Humanized and chimeric monoclonal antibodies against CD47

Humanized or chimeric monoclonal antibodies targeting CD47 address the immunogenicity issue of existing antibodies, enhancing therapeutic efficacy by increasing phagocytosis of CD47-expressing cells for diagnostic and therapeutic applications.

JP7763230B2Active Publication Date: 2025-10-31THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2023219295
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2010-05-14
Filing Date
2023-12-26
Publication Date
2025-10-31
Estimated Expiration
2031-05-13

AI Technical Summary

Technical Problem

Existing anti-CD47 antibodies are highly immunogenic in humans, limiting their therapeutic efficacy in treating diseases associated with CD47, particularly cancer.

Method used

Development of humanized or chimeric monoclonal antibodies that bind to and neutralize human CD47, reducing immunogenicity and enhancing therapeutic applications.

Benefits of technology

The humanized or chimeric antibodies effectively increase phagocytosis of CD47-expressing cells, offering diagnostic and therapeutic benefits with reduced immune response in humans.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007763230000001
    Figure 0007763230000001
  • Figure 0007763230000002
    Figure 0007763230000002
  • Figure 0007763230000003
    Figure 0007763230000003
Patent Text Reader

Abstract

To provide anti-CD47 antibodies having low immunogenicity in humans.SOLUTION: Humanized or chimeric anti-CD47 monoclonal antibodies are provided. The antibodies bind to and neutralize human CD47, and are for use in various therapeutic methods. Preferred are non-activating antibodies. Embodiments of the invention include: isolated antibodies, derivatives and fragments thereof and pharmaceutical formulations comprising one or more kinds of the humanized or chimeric anti-CD47 monoclonal antibodies; and cell lines that produce these monoclonal antibodies. Also there are provided amino acid sequences of the antibodies.SELECTED DRAWING: Figure 14
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Macrophages remove pathogens and damaged or senescent cells from the bloodstream by phagocytosis. Cell surface CD47 interacts with its receptor, SIRPα, on macrophages to inhibit the phagocytosis of normal, healthy cells. CD47 is a widely expressed transmembrane glycoprotein with one Ig-like domain and five transmembrane regions that functions as a cellular ligand for SIRPα, with binding mediated by the NH2-terminal V-like domain of SIRPα. SIRPα is primarily expressed on myeloid cells, including macrophages, granulocytes, myeloid dendritic cells (DCs), mast cells, and their precursors (including hematopoietic stem cells).

[0002] SIRPα inhibits phagocytosis of host cells by macrophages, where ligation of SIRPα on macrophages by CD47 expressed on host target cells results in an inhibitory signal mediated by SHP-1 that negatively regulates phagocytosis. SIRPα acts to detect signals provided by "self" and negatively regulates innate immune effector functions against these cells.

[0003] Consistent with a role for CD47 in inhibiting phagocytosis of normal cells, there is evidence that CD47 is transiently upregulated on hematopoietic stem cells (HSCs) and progenitor cells just prior to and during their migratory phase, and that the level of CD47 on these cells determines the probability that the cells will be engulfed in vivo.

[0004] CD47 is also constitutively upregulated in many cancers, including myeloid leukemia. Overexpression of CD47 in myeloid leukemia cell lines increases their pathogenicity by allowing them to evade phagocytosis. We conclude that CD47 upregulation is an important mechanism protecting normal HSCs during inflammation-mediated recruitment, and that leukemia progenitor cells incorporate this ability to evade killing by macrophages. Summary of the Invention [Problem to be solved by the invention]

[0005] The present invention provides anti-CD47 antibodies that are less immunogenic in humans. [Means for solving the problem]

[0006] Compositions and methods relating to humanized or chimeric anti-CD47 monoclonal antibodies are provided. The antibodies of the invention bind to and neutralize human CD47 and are used in a variety of therapeutic methods. Non-activating antibodies are preferred. Embodiments of the invention include isolated antibodies and derivatives and fragments thereof, including one or more humanized or chimeric anti-CD47 monoclonal antibodies, pharmaceutical formulations, and cell lines producing these monoclonal antibodies. Antibody amino acid sequences are also provided.

