figure 1-21] This is a continuation of Figure 1-1. [Figure 2] FIG. 1 presents the wild-type and mutant sequences of pAOX1 (SEQ ID NOs: 28-29). [Figure 3] 1 is an image showing the growth of pMx0414 transformants on YPD medium. [Figure 4] 1 is a graph plotting the relative expression of GFP in strains MxY0270 and MxY0279 under different growth conditions. [Figure 5] Comparison of portions of the sequences of MxG0038 and MxG0220. [Figure 6] 1 is a graph plotting the relative expression of GFP in strains MxY0964, MxY965, and MxY1039. [Figure 7] FIG. 1 presents the sequences of SEQ ID NOs: 30 to 37. DETAILED DESCRIPTION OF THE INVENTION

[0028] This document relates to materials and methods for protein production. For example, in one aspect, this document relates to materials and methods for making a product (e.g., a protein (e.g., a plant protein)) in a cell (e.g., a yeast (e.g., Pichia pastoris)) using an engineered promoter.

[0029] Methylotrophic yeasts such as Pichia pastoris are commonly used to produce recombinant products (e.g., proteins). Pichia strains are typically capable of growth on methanol as the sole carbon source. The term "Pichia pastoris" is still used and may refer to any suitable Komagataella species, although it will be understood that Pichia pastoris has been reclassified as a Komagataella species, such as Komagataella phaffii, Komagataella pastoris, or Komagataella pseudopastoris. Laboratory strains of P. pastoris are generally Komagataella phaffii.

[0030] Methanol utilization can be induced by the conversion of methanol to formaldehyde through the action of alcohol oxidase. P. pastoris contains two genes for alcohol oxidase, AOX1 and AOX2. Strains with reduced alcohol oxidase activity ("slow methanol utilization" or MutS strains) can typically produce more recombinant products (e.g., proteins) expressed from the AOX1 promoter than strains without reduced alcohol oxidase activity. The Pichia pastoris promoter for the alcohol oxidase 1 (AOX1) gene, designated pAOX1, can be used for the production of heterologous products (e.g., proteins, e.g., proteins of industrial interest). Expression from this promoter can be induced in the presence of methanol, a flammable and toxic compound. In some embodiments, the materials and methods described herein may allow for high-level expression of a recombinant product (e.g., a protein) from this promoter, or promoter elements derived therefrom, in the absence of methanol. In some embodiments, the materials and methods described herein may allow for high-level expression of a recombinant product (e.g., a protein) from this promoter, or promoter elements derived therefrom, in the absence of added methanol.

[0031] Expression from pAOX1 is typically absent or very poor in the presence of a non-inducing carbon source, such as glucose or glycerol. Described herein are mutations in pAOX1 that allow significant expression from pAOX1 in the absence of methanol. Described herein are mutations in pAOX1 that allow significant expression from pAOX1 in the absence of added methanol. A reference pAOX1 sequence is provided in SEQ ID NO: 28 (FIG. 2). Exemplary mutations in pAOX1 described herein are provided in SEQ ID NO: 29 (FIG. 2). These mutations may be present individually or in any combination. These mutations may also result in further increased expression from pAOX1 when methanol is present.

[0032] Thus, provided herein are nucleic acid constructs (sometimes also referred to as nucleic acid molecules) comprising a promoter element having a sequence that includes one or more mutations compared to a reference promoter sequence. In some embodiments, the promoter element can be an alcohol oxidase promoter element. In some embodiments, the promoter element can have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity to an alcohol oxidase promoter element (e.g., SEQ ID NO:28 or SEQ ID NO:29). In some embodiments, the promoter element can have the sequence of SEQ ID NO:29. In some embodiments, a single mutation can be present in the promoter element. For example, in some embodiments, a single mutation can be present in the promoter element corresponding to a mutation at one of nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO:28. For example, in some embodiments, a single mutation corresponding to one of the following mutations relative to SEQ ID NO: 28 may be present within the promoter element: T146C; C154T; T303C; T426A; A433T; A435G; T530A; C572T; T596C; T617C; T688C; A696T; T702C; A709G; A712G; T714G; A790G; A841T; or T862A. For example, in some embodiments, a single mutation corresponding to one of the following mutations relative to SEQ ID NO: 28: 146C; 154T; 303C; 426A; 433T; 435G; 530A; 572T; 596C; 617C; 688C; 696T; 702C; 709G; 712G; 714G; 790G; 841T; or 862A may be present in the promoter element, so long as the indicated nucleobase is not the same as the corresponding naturally occurring nucleobase.For example, in some embodiments, a single mutation may be present in a promoter element at a position corresponding to one of the following positions relative to SEQ ID NO: 28: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862. For example, in some embodiments, a single mutation may be present in a promoter element at a position corresponding to one of the following positions relative to SEQ ID NO: 28: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862. For example, in some embodiments, a single mutation corresponding to one of the following mutations relative to SEQ ID NO:28 may be present within a promoter element: T688C; A696T; T702C; A712G; or T714G. For example, in some embodiments, a single mutation corresponding to one of the following mutations relative to SEQ ID NO:28: 688C; 696T; 702C; 712G; or 714G may be present within a promoter element, so long as the indicated nucleobase is not the same as the corresponding naturally occurring nucleobase. For example, in some embodiments, a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO:28: T688; A696; T702; A712; or T714 may be present within a promoter element. For example, in some embodiments, a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO:28: 688; 696; 702; 712; or 714 may be present within a promoter element.

[0033] Also provided herein are nucleic acid constructs comprising promoter elements having sequences that include multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) mutations relative to a reference promoter sequence. For example, in some embodiments, there can be at least two (e.g., at least three, at least four, at least five, at least 10, at least 15, 2-5, 2-10, 2-15, 2-20, 5-10, 5-15, 5-20, 10-15, 10-20, or 15-20) mutations in the promoter element corresponding to mutations at nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO:28. For example, in some embodiments, at least two (e.g., at least three, at least four, at least five, at least six, at least seven, at least eight, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations corresponding to the following mutations relative to SEQ ID NO: 28 may be present in the promoter element: T146C; C154T; T303C; T426A; A433T; A435G; T530A; C572T; T596C; T617C; T688C; A696T; T702C; A709G; A712G; T714G; A790G; A841T; or T862A.For example, in some embodiments, at least two (e.g., at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least twelve, at least four, at least six, at least eight, at least eighteen, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) of the following mutations relative to SEQ ID NO: 28 may be present in the promoter element, so long as the indicated nucleobases are not the same as the corresponding naturally occurring nucleobases. For example, in some embodiments, at least two (e.g., at least three, at least four, at least five, at least six, at least seven, at least eight, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862) may be present within the promoter element. For example, in some embodiments, at least two (e.g., at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least twelve, at least four, at least six, at least eighteen, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862 (e.g., at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least twelve, at least fourteen, at least sixteen, at least eighteen, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) may be present in the promoter element.For example, in some embodiments, at least two (e.g., at least three, at least four, two, three, four, or five) mutations corresponding to the following mutations relative to SEQ ID NO: 28 may be present in a promoter element: T688C; A696T; T702C; A712G; or T714G. For example, in some embodiments, at least two (e.g., at least three, at least four, two, three, four, or five) mutations corresponding to the following mutations relative to SEQ ID NO: 28 may be present in a promoter element, so long as the indicated nucleobases are not the same as the corresponding naturally occurring nucleobases. For example, in some embodiments, there may be at least two (e.g., at least three, at least four, two, three, four, or five) mutations in a promoter element that correspond to one of the following positions relative to SEQ ID NO: 28: T688; A696; T702; A712; or T714. For example, in some embodiments, there may be at least two (e.g., at least three, at least four, two, three, four, or five) mutations in a promoter element that correspond to one of the following positions relative to SEQ ID NO: 28: 688; 696; 702; 712; or 714.

[0034] In some embodiments, the mutation in the nucleic acid may be an insertion, deletion, or substitution. In some embodiments, the mutation in the nucleic acid may be a substitution (e.g., a guanosine to cytosine mutation). In some embodiments, the mutation in the nucleic acid may be a mutation in a non-coding sequence. In some embodiments, the substitution in a coding sequence (e.g., encoding a protein) may be a silent mutation (e.g., the same amino acid is encoded). In some embodiments, the substitution in the coding sequence may be a non-synonymous mutation (e.g., a missense or nonsense mutation). In some embodiments, the substitution in the coding sequence may be a missense mutation (e.g., a different amino acid is encoded). In some embodiments, the substitution in the coding sequence may be a nonsense mutation (e.g., a premature stop codon is encoded). It will be understood that mutations may be used to alter endogenous nucleic acids, for example, using CRISPR, TALEN, and / or zinc finger nucleases.

[0035] In some embodiments, the mutation in the protein sequence may be an insertion, deletion, or substitution. It will be understood that a mutation in the nucleic acid encoding the protein may cause a mutation in the protein sequence. In some embodiments, the mutation in the protein sequence is a substitution (e.g., a cysteine ​​to serine mutation, or a cysteine ​​to alanine mutation).

[0036] As used herein, a "corresponding" nucleic acid position (or substitution) within a nucleic acid sequence that differs from a reference nucleic acid sequence (e.g., a nucleic acid sequence of a pAOX1 promoter that is truncated, extended, or mutated compared to a reference pAOX nucleic acid sequence such as SEQ ID NO: 28) can be identified by performing a sequence alignment between the nucleic acid sequences of interest. It will be understood that, in some cases, gaps may exist in the nucleic acid alignment. Similarly, a "corresponding" amino acid position (or substitution) within a protein sequence that differs from a reference protein sequence (e.g., a myoglobin protein sequence of a different organism compared to a reference myoglobin protein sequence such as SEQ ID NO: 18) can be identified by performing a sequence alignment between the protein sequences of interest. It will be understood that, in some cases, gaps may exist in the protein alignment. As used herein, a nucleotide position or amino acid position "compared to" a reference sequence can be the corresponding nucleotide position or amino acid position within the reference sequence.

[0037] In some embodiments, the reference sequence may be from the same taxonomic rank as the comparison sequence. In some embodiments, the reference sequence may be from the same domain as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the domain Eukarya. In some embodiments, the reference sequence may be from the same kingdom as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the kingdom Fungi. In some embodiments, the reference sequence may be from the same phylum as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the phylum Ascomycota. In some embodiments, the reference sequence may be from the same class as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the class Saccharomycetes. In some embodiments, the reference sequence may be from the same order as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the order Saccharomycetales. In some embodiments, the reference sequence may be from the same family as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the family Saccharomycetaceae. In some embodiments, the reference sequence may be from the same genus as the comparison sequence. For example, in some embodiments, both the reference sequence and the comparison sequence may be from the genus Pichia. In some embodiments, the reference sequence may be from the same species as the comparison sequence.

[0038] In some embodiments, both the reference sequence and the comparison sequence may be derived from yeast. In some embodiments, both the reference sequence and the comparison sequence may be derived from Pichia pastoris.

[0039] In some embodiments, the reference sequence and comparison sequence may have at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 99%) sequence identity.

[0040] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following mutations are present relative to SEQ ID NO: 28: T146C and C154T; T146C and T303C; T146C and T426A; T146C and A433T; T146C and A435G; T146C and T530A; T146C and C572T; T146C and T596C; T146C and T617C; T146C and T688C; T146C and A696T; T146C and T702C; T146C and A709G; T146C and A712G; T146C and T714G; T146C and A790G; T146C and A841T; T146C and T862A; C154T and T303C; C154T and T426A; C154T and A433T; C154T and A435G; C154T and T530A; C154T and C572T; C154T and T596C; C154T and T617C; C154T and T688C; C154T and A696T; C154T and T702C; C154T and A709G; C154T and A712G;C154T and T714G;C154T and A790G;C154T and A841T;C154T and T862A;T303C and T426A;T303C and A433T;T303C and A435G;T303C and T530A;T303C and C572T;T303C and T596C;T303C and T617C;T303C and T688C;T303C and A696T;T303C and T702C;T303C and A709G;T303C and A 712G;T303C and T714G;T303C and A790G;T303C and A841T;T303C and T862A;T426A and A433T;T426A and A435G;T426A and T530A;T426A and C572T;T426A and T596C;T426A and T617C;T426A and T688C;T426A and A696T;T426A and T702C;T426A and A709G;T426A and A712G;T426A and T714G;T426A and A790G; T426A and A841T; T426A and T862A; A433T and A435G; A433T and T530A; A433T and C572T; A433T and T596C; A433T and T617C; A433T and T688C; A433T and A696T; A433T and T702C; A433T and A709G; A433T and A712G; A433T and T714G; A433T and A790G; A433T and A841T; A433T and T862A; A435G and T5 30A;A435G and C572T;A435G and T596C;A435G and T617C;A435G and T688C;A435G and A696T;A435G and T702C;A435G and A709G;A435G and A712G;A435G and T714G;A435G and A790G;A435G and A841T;A435G and T862A;T530A and C572T;T530A and T596C;T530A and T617C;T530A and T688C;T530A and A696T;T530A and and T702C;T530A and A709G;T530A and A712G;T530A and T714G;T530A and A790G;T530A and A841T;T530A and T862A;C572T and T596C;C572T and T617C;C572T and T688C;C572T and A696T;C572T and T702C;C572T and A709G;C572T and A712G;C572T and T714G;C572T and A790G;C572T and A841T;C572T and T862A;T59 6C and T617C;T596C and T688C;T596C and A696T;T596C and T702C;T596C and A709G;T596C and A712G;T596C and T714G;T596C and A790G;T596C and A841T;T596C and T862A;T617C and T688C;T617C and A696T;T617C and T702C;T617C and A709G;T617C and A712G;T617C and T714G;T617C and A790G;T617C and A841T;T617C and T862A;T688C and A696T;T688C and T702C;T688C and A709G;T688C and A712G;T688C and T714G;T688C and A790G;T688C and A841T;T688C and T862A;A696T and T702C;A696T and A709G;A696T and A712G;A696T and T714G;A696T and A790G;A696T and A841T;A696T and T862A;T702C and A709G;T702C and A712G;T702C and T714G;T702C and A Two mutations corresponding to: A709G and A712G; A709G and T714G; A709G and A790G; A709G and A841T; A709G and T862A; A712G and T714G; A712G and A790G; A712G and A841T; A712G and T862A; T714G and A790G; T714G and A841T; T714G and T862A; A790G and A841T; A790G and T862A; or A841T and T862A may be present in the promoter sequence.

[0041] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following mutations are present relative to SEQ ID NO: 28: T146C, C154T, and T303C; T146C, C154T, and T426A; T146C, C154T, and A433T; T146C, C154T, and A435G; T146C, C154T, and T530A; T146C, C154T, and C572T; T146C, C154T, and T596C; T146C, C154T, and T617C; T146C, C154T, and T688C; T146C, C154T, and T688C. 154T, and A696T;T146C, C154T, and T702C;T146C, C154T, and A709G;T146C, C154T, and A712G;T146C, C154T, and T714G;T146C, C154T, and A790G;T146C, C154T, and A841T;T146C, C154T, and T862A;T146C, T303C, and T426A;T146C, T303C, and A433T;T146C, T303C, and A435G;T146C , T303C, and T530A;T146C, T303C, and C572T;T146C, T303C, and T596C;T146C, T303C, and T617C;T146C, T303C, and T688C;T146C, T303C, and A696T;T146C, T303C, and T702C;T146C, T303C, and A709G;T146C, T303C, and A712G;T146C, T303C, and T714G;T146C, T303C, and A790G;T1 46C, T303C, and A841T;T146C, T303C, and T862A;T146C, T426A, and A433T;T146C, T426A, and A435G;T146C, T426A, and T530A;T146C, T426A, and C572T;T146C, T426A, and T596C;T146C, T426A, and T617C;T146C, T426A, and T688C;T146C, T426A, and A696T;T146C, T426A, and T702C;T146C, T426A, and A709G;T146C, T426A, and A712G;T146C, T426A, and T714G;T146C, T426A, and A790G;T146C, T426A, and A841T;T146C, T426A, and T862A;T146C, A433T, and A435G;T146C, A433T, and T530A;T146C, A433T, and C572T;T146C, A433T, and T596C;T146C, A433T, and T617C;T146C, A433T, and T688C; T146C, A433T, and A696T; T146C, A433T, and T702C; T146C, A433T, and A709G; T146C, A433T, and A712G; T146C, A433T, and T714G; T146C, A433T, and A790G; T146C, A433T, and A841T; T146C, A433T, and T862A; T146C, A435G, and T530A; T146C, A435G, and C572T; T146C, A435G, and T596C; T146C, A435 G, and T617C;T146C, A435G, and T688C;T146C, A435G, and A696T;T146C, A435G, and T702C;T146C, A435G, and A709G;T146C, A435G, and A712G;T146C, A435G, and T714G;T146C, A435G, and A790G;T146C, A435G, and A841T;T146C, A435G, and T862A;T146C, T530A, and C572T;T146C, T530A, and T596C;T146C , T530A, and T617C;T146C, T530A, and T688C;T146C, T530A, and A696T;T146C, T530A, and T702C;T146C, T530A, and A709G;T146C, T530A, and A712G;T146C, T530A, and T714G;T146C, T530A, and A790G;T146C, T530A, and A841T;T146C, T530A, and T862A;T146C, C572T, and T596C;T146C, C572T, and T617C;T146C, C572T, and T688C;T146C, C572T, and A696T;T146C, C572T, and T702C;T146C, C572T, and A709G;T146C, C572T, and A712G;T146C, C572T, and T714G;T146C, C572T, and A790G;T146C, C572T, and A841T;T146C, C572T, and T862A;T146C, T596C, and T617C;T146C, T596C, and T688C;T146C, T596C, and A696T;T146C, T596C, and T702C;T146C, T596C, and A709G;T146C, T596C, and A712G;T146C, T596C, and T714G;T146C, T596C, and A790G;T146C, T596C, and A841T;T146C, T596C, and T862A;T146C, T617C, and T688C;T146C, T617C, and A696T;T146C, T617C, and T702C;T146C, T617C, and A709G;T146C, T617 C, and A712G;T146C, T617C, and T714G;T146C, T617C, and A790G;T146C, T617C, and A841T;T146C, T617C, and T862A;T146C, T688C, and A696T;T146C, T688C, and T702C;T146C, T688C, and A709G;T146C, T688C, and A712G;T146C, T688C, and T714G;T146C, T688C, and A790G;T146C, T688C, and A841T;T146C , T688C, and T862A;T146C, A696T, and T702C;T146C, A696T, and A709G;T146C, A696T, and A712G;T146C, A696T, and T714G;T146C, A696T, and A790G;T146C, A696T, and A841T;T146C, A696T, and T862A;T146C, T702C, and A709G;T146C, T702C, and A712G;T146C, T702C, and T714G;T146C, T702C, and A790G;T146C, T702C, and A841T;T146C, T702C, and T862A;T146C, A709G, and A712G;T146C, A709G, and T714G;T146C, A709G, and A790G;T146C, A709G, and A841T;T146C, A709G, and T862A;T146C, A712G, and T714G;T146C, A712G, and A790G;T146C, A712G, and A841T;T146C, A712G, and T862A;T146C, T714G, and A790G;T146C, T714G, and A841T;T146C, T714G, and T862A;T146C, A790G, and A841T;T146C, A790G, and T862A;T146C, A841T, and T862A;C154T, T303C, and T426A;C154T, T303C, and A433T;C154T, T303C, and A435G;C154T, T303C, and T530A;C154T, T303C, and C572T;C154T, T303C, and T596C;C154T, T303 C, and T617C;C154T, T303C, and T688C;C154T, T303C, and A696T;C154T, T303C, and T702C;C154T, T303C, and A709G;C154T, T303C, and A712G;C154T, T303C, and T714G;C154T, T303C, and A790G;C154T, T303C, and A841T;C154T, T303C, and T862A;C154T, T426A, and A433T;C154T, T426A, and A435G;C154T , T426A, and T530A;C154T, T426A, and C572T;C154T, T426A, and T596C;C154T, T426A, and T617C;C154T, T426A, and T688C;C154T, T426A, and A696T;C154T, T426A, and T702C;C154T, T426A, and A709G;C154T, T426A, and A712G;C154T, T426A, and T714G;C154T, T426A, and A790G;C154T, T426A, and A841T;C154T, T426A, and T862A; C154T, A433T, and A435G; C154T, A433T, and T530A; C154T, A433T, and C572T; C154T, A433T, and T596C; C154T, A433T, and T617C; C154T, A433T, and T688C; C154T, A433T, and A696T; C154T, A433T, and T702C; C154T, A433T, and A709G; C154T, A433T, and A712G; C154T, A433T, and T714G; C154T, A433T, and A790G; C154T, A433T, and A841T; C154T, A433T, and T862A; C154T, A435G, and T530A; C154T, A435G, and C572T; C154T, A435G, and T596C; C154T, A435G, and T617C; C154T, A435G, and T688C; C154T, A435G, and A696T; C154T, A435G, and T702C; C154T, A435G, and A709G; C154T, A435 G, and A712G; C154T, A435G, and T714G; C154T, A435G, and A790G; C154T, A435G, and A841T; C154T, A435G, and T862A; C154T, T530A, and C572T; C154T, T530A, and T596C; C154T, T530A, and T617C; C154T, T530A, and T688C; C154T, T530A, and A696T; C154T, T530A, and T702C; C154T, T530A, and A709G; C154T , T530A, and A712G;C154T, T530A, and T714G;C154T, T530A, and A790G;C154T, T530A, and A841T;C154T, T530A, and T862A;C154T, C572T, and T596C;C154T, C572T, and T617C;C154T, C572T, and T688C;C154T, C572T, and A696T;C154T, C572T, and T702C;C154T, C572T, and A709G;C154T, C572T, and A712G;C154T, C572T, and T714G;C154T, C572T, and A790G;C154T, C572T, and A841T;C154T, C572T, and T862A;C154T, T596C, and T617C;C154T, T596C, and T688C;C154T, T596C, and A696T;C154T, T596C, and T702C;C154T; T596C, and A709G; C154T, T596C, and A712G; C154T, T596C, and T714G; C154T, T596C, and A790G; C154T, T596C, and A841T; C154T, T596C, and T862A; C154T, T617C, and T688C; C154T, T617C, and A696T; C154T, T617C, and T702C; C154T, T617C, and A709G; C154T, T617C, and A712G; C154T, T617C, and T714G ;C154T, T617C, and A790G;C154T, T617C, and A841T;C154T, T617C, and T862A;C154T, T688C, and A696T;C154T, T688C, and T702C;C154T, T688C, and A709G;C154T, T688C, and A712G;C154T, T688C, and T714G;C154T, T688C, and A790G;C154T, T688C, and A841T;C154T, T688C, and T862A;C154T, A696T, and and T702C; C154T, A696T, and A709G; C154T, A696T, and A712G; C154T, A696T, and T714G; C154T, A696T, and A790G; C154T, A696T, and A841T; C154T, A696T, and T862A; C154T, T702C, and A709G; C154T, T702C, and A712G; C154T, T702C, and T714G; C154T, T702C, and A790G; C154T, T702C, and A841T; C154T, T702C, and T862A;C154T, A709G, and A712G;C154T, A709G, and T714G;C154T, A709G, and A790G;C154T, A709G, and A841T;C154T, A709G, and T862A;C154T, A712G, and T714G;C154T, A712G, and A790G;C154T, A712G, and A841T;C154T, A712G, and T862A;C154T, T714G, and A790G;C154T, T714G, and A841T;C154T, T714G, and T862A;C154T, A790G, and A841T;C154T, A790G, and T862A;C154T, A841T, and T862A;T303C, T426A, and A433T;T303C, T426A, and A435G;T303C, T426A, and T530A;T303C, T426A, and C572T;T303C, T426A, and T596C;T303C, T426A, and T617C;T303C, T426A, and T688C;T303C, T426A, and A696T;T303C, T426A, and T702C;T303C, T426A, and A709G;T303C, T426A, and A712G;T303C, T426A, and T714G;T303C, T426A, and A790G;T303C, T426A, and A841T;T303C, T426A, and T862A;T303C, A433T, and A435G;T303C, A433T, and T530A;T303C, A433T, and C572T;T303C, A433T, and T596C;T303C, A433 T, and T617C; T303C, A433T, and T688C; T303C, A433T, and A696T; T303C, A433T, and T702C; T303C, A433T, and A709G; T303C, A433T, and A712G; T303C, A433T, and T714G; T303C, A433T, and A790G; T303C, A433T, and A841T; T303C, A433T, and T862A; T303C, A435G, and T530A; T303C, A435G, and C572T; T303C , A435G, and T596C;T303C, A435G, and T617C;T303C, A435G, and T688C;T303C, A435G, and A696T;T303C, A435G, and T702C;T303C, A435G, and A709G;T303C, A435G, and A712G;T303C, A435G, and T714G;T303C, A435G, and A790G;T303C, A435G, and A841T;T303C, A435G, and T862A;T303C, T530A, and C572T;T303C, T530A, and T596C;T303C, T530A, and T617C;T303C, T530A, and T688C;T303C, T530A, and A696T;T303C, T530A, and T702C;T303C, T530A, and A709G;T303C, T530A, and A712G;T303C, T530A, and T714G;T303C, T530A, and A790G;T303C, T530A, and A841T;T303C, T530A, and T862A;T303C, T572T, and T596C; T303C, C572T, and T617C; T303C, C572T, and T688C; T303C, C572T, and A696T; T303C, C572T, and T702C; T303C, C572T, and A709G; T303C, C572T, and A712G; T303C, C572T, and T714G; T303C, C572T, and A790G; T303C, C572T, and A841T; T303C, C572T, and T862A; T303C, T596C, and T617C; T303C, T596 C, and T688C;T303C, T596C, and A696T;T303C, T596C, and T702C;T303C, T596C, and A709G;T303C, T596C, and A712G;T303C, T596C, and T714G;T303C, T596C, and A790G;T303C, T596C, and A841T;T303C, T596C, and T862A;T303C, T617C, and T688C;T303C, T617C, and A696T;T303C, T617C, and T702C;T303C , T617C, and A709G;T303C, T617C, and A712G;T303C, T617C, and T714G;T303C, T617C, and A790G;T303C, T617C, and A841T;T303C, T617C, and T862A;T303C, T688C, and A696T;T303C, T688C, and T702C;T303C, T688C, and A709G;T303C, T688C, and A712G;T303C, T688C, and T714G;T303C, T688C, and A790G;T303C, T688C, and A841T;T303C, T688C, and T862A;T303C, A696T, and T702C;T303C, A696T, and A709G;T303C, A696T, and A712G;T303C, A696T, and T714G;T303C, A696T, and A790G;T303C, A696T, and A841T;T303C, A696T, and T862A;T303C, T702C, and A709G;T303C, T702C, and A712G;T303C, T702C, and T714G;T303C, T702C, and A790G;T303C, T702C, and A841T;T303C, T702C, and T862A;T303C, A709G, and A712G;T303C, A709G, and T714G;T303C, A709G, and A790G;T303C, A709G, and A841T;T303C, A709G, and T862A;T303C, A712G, and T714G;T303C, A712G, and A790G;T303C, A712G, and A841T;T303C, A712 G, and T862A;T303C, T714G, and A790G;T303C, T714G, and A841T;T303C, T714G, and T862A;T303C, A790G, and A841T;T303C, A790G, and T862A;T303C, A841T, and T862A;T426A, A433T, and A435G;T426A, A433T, and T530A;T426A, A433T, and C572T;T426A, A433T, and T596C;T426A, A433T, and T617C;T426A , A433T, and T688C;T426A, A433T, and A696T;T426A, A433T, and T702C;T426A, A433T, and A709G;T426A, A433T, and A712G;T426A, A433T, and T714G;T426A, A433T, and A790G;T426A, A433T, and A841T;T426A, A433T, and T862A;T426A, A435G, and T530A;T426A, A435G, and C572T;T426A, A435G, and T596C;T426A, A435G, and T617C;T426A, A435G, and T688C;T426A, A435G, and A696T;T426A, A435G, and T702C;T426A, A435G, and A709G;T426A, A435G, and A712G;T426A, A435G, and T714G;T426A, A435G, and A790G;T426A, A435G, and A841T;T426A, A435G, and T862A;T426A, T530A, and C572T;T426A, T530A, and T596C; T426A, T530A, and T617C; T426A, T530A, and T688C; T426A, T530A, and A696T; T426A, T530A, and T702C; T426A, T530A, and A709G; T426A, T530A, and A712G; T426A, T530A, and T714G; T426A, T530A, and A790G; T426A, T530A, and A841T; T426A, T530A, and T862A; T426A, C572T, and T596C; T426A, C572 T, and T617C; T426A, C572T, and T688C; T426A, C572T, and A696T; T426A, C572T, and T702C; T426A, C572T, and A709G; T426A, C572T, and A712G; T426A, C572T, and T714G; T426A, C572T, and A790G; T426A, C572T, and A841T; T426A, C572T, and T862A; T426A, T596C, and T617C; T426A, T596C, and T688C; T426A , T596C, and A696T;T426A, T596C, and T702C;T426A, T596C, and A709G;T426A, T596C, and A712G;T426A, T596C, and T714G;T426A, T596C, and A790G;T426A, T596C, and A841T;T426A, T596C, and T862A;T426A, T617C, and T688C;T426A, T617C, and A696T;T426A, T617C, and T702C;T426A, T617C, and A709G;T426A, T617C, and A712G;T426A, T617C, and T714G;T426A, T617C, and A790G;T426A, T617C, and A841T;T426A, T617C, and T862A;T426A, T688C, and A696T;T426A, T688C, and T702C;T426A, T688C, and A709G;T426A, T688C, and A712G; T426A, T688C, and T714G;T426A, T688C, and A790G;T426A, T688C, and A841T;T426A, T688C, and T862A;T426A, A696T, and T702C;T426A, A696T, and A709G;T426A, A696T, and A712G;T426A, A696T, and T714G;T426A, A696T, and A790G;T426A, A696T, and A841T;T426A, A696T, and T862A;T426A, T702C, and A709G;T426A, T702C, and A712G;T426A, T702C, and T714G;T426A, T702C, and A790G;T426A, T702C, and A841T;T426A, T702C, and T862A;T426A, A709G, and A712G;T426A, A709G, and T714G;T426A, A709G, and A790G;T426A, A709G, and A841T;T426A, A709G, and T862A;T426A, A712G, and T714G;T426A, A712 G, and A790G;T426A, A712G, and A841T;T426A, A712G, and T862A;T426A, T714G, and A790G;T426A, T714G, and A841T;T426A, T714G, and T862A;T426A, A790G, and A841T;T426A, A790G, and T862A;T426A, A841T, and T862A;A433T, A435G, and T530A;A433T, A435G, and C572T;A433T, A435G, and T596C;A433T , A435G, and T617C;A433T, A435G, and T688C;A433T, A435G, and A696T;A433T, A435G, and T702C;A433T, A435G, and A709G;A433T, A435G, and A712G;A433T, A435G, and T714G;A433T, A435G, and A790G;A433T, A435G, and A841T;A433T, A435G, and T862A;A433T, T530A, and C572T;A433T, T530A, and T596C;A433T, T530A, and T617C; A433T, T530A, and T688C; A433T, T530A, and A696T; A433T, T530A, and T702C; A433T, T530A, and A709G; A433T, T530A, and A712G; A433T, T530A, and T714G; A433T, T530A, and A790G; A433T, T530A, and A841T; A433T, T530A, and T862A; A433T, C572T, and T596C; A433T, C572T, and T617C;A433T, C572T, and T688C;A433T, C572T, and A696T;A433T, C572T, and T702C;A433T, C572T, and A709G;A433T, C572T, and A712G;A433T, C572T, and T714G;A433T, C572T, and A790G;A433T, C572T, and A841T;A433T, C572T, and T862A;A433T, T596C, and T617C;A433T, T596C, and T688C;A433T, T596 C, and A696T;A433T, T596C, and T702C;A433T, T596C, and A709G;A433T, T596C, and A712G;A433T, T596C, and T714G;A433T, T596C, and A790G;A433T, T596C, and A841T;A433T, T596C, and T862A;A433T, T617C, and T688C;A433T, T617C, and A696T;A433T, T617C, and T702C;A433T, T617C, and A709G;A433T , T617C, and A712G;A433T, T617C, and T714G;A433T, T617C, and A790G;A433T, T617C, and A841T;A433T, T617C, and T862A;A433T, T688C, and A696T;A433T, T688C, and T702C;A433T, T688C, and A709G;A433T, T688C, and A712G;A433T, T688C, and T714G;A433T, T688C, and A790G;A433T, T688C, and A841T;A433T, T688C, and T862A;A433T, A696T, and T702C;A433T, A696T, and A709G;A433T, A696T, and A712G;A433T, A696T, and T714G;A433T, A696T, and A790G;A433T, A696T, and A841T;A433T, A696T, and T862A;A433T, T702C, and A709G;A433T, T702C, and A712G;A433T, T702C, and T714G;A433T, T702C, and A790G;A433T, T702C, and A841T;A433T, T702C, and T862A;A433T, A709G, and A712G;A433T, A709G, and T714G;A433T, A709G, and A790G;A433T, A709G, and A841T;A433T, A709G, and T862A;A433T, A712G, and T714G;A433T, A712G, and A790G;A433T, A712G, and A841T;A433T, A712G, and T862A;A433T, T714 G, and A790G;A433T, T714G, and A841T;A433T, T714G, and T862A;A433T, A790G, and A841T;A433T, A790G, and T862A;A433T, A841T, and T862A;A435G, T530A, and C572T;A435G, T530A, and T596C;A435G, T530A, and T617C;A435G, T530A, and T688C;A435G, T530A, and A696T;A435G, T530A, and T702C;A435G , T530A, and A709G;A435G, T530A, and A712G;A435G, T530A, and T714G;A435G, T530A, and A790G;A435G, T530A, and A841T;A435G, T530A, and T862A;A435G, C572T, and T596C;A435G, C572T, and T617C;A435G, C572T, and T688C;A435G, C572T, and A696T;A435G, C572T, and T702C;A435G, C572T, and A709G;A435G, C572T, and A712G;A435G, C572T, and T714G;A435G, C572T, and A790G;A435G, C572T, and A841T;A435G, C572T, and T862A;A435G, T596C, and T617C;A435G, T596C, and T688C;A435G, T596C, and A696T;A435G, T596C, and T702C;A435G, T596C, and A709G;A435G, T596C, and A712G;A435G, T596C, and T714G;A435G, T596C, and A790G;A435G, T596C, and A841T;A435G, T596C, and T862A;A435G, T617C, and T688C;A435G, T617C, and A696T;A435G, T617C, and T702C;A435G, T617C, and A709G;A435G, T617C, and A712G;A435G, T617C, and T714G;A435G, T617C, and A790G;A435G, T617C, and A841T;A435G, T617 C, and T862A;A435G, T688C, and A696T;A435G, T688C, and T702C;A435G, T688C, and A709G;A435G, T688C, and A712G;A435G, T688C, and T714G;A435G, T688C, and A790G;A435G, T688C, and A841T;A435G, T688C, and T862A;A435G, A696T, and T702C;A435G, A696T, and A709G;A435G, A696T, and A712G;A435G , A696T, and T714G;A435G, A696T, and A790G;A435G, A696T, and A841T;A435G, A696T, and T862A;A435G, T702C, and A709G;A435G, T702C, and A712G;A435G, T702C, and T714G;A435G, T702C, and A790G;A435G, T702C, and A841T;A435G, T702C, and T862A;A435G, A709G, and A712G;A435G, A709G, and T714G;A435G, A709G, and A790G;A435G, A709G, and A841T;A435G, A709G, and T862A;A435G, A712G, and T714G;A435G, A712G, and A790G;A435G, A712G, and A841T;A435G, A712G, and T862A;A435G, T714G, and A790G;A435G, T714G, and A841T;A435G, T714G, and T862A;A435G, A790G, and A841T;A435G, A790G, and T862A;A435G, A841T, and T862A;T530A, C572T, and T596C;T530A, C572T, and T617C;T530A, C572T, and T688C;T530A, C572T, and A696T;T530A, C572T, and T702C;T530A, C572T, and A709G;T530A, C572T, and A712G;T530A, C572T, and T714G;T530A, C572T, and A790G;T530A, C572T, and A841T;T530A, C572 T, and T862A;T530A, T596C, and T617C;T530A, T596C, and T688C;T530A, T596C, and A696T;T530A, T596C, and T702C;T530A, T596C, and A709G;T530A, T596C, and A712G;T530A, T596C, and T714G;T530A, T596C, and A790G;T530A, T596C, and A841T;T530A, T596C, and T862A;T530A, T617C, and T688C;T530A , T617C, and A696T;T530A, T617C, and T702C;T530A, T617C, and A709G;T530A, T617C, and A712G;T530A, T617C, and T714G;T530A, T617C, and A790G;T530A, T617C, and A841T;T530A, T617C, and T862A;T530A, T688C, and A696T;T530A, T688C, and T702C;T530A, T688C, and A709G;T530A, T688C, and A712G;T530A, T688C, and T714G;T530A, T688C, and A790G;T530A, T688C, and A841T;T530A, T688C, and T862A;T530A, A696T, and T702C;T530A, A696T, and A709G;T530A, A696T, and A712G;T530A, A696T, and T714G;T530A, A696T; and A790G;T530A, A696T, and A841T;T530A, A696T, and T862A;T530A, T702C, and A709G;T530A, T702C, and A712G;T530A, T702C, and T714G;T530A, T702C, and A790G;T530A, T702C, and A841T;T530A, T702C, and T862A;T530A, A709G, and A712G;T530A, A709G, and T714G;T530A, A709G, and A790G;T530A, A70 9G, and A841T;T530A, A709G, and T862A;T530A, A712G, and T714G;T530A, A712G, and A790G;T530A, A712G, and A841T;T530A, A712G, and T862A;T530A, T714G, and A790G;T530A, T714G, and A841T;T530A, T714G, and T862A;T530A, A790G, and A841T;T530A, A790G, and T862A;T530A, A841T, and T862A;C572T, T596C, and T617C;C572T, T596C, and T688C;C572T, T596C, and A696T;C572T, T596C, and T702C;C572T, T596C, and A709G;C572T, T596C, and A712G;C572T, T596C, and T714G;C572T, T596C, and A790G;C572T, T596C, and A841T;C572T, T596C, and T862A;C572T, T617C, and T688C;C572T, T617C, and A696T;C57 2T, T617C, and T702C;C572T, T617C, and A709G;C572T, T617C, and A712G;C572T, T617C, and T714G;C572T, T617C, and A790G;C572T, T617C, and A841T;C572T, T617C, and T862A;C572T, T688C, and A696T;C572T, T688C, and T702C;C572T, T688C, and A709G;C572T, T688C, and A712G;C572T, T688C, and T714G;C572T, T688C, and A790G;C572T, T688C, and A841T;C572T, T688C, and T862A;C572T, A696T, and T702C;C572T, A696T, and A709G;C572T, A696T, and A712G;C572T, A696T, and T714G;C572T, A696T, and A790G;C572T, A696T, and A841T;C572T, A696T, and T862A;C572T, T702C, and A709G;C572T, T702C, and A712G;C572T, T702C, and T714G;C572T, T702C, and A790G;C572T, T702C, and A841T;C572T, T702C, and T862A;C572T, A709G, and A712G;C572T, A709G, and T714G;C572T, A709G, and A790G;C572T, A709G, and A841T;C572T, A709G, and T862A;C572T, A712G, and T714G;C572T, A712G, and A790G;C572T, A712 G, and A841T;C572T, A712G, and T862A;C572T, T714G, and A790G;C572T, T714G, and A841T;C572T, T714G, and T862A;C572T, A790G, and A841T;C572T, A790G, and T862A;C572T, A841T, and T862A;T596C, T617C, and T688C;T596C, T617C, and A696T;T596C, T617C, and T702C;T596C, T617C, and A709G;T596C , T617C, and A712G;T596C, T617C, and T714G;T596C, T617C, and A790G;T596C, T617C, and A841T;T596C, T617C, and T862A;T596C, T688C, and A696T;T596C, T688C, and T702C;T596C, T688C, and A709G;T596C, T688C, and A712G;T596C, T688C, and T714G;T596C, T688C, and A790G;T596C, T688C, and A841T;T596C, T688C, and T862A;T596C, A696T, and T702C;T596C, A696T, and A709G;T596C, A696T, and A712G;T596C, A696T, and T714G;T596C, A696T, and A790G;T596C, A696T, and A841T;T596C, A696T, and T862A;T596C, T702C, and A709G;T596C, T702C, and A712G;T596C, T702C, and T714G;T596C, T702C, and A790G;T596C, T702C, and A841T;T596C, T702C, and T862A;T596C, A709G, and A712G;T596C, A709G, and T714G;T596C, A709G, and A790G;T596C, A709G, and A841T;T596C, A709G, and T862A;T596C, A712G, and T714G;T596C, A712G, and A790G;T596C, A712G, and A841T;T596C, A712G, and T862A;T596C, T714 G, and A790G;T596C, T714G, and A841T;T596C, T714G, and T862A;T596C, A790G, and A841T;T596C, A790G, and T862A;T596C, A841T, and T862A;T617C, T688C, and A696T;T617C, T688C, and T702C;T617C, T688C, and A709G;T617C, T688C, and A712G;T617C, T688C, and T714G;T617C, T688C, and A790G;T617C , T688C, and A841T;T617C, T688C, and T862A;T617C, A696T, and T702C;T617C, A696T, and A709G;T617C, A696T, and A712G;T617C, A696T, and T714G;T617C, A696T, and A790G;T617C, A696T, and A841T;T617C, A696T, and T862A;T617C, T702C, and A709G;T617C, T702C, and A712G;T617C, T702C, and T714G;T617C, T702C, and A790G;T617C, T702C, and A841T;T617C, T702C, and T862A;T617C, A709G, and A712G;T617C, A709G, and T714G;T617C, A709G, and A790G;T617C, A709G, and A841T;T617C, A709G, and T862A;T617C, A712G, and T714G;T617C, A712G, and A790G;T617C, A712G, and A841T;T617C, A712G, and T862A;T617C, T714G, and A790G;T617C, T714G, and A841T;T617C, T714G, and T862A;T617C, A790G, and A841T;T617C, A790G, and T862A;T617C, A841T, and T862A;T688C, A696T, and T702C;T688C, A696T, and A709G;T688C, A696T, and A712G;T688C, A696T, and T714G;T688C, A696T, and A790G;T688C, A696 T, and A841T;T688C, A696T, and T862A;T688C, T702C, and A709G;T688C, T702C, and A712G;T688C, T702C, and T714G;T688C, T702C, and A790G;T688C, T702C, and A841T;T688C, T702C, and T862A;T688C, A709G, and A712G;T688C, A709G, and T714G;T688C, A709G, and A790G;T688C, A709G, and A841T;T688C , A709G, and T862A;T688C, A712G, and T714G;T688C, A712G, and A790G;T688C, A712G, and A841T;T688C, A712G, and T862A;T688C, T714G, and A790G;T688C, T714G, and A841T;T688C, T714G, and T862A;T688C, A790G, and A841T;T688C, A790G, and T862A;T688C, A841T, and T862A;A696T, T702C, and A709G;A696T, T702C, and A712G;A696T, T702C, and T714G;A696T, T702C, and A790G;A696T, T702C, and A841T;A696T, T702C, and T862A;A696T, A709G, and A712G;A696T, A709G, and T714G;A696T, A709G, and A790G;A696T, A709G, and A841T;A696T, A709G, and T862A;A696T, A712G, and T714G;A696T, A712G, and A790G;A696T, A712G, and A841T;A696T, A712G, and T862A;A696T, T714G, and A790G;A696T, T714G, and A841T;A696T, T714G, and T862A;A696T, A790G, and A841T;A696T, A790G, and T862A;A696T, A841T, and T862A;T702C, A709G, and A712G;T702C, A709G, and T714G;T702C, A709G, and A790G;T702C, A709 G, and A841T;T702C, A709G, and T862A;T702C, A712G, and T714G;T702C, A712G, and A790G;T702C, A712G, and A841T;T702C, A712G, and T862A;T702C, T714G, and A790G;T702C, T714G, and A841T;T702C, T714G, and T862A;T702C, A790G, and A841T;T702C, A790G, and T862A;T702C, A841T, and T862A;A709G , A712G, and T714G;A709G, A712G, and A790G;A709G, A712G, and A841T;A709G, A712G, and T862A;A709G, T714G, and A790G;A709G, T714G, and A841T;A709G, A790G, and A841T;A709G, A790G, and T862A;A709G, A841T, and T862A;A712G, T714G, and A790G;A712G, T714G, and A841T;A712G, T714G, and T862A;A712G, A790G, and A841T;A712G, A790G, and T862A;A712G, A841T, and T862A;T714G, A790G, and A841T;T714G, A790G, and T862A;T714G, A841T, and T862A;or A790G, A841T; and T862A may be present within the promoter sequence.

[0042] In some embodiments, the nucleotide sequence of the promoter element provided herein may comprise two mutations compared to the nucleotide sequence of the reference promoter element.For example, in some embodiments, two mutations corresponding to the following mutations with respect to SEQ ID NO: 28 may be present in the promoter sequence: T688C and A696T; T688C and T702C; T688C and A712G; T688C and T714G; A696T and T702C; A696T and A712G; A696T and T714G; T702C and A712G; T702C and T714G; or A712G and T714G.

[0043] In some embodiments, the nucleotide sequence of the promoter element provided herein may comprise three mutations compared to the nucleotide sequence of the reference promoter element.For example, in some embodiments, the following mutations may be present in the promoter sequence: T688C, A696T, and T702C; T688C, A696T, and A712G; T688C, A696T, and T714G; T688C, T702C, and A712G; T688C, T702C, and T714G; T688C, A712G, and T714G; A696T, T702C, and A712G; A696T, T702C, and T714G; A696T, A712G, and T714G; or T702C, A712G, and T714G.

[0044] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following mutations relative to SEQ ID NO: 28 may be present in the promoter sequence: T688C, A696T, T702C, and A712G; T688C, A696T, T702C, and T714G; T688C, A696T, A712G, and T714G; T688C, T702C, A712G, and T714G; or A696T, T702C, A712G, and T714G.

[0045] In some embodiments, the nucleotide sequence of a promoter element provided herein may contain five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations corresponding to the following mutations relative to SEQ ID NO: 28 may be present in the promoter sequence: T688C, A696T, T702C, A712G, and T714G.

[0046] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following mutations are present in SEQ ID NO: 28: 146C and 154T; 146C and 303C; 146C and 426A; 146C and 433T; 146C and 435G; 146C and 530A; 146C and 572T; 146C and 596C; 146C and 617C; 146C and 688C; 146C and 696T; 146C and 702C; 146C and 709G; 146C and 712G; 146C and 714G; 146C and 790G; 146C and A841T;146C and 862A;154T and 303C;154T and 426A;154T and 433T;154T and 435G;154T and 530A;154T and 572T;154T and 596C;154T and 617C;154T and 688C;154T and 696T;154T and 702C;154T and 709G;154T and 712G;154T and 714G;154T and 790G;154T and A841T;154T and 862A;30 3C and 426A;303C and 433T;303C and 435G;303C and 530A;303C and 572T;303C and 596C;303C and 617C;303C and 688C;303C and 696T;303C and 702C;303C and 709G;303C and 712G;303C and 714G;303C and 790G;303C and A841T;303C and 862A;426A and 433T;426A and 435G;426A and 530A;4 26A and 572T;426A and 596C;426A and 617C;426A and 688C;426A and 696T;426A and 702C;426A and 709G;426A and 712G;426A and 714G;426A and 790G;426A and A841T;426A and 862A;433T and 435G;433T and 530A;433T and 572T;433T and 596C;433T and 617C;433T and 688C;433T and 696T;433T and 702C;433T and 709G;433T and 712G;433T and 714G;433T and 790G;433T and A841T;433T and 862A;435G and 530A;435G and 572T;435G and 596C;435G and 617C;435G and 688C;435G and 696T;435G and 702C;435G and 709G;435G and 712G;435G and 714G;435G and 790G;435G and A841T;435G and 862A;530A and and 572T;530A and 596C;530A and 617C;530A and 688C;530A and 696T;530A and 702C;530A and 709G;530A and 712G;530A and 714G;530A and 790G;530A and A841T;530A and 862A;572T and 596C;572T and 617C;572T and 688C;572T and 696T;572T and 702C;572T and 709G;572T and 712G;572T and 714G;572T and 790G;5 72T and A841T;572T and 862A;596C and 617C;596C and 688C;596C and 696T;596C and 702C;596C and 709G;596C and 712G;596C and 714G;596C and 790G;596C and A841T;596C and 862A;617C and 688C;617C and 696T;617C and 702C;617C and 709G;617C and 712G;617C and 714G;617C and 790G;617C and A841T;617C and and 862A;688C and 696T;688C and 702C;688C and 709G;688C and 712G;688C and 714G;688C and 790G;688C and A841T;688C and 862A;696T and 702C;696T and 709G;696T and 712G;696T and 714G;696T and 790G;696T and A841T;696T and 862A;702C and 709G;702C and 712G;702C and 714G;702C and 790G;702C and A841T;Two mutations corresponding to 702C and 862A; 709G and 712G; 709G and 714G; 709G and 790G; 709G and A841T; 709G and 862A; 712G and 714G; 712G and 790G; 712G and A841T; 712G and 862A; 714G and 790G; 714G and A841T; 714G and 862A; 790G and A841T; 790G and 862A; or A841T and 862A may be present in the promoter sequence, so long as the designated nucleotide bases are not the same as the corresponding naturally occurring nucleotide bases.