[0007] The subject antibodies include the provided humanized or chimeric antibodies and variants thereof. The monoclonal antibodies of the present invention are particularly useful as reagents for the diagnosis and immunotherapy of diseases associated with CD47 in humans, particularly in cancer therapy. The advantages of the monoclonal antibodies of the present invention derive from the humanization process. Therefore, the in vivo use of the monoclonal antibodies of the present invention for immunotherapy greatly reduces the problem of significant host immune responses to the antibodies.

[0008] Various forms of antibodies are contemplated herein. For example, the anti-CD47 antibody can be a full-length chimeric or humanized antibody having the constant region of a human immunoglobulin of any isotype (e.g., IgG1, IgG2a, IgG2b, IgG3, IgG4, IgA, etc.), or an antibody fragment (e.g., F(ab')2 fragment and F(ab) fragment, etc.). Fragments containing the CDR regions are also interesting, for example, for imaging purposes. Furthermore, the antibody can be labeled with a detectable label, immobilized on a solid phase, and / or conjugated to a heterologous compound. The antibody can also be provided as a bispecific or multispecific antibody reactive with a second antigen (particularly including a cancer antigen).

[0009] Diagnostic and therapeutic uses of the antibodies are particularly contemplated for the detection and elimination of undesirable cells expressing CD47. In one diagnostic application, the invention provides a method for determining the presence of CD47 expressing cancer cells, comprising exposing a patient sample suspected of containing CD47 expressing cancer cells to an anti-CD47 antibody and determining binding of the antibody to the sample. For this use, the invention provides a kit comprising the antibody and instructions for use of the antibody.

[0010] The antibodies of the invention are particularly effective in treating disease, e.g., increasing phagocytosis of CD47-expressing cells. Treatment can be systemic or local, e.g., delivered by intratumoral injection.

[0011] Embodiments of the invention include isolated antibodies and derivatives and fragments thereof that comprise at least one, and usually at least three, CDR sequences provided herein, usually in combination with framework sequences from a human variable region or as isolated CDR peptides. In some embodiments, the antibody comprises at least one light chain comprising three light chain CDR sequences provided herein located in a variable region framework (which may be, but is not limited to, a human or mouse variable region framework), and at least one heavy chain comprising three heavy chain CDR sequences provided herein located in a variable region framework (which may be, but is not limited to, a human or mouse variable region framework).

[0012] In other embodiments, the antibodies comprise amino acid sequence variants of one or more CDRs of the provided antibodies, wherein the variants comprise one or more amino acid insertions within or adjacent to the CDR residues, and / or one or more deletions within or adjacent to the CDR residues, and / or one or more substitutions of one or more CDR residues (one or more substitutions are the preferred type of amino acid change for generating such variants). Such variants typically have a binding affinity to human CD47 of at least about 10. -8 M and binds to the same epitope as an antibody having the amino acid sequence shown herein. For example, the light chain CDR3 can be modified to mutate the deamidation site. Various forms of antibodies are contemplated herein. For example, the antibody can be a full-length antibody having, for example, a human immunoglobulin constant region of any isotype (e.g., IgG1, IgG2a, IgG2b, IgG3, IgG4, IgA, etc.), or an antibody fragment (e.g., F(ab')2 fragment and F(ab) fragment, etc.). Furthermore, the antibody can be labeled with a detectable label, immobilized on a solid phase, and / or conjugated to a heterologous compound.

[0013] The present invention further provides methods for producing antibodies, comprising an isolated nucleic acid encoding the antibody and variants thereof; a vector containing the nucleic acid, optionally operably linked to a control sequence recognized by a host cell transformed by the vector; a host cell containing the vector; culturing the host cells so that the nucleic acid is expressed; and, optionally, recovering the antibody from the host cell culture (e.g., from the host cell culture medium). The present invention also provides compositions comprising one or more human anti-CD47 antibodies and a pharmaceutically acceptable carrier or diluent. The compositions for therapeutic use are sterile, can be lyophilized, and provided, for example, as a unit dose prepackaged with a diluent and a delivery device (e.g., an inhaler, syringe, etc.). [Brief explanation of the drawings]