[0047] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following mutations are present in SEQ ID NO: 28: 146C, 154T, and 303C; 146C, 154T, and 426A; 146C, 154T, and 433T; 146C, 154T, and 435G; 146C, 154T, and 530A; 146C, 154T, and 572T; 146C, 154T, and 596C; 146C, 154T, and 617C; 146C, 154T, and 688C; 146C, 154T, and 696T; 146C, 154T, and 702C. ;146C, 154T, and 709G;146C, 154T, and 712G;146C, 154T, and 714G;146C, 154T, and 790G;146C, 154T, and A841T;146C, 154T, and 862A;146C, 303C, and 426A;146C, 303C, and 433T;146C, 303C, and 435G;146C, 303C, and 530A;146C, 303C, and 572T;146C, 303C, and 596C;146C, 303C, and and 617C; 146C, 303C, and 688C; 146C, 303C, and 696T; 146C, 303C, and 702C; 146C, 303C, and 709G; 146C, 303C, and 712G; 146C, 303C, and 714G; 146C, 303C, and 790G; 146C, 303C, and A841T; 146C, 303C, and 862A; 146C, 426A, and 433T; 146C, 426A, and 435G; 146C, 426A, and 530A; 146C, 426A, and 572T;146C, 426A, and 596C;146C, 426A, and 617C;146C, 426A, and 688C;146C, 426A, and 696T;146C, 426A, and 702C;146C, 426A, and 709G;146C, 426A, and 712G;146C, 426A, and 714G;146C, 426A, and 790G;146C, 426A, and A841T;146C, 426A, and 862A;146C, 433T, and 435G;146C, 433T, and 530A;146C, 433T, and 572T;146C, 433T, and 596C;146C, 433T, and 617C;146C, 433T, and 688C;146C, 433T, and 696T;146C, 433T, and 702C;146C, 433T, and 709G;146C, 433T, and 712G;146C, 433T, and 714G;146C, 433T, and 790G;146C, 433T, and A841T;146C, 433T, and 862A;146C, 435G, and 530A;146C, 435G, and 572T;146C, 435G, and 596C;146C, 435G, and 617C;146C, 435G, and 688C;146C, 435G, and 696T;146C, 435G, and 702C;146C, 435G, and 709G;146C, 435G, and 712G;146C, 435G, and 714G;146C, 435G, and 790G;146C, 435G, and A841T;146C, 435G, and 862A;146C, 530A, and 572T;146C, 530A , and 596C;146C, 530A, and 617C;146C, 530A, and 688C;146C, 530A, and 696T;146C, 530A, and 702C;146C, 530A, and 709G;146C, 530A, and 712G;146C, 530A, and 714G;146C, 530A, and 790G;146C, 530A, and A841T;146C, 530A, and 862A;146C, 572T, and 596C;146C, 572T, and 617C;146C, 572T, and 688C;146C , 572T, and 696T;146C, 572T, and 702C;146C, 572T, and 709G;146C, 572T, and 712G;146C, 572T, and 714G;146C, 572T, and 790G;146C, 572T, and A841T;146C, 572T, and 862A;146C, 596C, and 617C;146C, 596C, and 688C;146C, 596C, and 696T;146C, 596C, and 702C;146C, 596C, and 709G;146C, 596C, and 712G;146C, 596C, and 714G;146C, 596C, and 790G;146C, 596C, and A841T;146C, 596C, and 862A;146C, 617C, and 688C;146C, 617C, and 696T;146C, 617C, and 702C;146C, 617C, and 709G;146C, 617C, and 712G;146C, 617C, and 714G;146C, 617C, and 790G;146C, 617C, and A841T;146C, 617C, and 862A;146C, 688C, and 6 96T;146C, 688C, and 702C;146C, 688C, and 709G;146C, 688C, and 712G;146C, 688C, and 714G;146C, 688C, and 790G;146C, 688C, and A841T;146C, 688C, and 862A;146C, 696T, and 702C;146C, 696T, and 709G;146C, 696T, and 712G;146C, 696T, and 714G;146C, 696T, and 790G;146C, 696T, and A841T;146C, 696T, and 862A;146C, 702C, and 709G;146C, 702C, and 712G;146C, 702C, and 714G;146C, 702C, and 790G;146C, 702C, and A841T;146C, 702C, and 862A;146C, 709G, and 712G;146C, 709G, and 714G;146C, 709G, and 790G;146C, 709G, and A841T;146C, 709G, and 862A;146C, 712G, and 714G;146C, 712G, and 790G;146C, 7 12G, and A841T;146C, 712G, and 862A;146C, 714G, and 790G;146C, 714G, and A841T;146C, 714G, and 862A;146C, 790G, and A841T;146C, 790G, and 862A;146C, A841T, and 862A;154T, 303C, and 426A;154T, 303C, and 433T;154T, 303C, and 435G;154T, 303C, and 530A;154T, 303C, and 572T;154T, 303C, and 596C;154T, 303C, and 617C;154T, 303C, and 688C;154T, 303C, and 696T;154T, 303C, and 702C;154T, 303C, and 709G;154T, 303C, and 712G;154T, 303C, and 714G;154T, 303C, and 790G;154T, 303C, and A841T;154T, 303C, and 862A;154T, 426A, and 433T;154T, 426A, and 435G;154T, 426A, and 530A;154T, 426A, and 572T;154T, 426A, and 596C;154T, 426A, and 617C;154T, 426A, and 688C;154T, 426A, and 696T;154T, 426A, and 702C;154T, 426A, and 709G;154T, 426A, and 712G;154T, 426A, and 714G;154T, 426A, and 790G;154T, 426A, and A841T;154T, 426A, and 862A;154T, 433T, and 435G;154T, 433T, and 530A;154T, 433T , and 572T;154T, 433T, and 596C;154T, 433T, and 617C;154T, 433T, and 688C;154T, 433T, and 696T;154T, 433T, and 702C;154T, 433T, and 709G;154T, 433T, and 712G;154T, 433T, and 714G;154T, 433T, and 790G;154T, 433T, and A841T;154T, 433T, and 862A;154T, 435G, and 530A;154T, 435G, and 572T;154T , 435G, and 596C;154T, 435G, and 617C;154T, 435G, and 688C;154T, 435G, and 696T;154T, 435G, and 702C;154T, 435G, and 709G;154T, 435G, and 712G;154T, 435G, and 714G;154T, 435G, and 790G;154T, 435G, and A841T;154T, 435G, and 862A;154T, 530A, and 572T;154T, 530A, and 596C;154T, 530A, and 617C;154T, 530A, and 688C;154T, 530A, and 696T;154T, 530A, and 702C;154T, 530A, and 709G;154T, 530A, and 712G;154T, 530A, and 714G;154T, 530A, and 790G;154T, 530A, and 841T;154T, 530A, and 862A;154T, 572T, and 596C;154T, 572T, and 617C;154T, 572T, and 688C;154T, 572T, and 696T;154T, 572T, and 7 02C;154T, 572T, and 709G;154T, 572T, and 712G;154T, 572T, and 714G;154T, 572T, and 790G;154T, 572T, and A841T;154T, 572T, and 862A;154T, 596C, and 617C;154T, 596C, and 688C;154T, 596C, and 696T;154T, 596C, and 702C;154T, 596C, and 709G;154T, 596C, and 712G;154T, 596C, and 714G;154T, 596C, and 790G;154T, 596C, and A841T;154T, 596C, and 862A;154T, 617C, and 688C;154T, 617C, and 696T;154T, 617C, and 702C;154T, 617C, and 709G;154T, 617C, and 712G;154T, 617C, and 714G;154T, 617C, and 790G;154T, 617C, and A841T;154T, 617C, and 862A;154T, 688C, and 696T;154T, 688C, and 702C;154T, 688C, and 709G;154T, 688C, and 712G;154T, 688C, and 714G;154T, 688C, and 790G;154T, 688C, and A841T;154T, 688C, and 862A;154T, 696T, and 702C;154T, 696T, and 709G;154T, 696T, and 712G;154T, 696T, and 714G;154T, 696T, and 790G;154T, 696T, and A841T;154T, 696T, and 862A;154T, 702C, and 709G;154T, 702C, and 712G;154T, 702C, and 714G;154T, 702C, and 790G;154T, 702C, and A841T;154T, 702C, and 862A;154T, 709G, and 712G;154T, 709G, and 714G; 154T, 709G, and 790G;154T, 709G, and A841T;154T, 709G, and 862A;154T, 712G, and 714G;154T, 712G, and 790G;154T, 712G, and A841T;154T, 712G, and 862A;154T, 714G, and 790G;154T, 714G, and A841T;154T, 790G, and A841T;154T, 790G, and 862A;154T, A841T, and 862A;303C, 426A, and 433T;303C, 426A, and 435G;303C, 426A, and 530A;303C, 426A, and 572T;303C, 426A, and 596C;303C, 426A, and 617C;303C, 426A, and 688C;303C, 426A, and 696T;303C, 426A, and 702C;303C, 426A, and 709G;303C, 426A, and 712G;303C, 426A, and 714G;303C, 426A, and 790G;303C, 426A, and 841T;303C, 426A, and 841G 6A, and 862A;303C, 433T, and 435G;303C, 433T, and 530A;303C, 433T, and 572T;303C, 433T, and 596C;303C, 433T, and 617C;303C, 433T, and 688C;303C, 433T, and 696T;303C, 433T, and 702C;303C, 433T, and 709G;303C, 433T, and 712G;303C, 433T, and 714G;303C, 433T, and 790G;303C, 433T, and 841T;303 C, 433T, and 862A;303C, 435G, and 530A;303C, 435G, and 572T;303C, 435G, and 596C;303C, 435G, and 617C;303C, 435G, and 688C;303C, 435G, and 696T;303C, 435G, and 702C;303C, 435G, and 709G;303C, 435G, and 712G;303C, 435G, and 714G;303C, 435G, and 790G;303C, 435G, and A841T;303C, 435G, and 862A;303C, 530A, and 572T;303C, 530A, and 596C;303C, 530A, and 617C;303C, 530A, and 688C;303C, 530A, and 696T;303C, 530A, and 702C;303C, 530A, and 709G;303C, 530A, and 712G;303C, 530A, and 714G;303C, 530A, and 790G;303C, 530A, and A841T;303C, 530A, and 862A;303C, 572T, and 596C;303C, 572T, and 617C;303C, 572T, and 688C;303C, 572T, and 696T;303C, 572T, and 702C;303C, 572T, and 709G;303C, 572T, and 712G;303C, 572T, and 714G;303C, 572T, and 790G;303C, 572T, and A841T;303C, 572T, and 862A;303C, 596C, and 617C;303C, 596C, and 688C;303C, 596C, and 696T;303C, 596C, and 702C;303C, 596C , and 709G;303C, 596C, and 712G;303C, 596C, and 714G;303C, 596C, and 790G;303C, 596C, and A841T;303C, 596C, and 862A;303C, 617C, and 688C;303C, 617C, and 696T;303C, 617C, and 702C;303C, 617C, and 709G;303C, 617C, and 712G;303C, 617C, and 714G;303C, 617C, and 790G;303C, 617C, and A841T;303C , 617C, and 862A;303C, 688C, and 696T;303C, 688C, and 702C;303C, 688C, and 709G;303C, 688C, and 712G;303C, 688C, and 714G;303C, 688C, and 790G;303C, 688C, and A841T;303C, 688C, and 862A;303C, 696T, and 702C;303C, 696T, and 709G;303C, 696T, and 712G;303C, 696T, and 714G;303C, 696T, and 790G;303C, 696T, and A841T; 303C, 696T, and 862A; 303C, 702C, and 709G; 303C, 702C, and 712G; 303C, 702C, and 714G; 303C, 702C, and 790G; 303C, 702C, and A841T; 303C, 702C, and 862A; 303C, 709G, and 712G; 303C, 709G, and 714G; 303C, 709G, and 790G; 303C, 709G, and A841T; 303C, 709G, and 862A; 303C, 712G, and and 714G; 303C, 712G, and 790G; 303C, 712G, and A841T; 303C, 712G, and 862A; 303C, 714G, and 790G; 303C, 714G, and A841T; 303C, 714G, and 862A; 303C, 790G, and A841T; 303C, 790G, and 862A; 303C, A841T, and 862A; 426A, 433T, and 435G; 426A, 433T, and 530A; 426A, 433T, and 572T; 426A, 433T, and 596C; 426A, 4 33T, and 617C;426A, 433T, and 688C;426A, 433T, and 696T;426A, 433T, and 702C;426A, 433T, and 709G;426A, 433T, and 712G;426A, 433T, and 714G;426A, 433T, and 790G;426A, 433T, and A841T;426A, 433T, and 862A;426A, 435G, and 530A;426A, 435G, and 572T;426A, 435G, and 596C;426A, 435G, and 617C;426 A, 435G, and 688C;426A, 435G, and 696T;426A, 435G, and 702C;426A, 435G, and 709G;426A, 435G, and 712G;426A, 435G, and 714G;426A, 435G, and 790G;426A, 435G, and A841T;426A, 435G, and 862A;426A, 530A, and 572T;426A, 530A, and 596C;426A, 530A, and 617C;426A, 530A, and 688C;426A, 530A, and 696T;426A, 530A, and 702C;426A, 530A, and 709G;426A, 530A, and 712G;426A, 530A, and 714G;426A, 530A, and 790G;426A, 530A, and A841T;426A, 530A, and 862A;426A, 572T, and 596C;426A, 572T, and 617C;426A, 572T, and 688C;426A, 572T, and 696T;426A, 572T, and 702C;426A, 572T, and 709G;426A, 572T, and 7 12G;426A, 572T, and 714G;426A, 572T, and 790G;426A, 572T, and A841T;426A, 572T, and 862A;426A, 596C, and 617C;426A, 596C, and 688C;426A, 596C, and 696T;426A, 596C, and 702C;426A, 596C, and 709G;426A, 596C, and 712G;426A, 596C, and 714G;426A, 596C, and 790G;426A, 596C, and A841T;426A, 596C , and 862A;426A, 617C, and 688C;426A, 617C, and 696T;426A, 617C, and 702C;426A, 617C, and 709G;426A, 617C, and 712G;426A, 617C, and 714G;426A, 617C, and 790G;426A, 617C, and A841T;426A, 617C, and 862A;426A, 688C, and 696T;426A, 688C, and 702C;426A, 688C, and 709G;426A, 688C, and 712G;426A, 688C, and 714G;426A, 688C, and 790G;426A, 688C, and A841T;426A, 688C, and 862A;426A, 696T, and 702C;426A, 696T, and 709G;426A, 696T, and 712G;426A, 696T, and 714G;426A, 696T, and 790G;426A, 696T, and A841T;426A, 696T, and 862A;426A, 702C, and 709G;426A, 702C, and 712G;426A, 702C, and 714G;426A, 702C, and 790G; 426A, 702C, and A841T; 426A, 702C, and 862A; 426A, 709G, and 712G; 426A, 709G, and 714G; 426A, 709G, and 790G; 426A, 709G, and A841T; 426A, 709G, and 862A; 426A, 712G, and 714G; 426A, 712G, and 790G; 426A, 712G, and A841T; 426A, 712G, and 862A; 426A, 714G, and 790G; 426A, 714G, and and A841T;426A, 714G, and 862A;426A, 790G, and A841T;426A, 790G, and 862A;426A, A841T, and 862A;433T, 435G, and 530A;433T, 435G, and 572T;433T, 435G, and 596C;433T, 435G, and 617C;433T, 435G, and 688C;433T, 435G, and 696T;433T, 435G, and 702C;433T, 435G, and 709G;433T, 435G, and 712G;433T, 43 5G, and 714G;433T, 435G, and 790G;433T, 435G, and A841T;433T, 435G, and 862A;433T, 530A, and 572T;433T, 530A, and 596C;433T, 530A, and 617C;433T, 530A, and 688C;433T, 530A, and 696T;433T, 530A, and 702C;433T, 530A, and 709G;433T, 530A, and 712G;433T, 530A, and 714G;433T, 530A, and 790G;433T , 530A, and A841T;433T, 530A, and 862A;433T, 572T, and 596C;433T, 572T, and 617C;433T, 572T, and 688C;433T, 572T, and 696T;433T, 572T, and 702C;433T, 572T, and 709G;433T, 572T, and 712G;433T, 572T, and 714G;433T, 572T, and 790G;433T, 572T, and A841T;433T, 572T, and 862A;433T, 596C, and 617C;433T, 596C, and 688C;433T, 596C, and 696T;433T, 596C, and 702C;433T, 596C, and 709G;433T, 596C, and 712G;433T, 596C, and 714G;433T, 596C,; and 790G;433T, 596C, and A841T;433T, 596C, and 862A;433T, 617C, and 688C;433T, 617C, and 696T;433T, 617C, and 702C;433T, 617C, and 709G;433T, 617C, and 712G;433T, 617C, and 714G;433T, 617C, and 790G;433T, 617C, and A841T;433T, 617C, and 862A;433T, 688C, and 696T;433T, 688C, and 702C;433 T, 688C, and 709G;433T, 688C, and 712G;433T, 688C, and 714G;433T, 688C, and 790G;433T, 688C, and A841T;433T, 688C, and 862A;433T, 696T, and 702C;433T, 696T, and 709G;433T, 696T, and 712G;433T, 696T, and 714G;433T, 696T, and 790G;433T, 696T, and A841T;433T, 696T, and 862A;433T, 702C, and 70 9G;433T, 702C, and 712G;433T, 702C, and 714G;433T, 702C, and 790G;433T, 702C, and A841T;433T, 702C, and 862A;433T, 709G, and 712G;433T, 709G, and 714G;433T, 709G, and 790G;433T, 709G, and A841T;433T, 709G, and 862A;433T, 712G, and 714G;433T, 712G, and 790G;433T, 712G, and A841T;433T, 71 2G, and 862A;433T, 714G, and 790G;433T, 714G, and A841T;433T, 714G, and 862A;433T, 790G, and A841T;433T, 790G, and 862A;433T, A841T, and 862A;435G, 530A, and 572T;435G, 530A, and 596C;435G, 530A, and 617C;435G, 530A, and 688C;435G, 530A, and 696T;435G, 530A, and 702C;435G, 530A, and 709G;435G, 530A, and 712G;435G, 530A, and 714G;435G, 530A, and 790G;435G, 530A, and A841T;435G, 530A, and 862A;435G, 572T, and 596C;435G, 572T, and 617C;435G, 572T, and 688C;435G, 572T, and 696T;435G, 572T, and 702C;435G, 572T, and 709G;435G, 572T, and 712G;435G, 572T, and 714G;435G, 572T, and 7 90G; 435G, 572T, and A841T; 435G, 572T, and 862A; 435G, 596C, and 617C; 435G, 596C, and 688C; 435G, 596C, and 696T; 435G, 596C, and 702C; 435G, 596C, and 709G; 435G, 596C, and 712G; 435G, 596C, and 714G; 435G, 596C, and 790G; 435G, 596C, and A841T; 435G, 596C, and 862A; 435G, 617C, and 688C; 435G, 617C , and 696T;435G, 617C, and 702C;435G, 617C, and 709G;435G, 617C, and 712G;435G, 617C, and 714G;435G, 617C, and 790G;435G, 617C, and A841T;435G, 617C, and 862A;435G, 688C, and 696T;435G, 688C, and 702C;435G, 688C, and 709G;435G, 688C, and 712G;435G, 688C, and 714G;435G, 688C, and 790G;435G, 688C, and A841T;435G, 688C, and 862A;435G, 696T, and 702C;435G, 696T, and 709G;435G, 696T, and 712G;435G, 696T, and 714G;435G, 696T, and 790G;435G, 696T, and A841T;435G, 696T, and 862A;435G, 702C, and 709G;435G, 702C, and 712G;435G, 702C, and 714G;435G, 702C, and 790G;435G, 702C, and A841T;435G, 702C, and 862A;435G, 709G, and 712G;435G, 709G, and 714G;435G, 709G, and 790G;435G, 709G, and A841T;435G, 709G, and 862A;435G, 712G, and 714G;435G, 712G, and 790G;435G, 712G, and A841T;435G, 712G, and 862A;435G, 714G, and 790G;435G, 714G, and A841T;435G, 714G, and 862A;435G, 790G, and and A841T;435G, 790G, and 862A;435G, A841T, and 862A;530A, 572T, and 596C;530A, 572T, and 617C;530A, 572T, and 688C;530A, 572T, and 696T;530A, 572T, and 702C;530A, 572T, and 709G;530A, 572T, and 712G;530A, 572T, and 714G;530A, 572T, and 790G;530A, 572T, and A841T;530A, 572T, and 862A;530A, 59 6C, and 617C;530A, 596C, and 688C;530A, 596C, and 696T;530A, 596C, and 702C;530A, 596C, and 709G;530A, 596C, and 712G;530A, 596C, and 714G;530A, 596C, and 790G;530A, 596C, and A841T;530A, 596C, and 862A;530A, 617C, and 688C;530A, 617C, and 696T;530A, 617C, and 702C;530A, 617C, and 709G;530A , 617C, and 712G;530A, 617C, and 714G;530A, 617C, and 790G;530A, 617C, and A841T;530A, 617C, and 862A;530A, 688C, and 696T;530A, 688C, and 702C;530A, 688C, and 709G;530A, 688C, and 712G;530A, 688C, and 714G;530A, 688C, and 790G;530A, 688C, and A841T;530A, 688C, and 862A;530A, 696T, and 702C;530A, 696T, and 709G;530A, 696T, and 712G;530A, 696T, and 714G;530A, 696T, and 790G;530A, 696T, and A841T;530A, 696T, and 862A;530A, 702C, and 709G;530A, 702C, and 712G;530A, 702C, and 714G;530A, 702C, and 790G;530A, 702C, and A841T;530A, 702C, and 862A;530A, 709G, and 712G;530A, 709G, and 14G;530A, 709G, and 790G;530A, 709G, and A841T;530A, 709G, and 862A;530A, 712G, and 714G;530A, 712G, and 790G;530A, 712G, and A841T;530A, 712G, and 862A;530A, 714G, and 790G;530A, 714G, and A841T;530A, 790G, and A841T;530A, 790G, and 862A;530A, A841T, and 862A;572T, 59 6C, and 617C;572T, 596C, and 688C;572T, 596C, and 696T;572T, 596C, and 702C;572T, 596C, and 709G;572T, 596C, and 712G;572T, 596C, and 714G;572T, 596C, and 790G;572T, 596C, and A841T;572T, 596C, and 862A;572T, 617C, and 688C;572T, 617C, and 696T;572T, 617C, and 702C;572T, 617C, and 709G;572T , 617C, and 712G;572T, 617C, and 714G;572T, 617C, and 790G;572T, 617C, and A841T;572T, 617C, and 862A;572T, 688C, and 696T;572T, 688C, and 702C;572T, 688C, and 709G;572T, 688C, and 712G;572T, 688C, and 714G;572T, 688C, and 790G;572T, 688C, and A841T;572T, 688C, and 862A;572T, 696T, and 702C;572T, 696T, and 709G;572T, 696T, and 712G;572T, 696T, and 714G;572T, 696T, and 790G;572T, 696T, and A841T;572T, 696T, and 862A;572T, 702C, and 709G;572T, 702C, and 712G;572T, 702C, and 714G;572T, 702C, and 790G;572T, 702C, and A841T;572T, 702C, and 862A;572T, 709G, and 712G;572T, 709G, and 14G;572T, 709G, and 790G;572T, 709G, and A841T;572T, 709G, and 862A;572T, 712G, and 714G;572T, 712G, and 790G;572T, 712G, and A841T;572T, 712G, and 862A;572T, 714G, and 790G;572T, 714G, and A841T;572T, 790G, and A841T;572T, 790G, and 862A;572T, A841T, and 862A;596C, 61 7C, and 688C;596C, 617C, and 696T;596C, 617C, and 702C;596C, 617C, and 709G;596C, 617C, and 712G;596C, 617C, and 714G;596C, 617C, and 790G;596C, 617C, and A841T;596C, 617C, and 862A;596C, 688C, and 696T;596C, 688C, and 702C;596C, 688C, and 709G;596C, 688C, and 712G;596C, 688C, and 714G;596C , 688C, and 790G;596C, 688C, and A841T;596C, 688C, and 862A;596C, 696T, and 702C;596C, 696T, and 709G;596C, 696T, and 712G;596C, 696T, and 714G;596C, 696T, and 790G;596C, 696T, and A841T;596C, 696T, and 862A;596C, 702C, and 709G;596C, 702C, and 712G;596C, 702C, and 714G;596C, 702C, and 790G;596C, 702C, and A841T;596C, 702C, and 862A;596C, 709G, and 712G;596C, 709G, and 714G;596C, 709G, and 790G;596C, 709G, and A841T;596C, 709G,; and 862A;596C, 712G, and 714G;596C, 712G, and 790G;596C, 712G, and A841T;596C, 712G, and 862A;596C, 714G, and 790G;596C, 714G, and A841T;596C, 714G, and 862A;596C, 790G, and A841T;596C, 790G, and 862A;596C, A841T, and 862A;617C, 688C, and 696T;617C, 688C, and 702C;617C, 688C, and 709G;61 7C, 688C, and 712G;617C, 688C, and 714G;617C, 688C, and 790G;617C, 688C, and A841T;617C, 688C, and 862A;617C, 696T, and 702C;617C, 696T, and 709G;617C, 696T, and 712G;617C, 696T, and 714G;617C, 696T, and 790G;617C, 696T, and A841T;617C, 696T, and 862A;617C, 702C, and 709G;617C, 702C, and 12G;617C, 702C, and 714G;617C, 702C, and 790G;617C, 702C, and A841T;617C, 702C, and 862A;617C, 709G, and 712G;617C, 709G, and 714G;617C, 709G, and 790G;617C, 709G, and A841T;617C, 709G, and 862A;617C, 712G, and 714G;617C, 712G, and 790G;617C, 712G, and A841T;617C, 712G, and 862A;617C, 71 4G, and 790G;617C, 714G, and A841T;617C, 714G, and 862A;617C, 790G, and A841T;617C, 790G, and 862A;617C, A841T, and 862A;688C, 696T, and 702C;688C, 696T, and 709G;688C, 696T, and 712G;688C, 696T, and 714G;688C, 696T, and 790G;688C, 696T, and A841T;688C, 696T, and 862A;688C, 702C, and 709G;688C, 702C, and 712G;688C, 702C, and 714G;688C, 702C, and 790G;688C, 702C, and A841T;688C, 702C, and 862A;688C, 709G, and 712G;688C, 709G, and 714G;688C, 709G, and 790G;688C, 709G, and A841T;688C, 709G, and 862A;688C, 712G, and 714G;688C, 712G, and 790G;688C, 712G, and 862A;688C, 714G, and 790G;688C, 714G, and A841T;688C, 714G, and 862A;688C, 790G, and A841T;688C, 790G, and 862A;688C, A841T, and 862A;696T, 702C, and 709G;696T, 702C, and 712G;696T, 702C, and 714G;696T, 702C, and 790G;696T, 702C, and A841T;696T, 702C, and 862A;696T, 709G, and 712G;6 96T, 709G, and 714G;696T, 709G, and 790G;696T, 709G, and A841T;696T, 709G, and 862A;696T, 712G, and 714G;696T, 712G, and 790G;696T, 712G, and A841T;696T, 712G, and 862A;696T, 714G, and 790G;696T, 714G, and A841T;696T, 714G, and 862A;696T, 790G, and A841T;696T, 790G, and 862A;696T, A841T , and 862A;702C, 709G, and 712G;702C, 709G, and 714G;702C, 709G, and 790G;702C, 709G, and A841T;702C, 709G, and 862A;702C, 712G, and 714G;702C, 712G, and 790G;702C, 712G, and A841T;702C, 712G, and 862A;702C, 714G, and 790G;702C, 714G, and A841T;702C, 714G, and 862A;702C, 790G, and A841T;702C, 790G, and 862A;702C, A841T, and 862A;709G, 712G, and 714G;709G, 712G, and 790G;709G, 712G, and A841T;709G, 712G, and 862A;709G, 714G, and 790G;709G, 714G, and A841T;709G, 714G, and 862A;709G, 790G, and A841T;709G, 790G, and 862A;709G, A841T, and 862A;712G, 714G , and 790G; 712G, 714G, and A841T; 712G, 714G, and 862A; 712G, 790G, and A841T; 712G, 790G, and 862A; 712G, A841T, and 862A; 714G, 790G, and 862A; 714G, A841T, and 862A; or three mutations corresponding to 790G, A841T, and 862A may be present in the promoter sequence, so long as the designated nucleotides are not identical to the corresponding naturally occurring nucleotides.

[0048] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations corresponding to the following mutations relative to SEQ ID NO: 28 may be present in the promoter sequence, as long as the indicated nucleotide bases are not the same as the corresponding naturally occurring nucleotide bases.

[0049] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following mutations relative to SEQ ID NO: 28 may be present in the promoter sequence: 688C, 696T, and 702C; 688C, 696T, and 712G; 688C, 696T, and 714G; 688C, 702C, and 712G; 688C, 702C, and 714G; 688C, 712G, and 714G; 696T, 702C, and 712G; 696T, 702C, and 714G; or three mutations corresponding to 702C, 712G, and 714G, as long as the indicated nucleotides are not the same as the corresponding naturally occurring nucleotides.

[0050] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following mutations relative to SEQ ID NO: 28 may be present in the promoter sequence: 688C, 696T, 702C, and 712G; 688C, 696T, 702C, and 714G; 688C, 696T, 712G, and 714G; 688C, 702C, 712G, and 714G; or four mutations corresponding to 696T, 702C, 712G, and 714G, so long as the indicated nucleotide bases are not the same as the corresponding naturally occurring nucleotide bases.

[0051] In some embodiments, the nucleotide sequence of a promoter element provided herein may contain five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations corresponding to the following mutations relative to SEQ ID NO: 28: 688C, 696T, 702C, 712G, and 714G may be present in the promoter sequence, to the extent that the indicated nucleobases are not the same as the corresponding naturally occurring nucleobases.

[0052] In some embodiments, the nucleotide sequence of the promoter element provided herein may comprise two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following positions relative to SEQ ID NO: 28: T146 and C154; T146 and T303; T146 and T426; T146 and A433; T146 and A435; T146 and T530; T146 and C572; T146 and T596; T146 and T617; T146 and T688; T146 and A696; T146 and T702; T146 and A709; T146 and A712; T146 and T714; T146 and A790; T146 and A841; T146 and T862; C154 and T303; C154 and T426; C154 and A433; C154 and A435; C154 and T530; C154 and C572; C154 and T596; C154 and T617; C154 and T688; C154 and A696; C154 and T702; C154 and A709; C154 and A712; C154 and T714; C154 and A790; C154 and A841; C154 and T862; T303 and T4 26;T303 and A433;T303 and A435;T303 and T530;T303 and C572;T303 and T596;T303 and T617;T303 and T688;T303 and A696;T303 and T702;T303 and A709;T303 and A712;T303 and T714;T303 and A790;T303 and A841;T303 and T862;T426 and A433;T426 and A435;T426 and T530;T426 and C57 2;T426 and T596;T426 and T617;T426 and T688;T426 and A696;T426 and T702;T426 and A709;T426 and A712;T426 and T714;T426 and A790;T426 and A841;T426 and T862;A433 and A435;A433 and T530;A433 and C572;A433 and T596;A433 and T617;A433 and T688;A433 and A696;A433 and T702;A433 and A709;A433 and A712;A433 and T714;A433 and A790;A433 and A841;A433 and T862;A435 and T530;A435 and C572;A435 and T596;A435 and T617;A435 and T688;A435 and A696;A435 and T702;A435 and A709;A435 and A712;A435 and T714;A435 and A790;A435 and A841;A435 and T862;T530 and C572;T530 and T5 96;T530 and T617;T530 and T688;T530 and A696;T530 and T702;T530 and A709;T530 and A712;T530 and T714;T530 and A790;T530 and A841;T530 and T862;C572 and T596;C572 and T617;C572 and T688;C572 and A696;C572 and T702;C572 and A709;C572 and A712;C572 and T714;C572 and A790;C572 and A841;C572 and and T862;T596 and T617;T596 and T688;T596 and A696;T596 and T702;T596 and A709;T596 and A712;T596 and T714;T596 and A790;T596 and A841;T596 and T862;T617 and T688;T617 and A696;T617 and T702;T617 and A709;T617 and A712;T617 and T714;T617 and A790;T617 and A841;T617 and T862;T688 and A696;T68 8 and T702;T688 and A709;T688 and A712;T688 and T714;T688 and A790;T688 and A841;T688 and T862;A696 and T702;A696 and A709;A696 and A712;A696 and T714;A696 and A790;A696 and A841;A696 and T862;T702 and A709;T702 and A712;T702 and T714;T702 and A790;T702 and A841;T702 and T862;A709 and A712;Two mutations at positions corresponding to A709 and T714; A709 and A790; A709 and A841; A709 and T862; A712 and T714; A712 and A790; A712 and A841; A712 and T862; T714 and A790; T714 and A841; T714 and T862; A790 and A841; A790 and T862; or A841 and T862 may be present within the promoter sequence.

[0053] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following positions relative to SEQ ID NO: 28: T146, C154, and T303; T146, C154, and T426; T146, C154, and A433; T146, C154, and A435; T146, C154, and T530; T146, C154, and C572; T146, C154, and T596; T146, C154, and T617; T146, C154, and T688; T146, C154, and A696; T146, C154, and T702; T146, C154, and A709; T146, C154, and A712; T146, C154, and T714; T146, C154, and A790; T146, C154, and A841; T146, C154, and T862; T146, T303, and T426; T146, T303, and A433; T146, T303, and A435; T146, T303, and T530; T146, T303, and C572; T146, T303, and T596; T146, T303, and and T617; T146, T303, and T688; T146, T303, and A696; T146, T303, and T702; T146, T303, and A709; T146, T303, and A712; T146, T303, and T714; T146, T303, and A790; T146, T303, and A841; T146, T303, and T862; T146, T426, and A433; T146, T426, and A435; T146, T426, and T530; T146, T 426, and C572;T146, T426, and T596;T146, T426, and T617;T146, T426, and T688;T146, T426, and A696;T146, T426, and T702;T146, T426, and A709;T146, T426, and A712;T146, T426, and T714;T146, T426, and A790;T146, T426, and A841;T146, T426, and T862;T146, A433, and A435;T146, A433, and T530; T146, A433, and C572; T146, A433, and T596; T146, A433, and T617; T146, A433, and T688; T146, A433, and A696; T146, A433, and T702; T146, A433, and A709; T146, A433, and A712; T146, A433, and T714; T146, A433, and A790; T146, A433, and A841; T146, A433, and T862; T146, A435, and T530; T146, A435, and C572; T146, A435, and T596; T146, A435, and T617; T146, A435, and T688; T146, A435, and A696; T146, A435, and T702; T146, A435, and A709; T146, A435, and A712; T146, A435, and T714; T146, A435, and A790; T146, A435, and A841; T146, A435, and T862; T146, T530, and C572; T146, T530 , and T596;T146, T530, and T617;T146, T530, and T688;T146, T530, and A696;T146, T530, and T702;T146, T530, and A709;T146, T530, and A712;T146, T530, and T714;T146, T530, and A790;T146, T530, and A841;T146, T530, and T862;T146, C572, and T596;T146, C572, and T617;T146, C572, and T688;T146 , C572, and A696;T146, C572, and T702;T146, C572, and A709;T146, C572, and A712;T146, C572, and T714;T146, C572, and A790;T146, C572, and A841;T146, C572, and T862;T146, T596, and T617;T146, T596, and T688;T146, T596, and A696;T146, T596, and T702;T146, T596, and A709;T146, T596, and A712;T146, T596, and T714; T146, T596, and A790; T146, T596, and A841; T146, T596, and T862; T146, T617, and T688; T146, T617, and A696; T146, T617, and T702; T146, T617, and A709; T146, T617, and A712; T146, T617, and T714; T146, T617, and A790; T146, T617, and A841; T146, T617, and T862; T146, T688, and A696;T146, T688, and T702;T146, T688, and A709;T146, T688, and A712;T146, T688, and T714;T146, T688, and A790;T146, T688, and A841;T146, T688, and T862;T146, A696, and T702;T146, A696, and A709;T146, A696, and A712;T146, A696, and T714;T146, A696, and A790;T146, A696, and A841;T146, A696 , and T862;T146, T702, and A709;T146, T702, and A712;T146, T702, and T714;T146, T702, and A790;T146, T702, and A841;T146, T702, and T862;T146, A709, and A712;T146, A709, and T714;T146, A709, and A790;T146, A709, and A841;T146, A709, and T862;T146, A712, and T714;T146, A712, and A790;T146 , A712, and A841;T146, A712, and T862;T146, T714, and A790;T146, T714, and A841;T146, T714, and T862;T146, A790, and A841;T146, A790, and T862;T146, A841, and T862;C154, T303, and T426;C154, T303, and A433;C154, T303, and A435;C154, T303, and T530;C154, T303, and C572;C154, T303, and T596;C154, T303, and T617; C154, T303, and T688; C154, T303, and A696; C154, T303, and T702; C154, T303, and A709; C154, T303, and A712; C154, T303, and T714; C154, T303, and A790; C154, T303, and A841; C154, T303, and T862; C154, T426, and A433; C154, T426, and A435; C154, T426, and T530; C154, T426, and C572; C154, T426, and T596; C154, T426, and T617; C154, T426, and T688; C154, T426, and A696; C154, T426, and T702; C154, T426, and A709; C154, T426, and A712; C154, T426, and T714; C154, T426, and A790; C154, T426, and A841; C154, T426, and T862; C154, A433, and A435; C154, A433, and T530; C154, A433 , and C572;C154, A433, and T596;C154, A433, and T617;C154, A433, and T688;C154, A433, and A696;C154, A433, and T702;C154, A433, and A709;C154, A433, and A712;C154, A433, and T714;C154, A433, and A790;C154, A433, and A841;C154, A433, and T862;C154, A435, and T530;C154, A435, and C572;C154 , A435, and T596;C154, A435, and T617;C154, A435, and T688;C154, A435, and A696;C154, A435, and T702;C154, A435, and A709;C154, A435, and A712;C154, A435, and T714;C154, A435, and A790;C154, A435, and A841;C154, A435, and T862;C154, T530, and C572;C154, T530, and T596;C154, T530, and T617;C154, T530, and T688; C154, T530, and A696; C154, T530, and T702; C154, T530, and A709; C154, T530, and A712; C154, T530, and T714; C154, T530, and A790; C154, T530, and A841; C154, T530, and T862; C154, C572, and T596; C154, C572, and T617; C154, C572, and T688; C154, C572, and A696; C154, C572, and T702;C154, C572, and A709;C154, C572, and A712;C154, C572, and T714;C154, C572, and A790;C154, C572, and A841;C154, C572, and T862;C154, T596, and T617;C154, T596, and T688;C154, T596, and A696;C154, T596, and T702;C154, T596, and A709;C154, T596, and A712;C154, T596, and T714;C154, T596 , and A790;C154, T596, and A841;C154, T596, and T862;C154, T617, and T688;C154, T617, and A696;C154, T617, and T702;C154, T617, and A709;C154, T617, and A712;C154, T617, and T714;C154, T617, and A790;C154, T617, and A841;C154, T617, and T862;C154, T688, and A696;C154, T688, and T702;C154 , T688, and A709;C154, T688, and A712;C154, T688, and T714;C154, T688, and A790;C154, T688, and A841;C154, T688, and T862;C154, A696, and T702;C154, A696, and A709;C154, A696, and A712;C154, A696, and T714;C154, A696, and A790;C154, A696, and A841;C154, A696, and T862;C154, T702, and A709;C154, T702, and A712;C154, T702, and T714;C154, T702, and A790;C154, T702, and A841;C154, T702, and T862;C154, A709, and A712;C154, A709, and T714;C154, A709, and A790;C154, A709, and A841; C154, A709, and T862;C154, A712, and T714;C154, A712, and A790;C154, A712, and A841;C154, A712, and T862;C154, T714, and A790;C154, T714, and A841;C154, T714, and T862;C154, A790, and A841;C154, A790, and T862;C154, A841, and T862;T303, T426, and A433;T303, T426, and A435;T303, T426, and T530; T303, T426, and C572; T303, T426, and T596; T303, T426, and T617; T303, T426, and T688; T303, T426, and A696; T303, T426, and T702; T303, T426, and A709; T303, T426, and A712; T303, T426, and T714; T303, T426, and A790; T303, T426, and A841; T303, T426, and T862; T303, A433, and A435; T303, A433 , and T530;T303, A433, and C572;T303, A433, and T596;T303, A433, and T617;T303, A433, and T688;T303, A433, and A696;T303, A433, and T702;T303, A433, and A709;T303, A433, and A712;T303, A433, and T714;T303, A433, and A790;T303, A433, and A841;T303, A433, and T862;T303, A435, and T530;T303 , A435, and C572;T303, A435, and T596;T303, A435, and T617;T303, A435, and T688;T303, A435, and A696;T303, A435, and T702;T303, A435, and A709;T303, A435, and A712;T303, A435, and T714;T303, A435, and A790;T303, A435, and A841;T303, A435, and T862;T303, T530, and C572;T303, T530, and T596;T303, T530, and T617; T303, T530, and T688; T303, T530, and A696; T303, T530, and T702; T303, T530, and A709; T303, T530, and A712; T303, T530, and T714; T303, T530, and A790; T303, T530, and A841; T303, T530, and T862; T303, C572, and T596; T303, C572, and T617; T303, C572, and T688; T303, C572, and A696; T303, C572, and T702; T303, C572, and A709; T303, C572, and A712; T303, C572, and T714; T303, C572, and A790; T303, C572, and A841; T303, C572, and T862; T303, T596, and T617; T303, T596, and T688; T303, T596, and A696; T303, T596, and T702; T303, T596, and A709; T303, T596, and A712; T303, T596 , and T714;T303, T596, and A790;T303, T596, and A841;T303, T596, and T862;T303, T617, and T688;T303, T617, and A696;T303, T617, and T702;T303, T617, and A709;T303, T617, and A712;T303, T617, and T714;T303, T617, and A790;T303, T617, and A841;T303, T617, and T862;T303, T688, and A696;T303 , T688, and T702;T303, T688, and A709;T303, T688, and A712;T303, T688, and T714;T303, T688, and A790;T303, T688, and A841;T303, T688, and T862;T303, A696, and T702;T303, A696, and A709;T303, A696, and A712;T303, A696, and T714;T303, A696, and A790;T303, A696, and A841;T303, A696, and T862;T303, T702, and A709;T303, T702, and A712;T303, T702, and T714;T303, T702, and A790;T303, T702, and A841;T303, T702, and T862;T303, A709, and A712;T303, A709, and T714;T303, A709, and A790;T303, A709, and A841;T303, A709, and T862;T303, A712, and T714;T303, A712, and A790;T303, A712, and A841; T303, A712, and T862; T303, T714, and A790; T303, T714, and A841; T303, T714, and T862; T303, A790, and A841; T303, A790, and T862; T303, A841, and T862; T426, A433, and A435; T426, A433, and T530; T426, A433, and C572; T426, A433, and T596; T426, A433, and T617; T426, A433, and T688; T426, A433 , and A696;T426, A433, and T702;T426, A433, and A709;T426, A433, and A712;T426, A433, and T714;T426, A433, and A790;T426, A433, and A841;T426, A433, and T862;T426, A435, and T530;T426, A435, and C572;T426, A435, and T596;T426, A435, and T617;T426, A435, and T688;T426, A435, and A696;T426 , A435, and T702;T426, A435, and A709;T426, A435, and A712;T426, A435, and T714;T426, A435, and A790;T426, A435, and A841;T426, A435, and T862;T426, T530, and C572;T426, T530, and T596;T426, T530, and T617;T426, T530, and T688;T426, T530, and A696;T426, T530, and T702;T426, T530, and A709;T426, T530, and A712; T426, T530, and T714; T426, T530, and A790; T426, T530, and A841; T426, T530, and T862; T426, C572, and T596; T426, C572, and T617; T426, C572, and T688; T426, C572, and A696; T426, C572, and T702; T426, C572, and A709; T426, C572, and A712; T426, C572, and T714; T426, C572, and A790; T426, C572, and A841; T426, C572, and T862; T426, T596, and T617; T426, T596, and T688; T426, T596, and A696; T426, T596, and T702; T426, T596, and A709; T426, T596, and A712; T426, T596, and T714; T426, T596, and A790; T426, T596, and A841; T426, T596, and T862; T426, T617, and T688; T426, T617 , and A696;T426, T617, and T702;T426, T617, and A709;T426, T617, and A712;T426, T617, and T714;T426, T617, and A790;T426, T617, and A841;T426, T617, and T862;T426, T688, and A696;T426, T688, and T702;T426, T688, and A709;T426, T688, and A712;T426, T688, and T714;T426, T688, and A790;T426 , T688, and A841;T426, T688, and T862;T426, A696, and T702;T426, A696, and A709;T426, A696, and A712;T426, A696, and T714;T426, A696, and A790;T426, A696, and A841;T426, A696, and T862;T426, T702, and A709;T426, T702, and A712;T426, T702, and T714;T426, T702, and A790;T426, T702, and A841;T426, T702, and T862;T426, A709, and A712;T426, A709, and T714;T426, A709, and A790;T426, A709, and A841;T426, A709, and T862;T426, A712, and T714;T426, A712, and A790;T426, A712, and A841;T426, A712, and T862;T426, T714, and A790;T426, T714, and A841;T426, T714, and T862;T426, A790, and A841; T426, A790, and T862; T426, A841, and T862; A433, A435, and T530; A433, A435, and C572; A433, A435, and T596; A433, A435, and T617; A433, A435, and T688; A433, A435, and A696; A433, A435, and T702; A433, A435, and A709; A433, A435, and A712; A433, A435, and T714; A433, A435, and A790; A433, A435 , and A841;A433, A435, and T862;A433, T530, and C572;A433, T530, and T596;A433, T530, and T617;A433, T530, and T688;A433, T530, and A696;A433, T530, and T702;A433, T530, and A709;A433, T530, and A712;A433, T530, and T714;A433, T530, and A790;A433, T530, and A841;A433, T530, and T862;A433 , C572, and T596;A433, C572, and T617;A433, C572, and T688;A433, C572, and A696;A433, C572, and T702;A433, C572, and A709;A433, C572, and A712;A433, C572, and T714;A433, C572, and A790;A433, C572, and A841;A433, C572, and T862;A433, T596, and T617;A433, T596, and T688;A433, T596, and A696;A433, T596, and T702;A433, T596, and A709;A433, T596, and A712;A433, T596, and T714;A433, T596, and A790;A433, T596, and A841;A433, T596, and T862;A433, T617, and T688;A433, T617; and A696;A433, T617, and T702;A433, T617, and A709;A433, T617, and A712;A433, T617, and T714;A433, T617, and A790;A433, T617, and A841;A433, T617, and T862;A433, T688, and A696;A433, T688, and T702;A433, T688, and A709;A433, T688, and A712;A433, T688, and T714;A433, T688, and A790;A433, T6 88, and A841;A433, T688, and T862;A433, A696, and T702;A433, A696, and A709;A433, A696, and A712;A433, A696, and T714;A433, A696, and A790;A433, A696, and A841;A433, A696, and T862;A433, T702, and A709;A433, T702, and A712;A433, T702, and T714;A433, T702, and A790;A433, T702, and A841;A433, T702, and T862;A433, A709, and A712;A433, A709, and T714;A433, A709, and A790;A433, A709, and A841;A433, A709, and T862;A433, A712, and T714;A433, A712, and A790;A433, A712, and A841;A433, A712, and T862;A433, T714, and A790;A433, T714, and A841;A433, T714, and T862;A433, A790, and A841;A4 33, A790, and T862; A433, A841, and T862; A435, T530, and C572; A435, T530, and T596; A435, T530, and T617; A435, T530, and T688; A435, T530, and A696; A435, T530, and T702; A435, T530, and A709; A435, T530, and A712; A435, T530, and T714; A435, T530, and A790; A435, T530, and A841; A435, T530, and T862;A435, C572, and T596; A435, C572, and T617; A435, C572, and T688; A435, C572, and A696; A435, C572, and T702; A435, C572, and A709; A435, C572, and A712; A435, C572, and T714; A435, C572, and A790; A435, C572, and A841; A435, C572, and T862; A435, T596, and T617; A435, T596, and T688; A435, T596, and A696; A435, T596, and T702; A435, T596, and A709; A435, T596, and A712; A435, T596, and T714; A435, T596, and A790; A435, T596, and A841; A435, T596, and T862; A435, T617, and T688; A435, T617, and A696; A435, T617, and T702; A435, T617, and A709; A435, T617, and A712; A435, T617, and T714; A435, T617 , and A790;A435, T617, and A841;A435, T617, and T862;A435, T688, and A696;A435, T688, and T702;A435, T688, and A709;A435, T688, and A712;A435, T688, and T714;A435, T688, and A790;A435, T688, and A841;A435, T688, and T862;A435, A696, and T702;A435, A696, and A709;A435, A696, and A712;A435 , A696, and T714;A435, A696, and A790;A435, A696, and A841;A435, A696, and T862;A435, T702, and A709;A435, T702, and A712;A435, T702, and T714;A435, T702, and A790;A435, T702, and A841;A435, T702, and T862;A435, A709, and A712;A435, A709, and T714;A435, A709, and A790;A435, A709, and A841;A435, A709, and T862;A435, A712, and T714;A435, A712, and A790;A435, A712, and A841;A435, A712, and T862;A435, T714, and A790;A435, T714, and A841;A435, T714, and T862;A435, A790, and A841;A435, A790, and T862;A435, A841, and T862;T530, C572, and T596;T530, C572, and T617;T530, C572, and T688; T530, C572, and A696; T530, C572, and T702; T530, C572, and A709; T530, C572, and A712; T530, C572, and T714; T530, C572, and A790; T530, C572, and A841; T530, C572, and T862; T530, T596, and T617; T530, T596, and T688; T530, T596, and A696; T530, T596, and T702; T530, T596, and A709; T530, T596 , and A712;T530, T596, and T714;T530, T596, and A790;T530, T596, and A841;T530, T596, and T862;T530, T617, and T688;T530, T617, and A696;T530, T617, and T702;T530, T617, and A709;T530, T617, and A712;T530, T617, and T714;T530, T617, and A790;T530, T617, and A841;T530, T617, and T862;T530 , T688, and A696;T530, T688, and T702;T530, T688, and A709;T530, T688, and A712;T530, T688, and T714;T530, T688, and A790;T530, T688, and A841;T530, T688, and T862;T530, A696, and T702;T530, A696, and A709;T530, A696, and A712;T530, A696, and T714;T530, A696, and A790;T530, A696, and A841;T530, A696, and T862;T530, T702, and A709;T530, T702, and A712;T530, T702, and T714;T530, T702, and A790;T530, T702, and A841;T530, T702, and T862;T530, A709, and A712;T530, A709, and T714;T530, A709, and A790;T530, A709, and A841;T530, A709, and T862;T530, A712, and T714;T530, A712, and A790; T530, A712, and A841; T530, A712, and T862; T530, T714, and A790; T530, T714, and A841; T530, T714, and T862; T530, A790, and A841; T530, A790, and T862; T530, A841, and T862; C572, T596, and T617; C572, T596, and T688; C572, T596, and A696; C572, T596, and T702; C572, T596, and A709; C572, T596 , and A712;C572, T596, and T714;C572, T596, and A790;C572, T596, and A841;C572, T596, and T862;C572, T617, and T688;C572, T617, and A696;C572, T617, and T702;C572, T617, and A709;C572, T617, and A712;C572, T617, and T714;C572, T617, and A790;C572, T617, and A841;C572, T617, and T862;C572 , T688, and A696;C572, T688, and T702;C572, T688, and A709;C572, T688, and A712;C572, T688, and T714;C572, T688, and A790;C572, T688, and A841;C572, T688, and T862;C572, A696, and T702;C572, A696, and A709;C572, A696, and A712;C572, A696, and T714;C572, A696, and A790;C572, A696, and A841;C572, A696, and T862;C572, T702, and A709;C572, T702, and A712;C572, T702, and T714;C572, T702, and A790;C572, T702, and A841;C572, T702, and T862;C572, A709, and A712;C572, A709, and T714;C572, A709, and A790;C572, A709, and A841;C572, A709, and T862;C572, A712, and T714;C572, A712, and A790; C572, A712, and A841; C572, A712, and T862; C572, T714, and A790; C572, T714, and A841; C572, T714, and T862; C572, A790, and A841; C572, A790, and T862; C572, A841, and T862; T596, T617, and T688; T596, T617, and A696; T596, T617, and T702; T596, T617, and A709; T596, T617, and A712; T596, T617 , and T714;T596, T617, and A790;T596, T617, and A841;T596, T617, and T862;T596, T688, and A696;T596, T688, and T702;T596, T688, and A709;T596, T688, and A712;T596, T688, and T714;T596, T688, and A790;T596, T688, and A841;T596, T688, and T862;T596, A696, and T702;T596, A696, and A709;T596 , A696, and A712;T596, A696, and T714;T596, A696, and A790;T596, A696, and A841;T596, A696, and T862;T596, T702, and A709;T596, T702, and A712;T596, T702, and T714;T596, T702, and A790;T596, T702, and A841;T596, T702, and T862;T596, A709, and A712;T596, A709, and T714;T596, A709, and A790;T596, A709, and A841;T596, A709, and T862;T596, A712, and T714;T596, A712, and A790;T596, A712, and A841;T596, A712, and T862;T596, T714, and A790;T596, T714, and A841;T596,; T714, and T862; T596, A790, and A841; T596, A790, and T862; T596, A841, and T862; T617, T688, and A696; T617, T688, and T702; T617, T688, and A709; T617, T688, and A712; T617, T688, and T714; T617, T688, and A790; T617, T688, and A841; T617, T688, and T862; T617, A696, and T702; T617, A696, and A709 ;T617, A696, and A712;T617, A696, and T714;T617, A696, and A790;T617, A696, and A841;T617, A696, and T862;T617, T702, and A709;T617, T702, and A712;T617, T702, and T714;T617, T702, and A790;T617, T702, and A841;T617, T702, and T862;T617, A709, and A712;T617, A709, and T714;T617, A709, and and A790; T617, A709, and A841; T617, A709, and T862; T617, A712, and T714; T617, A712, and A790; T617, A712, and A841; T617, A712, and T862; T617, T714, and A790; T617, T714, and A841; T617, T714, and T862; T617, A790, and A841; T617, A790, and T862; T617, A841, and T862; T688, A696, and T702; T688, A696, and A709;T688, A696, and A712;T688, A696, and T714;T688, A696, and A790;T688, A696, and A841;T688, A696, and T862;T688, T702, and A709;T688, T702, and A712;T688, T702, and T714;T688, T702, and A790;T688, T702, and A841;T688, T702, and T862;T688, A709, and A712;T688, A709, and T714;T688, A709, and A790;T688, A709, and A841;T688, A709, and T862;T688, A712, and T714;T688, A712, and A790;T688, A712, and A841;T688, A712, and T862;T688, T714, and A790;T688, T714, and A841;T688, T714, and T862;T688, A790, and A841;T688, A790, and T862;T688, A841, and T862;A696, T702, and A709;A696, T702, and A712;A696, T702, and T714;A696, T702, and A790;A696, T702, and A841;A696, T702, and T862;A696, A709, and A712;A696, A709, and T714;A696, A709, and A790;A696, A709, and A841;A696, A709, and T862;A696, A712, and T714;A696, A712, and A790;A696, A712, and A841;A696, A712 , and T862;A696, T714, and A790;A696, T714, and A841;A696, T714, and T862;A696, A790, and A841;A696, A790, and T862;A696, A841, and T862;T702, A709, and A712;T702, A709, and T714;T702, A709, and A790;T702, A709, and A841;T702, A709, and T862;T702, A712, and T714;T702, A712, and A790;T702 , A712, and A841;T702, A712, and T862;T702, T714, and A790;T702, T714, and A841;T702, T714, and T862;T702, A790, and A841;T702, A790, and T862;T702, A841, and T862;A709, A712, and T714;A709, A712, and A790;A709, A712, and A841;A709, A712, and T862;A709, T714, and A790;A709, T714, and A841;A709, T714, and T862; A709, A790, and A841; A709, A790, and T862; A709, A841, and T862; A712, T714, and A790; A712, T714, and A841; A712, T714, and T862; A712, A790, and A841; A712, A790, and T862; A712, A841, and T862; T714, A790, and A841; T714, A790, and T862; T714, A841, and T862; or three mutations at positions corresponding to A790, A841, and T862 may be present within the promoter sequence.