[0014] [Figure 1A] 1 shows the amino acid sequence of the B6H12 heavy chain variable region (A), with complementarity determining regions (CDRs) as indicated. [Figure 1B] 1 shows the amino acid sequence of the B6H12 light chain variable region (B), with complementarity determining regions (CDRs) as indicated. [Figure 2] Figure 1 shows SDS-PAGE analysis of purified B6H12 protein. Purified chimeric and humanized B6H12 were analyzed by SDS-PAGE under non-reducing conditions. Molecular weight standards are shown on the left. [Figure 3A] Graphs showing competition between chimeric and murine B6H12 antibodies for CD47 binding. A. Chimeric B6H12 competed with murine B6H12 for binding to YB2 / 0 cells stably transfected with human CD47 (YB2 / 0-CD47). A human IgG1 antibody was used as an isotype control. [Figure 3B]Graph showing competition between chimeric and murine B6H12 antibodies for CD47 binding. B. Murine B6H12 competed with chimeric B6H12 for binding to human CD47 expressed in transfected YB2 / 0 cells. Mouse IgG1 was used as an isotype control. [Figure 4A] FIG. 1 shows the nucleotide sequence of the humanized B6H12 heavy chain variable region (A). [Figure 4B] FIG. 1 shows the nucleotide sequence of the humanized B6H12 light chain variable region (B). [Figure 5] Figure 1 shows a comparison of the binding of chimeric and humanized B6H12 antibodies to human CD47 by flow cytometry. YB2 / 0 cells stably transfected with human CD47 were stained with chimeric B6H12, humanized B6H12, or a human IgG1 isotype control antibody. Bound antibody was detected with a PE-labeled secondary antibody. [Figure 6]

[0023] Figure 1 shows a comparison of the binding of chimeric and humanized B6H12 antibodies to human CD47 by ELISA. Soluble CD47 binding activity was measured by ELISA as described in "Materials and Methods." Bound antibody was detected with a goat anti-human kappa antibody conjugated to HRP, and the signal was developed using OPT. [Figure 7] Figure 1 shows graphs showing phagocytosis mediated by chimeric and humanized B6H12 antibodies. CFSE-labeled HL-60 cells were incubated with mouse bone marrow-derived macrophages at a target-to-effector cell ratio of 4:1. After 2 hours, macrophages were imaged by fluorescence microscopy to detect phagocytosis. The phagocytic index (the number of ingested target cells per 100 macrophages) was determined in duplicate for each condition. Statistical comparison of each antibody to the hIgG1 isotype control using Student's t-test showed that all antibodies were able to statistically significantly increase phagocytosis (p-values: mouse B6H12 antibody: 0.004; chimeric B6H12 antibody: 0.04; and humanized B6H12 antibody: 0.003). [Figure 8A]

[0023] Figure 1 shows the amino acid alignment of humanized B6H12 VL with human VK3-11 and JK1, and humanized B6H12 VH with human VH3-7 and JH4. The number of amino acids that differ between the humanized B6H12 sequence and the human germline sequence in the framework and CDR regions of VH and VL is summarized in the table. [Figure 8B]

[0023] Figure 1 shows the amino acid alignment of humanized B6H12 VL with human VK3-11 and JK1, and humanized B6H12 VH with human VH3-7 and JH4. The number of amino acids that differ between the humanized B6H12 sequence and the human germline sequence in the framework and CDR regions of VH and VL is summarized in the table. [Figure 9A] 1 shows the amino acid sequence of the 5F9 heavy chain variable region (A). Complementarity determining regions (CDRs) are as indicated. [Figure 9B] Figure 1 shows the amino acid sequence of the 5F9 light chain variable region (B), with complementarity determining regions (CDRs) as indicated. [Figure 10A] 1 shows the amino acid sequence of the 8B6 heavy chain variable region (A). Complementarity determining regions (CDRs) are as indicated. [Figure 10B] 1 shows the amino acid sequence of the 8B6 light chain variable region (B), with complementarity determining regions (CDRs) as indicated. [Figure 11] Figure 1 shows a comparison of the binding of chimeric 5F9 and 8B6 antibodies to human CD47 by ELISA. Soluble CD47 binding activity was measured by ELISA assay as previously described. Bound antibody was detected with a goat anti-human kappa antibody conjugated to HRP, and the signal was developed using OPT. [Figure 12A] Figure 1 shows the amino acid sequence alignment of various versions of the humanized 5F9 heavy chain variable region (A) with the germline sequence. The CDR regions are marked in red. [Figure 12B]Figure 1 shows the amino acid sequence alignment of different versions of the humanized 5F9 light chain variable region (B) with the germline sequence. The CDR regions are marked in red. [Figure 13] Figure 1 shows a comparison of the binding of humanized and chimeric 5F9 antibodies to human CD47 by ELISA. Soluble CD47 binding activity was measured by ELISA assay as previously described. Bound antibody was detected with a goat anti-human kappa antibody conjugated to HRP, and the signal was developed using OPT. [Figure 14] Figure 1 shows a graph showing phagocytosis induced by the 5F9 and 8B6 antibodies. HL-60 cells were used as target cells and incubated with human peripheral blood-derived macrophages at a target-to-effector cell ratio of 4:1. Each condition was performed in duplicate. DETAILED DESCRIPTION OF THE INVENTION