[0054] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations may be present in the promoter sequence at the following positions relative to SEQ ID NO: 28: T688 and A696; T688 and T702; T688 and A712; T688 and T714; A696 and T702; A696 and A712; A696 and T714; T702 and A712; T702 and T714; or A712 and T714.

[0055] In some embodiments, the nucleotide sequence of the promoter element provided herein may comprise three mutations compared to the nucleotide sequence of the reference promoter element.For example, in some embodiments, three mutations may be present in the promoter sequence at the following positions relative to SEQ ID NO: 28: T688, A696, and T702; T688, A696, and A712; T688, A696, and T714; T688, T702, and A712; T688, T702, and T714; T688, A712, and T714; A696, T702, and A712; A696, T702, and T714; A696, A712, and T714; or T702, A712, and T714.

[0056] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, four mutations may be present in the promoter sequence at the following positions relative to SEQ ID NO: 28: T688, A696, T702, and A712; T688, A696, T702, and T714; T688, A696, A712, and T714; T688, T702, A712, and T714; or A696, T702, A712, and T714.

[0057] In some embodiments, the nucleotide sequence of a promoter element provided herein may contain five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations may be present in the promoter sequence at positions corresponding to the following positions relative to SEQ ID NO: 28: T688, A696, T702, A712, and T714.

[0058] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following positions relative to SEQ ID NO: 28 are present: 146 and 154; 146 and 303; 146 and 426; 146 and 433; 146 and 435; 146 and 530; 146 and 572; 146 and 596; 146 and 617; 146 and 688; 146 and 696; 146 and 702; 146 and 709; 146 and 712; 146 and 714; 146 and 790; 146 and 841; 146 and 862; 154 and 303; 154 and 4 26;154 and 433;154 and 435;154 and 530;154 and 572;154 and 596;154 and 617;154 and 688;154 and 696;154 and 702;154 and 709;154 and A712;154 and 714;154 and 790;154 and 841;154 and 862;303 and 426;303 and 433;303 and 435;303 and 530;303 and 572;303 and 596;303 and 617;303 and and 688;303 and 696;303 and 702;303 and 709;303 and A712;303 and 714;303 and 790;303 and 841;303 and 862;426 and 433;426 and 435;426 and 530;426 and 572;426 and 596;426 and 617;426 and 688;426 and 696;426 and 702;426 and 709;426 and A712;426 and 714;426 and 790;426 and 841;42 6 and 862;433 and 435;433 and 530;433 and 572;433 and 596;433 and 617;433 and 688;433 and 696;433 and 702;433 and 709;433 and A712;433 and 714;433 and 790;433 and 841;433 and 862;435 and 530;435 and 572;435 and 596;435 and 617;435 and 688;435 and 696;435 and 702;435 and 709;435 and A712;435 and 714;435 and 790;435 and 841;435 and 862;530 and 572;530 and 596;530 and 617;530 and 688;530 and 696;530 and 702;530 and 709;530 and A712;530 and 714;530 and 790;530 and 841;530 and 862;572 and 596;572 and 617;572 and 688;572 and 696;572 and 70 2;572 and 709;572 and A712;572 and 714;572 and 790;572 and 841;572 and 862;596 and 617;596 and 688;596 and 696;596 and 702;596 and 709;596 and A712;596 and 714;596 and 790;596 and 841;596 and 862;617 and 688;617 and 696;617 and 702;617 and 709;617 and A712;617 and and 714;617 and 790;617 and 841;617 and 862;688 and 696;688 and 702;688 and 709;688 and A712;688 and 714;688 and 790;688 and 841;688 and 862;696 and 702;696 and 709;696 and A712;696 and 714;696 and 790;696 and 841;696 and 862;702 and 709;702 and A712;702 and 714;70 Two mutations at positions corresponding to A712 and A790; 702 and 841; 702 and 862; 709 and A712; 709 and 714; 709 and 790; 709 and 841; 709 and 862; A712 and 714; A712 and 790; A712 and 841; A712 and 862; 714 and 790; 714 and 841; 714 and 862; 790 and 841; 790 and 862; or 841 and 862 may be present within the promoter sequence.

[0059] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, the following positions relative to SEQ ID NO: 28: 146, 154, and 303; 146, 154, and 426; 146, 154, and 433; 146, 154, and 435; 146, 154, and 530; 146, 154, and 572; 146, 154, and 596; 146, 154, and 617; 146, 154, and 688; 146, 154, and 696; 146, 154, and 702; 146, 154, and 709; 146, 154, and 712; 146, 154, and 714;146, 154, and 790;146, 154, and 841;146, 154, and 862;146, 303, and 426;146, 303, and 433;146, 303, and 435;146, 303, and 530;146, 303, and 572;146, 303, and 596;146, 303, and 617;146, 303, and 688;146, 303, and 696;146, 303, and 702;146, 303, and 709;1 46, 303, and A712;146, 303, and 714;146, 303, and 790;146, 303, and 841;146, 303, and 862;146, 426, and 433;146, 426, and 435;146, 426, and 530;146, 426, and 572;146, 426, and 596;146, 426, and 617;146, 426, and 688;146, 426, and 696;146, 426, and 702;146, 426, and 709;1 46, 426, and A712;146, 426, and 714;146, 426, and 790;146, 426, and 841;146, 426, and 862;146, 433, and 435;146, 433, and 530;146, 433, and 572;146, 433, and 596;146, 433, and 617;146, 433, and 688;146, 433, and 696;146, 433, and 702;146, 433, and 709;146, 433, and A712;146, 433, and 714;146, 433, and 790;146, 433, and 841;146, 433, and 862;146, 435, and 530;146, 435, and 572;146, 435, and 596;146, 435, and 617;146, 435, and 688;146, 435, and 696;146, 435, and 702;146, 435, and 709;146, 435, and 712;146, 435, and 714;146, 435, and 790;146, 435, and 841;146, 435, and 862;146, 530, and 572;146, 530, and 596;146, 530, and 617;146, 530, and 688;146, 530, and 696;146, 530, and 702;146, 530, and 709;146, 530, and 712;146, 530, and 714;146, 530, and 790;146, 530, and 841;146, 530, and 862;146, 572, and 596;146, 572, and 617;146, 572, and 688;146, 572, and 696;1 46, 572, and 702;146, 572, and 709;146, 572, and A712;146, 572, and 714;146, 572, and 790;146, 572, and 841;146, 572, and 862;146, 596, and 617;146, 596, and 688;146, 596, and 696;146, 596, and 702;146, 596, and 709;146, 596, and A712;146, 596, and 714;146, 596, and 790;146, 596, and 841;146, 596, and 862;146, 617, and 688;146, 617, and 696;146, 617, and 702;146, 617, and 709;146, 617, and A712;146, 617, and 714;146, 617, and 790;146, 617, and 841;146, 617, and 862;146, 688, and 696;146, 688, and 702;146, 688, and 709;146, 688, and A712;146, 688, and 714;146, 688, and 790;146, 688, and 841;146, 688, and 862;146, 696, and 702;146, 696, and 709;146, 696, and A712;146, 696, and 714;146, 696, and 790;146, 696, and 841;146, 696, and 862;146, 702, and 709;146, 702, and A712;146, 702, and 714;146, 702, and 790;146, 702, and 841;146, 702, and 862;146, 709, and A712;146, 709, and 714;146, 70 9, and 790;146, 709, and 841;146, 709, and 862;146, A712, and 714;146, A712, and 790;146, A712, and 841;146, A712, and 862;146, 714, and 790;146, 714, and 841;146, 714, and 862;146, 790, and 841;146, 790, and 862;146, 841, and 862;154, 303, and 426;154, 303, and 433;154, 303, and 435;154, 303, and 5 30;154, 303, and 572;154, 303, and 596;154, 303, and 617;154, 303, and 688;154, 303, and 696;154, 303, and 702;154, 303, and 709;154, 303, and 712;154, 303, and 714;154, 303, and 790;154, 303, and 841;154, 303, and 862;154, 426, and 433;154, 426, and 435;154, 426, and 530;154, 426, and 572;154, 42 6, and 596;154, 426, and 617;154, 426, and 688;154, 426, and 696;154, 426, and 702;154, 426, and 709;154, 426, and A712;154, 426, and 714;154, 426, and 790;154, 426, and 841;154, 426, and 862;154, 433, and 435;154, 433, and 530;154, 433, and 572;154, 433, and 596;154, 433, and 617;154, 433, and 688;154, 433, and 696;154, 433, and 702;154, 433, and 709;154, 433, and 712;154, 433, and 714;154, 433, and 790;154, 433, and 841;154, 433, and 862;154, 435, and 530;154, 435, and 572;154, 435, and 596;154, 435, and 617;154, 435, and 688;154, 435, and 696;154, 435, and 702;154, 435, and 709;154, 435, and A712;154, 435, and 714;154, 435, and 790;154, 435, and 841;154, 435, and 862;154, 530, and 572;154, 530, and 596;154, 530, and 617;154, 530, and 688;154, 530, and 696;154, 530, and 702;154, 530, and 709;154, 530, and A712;154, 530, and 714;154, 530, and 790;154, 530, and 841;154, 530, and 862; 154, 572, and 596;154, 572, and 617;154, 572, and 688;154, 572, and 696;154, 572, and 702;154, 572, and 709;154, 572, and 712;154, 572, and 714;154, 572, and 790;154, 572, and 841;154, 572, and 862;154, 596, and 617;154, 596, and 688;154, 596, and 696;154, 596, and 702;154, 596, and 709;154, 596, and A712;154, 596, and 714;154, 596, and 790;154, 596, and 841;154, 596, and 862;154, 617, and 688;154, 617, and 696;154, 617, and 702;154, 617, and A712;154, 617, and 714;154, 617, and 790;154, 617, and 841;154, 617, and 862;154, 688, and 696;154, 688, and 702;154, 688, and 709;154, 688, and A712;154, 688, and 714;154, 688, and 790;154, 688, and 841;154, 688, and 862;154, 696, and 702;154, 696, and 709;154, 696, and A712;154, 696, and 714;154, 696, and 790;154, 696, and 841;154, 696, and 862;154, 702, and 709;154, 702, and A712;154, 702, and 714;154, 702, and 790;154, 702 , and 841;154, 702, and 862;154, 709, and A712;154, 709, and 714;154, 709, and 790;154, 709, and 841;154, 709, and 862;154, A712, and 714;154, A712, and 790;154, A712, and 841;154, A712, and 862;154, 714, and 790;154, 714, and 841;154, 714, and 862;154, 790, and 841;154, 790, and 862;154, 841, and 8 62;303, 426, and 433;303, 426, and 435;303, 426, and 530;303, 426, and 572;303, 426, and 596;303, 426, and 617;303, 426, and 688;303, 426, and 696;303, 426, and 702;303, 426, and 709;303, 426, and 712;303, 426, and 714;303, 426, and 790;303, 426, and 841;303, 426, and 862;303, 433, and 435;303, 43 3, and 530;303, 433, and 572;303, 433, and 596;303, 433, and 617;303, 433, and 688;303, 433, and 696;303, 433, and 702;303, 433, and 709;303, 433, and A712;303, 433, and 714;303, 433, and 790;303, 433, and 841;303, 433, and 862;303, 435, and 530;303, 435, and 572;303, 435, and 596;303, 435, and 617;303, 435, and 688;303, 435, and 696;303, 435, and 702;303, 435, and 709;303, 435, and A712;303, 435, and 714;303, 435, and 790;303, 435, and 841;303, 435, and 862;303,; 530, and 572;303, 530, and 596;303, 530, and 617;303, 530, and 688;303, 530, and 696;303, 530, and 702;303, 530, and 709;303, 530, and 712;303, 530, and 714;303, 530, and 790;303, 530, and 841;303, 530, and 862;303, 572, and 596;303, 572, and 617;303, 572, and 688;303, 572, and 696;303, 572, and 702;303, 572, and 709;303, 572, and A712;303, 572, and 714;303, 572, and 790;303, 572, and 841;303, 572, and 862;303, 596, and 617;303, 596, and 688;303, 596, and 696;303, 596, and 702;303, 596, and 709;303, 596, and A712;303, 596, and 714;303, 596, and 790;303, 596, and 841;303, 596, and 862;303 , 617, and 688; 303, 617, and 696; 303, 617, and 702; 303, 617, and 709; 303, 617, and A712; 303, 617, and 714; 303, 617, and 790; 303, 617, and 841; 303, 617, and 862; 303, 688, and 696; 303, 688, and 702; 303, 688, and 709; 303, 688, and A712; 303, 688, and 714; 303, 688, and 790; 303, 688, and 841; 303, 688, and and 862; 303, 696, and 702; 303, 696, and 709; 303, 696, and A712; 303, 696, and 714; 303, 696, and 790; 303, 696, and 841; 303, 696, and 862; 303, 702, and 709; 303, 702, and A712; 303, 702, and 714; 303, 702, and 790; 303, 702, and 841; 303, 702, and 862; 303, 709, and A712; 303, 709, and 714; 303, 709, and 790;303, 709, and 841;303, 709, and 862;303, A712, and 714;303, A712, and 790;303, A712, and 841;303, A712, and 862;303, 714, and 790;303, 714, and 841;303, 714, and 862;303, 790, and 841;303, 790, and 862;303, 841, and 862;426, 433, and 435;426, 433, and 530;426, 433, and 572;426, 433, and 596;426, 4 33, and 617;426, 433, and 688;426, 433, and 696;426, 433, and 702;426, 433, and 709;426, 433, and 712;426, 433, and 714;426, 433, and 790;426, 433, and 841;426, 433, and 862;426, 435, and 530;426, 435, and 572;426, 435, and 596;426, 435, and 617;426, 435, and 688;426, 435, and 696;426, 435, and 702 ;426, 435, and 709;426, 435, and A712;426, 435, and 714;426, 435, and 790;426, 435, and 841;426, 435, and 862;426, 530, and 572;426, 530, and 596;426, 530, and 617;426, 530, and 688;426, 530, and 696;426, 530, and 702;426, 530, and 709;426, 530, and A712;426, 530, and 714;426, 530, and 790;426, 53 0, and 841;426, 530, and 862;426, 572, and 596;426, 572, and 617;426, 572, and 688;426, 572, and 696;426, 572, and 702;426, 572, and 709;426, 572, and A712;426, 572, and 714;426, 572, and 790;426, 572, and 841;426, 572, and 862;426, 596, and 617;426, 596, and 688;426, 596, and 696;426, 596, and 702;426, 596, and 709;426, 596, and A712;426, 596, and 714;426, 596, and 790;426, 596, and 841;426, 596, and 862;426, 617, and 688;426, 617, and 696;426, 617, and 702;426, 617, and 709;426, 617, and A712;426, 617, and 714;426, 617, and 790;426, 617, and 841;426, 617, and 862;426, 688, and 696;426, 688, and 702;426, 688, and 709;426, 688, and A712;426, 688, and 714;426, 688, and 790;426, 688, and 841;426, 688, and 862;426, 696, and 702;426, 696, and 709;426, 696, and A712;426, 696, and 714;426, 696, and 790;426, 696, and 841;426, 696, and 862;426, 702, and 709;426, 702, and A712;426, 702, and 714; 426, 702, and 790;426, 702, and 841;426, 702, and 862;426, 709, and A712;426, 709, and 714;426, 709, and 790;426, 709, and 841;426, 709, and 862;426, A712, and 714;426, A712, and 790;426, A712, and 841;426, A712, and 862;426, 714, and 790;426, 714, and 841;426, 714, and 862;426, 790, and 841;426, 7 90, and 862;426, 841, and 862;433, 435, and 530;433, 435, and 572;433, 435, and 596;433, 435, and 617;433, 435, and 688;433, 435, and 696;433, 435, and 702;433, 435, and 709;433, 435, and A712;433, 435, and 714;433, 435, and 790;433, 435, and 841;433, 435, and 862;433, 530, and 572;433, 530, and 596;433, 530, and 617;433, 530, and 688;433, 530, and 696;433, 530, and 702;433, 530, and 709;433, 530, and 712;433, 530, and 714;433, 530, and 790;433, 530, and 841;433, 530, and 862;433, 572, and 596;433, 572, and 617;433, 572, and 688;433, 572, and 696;433, 572, and 702;433, 572, and 709;433, 572, and A712;433, 572, and 714;433, 572, and 790;433, 572, and 841;433, 572, and 862;433, 596, and 617;433, 596, and 688;433, 596, and 696;433, 596, and 702;433, 596, and 709;433, 596, and A712;433, 596, and 714;433, 596, and 790;433, 596, and 841;433, 596, and 862;433, 617, and 688;433, 617, and 696;4 33, 617, and 702;433, 617, and 709;433, 617, and A712;433, 617, and 714;433, 617, and 790;433, 617, and 841;433, 617, and 862;433, 688, and 696;433, 688, and 702;433, 688, and 709;433, 688, and A712;433, 688, and 714;433, 688, and 790;433, 688, and 841;433, 688, and 862;433, 696, and 702;433, 696, and 709;433, 696, and A712;433, 696, and 714;433, 696, and 790;433, 696, and 841;433, 696, and 862;433, 702, and 709;433, 702, and A712;433, 702, and 714;433, 702, and 790;433, 702, and 841;433, 702, and 862;433, 709, and A712;433, 709, and 714;433, 709, and 790;433, 709, and 841;433, 709, and 862;433, A712, and 714;433, A712, and 790;433, A712, and 841;433, A712, and 862;433, 714, and 790;433, 714, and 841;433, 714, and 862;433, 790, and 841;433, 790, and 862;433, 841, and 862;435, 530, and 572;435, 530, and 596;435, 530, and 617;435, 530, and 688;435, 530, and 696;435, 530, and 702;435, 53 0, and 709;435, 530, and A712;435, 530, and 714;435, 530, and 790;435, 530, and 841;435, 530, and 862;435, 572, and 596;435, 572, and 617;435, 572, and 688;435, 572, and 696;435, 572, and 702;435, 572, and 709;435, 572, and A712;435, 572, and 714;435, 572, and 790;435, 572, and 841;435, 572, and 862 ;435, 596, and 617;435, 596, and 688;435, 596, and 696;435, 596, and 702;435, 596, and 709;435, 596, and A712;435, 596, and 714;435, 596, and 790;435, 596, and 841;435, 596, and 862;435, 617, and 688;435, 617, and 696;435, 617, and 702;435, 617, and 709;435, 617, and A712;435, 617, and 714;435, 617 , and 790;435, 617, and 841;435, 617, and 862;435, 688, and 696;435, 688, and 702;435, 688, and 709;435, 688, and A712;435, 688, and 714;435, 688, and 790;435, 688, and 841;435, 688, and 862;435, 696, and 702;435, 696, and 709;435, 696, and A712;435, 696, and 714;435, 696, and 790;435, 696, and 841;435, 696, and 862;435, 702, and 709;435, 702, and A712;435, 702, and 714;435, 702, and 790;435, 702, and 841;435, 702, and 862;435, 709,; and A712;435, 709, and 714;435, 709, and 790;435, 709, and 841;435, 709, and 862;435, A712, and 714;435, A712, and 790;435, A712, and 841;435, A712, and 862;435, 714, and 790;435, 714, and 841;435, 714, and 862;435, 790, and 841;435, 790, and 862;435, 841, and 862;530, 572, and 596;530, 572, and 617;530, 572, and 688;530, 572, and 696;530, 572, and 702;530, 572, and 709;530, 572, and A712;530, 572, and 714;530, 572, and 790;530, 572, and 841;530, 572, and 862;530, 596, and 617;530, 596, and 688;530, 596, and 696;530, 596, and 702;530, 596, and 709;530, 596, and A712;530, 596, and 714;53 0, 596, and 790;530, 596, and 841;530, 596, and 862;530, 617, and 688;530, 617, and 696;530, 617, and 702;530, 617, and 709;530, 617, and A712;530, 617, and 714;530, 617, and 790;530, 617, and 841;530, 617, and 862;530, 688, and 696;530, 688, and 702;530, 688, and 709;530, 688, and A712;530, 688, and 714;530, 688, and 790;530, 688, and 841;530, 688, and 862;530, 696, and 702;530, 696, and 709;530, 696, and A712;530, 696, and 714;530, 696, and 790;530, 696, and 841;530, 696, and 862;530, 702, and 709;530, 702, and A712;530, 702, and 714;530, 702, and 790;530, 702, and 841;530, 702, and 862;530, 709, and A712;530, 709, and 714;530, 709, and 790;530, 709, and 841;530, 709, and 862;530, A712, and 714;530, A712, and 790;530, A712, and 841;530, A712, and 862;530, 714, and 790;530, 714, and 841;530, 714, and 862;530, 790, and 841;530, 790, and 862;530, 841, and 862;572, 596, and 617;57 2, 596, and 688;572, 596, and 696;572, 596, and 702;572, 596, and 709;572, 596, and A712;572, 596, and 714;572, 596, and 790;572, 596, and 841;572, 596, and 862;572, 617, and 688;572, 617, and 696;572, 617, and 702;572, 617, and 709;572, 617, and A712;572, 617, and 714;572, 617, and 790;572, 617, and 841;572, 617, and 862;572, 688, and 696;572, 688, and 702;572, 688, and 709;572, 688, and A712;572, 688, and 714;572, 688, and 790;572, 688, and 841;572, 688, and 862;572, 696, and 702;572, 696, and 709;572, 696, and A712;572, 696, and 714;572, 696, and 790;572, 696, and 841;572, 696, and A76 2;572, 702, and 709;572, 702, and A712;572, 702, and 714;572, 702, and 790;572, 702, and 841;572, 702, and 862;572, 709, and A712;572, 709, and 714;572, 709, and 790;572, 709, and 841;572, 709, and 862;572, A712, and 714;572, A712, and 790;572, A712, and 841;572, A712, and 862;572, 714, and 790;572, 714, and 841;572, 714, and 862;572, 790, and 841;572, 790, and 862;572, 841, and 862;596, 617, and 688;596, 617, and 696;596, 617, and 702;596, 617, and 709;596, 617, and 712;596, 617, and 714;596, 617, and 790;596, 617, and 841;596, 617, and 862;596, 688, and 696;596, 688, and 702;596, 688, and and 709;596, 688, and A712;596, 688, and 714;596, 688, and 790;596, 688, and 841;596, 688, and 862;596, 696, and 702;596, 696, and 709;596, 696, and A712;596, 696, and 714;596, 696, and 790;596, 696, and 841;596, 696, and 862;596, 702, and 709;596, 702, and A712;596, 702, and 714;596, 702, and 790;5 96, 702, and 841;596, 702, and 862;596, 709, and A712;596, 709, and 714;596, 709, and 790;596, 709, and 841;596, 709, and 862;596, A712, and 714;596, A712, and 790;596, A712, and 841;596, A712, and 862;596, 714, and 790;596, 714, and 841;596, 714, and 862;596, 790, and 841;596, 790, and 862;596, 84 1, and 862;617, 688, and 696;617, 688, and 702;617, 688, and 709;617, 688, and A712;617, 688, and 714;617, 688, and 790;617, 688, and 841;617, 688, and 862;617, 696, and 702;617, 696, and 709;617, 696, and A712;617, 696, and 714;617, 696, and 790;617, 696, and 841;617, 696, and 862;617, 702, and 709;617, 702, and A712;617, 702, and 714;617, 702, and 790;617, 702, and 841;617, 702, and 862;617, 709, and A712;617, 709, and 714;617, 709, and 790;617, 709, and 841;617, 709, and 862;617, A712, and 714;617, A712, and 790;617, A712, and 841;617, A712, and 862;617, 714, and 790;617, 714, and 841;61 7, 714, and 862;617, 790, and 841;617, 790, and 862;617, 841, and 862;688, 696, and 702;688, 696, and 709;688, 696, and A712;688, 696, and 714;688, 696, and 790;688, 696, and 841;688, 696, and 862;688, 702, and 709;688, 702, and A712;688, 702, and 714;688, 702, and 790;688, 702, and 841;688, 702, and and 862; 688, 709, and A712; 688, 709, and 714; 688, 709, and 790; 688, 709, and 841; 688, 709, and 862; 688, A712, and 714; 688, A712, and 790; 688, A712, and 841; 688, A712, and 862; 688, 714, and 790; 688, 714, and 841; 688, 714, and 862; 688, 790, and 841; 688, 790, and 862; 688, 841, and 862; 696, 702, and 7 09;696, 702, and A712;696, 702, and 714;696, 702, and 790;696, 702, and 841;696, 702, and 862;696, 709, and A712;696, 709, and 714;696, 709, and 790;696, 709, and 841;696, 709, and 862;696, A712, and 714;696, A712, and 790;696, A712, and 841;696, A712, and 862;696, 714, and 790;696, 714, and 841;696, 714, and 862;696, 790, and 841;696, 790, and 862;696, 841, and 862;702, 709, and A712;702, 709, and 714;702, 709, and 790;702, 709, and 841;702, 709, and 862;702, A712, and 714;702, A71 2, and 790;702, A712, and 841;702, A712, and 862;702, 714, and 790;702, 714, and 841;702, 714, and 862;702, 790, and 841;702, 790, and 862;702, 841, and 862;709, A712, and 714;709, A712, and 7 90;709, A712, and 841;709, A712, and 862;709, 714, and 790;709, 714, and 841;709, 714, and 862;709, 790, and 841;709, 790, and 862;709, 841, and 862;A712, 714, and 790;A712, 714, and 841;A7 A712, 790, and 841; A712, 790, and 862; A712, 841, and 862; 714, 790, and 841; 714, 790, and 862; 714, 841, and 862; or three mutations at positions corresponding to 790, 841, and 862 may be present in the promoter sequence.

[0060] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain two mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, two mutations may be present in the promoter sequence at positions corresponding to the following positions relative to SEQ ID NO: 28: 688 and 696; 688 and 702; 688 and A712; 688 and 714; 696 and 702; 696 and A712; 696 and 714; 702 and A712; 702 and 714; or A712 and 714.

[0061] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain three mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, three mutations may be present in the promoter sequence at the following positions relative to SEQ ID NO: 28: 688, 696, and 702; 688, 696, and A712; 688, 696, and 714; 688, 702, and A712; 688, 702, and 714; 688, A712, and 714; 696, 702, and A712; 696, 702, and 714; 696, A712, and 714; or 702, A712, and 714.

[0062] In some embodiments, the nucleotide sequence of the promoter element provided herein may contain four mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, four mutations may be present in the promoter sequence at positions corresponding to the following positions relative to SEQ ID NO: 28: 688, 696, 702, and A712; 688, 696, 702, and 714; 688, 696, A712, and 714; 688, 702, A712, and 714; or 696, 702, A712, and 714.