[0015] The present invention relates to humanized monoclonal antibodies specific for CD47. Also disclosed are the nucleic acid and amino acid sequences of such antibodies. These antibodies find use in therapeutic and diagnostic methods related to CD47.

[0016] "Treatment" refers to therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in whom the disorder is to be prevented.

[0017] "Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sport, or pet animals, such as dogs, horses, cats, cows, etc. Preferably, the mammal is a human.

[0018] The term "antibody" is used in the broadest sense and specifically encompasses monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, provided they exhibit the desired biological activity. "Antibodies" (Ab) and "immunoglobulins" (Ig) are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antigens and other antibody-like molecules that lack antigen specificity. Polypeptides of the latter type are produced, for example, at low levels by the lymphatic system and at increased levels by myelomas.

[0019] As used herein, the term "epitope" refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics.

[0020] "Native antibodies and immunoglobulins" are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, although the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain contains at one end a variable domain (V H ) followed by several constant domains. Each light chain has a variable domain (V L ) and a constant domain at its other end, with the light-chain constant domain aligned with the first constant domain of the heavy chain and the light-chain variable domain aligned with the heavy-chain variable domain. Particular amino acid residues are thought to form an interface between the light-chain variable domain and the heavy-chain variable domain (Clothia et al., J. Mol. Biol. 186:651 (1985); Novotny and Haber, Proc. Natl. Acad. Sci. USA 82:4592 (1985)).

[0021] The term "variable" refers to the fact that the sequences of certain portions of the variable domains vary considerably among antibodies and are used in the binding and specificity of each individual antibody for a particular antigen. However, variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments, called complementarity-determining regions (CDRs) or hypervariable regions, in both the light-chain and heavy-chain variable domains. The more highly conserved portions of the variable domains are called the framework (FR). Native heavy-chain and light-chain variable domains each contain four FR regions. The FR regions are primarily in a β-sheet configuration and are connected by three CDRs. The CDRs form loops that connect, and in some cases form part of, the β-sheet structure. The CDRs of each chain are held in close proximity by the FR regions and, together with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., National Institutes of Health, Bethesda, MD (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.

[0022] CDR sequences for exemplary anti-CD47 heavy and light chain combinations are set forth in the Sequence Listing, including B6H12 (SEQ ID NOS: 3-8), 5F9 (SEQ ID NOS: 20-25), and 8B6 (SEQ ID NOS: 28-33). In some embodiments, the CDR sequences for the individual heavy and light chain combinations set forth in B6H12, 5F9, and 8B6 are combined and retained. That is, a humanized antibody comprises both the B6H12 heavy chain CDR sequences and the B6H12 heavy chain CDR sequences, or both the 5F9 heavy chain CDR sequences and the 5F9 heavy chain CDR sequences, or the 8B6 heavy chain CDR sequences and the 8B6 heavy chain CDR sequences.

[0023] Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, each with one antigen-binding site, and a residual "Fc" fragment, a name reflecting its ability to readily crystallize. Pepsin treatment produces an F(ab')2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen.

[0024] An "Fv" is the minimum antibody fragment containing a complete antigen recognition and binding site. In two-chain Fv species, this region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. In single-chain Fv species (scFv), one heavy- and one light-chain variable domain can be covalently linked by a flexible peptide linker, allowing the light and heavy chains to associate in a "dimeric" structure similar to that in two-chain Fv species. In this configuration, the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three antigen-specific CDRs) has the ability to recognize and bind antigen, although with lower affinity than the entire binding site. For a review of scFvs, see Pluckthun, The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore (eds.), Springer-Verlag, New York, pp. 269-315 (1994).

[0025] Fab fragments also contain the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. As used herein, Fab'-SH designates Fab' in which one or more cysteine ​​residues of the constant domains bear a free thiol group. F(ab')2 antibody fragments were originally produced as a pair of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0026] There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, several of which can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy-chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are well known.

[0027] As used herein, "antibody fragment" and all grammatical variations thereof are defined as a portion of an intact antibody that contains the antigen-binding site or variable region of the intact antibody, but does not contain the constant heavy chain domains of the Fc region of the intact antibody (i.e., CH2, CH3, and CH4, depending on the antibody isotype). Examples of antibody fragments include Fab, Fab', Fab'-SH, F(ab')2, and Fv fragments; diabodies; any antibody fragment that is a polypeptide having a primary structure consisting of an uninterrupted sequence of contiguous amino acid residues (herein referred to as a "single-chain antibody fragment" or "single-chain polypeptide"), including, but not limited to, (1) a single-chain Fv (scFv) molecule, (2) a single-chain polypeptide containing only a light-chain variable domain without a heavy-chain portion, or a fragment thereof containing the three CDRs of the light-chain variable domain, and (3) a single-chain polypeptide containing only a heavy-chain variable region without a light-chain portion, or a fragment thereof containing the three CDRs of the heavy-chain variable region; and multispecific or multivalent structures formed from antibody fragments. In antibody fragments comprising one or more heavy chains, the one or more heavy chains can contain any of the constant domain sequences found in the non-Fc region of an intact antibody (e.g., CH1 in an IgG isotype), and / or can contain any of the hinge region sequences found in an intact antibody, and / or can contain leucine zipper sequences fused to or located on the hinge region sequence or constant domain sequences of one or more heavy chains.

[0028] Unless otherwise indicated, the term "conjugate" as used herein and in the claims is defined as a heterogeneous molecule formed by the covalent attachment of one or more antibody fragments to one or more polymer molecules, which is water-soluble, i.e., soluble in physiological fluids such as blood, and which does not contain any structural aggregates. A conjugate of interest is PEG. In relation to the above definition, the term "structural aggregate" refers to (1) any molecular aggregate in aqueous solution in which the heterogeneous molecule has a spheroid or spheroidal shell structure, such that the heterogeneous molecule is not in a micelle or other emulsion structure and is not immobilized in a lipid bilayer, vesicle, or liposome, and (2) any molecular aggregate in a solid or insolubilized form, such as a chromatography bead matrix, which does not release the heterogeneous molecule into solution upon contact with an aqueous phase. Thus, the term "conjugate" as defined herein encompasses such heterogeneous molecules in a precipitate, sediment, bioerodible matrix, or other solid that can release the heterogeneous molecule into an aqueous solution upon hydration of the solid.

[0029] As used herein, the term "monoclonal antibody" (mAb) refers to an antibody obtained from a population of substantially homogeneous antibodies. That is, the individual antibodies comprising the population are identical except for possible naturally occurring mutations, which may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Each mAb is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are advantageous in that they can be synthesized by hybridoma culture, uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies used in accordance with the present invention can be produced in immortalized B cells or hybridomas thereof, or by recombinant DNA techniques.

[0030] As used herein, monoclonal antibodies include hybrid antibodies and recombinant antibodies produced by splicing variable domains (including hypervariable domains) of an anti-CD47 antibody to constant domains (e.g., "humanized" antibodies), or by splicing light chains to heavy chains, or by splicing chains from one species to chains from another species, or by fusion with heterologous proteins (regardless of species or subclass designation of the species or immunoglobulin type of origin), as well as antibody fragments (e.g., Fab, F(ab')2, and Fv) provided they exhibit the desired biological activity.

[0031] As used herein, monoclonal antibodies specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and / or light chains are identical to or homologous to corresponding sequences in antibodies from a particular species or belonging to a particular antibody class or subclass, while the remaining chain or chains are identical to or homologous to corresponding sequences in antibodies from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, provided they exhibit the desired biological activity.