[0063] In some embodiments, the nucleotide sequence of a promoter element provided herein may contain five mutations compared to the nucleotide sequence of a reference promoter element. For example, in some embodiments, five mutations may be present in the promoter sequence at positions corresponding to the following positions: 688, 696, 702, A712, and 714 relative to SEQ ID NO: 28.

[0064] The nucleic acid molecules used in the methods described herein are typically DNA, although RNA molecules can also be used under appropriate circumstances. As used herein, "exogenous" refers to any nucleic acid sequence, or synthetically produced nucleic acid (e.g., a codon-optimized nucleic acid sequence), introduced into a cell from the same or a different organism. For example, an exogenous nucleic acid can be a nucleic acid from one microorganism (e.g., a genus or species of Pichia pastoris) introduced into a different genus or species of Pichia pastoris; an exogenous nucleic acid can also be a nucleic acid from Pichia pastoris that is recombinantly introduced into Pichia pastoris as an additional copy despite the presence of the corresponding native nucleic acid sequence, or a nucleic acid from Pichia pastoris that is recombinantly introduced into Pichia pastoris and contains one or more mutations, insertions, or deletions compared to the sequence native to Pichia pastoris. For example, P. pastoris contains an endogenous nucleic acid encoding ALAS; however, additional copies of the P. pastoris ALAS nucleic acid (e.g., introduced into P. pastoris by recombination) are considered exogenous. Similarly, an "exogenous" protein is one that is encoded by an exogenous nucleic acid.

[0065] In some cases, an exogenous nucleic acid can be a heterologous nucleic acid. As used herein, a "heterologous" nucleic acid refers to any nucleic acid sequence that is not native to an organism (e.g., a heterologous nucleic acid can be a nucleic acid from one microorganism (e.g., one genus or species of Pichia pastoris, whether codon-optimized or not) that has been introduced into a different genus or species of Pichia pastoris). Similarly, a "heterologous" protein is a protein encoded by a heterologous nucleic acid.

[0066] A nucleic acid molecule is considered to be exogenous to a host organism if any portion thereof (e.g., a promoter sequence or the sequence of the encoded protein) is exogenous to the host organism. A nucleic acid molecule is considered to be heterologous to a host organism if any portion thereof (e.g., a promoter sequence or the sequence of the encoded protein) is heterologous to the host organism.

[0067]

[0010] Provided herein are nucleic acid constructs that allow for the genetic engineering of cells (e.g., yeast cells (e.g., Pichia pastoris cells)). In some embodiments, provided herein are nucleic acid constructs that allow for the genetic engineering of cells (e.g., yeast cells (e.g., Pichia pastoris cells)) to make RNA. The recombinantly produced RNA may be used to modify cellular function, e.g., by RNA interference, or may be used as a guide for DNA editing. In some embodiments, provided herein are nucleic acid constructs that allow for the genetic engineering of cells (e.g., yeast cells (e.g., Pichia pastoris cells)) to make a product (e.g., a protein). In some embodiments, provided herein are nucleic acid constructs that allow for the genetic engineering of cells (e.g., yeast cells (e.g., Pichia pastoris cells)) to make an exogenous product (e.g., a protein). In some embodiments, provided herein are nucleic acid constructs that allow for the genetic engineering of cells (e.g., yeast cells (e.g., Pichia pastoris cells)) to make a heterologous product (e.g., a protein). In some embodiments, provided herein are nucleic acid constructs that allow a cell (e.g., a yeast cell (e.g., a Pichia pastoris cell)) to be engineered to produce a product (e.g., a protein) in the absence of methanol. Additionally, provided herein are nucleic acid constructs that allow a cell (e.g., a yeast cell (e.g., a Pichia pastoris cell)) to be engineered to increase expression of a heme-binding protein.

[0068] Also provided herein are cells comprising any of the promoter elements described herein. The cells can be any suitable cells. For example, the cells can be bacterial cells (e.g., E. coli cells, B. subtilis cells, or Lactococcus lactis cells), fungal cells, algae cells, plant cells, insect cells, or mammalian cells. In some embodiments, the cells can be yeast cells. Non-limiting examples of yeast cells include Pichia (e.g., Pichia methanolica, Pichia pastoris), Candida (e.g., Candida boidinii) cells, Hansenula (e.g., Hansenula polymorpha) cells, Torulopsis cells, and Saccharomyces (e.g., Saccharomyces cerevisiae) cells. In some embodiments, the cell may be a Pichia yeast cell. Non-limiting examples of Pichia cells include Pichia, Candida, Hansenula, and Torulopsis cells. In some embodiments, the cell may be a Pichia or a Saccharomyces cell.

[0069] In some embodiments, this document provides a cell containing a nucleic acid construct (e.g., a first nucleic acid construct, a second nucleic acid construct, etc.) comprising a nucleotide sequence operably linked to a promoter element described herein. The nucleic acid construct comprising the nucleotide sequence can comprise any suitable nucleotide sequence.

[0070] As used herein, "operably linked" means that a promoter or other expression element(s) is positioned relative to a coding sequence so as to direct or regulate the expression (e.g., in-frame) of the coding sequence.

[0071] It will be appreciated that a nucleic acid construct comprising a nucleotide sequence operably linked to any of the promoter elements described herein can comprise a nucleotide sequence of interest. In some embodiments, transcription and / or translation of the nucleotide sequence can result in the production of a product of interest (e.g., a protein, DNA, RNA, or a small molecule). For example, in some embodiments, a nucleic acid construct comprising a nucleotide sequence can be a nucleic acid construct that encodes a protein. For example, in some embodiments, a nucleic acid construct comprising a nucleotide sequence can be a nucleic acid construct that encodes RNA (e.g., mRNA, tRNA, ribozyme, siRNA, miRNA, or shRNA). For example, in some embodiments, a nucleic acid construct comprising a nucleotide sequence can be a nucleic acid construct that encodes DNA. For example, in some embodiments, a nucleic acid construct comprising a nucleotide sequence can be a nucleic acid construct whose transcription results in or contributes to the production of a small molecule (e.g., heme, ethanol, or a pharmaceutically active agent).

[0072] In some embodiments, a nucleic acid construct comprising a nucleotide sequence (e.g., a first nucleic acid construct, a second nucleic acid construct, etc.) may be a nucleic acid construct that encodes a protein (e.g., a first protein, a second protein, etc.).

[0073] Recombinantly expressed proteins can be widely used in many applications, such as food, research, and pharmaceutical applications. In some embodiments, the protein encoded by a nucleic acid construct comprising a nucleotide sequence operably linked to any of the promoter elements described herein can be a dehydrin, phytase, protease, catalase, lipase, peroxidase, amylase, transglutaminase, oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase. In some embodiments, the protein encoded by a nucleic acid operably linked to any of the promoter elements described herein is an antibody or fragment thereof (e.g., adalimumab, rituximab, trastuzumab, bevacizumab, infliximab, or ranibizumab), an enzyme (e.g., a therapeutic enzyme such as alpha-galactosidase A, alpha-L-induronidase, N-acetylgalactosamine-4-sulfatase, dornase alfa, glucocerebrosidase, tissue plasminogen activator, rasburicase), an industrial enzyme (e.g., catalase, cellulase, laccase), or a cytosolic enzyme (e.g., a cytosolic enzyme such as cytosolic enzyme, ... The enzyme may be a phosphodiesterase (e.g., a transaminase, glutaminase, or glycosidase), or a biocatalyst (e.g., a transaminase, cytochrome P450, kinase, phosphorylase, or isomerase), a regulatory protein (e.g., a transcription factor (e.g., Mxr1, Adr1)), a peptide hormone (e.g., a growth hormone such as insulin, insulin-like growth factor 1, granulocyte colony-stimulating factor, follicle-stimulating hormone, or human growth hormone), a blood clotting protein (e.g., Factor VII), a cytokine (e.g., an interferon or erythropoietin), or a cytokine inhibitor (e.g., etanercept).

[0074] In some embodiments, the protein can be a heme-binding protein (e.g., an exogenous or heterologous heme-binding protein). In some embodiments, the heme-binding protein can be selected from the group consisting of globin (PF00042 in the Pfam database), cytochrome (e.g., cytochrome P450, cytochrome a, cytochrome b, cytochrome c), cytochrome c oxidase, ligninase, catalase, and peroxidase. In some embodiments, the globin can be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin (e.g., betahemoglobin, alphahemoglobin), histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin (e.g., HbN, HbO, Glb3, cyanoglobin). In some embodiments, the heme-binding protein can be a non-symbiotic hemoglobin. In some embodiments, the heme-binding protein can be leghemoglobin. In some embodiments, the heme-binding protein can be soybean leghemoglobin (LegH). A reference amino acid sequence for LegH is provided in FIG. 1 as SEQ ID NO:4. LegH is a protein that binds heme, resulting in a characteristic absorption at 415 nm and a distinct red color. The LegH protein (also known as LGB2) is naturally found in soybean root nodules (see, e.g., UniprotKB Accession No. P02236). See also WO 2014 / 110539 and WO 2014 / 110532, each of which is incorporated by reference in its entirety. In some embodiments, a heme-binding protein can have an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence set forth in any of SEQ ID NOS: 1-27 (FIG. 1).In some embodiments, the heme-binding protein is an amino acid sequence set forth in any of SEQ ID NOs: 1-27 (FIG. 1).

[0075] Although materials and methods are exemplified herein using alcohol oxidase promoter elements from Pichia species (P. pastoris), other organisms may also be used. For example, alcohol oxidase promoter elements from different methylotrophic yeasts, such as other species of Pichia or species from any of the genera Candida, Hansenula, Pichia, and Torulopsis, may also be used. Non-limiting examples of methylotrophic yeast species include Pichia methanolica, Pichia pastoris, Candida boidinii, and Hansenula polymorpha (also known as Pichia angusta). In some embodiments, the promoter element can be an alcohol oxidase promoter element from any of the genera Candida, Hansenula, Pichia, and Torulopsis. In some embodiments, the promoter element can have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity to an alcohol oxidase promoter element from any of the genera Candida, Hansenula, Pichia, and Torulopsis. In some embodiments, the promoter element can be an alcohol oxidase promoter element from any of the genera Candida, Hansenula, Pichia, and Torulopsis.In some embodiments, the promoter element can be an alcohol oxidase promoter element from Pichia methanolica, Pichia pastoris, Candida boidinii, or Hansenula polymorpha. In some embodiments, the promoter element can have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity to an alcohol oxidase promoter element from Pichia methanolica, Pichia pastoris, Candida boidinii, or Hansenula polymorpha. In some embodiments, the promoter element can be an alcohol oxidase promoter element derived from Pichia methanolica, Pichia pastoris, Candida boidinii, or Hansenula polymorpha.Non-limiting examples of other alcohol oxidase promoters include the AOX2 promoter from Pichia pastoris (see, e.g., Ohi, Hideyuki, et al. Molecular and General Genetics MGG 243.5 (1994): 489-499, which is incorporated herein by reference in its entirety), the alcohol oxidase (AOD1) promoter from Candida boidinii (see, e.g., GenBank Accession No.: YSAAOD1A), the alcohol oxidase (MOX) promoter from Hansenula polymorpha (see, e.g., GenBank Accession No.: X02425), or the MOD1 or MOD2 promoters from Pichia methanolica (see, e.g., Raymond et al., 1998, Yeast, 14:11-23; and Nakagawa et al., 1999, Yeast, 15:1223-30). In some embodiments, the alcohol oxidase promoter element may be selected from the group consisting of promoter elements derived from AOX1, AOX2, AOD1, MOX, MOD1, and MOD2. In some embodiments, the alcohol oxidase promoter element may be a promoter element derived from AOX1. In some embodiments, the alcohol oxidase promoter element may be a promoter element derived from AOX2. In some embodiments, the alcohol oxidase promoter element may be a promoter element derived from AOD1. In some embodiments, the alcohol oxidase promoter element may be a promoter element derived from MOX. In some embodiments, the alcohol oxidase promoter element may be a promoter element derived from MOD1. In some embodiments, the alcohol oxidase promoter element may be a promoter element derived from MOD2.

[0076] In some embodiments, any of the cells described herein (e.g., a yeast cell (e.g., a Pichia pastoris cell)) can include a second nucleic acid construct comprising a nucleotide sequence whose transcription and / or translation can result in the production of a second product (e.g., a protein, RNA, DNA, or a small molecule) operably linked to a promoter element. In some embodiments, the promoter element to which the nucleotide sequence of the second nucleic acid construct is operably linked is the same as the promoter element to which the nucleotide sequence of the first nucleic acid construct is operably linked. In some embodiments, the promoter element to which the nucleotide sequence of the second nucleic acid construct is operably linked is a second promoter element. In some embodiments, the second promoter element can be any of the promoter elements described herein. In some embodiments, the second promoter element can have the same sequence as the first promoter element. In some embodiments, the second promoter element may include one or more mutations corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO:28. In some embodiments, the second promoter element may include one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, 12, 13, 14, 15, 16, 17, 18, or 19) mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28.In some embodiments, the second promoter element may include one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, 12, 13, 14, 15, 16, 17, 18, or 19) mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28, so long as the indicated nucleobases are not the same as the corresponding naturally occurring nucleobases. In some embodiments, one or more (e.g., two, three, four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862 may be present in the second promoter element. In some embodiments, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 may be present in the second promoter element. In some embodiments, the second promoter element may include one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, or T714G relative to SEQ ID NO: 28.In some embodiments, the second promoter element may include one or more (e.g., two, three, four, or five) mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, or 714G relative to SEQ ID NO: 28, so long as the indicated nucleobases are not the same as the corresponding naturally occurring nucleobases. In some embodiments, one or more (e.g., two, three, four, or five) mutations corresponding to one of the following positions relative to SEQ ID NO: 28 may be present in the second promoter element. In some embodiments, one or more (e.g., two, three, four, or five) mutations corresponding to one of the following positions relative to SEQ ID NO: 28 may be present in the second promoter element. In some embodiments, the second promoter element can be an inducible promoter element (eg, a methanol-inducible promoter element) or a constitutive promoter element.

[0077] When genetically engineering cells (e.g., yeast (e.g., Pichia pastoris)), any of several inducible promoters can generally be used. For example, a methanol-inducible promoter, or promoter elements derived therefrom, can be used. Suitable methanol-inducible promoters include pAOX1, described herein, as well as other methanol-inducible promoters, or promoter elements derived therefrom. These include, but are not limited to, the pAOX2 promoter from Pichia pastoris, the alcohol oxidase (AOD1) promoter from Candida boidinii (see, e.g., GenBank Accession No. YSAAOD1A), the alcohol oxidase (MOX) promoter from Hansenula polymorpha (see, e.g., GenBank Accession No. X02425), the MOD1 or MOD2 promoter from Pichia methanolica (see, e.g., Raymond et al., 1998, Yeast, 14:11-23; and Nakagawa et al., 1999, Yeast, 15:1223-30), the pAOX2 promoter from Pichia pastoris ...), the pAOX2 promoter from Pichia pastoris (see, e.g., Raymond et al., 1998, Yeast, 14:11-23), the pAOX2 promoter from Pichia pastoris (see, e.g. Examples of promoters that can be induced by methanol include the DHAS promoter from P. pastoris (see, e.g., GenBank Accession No. FJ752551) or promoter elements derived therefrom, the formaldehyde dehydrogenase (FLD1) promoter from P. pastoris (see, e.g., GenBank Accession No. AF066054), or the PEX8 promoter from P. pastoris (see, e.g., Kranthi et al., 2010, Yeast, 27:705-11). All of these promoters are known to be induced by methanol.Suitable constitutive promoters and constitutive promoter elements include, but are not limited to, the P. pastoris promoter (or portions thereof) derived from the gene for the strongly constitutively transcribed transcription elongation factor EF-1α (TEF1). Other suitable constitutive promoters (or promoter elements derived therefrom) may also be used, including, but not limited to, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter from P. pastoris (P. pastoris) (see, e.g., GenBank Accession No. U62648.1), the promoter from GCW14p (PAS_chr1-4_0586), a potential glycosylphosphatidylinositol (GPI)-anchored protein from P. pastoris (P. pastoris) (see, e.g., GenBank Accession No. XM_002490678), and the promoter from the 3-phosphoglycerate kinase gene (PGK1) from P. pastoris (P. pastoris) (see, e.g., GenBank Accession No. AY288296). It is further noted that inducible (e.g., methanol-inducible) promoters and constitutive promoters (or promoter elements derived therefrom) can be combined to further increase expression of any of the nucleic acids operably linked thereto.

[0078] In some embodiments, the second protein may be any of the proteins described above. In some embodiments, the second protein may be a transcription factor (e.g., Mxr1). In some embodiments, any of the promoter elements herein (e.g., the first promoter element or the second promoter element) may contain one or more recognition sequences for a transcription factor. Thus, in some embodiments, a feedback loop may be constructed such that a transcription factor drives the expression of a protein of interest and also drives the expression of additional copies of the transcription factor. In some embodiments, the transcription factor may be Mxr1. In some embodiments, the second protein can be a protein involved in heme biosynthesis (e.g., a protein selected from the group consisting of aminolevulinic acid synthase (ALAS), delta-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coprotoporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and / or ferrochelatase (FC)).

[0079] Nucleic acids encoding one or more of the eight different enzymes involved in heme biosynthesis (determined and annotated from the sequence of the Pichia pastoris genome) can be expressed as described herein. For example, heterologous nucleic acid molecules encoding ALA synthase, ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrochelatase can be expressed in strains described herein, such as yeast strains (e.g., Pichia pastoris strains). To engineer cells (e.g., yeast (e.g., Pichia pastoris)) to contain more than one heterologous nucleic acid (e.g., transgene), methanol-inducible and constitutive promoters, or elements derived therefrom, can be combined to further increase expression of such nucleic acids.

[0080] It will be understood that any of the cells described herein (e.g., yeast cells (e.g., Pichia pastoris cells)) can include additional nucleic acid constructs, such as a third, fourth, fifth, etc. nucleic acid construct, and in some embodiments, such constructs are as already described for the second nucleic acid construct.

[0081] Previous work in Saccharomyces cerevisiae identified ALAD and porphobilinogen deaminase as rate-limiting enzymes in heme biosynthesis (see, e.g., Hoffman et al., 2003, Biochem. Biophys. Res. Commun., 310(4):1247-53). However, heterologous expression of individual heme enzymes from the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter in P. pastoris failed to overcome limitations associated with the expression of heme-containing recombinant proteins (see, Krainer et al., 2015, Microb. Cell Fact., 13;14:4). Although it is envisioned that one or more of the genes involved in the heme biosynthetic pathway can be expressed from one or more constitutive promoters (see, e.g., U.S. Pat. No. 9,938,327, incorporated by reference in its entirety), expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing the entire heme biosynthetic pathway from a methanol-inducible promoter.

[0082] Also provided herein are methods of producing a product (e.g., a protein) using any of the nucleic acid constructs and / or cells described herein. In some embodiments, the methods provided herein can include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element. In some embodiments, the first promoter element can be any promoter element described herein. In some embodiments, the first promoter element comprises one or more mutations corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO:28. In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element comprises one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, 12, 13, 14, 15, 16, 17, 18, or 19) mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28.In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28, so long as the indicated nucleobases are not the same as the corresponding naturally occurring nucleobases. In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: T146; C154; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862. In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862.In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element comprises one or more (e.g., two, three, four, or five) mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element comprises one or more (e.g., two, three, four, or five) mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28, so long as the indicated nucleobases are not the same as the corresponding naturally occurring nucleobases. In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element comprises one or more (e.g., two, three, four, or five) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: T688; A696; T702; A712; or T714. In some embodiments, the methods provided herein may include expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element comprises one or more (e.g., two, three, four, or five) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: 688; 696; 702; 712; or 714. In some embodiments of any of the methods described herein, the method may be performed in the absence of added methanol.In some embodiments, the primary carbon source for the Pichia pastoris cells can be dextrose, sucrose, xylose, lactose, maltose, isomaltose, arabinose, a sugar alcohol, ethanol, acetate, or glycerol. In some embodiments, the primary carbon source can be selected from the group consisting of glucose, sucrose, sorbitol, methanol, and glycerol. In some embodiments, the primary carbon source can be selected from the group consisting of glucose, sucrose, sorbitol, and glycerol. In some embodiments, the primary carbon source can be an oligosaccharide or polysaccharide (e.g., starch, pectin, cellulose, or hemicellulose). In some embodiments, the primary carbon source for the Pichia pastoris cells can be a mixture of sugars (e.g., derived from cellulosic biomass or starch).

[0083] In some embodiments, the methods provided herein allow for increased product (e.g., protein) titer. In some embodiments, product (e.g., protein) titer may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more) compared to a corresponding method lacking a nucleic acid construct described herein. In some embodiments, the titer of a product (e.g., protein) includes expressing a nucleic acid encoding a first product (e.g., protein) operably linked to a first promoter element, wherein the first promoter element is located between nucleotide positions 668 and 734 (e.g., nucleotide positions 673 to 729, nucleotide positions 678 to 724, nucleotide positions 683 to 719, or nucleotide positions 684 to 729, 685 to 739, or 686 to 739) relative to SEQ ID NO:28. In some embodiments, the gene expression level of a gene that is amplified by a gene encoding a gene encoding a nucleotide sequence corresponding to a sequence of ...In some embodiments, product (e.g., protein) titer is measured by expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element is selected from the group consisting of T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T716C, T720C, T730C, T740C, T750C, T760C, T770C, T780C, T790C, T791C, T792C, T793C, T794C, T795C, T796C, T797C, T798C, T799C, T800C, T801C, T802C, T803C, T804C, T805C, T806C, T807C, T808C, T810C, T811C, T812C, T813C, T814C, T815C, T816C, T817C, T818C, T820C, T821C, T822C, T823C, T824C, T825C, T826C, T827C, T828C, T830C, T831C, T832C, T833C, T834C, T835C, T840C, T841C, T842C, T843C, T844C, T845C, T846C, T847C, T848C The increase may be at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method lacking any mutation selected from the group consisting of mutations corresponding to 714G, A790G, A841T, and T862A. In some embodiments, product (e.g., protein) titer can be measured by expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element is selected from the group consisting of 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 70A, 71A, 72A, 73A, 74A, 75A, 76A, 77A, 78A, 79A, 80A, 81A, 82A, 83A, 84A, 85A, 86A, 87A, 88A, 89A, 90A, 91A, 92A, 93A, 94A, 95A, 96A, 97A, 98A, 99A, 100A, 101A, 102A, 103A, 104A, 105A, 106A, 107A, 108A, 109A, 110B, 111B, 112A, 113A, 114A, 115A, 116A, 117A, 118A, 119A, 120A, 121A, 122A, 123A, 124A, 125A, 126A, 127A, 128A, 129A, 130A, 131A, 132A, 133A, 134A, 135A, 136A, 137 The increase may be at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method lacking any mutation selected from the group consisting of mutations corresponding to 2C, 709G, 712G, 714G, 790G, 841T, and 862A.In some embodiments, product (e.g., protein) titer is measured by expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element is located at nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T713, T726, T736, T746, T756, T766, T776, T786, T796, T802, T812, T826, T836, T846, T856, T866, T876, T886, T896, T902, T912, T926, T936, T946, T956, T966, T976, T986, T9 ... The increase may be at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method lacking any mutation at the nucleotide positions corresponding to A714, A790, A841, and T862. In some embodiments, product (e.g., protein) titer is measured by expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element is located at nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 79, 802, 809, 812, 814, 820, 825, 830, 835, 840, 845, 850, 851, 852, 853, 854, 855, 860, 865, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 902, 909, 912, 914, 915, 916, 917, 918, 920, 925, 926, 927, 928, 930, 932, 934, 936, 938, 940, 942, 946, 948, 949, 950, 952, 954, 956, 958, 959, 960, 961, 962, 963, 964, 965, The increase may be at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method lacking any mutations at nucleotide positions corresponding to 0, 841, and 862.

[0084] In some embodiments, the titer of a product (e.g., a protein) may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more) compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks any mutation selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO:28. In some embodiments, the titer of a product (e.g., a protein) may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more) compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks any mutation selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO:28.In some embodiments, the titer of a product (e.g., a protein) may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more) compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks any mutations at nucleotide positions corresponding to nucleotide positions T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. In some embodiments, the titer of a product (e.g., a protein) may be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more) compared to a corresponding method comprising expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks any mutations at nucleotide positions corresponding to nucleotide positions 688, 696, 702, 712, and 714 relative to SEQ ID NO:28.

[0085] Generally, "titer" is a measurement of the amount of a substance in a solution. As used herein, "titer" of a heme-binding protein refers to the total amount of polypeptide, whether or not bound to heme, unless otherwise specified. Product (e.g., protein) titer can be measured by any suitable method, such as high-performance liquid chromatography (HPLC), high-performance liquid chromatography-mass spectrometry (HPLC-MS), enzyme-linked immunosorbent assay (ELISA), or ultraviolet and / or visible spectroscopy.

[0086] As used herein, a "corresponding method" is a method that is essentially identical in all respects to the reference method except for the identified differences. For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations corresponding to mutations at nucleotide positions corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO:28, would be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the nucleic acid construct lacks any mutations corresponding to mutations at nucleotide positions corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO:28.For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28, can be used to express a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element. The method will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to an element, the nucleic acid construct lacking any of the mutations included in the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28.For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks one or more mutations at nucleotide positions corresponding to nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28, can be used to express a nucleic acid construct comprising a first promoter element, wherein the first promoter element lacks one or more mutations at nucleotide positions corresponding to nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. The method will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to an element, the nucleic acid construct lacking any of the mutations at nucleotide positions corresponding to nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28.For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO:28, can be used to express a nucleic acid construct comprising a first promoter element. The method will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to an element, wherein the nucleic acid construct lacks any of the mutations included in the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO:28.For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the first promoter element lacks one or more mutations at nucleotide positions corresponding to nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28, can comprise: The method will be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a nucleotide sequence encoding a first protein, the nucleotide sequence lacking any of the mutations at nucleotide positions corresponding to nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28.

[0087] For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO:28, would be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the nucleic acid construct lacks any of the mutations included in the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO:28. For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO:28, would be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the nucleic acid construct lacks any of the mutations included in the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO:28.For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations at nucleotide positions corresponding to nucleotide positions T688, A696, T702, A712, and T714 relative to SEQ ID NO:28, would be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the nucleic acid construct lacks any of the mutations included in the group consisting of mutations corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. For example, a corresponding method for expressing a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations at nucleotide positions corresponding to nucleotide positions 688, 696, 702, 712, and 714 relative to SEQ ID NO:28, would be essentially the same as the reference method in all aspects (e.g., genetic composition of the cells, temperature and times of culture, etc.), except that the corresponding method expresses a nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the nucleic acid construct lacks any of the mutations included in the group consisting of mutations corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO:28.