[0032] An "isolated" antibody is one that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, such as enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In some embodiments, the antibody is purified to (1) greater than 75% by weight, and most preferably greater than 80%, 90%, or 99% by weight, of the antibody as determined by the Lowry method, or (2) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue, or preferably silver stain. Isolated antibody includes the antibody in situ within recombinant cells, since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

[0033] The term "epitope tagged," as used herein, refers to an anti-CD47 antibody fused to an "epitope tag." The epitope tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough so as not to interfere with activity of the CD47 antibody. The epitope tag preferably is sufficiently unique so that an antibody specific for the epitope does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six amino acid residues, and usually about 8-50 amino acid residues (preferably about 9-30 residues). Examples include the c-myc tag and the 8F9, 3C7, 6E10, G4, B7, and 9E10 antibodies directed against it (Evan et al., Mol. Cell. Biol. 5(12):3610-3616 (1985)), and the herpes simplex virus glycoprotein D (gD) tag and its antibodies (Paborsky et al., Protein Engineering 3(6):547-553 (1990)).

[0034] The term "label," as used herein, refers to a detectable compound or composition that is directly or indirectly conjugated to an antibody. The label itself may be detectable alone (e.g., a radioisotope label or a fluorescent label) or, in the case of an enzymatic label, the label may catalyze chemical alteration of a substrate compound or composition that is detectable.

[0035] By "solid phase" is meant a water-insoluble matrix to which an antibody of the invention can adhere. Examples of solid phases encompassed herein include those formed in part or entirely from glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamide, polystyrene, polyvinyl alcohol, and silicone. In certain embodiments, depending on the context, the solid phase may comprise the well of an assay plate; in other embodiments, it is a purification column (e.g., an affinity chromatography column). The term also includes discontinuous solid phases of discrete particles, such as those described in U.S. Pat. No. 4,275,149.

[0036] Polypeptides In one aspect, the present invention is directed to humanized or chimeric monoclonal antibodies that are specifically reactive with and neutralize CD47, and cell lines producing such antibodies. Exemplary antibody variable regions are provided. The subject antibodies include the provided combinations, as well as fusions of the variable regions to appropriate constant regions or fragments of constant regions (e.g., to generate F(ab)' antibodies). The subject variable regions include at least one CDR sequence of a provided anti-CD47 antibody, where the CDRs can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more amino acids. Alternatively, the subject antibodies include the variable regions shown in the provided antibodies, or pairs of variable region sequences shown herein.

[0037] In some embodiments, the subject polypeptides have a contiguous sequence of at least about 10 amino acids, at least about 15 amino acids, at least about 20 amino acids, at least about 25 amino acids, or at least about 30 amino acids, up to the complete variable region provided. The subject polypeptides also include variable region sequences that differ by up to 1, up to 2, up to 3, up to 4, up to 5, up to 6 or more amino acids compared to the amino acid sequences set forth herein. In other embodiments, the subject polypeptides are at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identical to the amino acid sequences set forth herein.

[0038] In addition to Fabs, smaller antibody fragments and epitope-binding peptides having binding specificity for at least one epitope of CD47 are also contemplated by the present invention and can also be used in the methods of the present invention. For example, single-chain antibodies can be produced according to the method of U.S. Pat. No. 4,946,778 (Ladner et al.), which is incorporated herein by reference in its entirety. Single-chain antibodies comprise the variable regions of the light and heavy chains connected by a flexible linker moiety. Even smaller are antibody fragments known as single-domain antibodies, which comprise an isolated VH single domain. Techniques for obtaining single-domain antibodies with at least a portion of the binding specificity of the intact antibody from which they are derived are known in the art. For example, Ward et al., in "Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted from Escherichia coli," Nature 341:644-646, disclose a screening method for obtaining, in isolated form, an antibody heavy chain variable region (H single domain antibody) that has sufficient affinity for and binds to a target epitope.

[0039] The present invention also provides isolated nucleic acids encoding humanized or chimeric anti-CD47 antibodies, vectors and host cells containing the nucleic acids, and recombinant techniques for producing the antibodies. The nucleic acids of interest can be at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identical to the nucleic acid sequences provided. In some embodiments, a contiguous nucleotide sequence of at least about 20 nt, at least about 25 nt, at least about 50 nt, at least about 75 nt, or at least about 100 nt, up to the complete sequence provided, as set forth in any one of SEQ ID NOS: 1-6, can be used. Such a contiguous sequence can encode CDR sequences or the entire variable region. As known in the art, the variable region sequence can be fused to any suitable constant region sequence.