[0088] Genetic engineering of a cell (e.g., a yeast cell (e.g., a Pichia pastoris cell)) typically involves the introduction of a recombinant nucleic acid molecule (also referred to as a nucleic acid construct) into the cell. As described herein, a recombinant nucleic acid molecule typically includes an exogenous nucleic acid encoding a product (e.g., a protein (e.g., a protein involved in heme biosynthesis, a heme-binding protein, or a transcription factor) operably linked to at least one promoter element (e.g., an inducible promoter element or a constitutive promoter element). In some embodiments, a recombinant nucleic acid molecule may comprise a linear array of two or more protein-coding sequences operably linked to the same or separate promoter elements (e.g., a first promoter operably linked to a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) and a second promoter operably linked to a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein), or one promoter operably linked to a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) and a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein)). In some cases, a recombinant nucleic acid molecule comprising at least one promoter operably linked to a nucleotide sequence (e.g., encoding a protein) may be referred to as a cassette.

[0089] Recombinant nucleic acids may contain expression elements. Expression elements include nucleic acid sequences that direct and regulate the expression of nucleic acid coding sequences. One example of an expression element is a promoter sequence. Expression elements may also include introns, enhancer sequences, response elements, or induction elements that regulate the expression of nucleic acids. Expression elements can be derived from bacteria, yeast, insects, mammals, or viruses, and vectors may contain a combination of elements from different sources.

[0090] Nucleic acids can be detected using any number of amplification techniques (see, e.g., PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188) with appropriate oligonucleotide (e.g., primer) pairs. Several modifications to the original PCR method have been developed and can be used to detect selected nucleic acids.

[0091] Suitable transcription factors and nucleic acids encoding transcription factors (e.g., exogenous nucleic acids encoding transcription factors) include, for example, Mxr1 from Pichia pastoris. A representative P. pastoris Mxr1 nucleic acid sequence can be found, for example, in GenBank Accession No. DQ395124, while a representative P. pastoris Mxr1 polypeptide sequence can be found, for example, in GenBank Accession No. ABD57365. In some embodiments, the transcription factor can be a Mit1 sequence from P. pastoris (see, for example, GenBank Accession No. CAY70887). Suitable transcription factors may also be found in Hansenula polymorpha (e.g., Adr1; see, e.g., GenBank Accession No. AEOI02000005 for the nucleic acid sequence, bases 858873-862352, and GenBank Accession No. ESX01253 for the amino acid sequence); and Candida boidinii (e.g., Trm1; see, e.g., GenBank Accession No. AB365355 for the nucleic acid sequence, and GenBank Accession No. BAF99700 for the amino acid sequence; and Trm2; see, e.g., GenBank Accession No. AB548760 for the nucleic acid sequence, and GenBank Accession No. BAJ07608 for the amino acid sequence).

[0092] Transcription factors such as Mxr1 may normally be expressed at low levels. In some embodiments, it is desirable to place the exogenous nucleic acid (e.g., transcription factor) under the control of a promoter that is inducible.

[0093] In some embodiments, a transcription factor can bind to a promoter element described herein and activate transcription from the promoter element. In some embodiments, when a nucleic acid sequence encoding a transcription factor is operably linked to a promoter element to which it binds, a positive feedback loop can be created that helps drive the expression of other nucleic acid sequences (e.g., protein-encoding nucleic acid sequences) operably linked to the promoter. Non-limiting examples of transcription factors that can be used with an AOX1 promoter (e.g., a mutant AOX1 promoter) include Mxr1, Mit1, Adr1, Trm1, Trm2, and combinations thereof. In some embodiments, a transcription factor that can be used with an AOX1 promoter can include Mxr1. A non-limiting example of a transcription factor that can be used with a MOX promoter (e.g., a mutant MOX promoter) is Adr1. Non-limiting examples of transcription factors that can be used with an AOD1 promoter (e.g., a mutant AOD1 promoter) include Trm1, Trm2, or combinations thereof. In some embodiments, two methanol-regulated transcription factors (e.g., Mxr1 and Mit1) can be operably linked to a methanol-inducible promoter element (e.g., pAOX1).

[0094] The recombinant nucleic acid molecules described herein can be stably integrated into the genome of a cell (e.g., a yeast cell (e.g., a Pichia pastoris cell)) or can be expressed extrachromosomally from a replication-competent plasmid. Methods to achieve either are well known and routinely used in the art.

[0095] In addition, it is noted that a first nucleic acid construct (e.g., encoding a first protein (e.g., a heme-binding protein)) comprising a nucleotide sequence operably linked to a promoter element (e.g., a promoter element described herein) can be physically separated from a second nucleic acid construct (i.e., the first and second nucleic acid constructs can be completely separate molecules) comprising a nucleotide sequence (e.g., encoding a second protein (e.g., a transcription factor)) operably linked to a promoter element (e.g., a promoter element described herein). Alternatively, a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a promoter element (e.g., a promoter element described herein) and a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein) operably linked to a promoter element (e.g., a promoter element described herein) can be incorporated into the same nucleic acid construct. In some embodiments, a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a first protein) operably linked to a promoter element can be contiguous with a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein) operably linked to a promoter element. Those skilled in the art will appreciate that when a second nucleic acid construct comprising a nucleotide sequence (e.g., encoding a second protein) is contiguous with a first nucleic acid construct comprising a nucleotide sequence (e.g., encoding a protein of interest), a single promoter, or promoter element derived therefrom, can be used to drive transcription of both or all of the nucleotide sequences (e.g., nucleic acids encoding the first protein and the second protein).

[0096] Methods for introducing nucleic acids into cells (e.g., yeast cells (e.g., Pichia pastoris cells)) are known in the art and include, but are not limited to, transduction, electroporation, biolistic particle delivery, and chemical transformation. Methods for culturing cells (e.g., yeast cells (e.g., Pichia pastoris cells)) are also known in the art. See, e.g., Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2nd Ed., Humana Press, Inc. Under some circumstances, as supported herein, it may be desirable to introduce or add methanol to the culture medium, although methanol is not required to obtain efficient expression of one or more products of interest (e.g., proteins) at high levels. Under some circumstances (e.g., when one or more nucleic acids encoding an enzyme(s) involved in heme biosynthesis are expressed), it may be desirable to supplement the culture medium with iron, or a pharmaceutically or metabolically acceptable salt (or GRAS salt) thereof.

[0097] The methods provided herein can also include a step of purifying the expressed protein. As used herein, an "enriched" protein is one that accounts for at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more) of the mass of the producing cells by dry weight, or at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99%) of the mass of the producing cell lysate (e.g., excluding cell wall or membrane material) by dry weight. As used herein, a "purified" protein is one that has been separated from cellular components that naturally accompany it. Typically, a protein is considered to be "purified" when it is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) free, by dry weight, from other proteins and naturally occurring molecules with which it is naturally associated.

[0098] As used herein, nucleic acids may include DNA and RNA, and may include nucleic acids containing one or more nucleotide analogs or backbone modifications. Nucleic acids may be single-stranded or double-stranded, typically depending on their intended use. Nucleic acids and polypeptides that differ from a given sequence are also provided. Nucleic acids and polypeptides may have at least 50% sequence identity (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to a given nucleic acid or polypeptide sequence. In some embodiments, a nucleic acid or polypeptide may have 100% sequence identity to a given nucleic acid or polypeptide sequence.

[0099] In calculating percent sequence identity, two sequences are aligned and the number of identical matches, either nucleotides or amino acid residues, between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identity value. It will be appreciated that the length of the aligned region can be the size of a portion of one or both sequences up to the full length of the shortest sequence. It will also be appreciated that a single sequence may be aligned with more than one other sequence and, therefore, may have different percent sequence identity values ​​across each aligned region.

[0100] Alignment of two or more sequences to determine percent sequence identity can be performed using the computer program ClustalW, which allows nucleic acid or polypeptide sequences to be aligned over their entire length (global alignment), and default parameters (Chenna et al., 2003, Nucleic Acids Res., 31(13):3497-500). ClustalW calculates the best match between a query sequence and one or more subject sequences and aligns them so that identity, similarity, and difference can be determined. Gaps of one or more residues can be inserted into the query sequence, the subject sequence, or both to maximize sequence alignment. For rapid, pairwise alignment of nucleic acid sequences, default parameters (i.e., word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5) may be used; for alignment of multiple nucleic acid sequences, the following parameters may be used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transition: on. For rapid, pairwise alignment of polypeptide sequences, the following parameters may be used: word size: 1; window size: 5; scoring method: percentage; number of top diagonals: 5; and gap penalty: 3. For multiple alignment of polypeptide sequences, the following parameters may be used: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: GIy, Pro, Ser, Asn, Asp, Gln, Glu, Arg, and Lys; and residue-specific gap penalty: on. ClustalW can be run on the Internet, for example, at the Baylor College of Medicine Search Launcher website or the European Bioinformatics Institute website.

[0101] Changes can be introduced into nucleic acid molecules, resulting in changes to the amino acid sequence of the encoded polypeptide. For example, changes can be introduced into nucleic acid coding sequences using mutagenesis (e.g., site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, chemical mutagenesis, UV mutagenesis, or radiation-induced mutagenesis), or by chemically synthesizing nucleic acid molecules with such changes. Such nucleic acid changes can result in conservative and / or non-conservative amino acid substitutions at one or more amino acid residues. A "conservative amino acid substitution" is one in which one amino acid residue is replaced with a different amino acid residue having a similar side chain (see, for example, Dayhoff et al., 1978, Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352, which presents a frequency table for amino acid substitutions), whereas a non-conservative substitution is one in which an amino acid residue is replaced with an amino acid residue that does not have a similar side chain. Nucleic acid and / or polypeptide sequences may be modified as described herein to improve one or more properties, including, but not limited to, increased expression (e.g., transcription and / or translation), tighter regulation, deregulation, loss of catabolite repression, specificity, secretion, thermostability, solvent stability, oxidative stability, protease resistance, catalytic activity, and / or modified color.

[0102] As used herein, an "isolated" nucleic acid molecule is a nucleic acid molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease digestion) that does not naturally contain sequences flanking one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid molecule is derived.Such isolated nucleic acid molecules are generally introduced into vectors (e.g., cloning vectors or expression vectors) for ease of manipulation or to create fusion nucleic acid molecules, as discussed in more detail below.In addition, isolated nucleic acid molecules can include engineered nucleic acid molecules, such as recombinant nucleic acid molecules or synthetic nucleic acid molecules.

[0103] The vectors described herein can be introduced into host cells. As used herein, "host cell" refers to the particular cell into which a nucleic acid is introduced and also includes the progeny of such a cell that harbors the vector. A host cell can be any prokaryotic or eukaryotic cell. For example, nucleic acids can be expressed in bacterial cells such as Escherichia coli (E. coli), insect cells, yeast cells, or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art. Many methods, both in vivo and in vitro, for introducing nucleic acids into host cells are well known to those skilled in the art, including, but not limited to, electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer.

[0104] Nucleic acids can be isolated using techniques that are well-known in the art. For example, nucleic acids can be isolated using any method, including, but not limited to, recombinant nucleic acid technology and / or polymerase chain reaction (PCR). General PCR techniques are described, for example, in PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate nucleic acids. Isolated nucleic acids can also be chemically synthesized as a single nucleic acid molecule or a series of oligonucleotides.

[0105] Polypeptides can be purified from natural sources (e.g., biological samples) by known methods, such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography. Polypeptides can also be purified by expressing a nucleic acid, for example, in an expression vector. In addition, purified polypeptides can be obtained by chemical synthesis. Polypeptide purity can be measured using any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0106] Constructs or vectors containing the nucleic acid constructs described herein (e.g., nucleotide sequences encoding polypeptides operably linked to promoter elements described herein) are also provided. Constructs or vectors containing expression constructs or expression vectors can be commercially available or can be produced by recombinant DNA techniques as defined in the art. Constructs or vectors containing nucleic acids can have expression elements operably linked to such nucleic acids and can further include sequences such as sequences encoding selectable markers (e.g., antibiotic resistance genes). Constructs or vectors containing nucleic acids can encode chimeric or fusion polypeptides (i.e., polypeptides operably linked to heterologous polypeptides, which can be at the N-terminus or C-terminus of the polypeptide). Exemplary heterologous polypeptides are those that can be used in purifying the encoded polypeptide (e.g., 6xHis tags, glutathione S-transferase (GST)).

[0107] Nucleic acids can also be detected using hybridization. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Sections 7.37-7.57, 9.47-9.57, 11.7-11.8, and 11.45-11.57). Sambrook et al. disclose Southern blot conditions suitable for oligonucleotide probes less than about 100 nucleotides in length (Sections 11.45-11.46). The Tm between a sequence less than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Section 11.46. In addition, Sambrook et al. disclose Southern blot conditions suitable for oligonucleotide probes greater than about 100 nucleotides in length (see Sections 9.47-9.54). The Tm between a sequence greater than 100 nucleotides in length and a second sequence can be calculated using the formula provided in sections 9.50-9.51 of Sambrook et al.

[0108] In addition to the conditions under which the nucleic acid-containing membrane is prehybridized and hybridized, the conditions under which the nucleic acid-containing membrane is washed to remove excess probe and non-specifically bound probe can play a significant role in the stringency of hybridization. Such hybridization and washing can be carried out under moderately stringent or highly stringent conditions, as appropriate. For example, washing conditions can be made more stringent by reducing the salt concentration in the washing solution and / or by increasing the temperature at which washing is performed. By way of example only, highly stringent conditions typically include washing the membrane in 0.2x SSC at 65°C.

[0109] In addition, the interpretation of the amount of hybridization can be affected by, for example, the specific activity of the labeled oligonucleotide probe, the number of probe-binding sites on the template nucleic acid to which the probe is hybridized, and the amount of exposure to an autoradiograph or other detection medium. Those skilled in the art will readily appreciate that any number of hybridization and washing conditions can be used to study the hybridization of a probe nucleic acid molecule to an immobilized target nucleic acid, but it is important to study the hybridization of the probe to the target nucleic acid under identical hybridization, washing, and exposure conditions. Preferably, the target nucleic acids are on the same membrane.

[0110] A nucleic acid molecule is considered to hybridize to one nucleic acid but not to another nucleic acid if its hybridization to the other nucleic acid is at least 5 times (e.g., at least 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 50 times, or 100 times) greater than its hybridization to the other nucleic acid. The amount of hybridization may be quantified directly on the membrane or by autoradiography, for example, using a PhosphorImager or Densitometer (Molecular Dynamics, Sunnyvale, CA).

[0111] Polypeptides can be detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation, and immunofluorescence. Antibodies can be polyclonal or monoclonal. Antibodies with specific binding affinity for polypeptides can be produced using methods known in the art. Antibodies can be attached to a solid support, such as a microtiter plate, using methods known in the art. In the presence of the polypeptide, an antibody-polypeptide complex is formed.

[0112] Detection (e.g., of an amplification product, hybridization complex, or polypeptide) is typically achieved using a detectable label. The term "label" is intended to encompass the use of direct as well as indirect labels. Detectable labels include enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.

[0113] Described herein are methods that can be used to generate strains lacking sequences for selection (i.e., lacking selectable markers). These methods include the use of circular plasmid DNA vectors and linear DNA sequences; the circular plasmid DNA vector contains a selectable marker and an origin of DNA replication (also known as an autonomously replicating sequence (ARS)), and the linear DNA sequence contains sequences for integration into the Pichia genome by homologous recombination. In addition, the linear DNA molecule can contain nucleic acid sequences encoding one or more proteins of interest, such as, but not limited to, heme-binding LegH, dehydrin, phytase, protease catalase, lipase, peroxidase, amylase, transglutaminase, oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, one or more enzymes involved in pathways for the production of small molecules such as ethanol, lactate, butanol, adipic acid, or succinate, or antibodies against any such proteins.

[0114] Cells (e.g., yeast cells (e.g., Pichia cells)) are transformed with both DNA molecules, and transformants can be selected by the presence of a selectable marker on the circular plasmid. Transformants can then be screened for genomic integration of the linear DNA molecule, for example, using PCR. Once transformants that have properly integrated the marker-free linear DNA molecule are identified, the cells can be grown in the absence of selection for the circular plasmid. Because the marker-carrying plasmid is not stably maintained in the absence of selection, the plasmid is often lost very rapidly after selection is relaxed. The resulting strain possesses the integrated linear DNA in the absence of the heterologous sequence for selection. Thus, this approach can be used to construct strains (e.g., Pichia strains) that lack a selectable marker (e.g., a heterologous selectable marker) with little to no effect on recombinant product (e.g., protein) yield.

[0115] In accordance with the present disclosure, conventional molecular biology, microbiology, biochemistry, and recombinant DNA techniques within the skill of the art can be employed. Such techniques are fully explained in the literature. The following examples further illustrate the materials and methods of the present disclosure, but do not limit the scope of the methods and compositions described in the claims.

[0116] Exemplary Embodiments Embodiment 1. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28. Embodiment 2. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673 to 729 relative to SEQ ID NO:28. Embodiment 3. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to SEQ ID NO:28. Embodiment 4. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683 to 719 relative to SEQ ID NO:28. Embodiment 5. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688 to 714 relative to SEQ ID NO:28. Embodiment 6. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 7. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 8. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 9. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 10. The nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter has the sequence of SEQ ID NO: 29. Embodiment 11. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 12. The nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 13. The nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 14. The nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 15. The nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 16. The nucleic acid construct of any one of embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. Embodiment 17. The nucleic acid construct of any one of embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. Embodiment 18. The nucleic acid construct of any one of embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. Embodiment 19. The nucleic acid construct of any one of embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. Embodiment 20. The nucleic acid construct of any one of embodiments 11 to 15, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. Embodiment 21. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28. Embodiment 22. The nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28. Embodiment 23. The nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28. Embodiment 24. The nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28. Embodiment 25. The nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28. Embodiment 26. The nucleic acid construct of any one of embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 27. The nucleic acid construct of any one of embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 28. The nucleic acid construct of any one of embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 29. The nucleic acid construct of any one of embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 30. The nucleic acid construct of any one of embodiments 21 to 25, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO:28. Embodiment 31. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. Embodiment 32. The nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. Embodiment 33. The nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. Embodiment 34. The nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. Embodiment 35. The nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. Embodiment 36. The nucleic acid construct of any one of embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 37. The nucleic acid construct of any one of embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 38. The nucleic acid construct of any one of embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 39. The nucleic acid construct of any one of embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 40. The nucleic acid construct of any one of embodiments 1 to 35, wherein the first alcohol oxidase promoter element comprises the mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO:28. Embodiment 41. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO:28. Embodiment 42. The nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 43. The nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 44. The nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 45. The nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 46. The nucleic acid construct of any one of embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 47. The nucleic acid construct of any one of embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 48. The nucleic acid construct of any one of embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 49. The nucleic acid construct of any one of embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 50. The nucleic acid construct of any one of embodiments 1 to 45, wherein the first alcohol oxidase promoter element comprises the mutations 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO:28. Embodiment 51. The nucleic acid construct of any one of embodiments 1 to 50, wherein the first alcohol oxidase promoter element is an alcohol oxidase promoter element derived from a promoter selected from the group consisting of AOX1, AOX2, AOD1, MOX, MOD1, and MOD2. Embodiment 52. The nucleic acid construct of any one of embodiments 1 to 51, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element. Embodiment 53. The nucleic acid construct of any one of embodiments 1 to 52, wherein the first alcohol oxidase promoter element has at least 90% sequence identity to SEQ ID NO:28. Embodiment 54. The nucleic acid construct of any one of embodiments 1 to 52, wherein the first alcohol oxidase promoter element has at least 95% sequence identity to SEQ ID NO:28. Embodiment 55. The nucleic acid construct of any one of embodiments 1 to 54, further comprising a nucleotide sequence, wherein the nucleotide sequence is operably linked to the first alcohol oxidase promoter element. Embodiment 56. The nucleic acid construct of embodiment 55, wherein the nucleotide sequence encodes a first protein. Embodiment 57. The nucleic acid construct of embodiment 56, wherein the first protein is exogenous to the Pichia pastoris cell. Embodiment 58. The nucleic acid construct of embodiment 56 or embodiment 57, wherein the first protein is heterologous to the Pichia pastoris cell. Embodiment 59. The nucleic acid construct of any one of embodiments 56 to 58, wherein the first protein is selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, a cytokine inhibitor, and a heme-binding protein. Embodiment 60. The nucleic acid construct of any one of embodiments 56 to 59, wherein the first protein is a heme-binding protein. Embodiment 61. The nucleic acid construct of embodiment 60, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. Embodiment 62. The nucleic acid construct of embodiment 60, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. Embodiment 63 The nucleic acid construct of embodiment 60, wherein the heme-binding protein is a non-symbiotic hemoglobin. Embodiment 64 The nucleic acid construct of embodiment 60, wherein the heme-binding protein is leghemoglobin. Embodiment 65. The nucleic acid construct of embodiment 60, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of any of SEQ ID NOs: 1 to 27. Embodiment 66 The nucleic acid construct of any one of embodiments 1 to 65, wherein the first alcohol oxidase promoter element comprises a recognition sequence for a transcription factor. Embodiment 67. A cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is a nucleic acid construct described in any one of embodiments 1 to 66. Embodiment 68. The cell of embodiment 67, which is a yeast cell. Embodiment 69. The cell of embodiment 68, wherein the yeast cell is a Pichia pastoris cell. Embodiment 70. The cell of embodiment 69, wherein the Pichia pylori-utilizing Pichia cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. Embodiment 71. The cell of embodiment 69 or embodiment 70, wherein the methylotrophic yeast cell is a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. Embodiment 72. The cell of any one of embodiments 69 to 71, wherein the Pichia pastoris cell is a Pichia pastoris cell. Embodiment 73. The cell of any one of embodiments 67 to 72, further comprising a second nucleic acid construct comprising a nucleotide sequence, wherein the nucleotide sequence is operably linked to the first alcohol oxidase promoter element or to the second promoter element. Embodiment 74. The cell of embodiment 73, wherein the nucleotide sequence of the second nucleic acid construct is operably linked to a second promoter element having the same sequence as the first alcohol oxidase promoter element. Embodiment 75. The cell of any one of embodiments 73 to 74, wherein the nucleotide sequence of the second nucleic acid construct encodes a second protein. Embodiment 76 The cell of embodiment 75, wherein the second protein is a transcription factor. Embodiment 77. The cell of embodiment 76, wherein the nucleotide sequence encoding the second protein is operably linked to a second promoter element comprising a recognition sequence for a transcription factor. Embodiment 78 The cell of embodiment 76 or embodiment 77, wherein the first alcohol oxidase promoter element comprises a recognition sequence for a transcription factor. Embodiment 79. The cell of any one of embodiments 75 to 78, wherein the second protein is a protein involved in heme biosynthesis. Embodiment 80. The cell of embodiment 79, wherein the protein involved in heme biosynthesis is selected from the group consisting of aminolevulinic acid synthase (ALAS), delta-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coprotoporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and ferrochelatase (FC). Embodiment 81. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 82. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673 to 729 relative to SEQ ID NO:28. Embodiment 83. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678 to 724 relative to SEQ ID NO:28. Embodiment 84. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683 to 719, relative to SEQ ID NO:28. Embodiment 85. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688 to 714 relative to SEQ ID NO:28. Embodiment 86. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 87. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 88. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 89. The method of embodiment 81, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. Embodiment 90. The method of any one of embodiments 81 to 89, wherein the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28, is greater than the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element lacks any mutation at a nucleotide position corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO:28. Embodiment 91. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 92. The method of embodiment 91, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 93. The method of embodiment 91, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862, relative to SEQ ID NO:28. Embodiment 94. The method of embodiment 91, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 95. The method of embodiment 91, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 96. The method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. Embodiment 97. The method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. Embodiment 98. The method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. Embodiment 99. The method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714, compared to SEQ ID NO: 28. Embodiment 100. The method of any one of embodiments 91 to 95, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO:28. Embodiment 101. A nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28, wherein the titer of a product produced by expressing the nucleic acid construct is 101. The method of any one of embodiments 91 to 100, wherein the titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to an alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element lacks any mutation at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. Embodiment 102. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO:28. Embodiment 103. The method of embodiment 102, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28. Embodiment 104. The method of embodiment 102, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28. Embodiment 105. The method of embodiment 102, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28. Embodiment 106. The method of embodiment 102, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28. Embodiment 107. The method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 108. The method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 109. The method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 110. The method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 compared to SEQ ID NO: 28. Embodiment 111. The method of any one of embodiments 102 to 106, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28. Embodiment 112. A nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28, wherein the titer of a product produced by expressing the nucleic acid construct is greater than or equal to the titer of the first alcohol oxidase promoter. 112. The method of any one of embodiments 102 to 111, wherein the titer of product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a promoter element, wherein the first alcohol oxidase promoter element lacks any mutation at a nucleotide position selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28 is greater than the titer of product produced by expressing the nucleic acid construct. Embodiment 113. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. Embodiment 114. The method of embodiment 113, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. Embodiment 115. The method of embodiment 113, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. Embodiment 116. The method of embodiment 113, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. Embodiment 117. The method of embodiment 113, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. Embodiment 118. A nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28, wherein the titer of a product produced by expressing the nucleic acid construct is 118. The method of any one of embodiments 113 to 117, wherein the titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to an alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element lacks any mutation selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. Embodiment 119. The method of any one of embodiments 81 to 118, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 120. The method of any one of embodiments 81 to 118, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 121. The method of any one of embodiments 81 to 118, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 122. The method of any one of embodiments 81 to 118, wherein the first alcohol oxidase promoter element comprises the mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. Embodiment 123. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO:28. Embodiment 124. The method of embodiment 123, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 125. The method of embodiment 123, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 126. The method of embodiment 123, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 127. The method of embodiment 123, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 128. A nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28, wherein the titer of a product produced by expressing the nucleic acid construct is 128. The method of any one of embodiments 123 to 127, wherein the titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to an alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element lacks any mutation selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28. Embodiment 129. The method of any one of embodiments 81 to 128, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 130. The method of any one of embodiments 81 to 128, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 131. The method of any one of embodiments 81 to 128, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 132. The method of any one of embodiments 81 to 128, wherein the first alcohol oxidase promoter element comprises the mutations 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28. Embodiment 133. A method for producing a product in a cell, comprising: 55. A method comprising expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element is the nucleic acid construct of any one of embodiments 1 to 54. Embodiment 134. The method of any one of embodiments 81 to 133, wherein the first alcohol oxidase promoter element is an alcohol oxidase promoter element derived from a promoter selected from the group consisting of AOX1, AOX2, AOD1, MOX, MOD1, and MOD2. Embodiment 135. The method of any one of embodiments 81 to 134, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element. Embodiment 136 The method of any one of embodiments 81 to 135, wherein the first alcohol oxidase promoter element has at least 90% sequence identity to SEQ ID NO:28. Embodiment 137. The method of any one of embodiments 55 to 135, wherein the first alcohol oxidase promoter element has at least 95% sequence identity to SEQ ID NO:28. Embodiment 138. The method of any one of embodiments 81 to 137, wherein the first alcohol oxidase promoter element has the sequence of SEQ ID NO: 29. Embodiment 139. The method of any one of embodiments 81 to 138, wherein the cell is a yeast cell. Embodiment 140. The method of embodiment 139, wherein the yeast cell is a Pichia pastoris cell. Embodiment 141 The method of any one of embodiments 81 to 140, wherein the nucleotide sequence operably linked to the first alcohol oxidase promoter element encodes a first protein. Embodiment 142 The method of embodiment 141, wherein the first protein is exogenous to the cell. Embodiment 143 The method of any one of embodiments 141 to 142, wherein the first protein is heterologous to the cell. Embodiment 144. The method of any one of embodiments 141 to 143, wherein the first protein is selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, and a heme-binding protein. Embodiment 145 The method of any one of embodiments 141 to 144, wherein the first protein is a heme-binding protein. Embodiment 146. The method of embodiment 145, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. Embodiment 147. The method of embodiment 145, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. Embodiment 148. The method of embodiment 145, wherein the heme-binding protein is a non-symbiotic hemoglobin. Embodiment 149. The method of embodiment 145, wherein the heme-binding protein is leghemoglobin. Embodiment 150. The method of embodiment 145, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of any of SEQ ID NOs: 1-27. Embodiment 151 The method of any one of embodiments 81 to 150, wherein the first alcohol oxidase promoter element contains one or more recognition sequences for a transcription factor. Embodiment 152. The method of any one of embodiments 81 to 151, further comprising expressing a second nucleic acid construct comprising a nucleotide sequence, wherein the nucleotide sequence of the second nucleic acid construct is operably linked to the first alcohol oxidase promoter element or to a second promoter element. Embodiment 153. The method of embodiment 152, wherein the nucleotide sequence of the second nucleic acid construct is operably linked to a second promoter element having the same sequence as the first alcohol oxidase promoter element. Embodiment 154 The method of any one of embodiments 152 to 153, wherein the nucleotide sequence of the second nucleic acid construct encodes a second protein. Embodiment 155. The method of embodiment 154, wherein the second protein is a transcription factor. Embodiment 156. The method of embodiment 155, wherein the nucleotide sequence encoding the second protein is operably linked to a second promoter element comprising a recognition sequence for a transcription factor. Embodiment 157. The method of embodiment 155, wherein the first alcohol oxidase promoter element comprises a recognition sequence for a transcription factor. Embodiment 158. The method of embodiment 154, wherein the second protein is a protein involved in the biosynthesis of heme. Embodiment 159. The method of embodiment 158, wherein the protein involved in heme biosynthesis is selected from the group consisting of ALAS, ALAD, PBGD, UPG3S, UPG3D, COPROX, PROTOX, and FC. Embodiment 160 The method of any one of embodiments 81 to 159, carried out in the absence of added methanol.

[0117] The following examples further describe the materials and methods of this disclosure, but do not limit the scope of the claims. [Example]

[0118] [Example 1] polymerase chain reaction Genes of interest were amplified from genomic or plasmid DNA templates using Phusion Hi-fidelity DNA polymerase (New England Biolabs). Briefly, 0.6 μM each of forward and reverse primers were incubated with 10–50 ng of template DNA and 400 μM of nucleotide mix in the presence of 1–2 U of Phusion DNA polymerase. Reaction conditions were as follows:

[0119] [Table 1]

[0120] [Example 2] Plasmid construction by ligation 50-100 ng of restriction enzyme-digested plasmid was incubated with a 3-fold molar excess of PCR-amplified insert in the presence of T4 DNA ligase (New England Biolabs). Ligation was carried out at 16°C for more than 2 hours. DH10B electrocompetent E. coli cells were transformed with 2 μl of the ligation reaction.

[0121] [Example 3] Transformation of E. coli ElectroMax DH10B T1 Phage-Resistant Competent Cells 20 μl of ElectroMax DH10B T1 Phage-Resistant Competent Cells (Invitrogen, Cat. No. 12033-015) were transformed with 1.5 to 2 μl of the ligation mixture (Example 2) by electroporation using a MicroPulser (BioRad) set at 1.7 kV using a 1 mm gap cuvette (BioRad, Cat. No. 165-2089); after pulsing, 1 ml of SOC (super optimal broth with catabolite repression) was added to the cells, and the cells were incubated at 37°C for 1 hour with shaking at 200 rpm. 10 μl of the recovery mixture was plated onto LB (lysogeny broth) agar plates containing ampicillin at a concentration of 100 μg / ml. The plates were incubated overnight at 37°C. Plasmids were isolated and purified using the NUCLEOSPIN® Plasmid Kit from Macherev-Nagel according to the manufacturer's instructions.

[0122] [Example 4] Preparation of P. pastoris transformation-competent cells Selected strains of P. pastoris were grown to mid-exponential growth (approximately 2 OD) in 25 ml of YPD (yeast extract-peptone-dextrose) medium. Cells were harvested by centrifugation at 930 × g for 15 minutes. The cell pellet was resuspended in 2 ml of 80% YPD and 200 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), pH 6.8. 75 μl of 1 M DTT (dithiothreitol) was added. The resuspended cell pellet was mixed at 100 rpm at 30°C for 25 minutes. A volume of 40 ml of ice-cold sterile water was added to the suspension, and the cells were harvested by centrifugation at 1125 × g for 15 minutes and placed on ice. The cell pellet was resuspended in 40 ml of ice-cold water and collected for two additional washing steps as before. The cell pellet was then resuspended in 20 ml of 1 M ice-cold sorbitol and collected by centrifugation as before. The final cell pellet was suspended in 0.3 ml of 1 M ice-cold sterile sorbitol, aliquoted, and frozen at -80°C.

[0123] [Example 5] Transformation of P. pastoris Using a 1 mm gap GenePulser cuvette (BioRad) with the GenePulser (BioRad) set at 1.15 kV, 30 μl of electrocompetent P. pastoris cells were transformed with 50–100 ng of plasmid DNA. 1 ml of YPD / 1 M sorbitol was added and mixed with the cells at a 1:1 ratio. The cells were allowed to recover for 3 hours at 30°C with shaking at 100 rpm. 100 μl of the recovery mixture was plated onto a YPD plate containing the appropriate antibiotic (primary transformation plate), and the remaining transformed cells were plated onto a second YPD plate with the appropriate antibiotic. The plate was incubated at 30°C for 48 hours. An additional YPD plate with the appropriate antibiotic was streaked with the transformed cells from the primary transformation plate, and the plate was incubated at 30°C for 48 hours. Individual clones were patched onto YPD plates with antibiotics and the patches were used to grow strains in shake flasks for further analysis.

[0124] [Example 6] Construction of AOX1 promoter-green fluorescent protein reporter vector Vectors and mutants were constructed using green fluorescent protein (GFP) as a reporter protein to monitor expression from the AOX1 promoter. The GFP open reading frame was inserted into the pGAB vector (see, e.g., U.S. Pat. No. 9,938,327, incorporated herein by reference in its entirety) with a translation initiation signal immediately downstream of the methanol-inducible alcohol oxidase 1 (AOX1) promoter from Pichia pastoris and a translation termination signal immediately followed by a transcription termination sequence from the P. pastoris FDH1 gene.

[0125] The open reading frame encoding the Dasher GFP mutant protein was amplified by PCR from the pJ1214-03c plasmid vector from DNA2.0 Inc. (Newark, Calif.). The Dasher GFP open reading frame was amplified from pJ1214-03c using primers MxO0560 (GAGGGTCTCGGATGACAGCTTTAACTGAAGGGGCC; SEQ ID NO: 30) and MxO0561 (GAGGGTCTCGATTATTGGTAAGTGTCGAGATCAACTGCC; SEQ ID NO: 31), which added flanking Eco31I / BsaI restriction endonuclease recognition sites. Amplification was accomplished using the PCR described in Example 1.

[0126] The amplified Dasher GFP PCR product and pGAB vector were digested with 10 units of FastDigest Eco31I restriction endonuclease (ThermoFisher Scientific) in 1x FastDigest buffer (ThermoFisher Scientific) at 37°C for 1 hour. The amplified, Eco31I-digested Dasher GFP fragment and pGAB vector were separated by electrophoresis on a 1% agarose gel in 1x TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA (ethylenediaminetetraacetic acid), pH 8.3) and visualized using SYBR Safe DNA gel stain (Life Technologies, Carlsbad, Calif.). The desired DNA fragment was excised from the agarose gel, and DNA was recovered using a ZYMOCLEAN™ Gel DNA Recovery Kit (Zymo Research, Irvine, Calif.).

[0127] An Eco31I-digested fragment containing the Dasher GFP open reading frame was introduced into pGAB by ligation at the Eco31I site immediately downstream of the AOX1 promoter. A mixture containing 72 ng of Eco31I-digested DNA encoding the Dasher GFP open reading frame and 35 ng of Eco31I-digested pGAB was incubated with 400 units of T4 DNA ligase (New England Biolabs) in 1× T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl, 1 mM ATP, 10 mM DTT, pH 7.5 at 25°C) in a 20 μl reaction at 16°C for 2 hours. Electrocompetent E. coli DH10B cells were transformed with 2 μl of the ligation reaction, and antibiotic-resistant transformants were selected on listeria special broth (LSB) agar plates supplemented with 100 μg / μl ampicillin. Plates were incubated overnight at 37°C. Colonies were screened for the presence of the insert by PCR using primers MxO0560 and MxO0561. The sequence of the final vector was confirmed by DNA sequencing.

[0128] The resulting vector, pMx0369, contained the P. pastoris AOX1 promoter flanked by the Dasher GFP open reading frame and the P. pastoris FDH1 terminator. These elements were amplified from pMx0369 DNA with primers MxO0513 (GTGCTAGGATCCAACATCCAAAGACG; SEQ ID NO: 32) and MxO0514 (TTTTTCTAGAACCTTATCAAGATAGCTAGAAATAGAAATGGTTGC; SEQ ID NO: 33) using the polymerase chain reaction as described in Example 1. The primers introduced BamHI and XbaI restriction sites into the 5' and 3' ends of the amplified AOX1 promoter-Dasher GFP-FDH1 terminator DNA fragment, respectively. Using these restriction sites, Dasher GFP and the sequences required for its expression were cloned into the pIL75 episomal vector. The pIL75 vector carries the panARS autonomously replicating sequence (Liachko & Dunham, 2014, FEMS Yeast Res., 14:364-7), which allows for integration into the genome of transformed cells and maintenance of the plasmid vector without the kanMX marker for selection of transformants with the antibiotic G418. Both the amplified Dasher GFP-expressing DNA fragment and the pIL75 vector DNA were digested with 10 units of BamHI restriction endonuclease and 10 units of XbaI restriction endonuclease (New England Biolabs) in 1x CutSmart buffer (New England Biolabs) at 37°C for 1 hour. The BamHI-XbaI digested DNA fragments were separated by electrophoresis on a 1% agarose gel in 1x TBE buffer and visualized using SYBR Safe DNA gel stain. The desired DNA fragments were excised from the agarose gel and the DNA was recovered using a Zymoclean Gel DNA recovery kit.

[0129] A DNA fragment containing the P. pastoris AOX1 promoter, Dasher GFP open reading frame, and P. pastoris FDH1 terminator was introduced into a similarly digested pIL75 vector by ligation. A mixture containing 48 ng of the BamHI-XbaI-digested DNA fragment containing the sequence for Dasher GFP expression and 15 ng of BamHI-XbaI-digested pIL75 DNA was incubated with 400 units of T4 DNA ligase (New England Biolabs) in 1x T4 DNA ligase reaction buffer in a 20 μl reaction at 16°C for 2 hours. Electrocompetent E. coli DH10B cells were transformed with 2 μl of the ligation reaction, and antibiotic-resistant transformants were selected on LSB agar plates supplemented with 100 μg / μl ampicillin. The plates were incubated overnight at 37°C. Colonies were screened for the presence of inserts by PCR using primers MxO0513 and MxO0514. The sequence of the final vector was confirmed by DNA sequencing. The resulting episomal vector, containing a sequence encoding the Dasher GFP variant, whose expression is under the control of the AOX1 promoter, was designated pMx0379.

[0130] [Example 7] Construction of strain MxY0270 The pMx0379 vector, carrying the Dasher GFP reporter under the control of the AOX1 promoter, was transformed into the Pichia pastoris host strain, MxY0051. The MxY0051 strain is a MutS strain and contains no other modifications. Transformants were selected and the plasmid maintained by growth on medium containing the antibiotic G418. Plates were incubated at 30°C for 48 hours. Individual clones were patched onto YPD plates with G418 antibiotic, and the patches were used to inoculate cultures in subsequent experiments.

[0131] [Example 8] Error-prone mutagenesis of the AOX1 promoter The pMx0369 vector was used as a template for amplification of the AOX1 promoter by error-prone PCR. Error-prone PCR was performed as described in McCullum, et al. (2010, Methods in Molecular Biology, 634:103-9). The pAOX1 promoter was amplified using primers MxO0569 (TCCTGCAGCCCGGGGGATCCAACATCCAAAGA; SEQ ID NO: 34) and MxO0570 (CTTCAGTTAAAGCTGTCATCGTTTCGAATAATTAGT; SEQ ID NO: 35) in a reaction containing 1 μM of each primer, 50 ng of template DNA, 1 mM dCTP and dTTP, 0.2 mM dATP and dGTP, 5.5 mM MgCl2, and 0.5 mM MnCl2, and 5 U of Taq DNA polymerase in a 1x reaction buffer (Invitrogen). The reaction conditions for error-prone amplification were as follows:

[0132] [Table 2]

[0133] The pMx0379 vector, excluding the pAOX1 promoter sequence, was amplified using primers MxO0571 (AACAACTAATTATTCGAAACGATGACAGCTTTAACT; SEQ ID NO: 36) and MxO0572 (ACCTTTCGTCTTTGGATGTTGGATCCCCCGGG; SEQ ID NO: 37) under standard PCR amplification conditions described in Example 1.

[0134] The pAOX1 promoter generated by error-prone amplification and the amplified pMx0379 vector DNA were each separated by electrophoresis on a 1% agarose gel in 1x TBE buffer and visualized using SYBR Safe DNA gel stain. The desired DNA fragment was excised from the agarose gel, and DNA was recovered using the ZYMOCLEAN™ Gel DNA Recovery Kit as described herein. The pAOX1 promoter sequence (600 ng) and vector DNA (200 ng) were assembled using Gibson assembly reaction mixture (New England Biolabs). The assembly reaction mixture was used to transform ElectroMaxDH10B competent cells as described in Example 3. After overnight growth on LB agar plates with ampicillin, the transformants were pooled in 50 ml of LB liquid medium containing 100 μg / ml ampicillin and grown for 4 hours at 37°C with shaking at 250 rpm. After amplification, plasmid DNA was recovered using the QIAGEN Plasmid Midi kit (Qiagen Inc.). The resulting DNA consisted of the pMx0379 vector containing various mutated pAOX1 promoter sequences.

[0135] [Example 9] Screening of the pAOX1 mutant library A pAOX1 promoter library consisting of the pAOX1 promoter generated by error-prone PCR driving expression of a GFP reporter was transformed into strain MxY0051. Transformants were selected and maintained by growth on YPD plates containing the antibiotic G418. Plates were incubated at 30°C for 72 hours, and colonies were screened for fluorescence using a Li-Cor Odyssey Fc imaging system (Li-Cor Biosciences, Lincoln, NE). A colony that showed significant fluorescence on YPD was identified. This colony was subcultured onto a fresh YPD plate along with the wild-type pAOX1 reference strain MxY0270 and confirmed to show increased GFP expression compared to the reference. This strain was designated MxY0279.

[0136] [Example 10] Recovery of mutant plasmids from MxY0279 Plasmid DNA was recovered from the transformed P. pastoris cells by resuspending the MxY0279 colony in 100 μl of lysis buffer (200 mM Li-acetate, 1% SDS) and heating the suspension to 70°C for 5 minutes. DNA was precipitated from the lysate by adding 300 μl of 100% ethanol followed by centrifugation at 15,000 × g for 3 minutes. The recovered material was washed with 70% ethanol to a volume of 1 ml, followed by centrifugation. The precipitated DNA was dissolved in 100 μl of DNA elution buffer (5 mM Tris / HCl, pH 8.5). 2 μl of the recovered DNA solution was used to transform ElectroMaxDH10B competent cells as described in Example 3, and bacterial transformants were recovered by plating on LB plates containing ampicillin at a concentration of 100 μg / ml. Plasmid DNA was isolated from the bacterial transformants using a QIAprep Spin Miniprep kit, and the sequence of the mutant promoter was determined by sequencing the plasmid DNA using primers MxO0569 and MxO0570. The recovered plasmid vector containing the mutant pAOX1 promoter driving GFP expression was designated pMx0414. The sequence is shown in SEQ ID NO: 29 in Figure 2, where the 19 mutation sites are double underlined.

[0137] [Example 11] Confirmation that improved GFP expression in MxY0279 results from pMx0414 The P. pastoris MxY0051 strain was transformed with the recovered pMx0414 plasmid as described in Example 3. YPD agar plates were streaked with the transformants and the MxY0270 control strain and incubated at 30°C for 3 days. Fluorescence from these cells was measured using a Li-Cor Odyssey Fc imaging system as described in Example 9. On YPD medium lacking the inducer methanol, the transformants showed significant expression from the mutant pAOX1 promoter, whereas the MxY0270 control strain, carrying a plasmid with GFP driven by the wild-type pAOX1 promoter, showed significantly reduced or absent fluorescence (Figure 3). These results confirm that the improved GFP expression observed in the original MxY0279 strain was due to mutations in the pMx0414 plasmid and not the host strain genome.

[0138] [Example 12] Shake flask culture of transformants and measurement of GFP expression As described herein, strains MxY0270 and MxY0279 carrying the pMx0379 and pMx0414 GFP expression plasmids were inoculated into growth medium (1% yeast extract, 2% peptone supplemented with 1% glycerol) containing the antibiotic G418 and grown overnight at 30°C with shaking at 200 rpm. The next day, the cultures were diluted overnight to an OD of 0.5-0.7 in YP medium supplemented with 1% dextrose, 1% glycerol, 1% methanol, or both 1% methanol and 1% dextrose. All media contained the G418 antibiotic.

[0139] GFP fluorescence in cultures expressing the reporter protein was measured using a SpectraMax M2 microplate reader and SoftMax Pro 6.1 software (Molecular Device, San Jose, Calif.) at an excitation wavelength of 485 nm and an emission wavelength of 525 nm. Fluorescence was measured in shake flask cultures 48 hours after dilution into the relevant carbon source. GFP fluorescence in relative fluorescence units (RFU) was normalized to the OD of the culture (see Figure 4).

[0140] [Example 13] Assessment of a set of mutations A combinatorial promoter library containing mutations present in a plasmid with all 19 mutations in pAOX1 (a promoter designated MxG0038; see, e.g., SEQ ID NO: 29) was assessed, where each mutated position in MxG0038 was either a wild-type or mutant nucleotide. A group of five mutations derived from the MxG0038 mutant was identified that conferred improved expression phenotypes. The mutant AOX1 promoter, containing the mutations T688C, A696T, T702C, A712G, and T714G, was designated MxG0220. Portions of the sequences of MxG0038 and MxG0020 are compared in Figure 5.

[0141] The relative expression of GFP using the wild-type pAOX1 promoter, the pAOX1 promoter containing all 19 mutations (promoter designated MxG0038 in strain MxY965), and the pAOX1 promoter containing the five selected mutations (promoter designated MxG0220) is shown in Figure 6.

[0142] Other embodiments While the present invention has been described in conjunction with its detailed description, it is to be understood that the foregoing description is intended to illustrate, but not to limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. Various embodiments of the present invention are described below. 1. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. 2. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein said first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. 3. The nucleic acid construct according to any one of 1 to 2 above, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. 4. The nucleic acid construct according to any one of 1 to 3 above, wherein the first alcohol oxidase promoter element comprises a mutation at a corresponding nucleotide position selected from the group consisting of T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. 5. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. 6. The nucleic acid construct according to any one of 1 to 5 above, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 7. The nucleic acid construct of any one of 1 to 5 above, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 8. The nucleic acid construct according to any one of 1 to 5 above, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 9. The nucleic acid construct of any one of 1 to 5 above, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 10. The nucleic acid construct according to any one of 1 to 5 above, wherein the first alcohol oxidase promoter element comprises the mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 11. A nucleic acid construct according to any one of 1 to 10 above, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element. 12. The nucleic acid construct according to any one of 1 to 11 above, wherein the first alcohol oxidase promoter element has at least 90% sequence identity to SEQ ID NO:28. 13. The nucleic acid construct according to any one of 1 to 12 above, further comprising a nucleotide sequence, said nucleotide sequence being operably linked to said first alcohol oxidase promoter element. 14. The nucleic acid construct according to claim 13, wherein the nucleotide sequence encodes a first protein. 15. The nucleic acid construct according to claim 13, wherein the first protein is selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, a cytokine inhibitor, and a heme-binding protein. 16. The nucleic acid construct according to any one of claims 13 to 14, wherein the first protein is a heme-binding protein. 17. The nucleic acid construct according to claim 16, wherein the heme-binding protein is leghemoglobin. 18. The nucleic acid construct according to 17 above, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any of the amino acid sequences of SEQ ID NOs: 1 to 27. 19. A cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is a nucleic acid construct described in any one of 1 to 18 above. 20. The cell of claim 19, further comprising a second nucleic acid construct comprising a nucleotide sequence, wherein the nucleotide sequence is operably linked to the first alcohol oxidase promoter element or to a second promoter element. 21. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668 to 734 relative to SEQ ID NO:28. 22. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:28. 23. The method of any of claims 21 to 22, wherein the first alcohol oxidase promoter element comprises one or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28. 24. A method for producing a product in a cell, comprising: 1. A method comprising: expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:28. 25. The method of any one of claims 21 to 24, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 26. The method of any one of claims 21 to 24, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 27. The method of any one of claims 21 to 24, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 28. The method of any of claims 21 to 24, wherein the first alcohol oxidase promoter element comprises the mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28. 29. A method according to any one of claims 21 to 28, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element. 30. A method according to any one of claims 21 to 29, wherein the first alcohol oxidase promoter element has at least 90% sequence identity to SEQ ID NO: 28. 31. A method according to any one of claims 21 to 30, wherein the nucleotide sequence operably linked to the first alcohol oxidase promoter element encodes a first protein. 32. The method of claim 31, wherein the first protein is selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, and a heme-binding protein. 33. A method according to any one of claims 31 to 32, wherein the first protein is a heme-binding protein. 34. The method according to claim 33, wherein the heme-binding protein is leghemoglobin. 35. The method according to claim 33, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. 36. A method according to any one of claims 21 to 35, carried out in the absence of added methanol.

Claims

1. 1. A nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO:28, and wherein the first alcohol oxidase promoter element has at least 90% sequence identity to SEQ ID NO:

28.

2. 2. The nucleic acid construct of claim 1, further comprising a nucleotide sequence, said nucleotide sequence operably linked to said first alcohol oxidase promoter element.

3. The nucleic acid construct of claim 2 , wherein the nucleotide sequence encodes a first protein.

4. 4. The nucleic acid construct of claim 3, wherein the first protein is selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, a cytokine inhibitor, and a heme-binding protein.

5. The nucleic acid construct of claim 3 or 4, wherein the first protein is a heme-binding protein.

6. The nucleic acid construct of claim 5 , wherein the heme-binding protein is leghemoglobin.

7. 6. The nucleic acid construct of claim 5, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any of the amino acid sequences of SEQ ID NOs: 1 to 27.

8. 6. The nucleic acid construct of claim 5, wherein the heme-binding protein comprises an amino acid sequence identical to any of the amino acid sequences of SEQ ID NOs: 1 to 27.

9. 9. The nucleic acid construct of claim 1, wherein the nucleic acid construct is capable of expressing a coding sequence operably linked to the first alcohol oxidase promoter element.

10. 1. A nucleic acid construct comprising a first alcohol oxidase promoter element and a second alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element and the second alcohol oxidase promoter element comprise mutations at nucleotide positions corresponding to T688C, A696T, T702C, A712G, and T714G, respectively, relative to SEQ ID NO:28, and wherein the first alcohol oxidase promoter element and the second alcohol oxidase promoter element each have at least 90% sequence identity to SEQ ID NO:28, and the nucleic acid construct further comprises a first nucleic acid sequence operably linked to the first alcohol oxidase promoter element and a second nucleic acid sequence operably linked to the second alcohol oxidase promoter element.

11. The nucleic acid construct of claim 9 or 10, wherein the first nucleic acid sequence encodes a transcriptional activator and the second nucleic acid sequence encodes an enzyme, a regulatory protein, or a heme-binding protein.

12. A cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is a nucleic acid construct described in any one of claims 1 to 11.

13. 13. The cell of claim 12, further comprising a second nucleic acid construct comprising a second nucleotide sequence, wherein the second nucleotide sequence is operably linked to the first alcohol oxidase promoter element or to a second promoter element.

14. 1. A method for producing a protein in a cell, comprising:

12. A method comprising expressing the nucleic acid construct of any one of claims 1 to 11, wherein the first alcohol oxidase promoter element is operably linked to a nucleotide sequence encoding the protein.

15. 15. The method of claim 14 carried out in the absence of added methanol.

16. 15. The method of claim 14 carried out in the presence of added methanol.

Citation Information

Patent Citations

  • Pichia yeast phytase expression system containing reorganized ethyl alcohol oxidase promotor

    CN1749399A

  • Genetically engineered human-derived Kunitz domains that inhibit human neutrophil elastase

    EP1734121A2

  • Tools for multiprotein complex expression in pichia pastoris

    EP3128006A1

  • Yeast Expression of Group b Neisseria meningitidis Outer Membrane (mb3) Proteins and Vaccines

    JP2001508758A

  • Mutant AOX1 promoter

    JP2008531000A