[0040] For recombinant production of an antibody, the nucleic acid encoding the antibody is inserted into a replicable vector for further cloning (amplification of the DNA) or for expression. DNA encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to genes encoding the antibody heavy and light chains). Many vectors are available. Vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.

[0041] The anti-CD47 antibodies of the invention can be recombinantly produced directly or as a fusion polypeptide with a heterologous or homologous polypeptide, such as another polypeptide containing a signal sequence or a specific cleavage site at the N-terminus of the mature protein or polypeptide, such as an immunoglobulin constant region sequence. The heterologous signal sequence selected is preferably one that is recognized and processed (i.e., cleaved by a signal peptidase) by the host cell. In the case of prokaryotic host cells that do not recognize and process the native antibody signal sequence, the signal sequence is substituted by a prokaryotic signal sequence of choice.

[0042] An "isolated" nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the antibody nucleic acid. An isolated nucleic acid molecule is other than in the form or setting in which it is found in nature. Thus, isolated nucleic acid molecules are distinguished from the nucleic acid molecule as it exists in natural cells. However, isolated nucleic acid molecules include nucleic acid molecules contained in cells that normally express the antibody where, for example, the nucleic acid molecule is in a different chromosomal location than that in natural cells.

[0043] Suitable host cells for cloning or expressing DNA are prokaryote, yeast, or higher eukaryote cells. Examples of useful mammalian host cell lines are: SV40-transformed monkey kidney CV1 cell line (COS-7, ATCC CRL 1651); human embryonic kidney cell line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells / -DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse Sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1, ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TR1 cells (Mather et al., Annals NY Acad. Sci. 383:44-68 (1.982)); MRC 5 cells; FS4 cells; and a human hepatoma cell line (Hep G2). Host cells are transformed with the above expression or cloning vectors for anti-CD47 antibody production and cultured in conventional nutrient media modified as appropriate for inducing the promoter, selecting for transformants, or amplifying the gene encoding the desired sequence.

[0044] Antibody compositions prepared from cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain present in the antibody. Protein A can be used to purify antibodies based on human γ1, γ2, or γ4 heavy chains (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is recommended for human γ3 (Guss et al., EMBO J. 5:1567-1575 (1986)). The matrix to which the affinity ligand is attached is most often agarose, although other matrices are also available. Mechanically stable matrices, such as controlled-pore glass or poly(styrenedivinyl)benzene, allow for faster flow rates and shorter processing times than can be achieved with agarose. If the antibody contains a CH3 domain, Bakerbond ABX™ resin (JT Baker, Phillipsburg, NJ) is useful for purification. Other techniques for protein purification, such as fractionation on an ion exchange column, ethanol precipitation, reverse-phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSE™, chromatography on anion or cation exchange resins (e.g., polyaspartic acid columns), isoelectric focusing, SDS-PAGE, and ammonium sulfate precipitation, are also available, depending on the antibody to be recovered.

[0045] After any one or more preliminary purification steps, the mixture containing the antibody of interest and contaminants can be subjected to low pH hydrophobic interaction chromatography, preferably performed at a low salt concentration (e.g., about 0-0.25 M salt), using an elution buffer at a pH of about 2.5-4.5.

[0046] How to use The humanized or chimeric monoclonal antibodies of the invention can be used to modulate phagocytosis, including the methods described in International Application US2009 / 000319, specifically incorporated herein by reference in its entirety. For example, antibody compositions can be administered to increase phagocytosis of cancer cells that express CD47.

[0047] The humanized or chimeric monoclonal antibodies of the present invention can be used in vitro and in vivo to monitor the progress of CD47 disease therapy. Thus, for example, by measuring an increase or decrease in the number of CD47-expressing cells, particularly CD47-expressing cancer cells, it can be determined whether an individual's optimal treatment regimen aimed at remission of the disease is effective.

[0048] The monoclonal antibodies of the present invention can be used in vitro in immunoassays in which they can be used in liquid phase or bound to a solid-phase carrier. Furthermore, the monoclonal antibodies can be detectably labeled in various ways in these immunoassays. Examples of immunoassay types in which the monoclonal antibodies of the present invention can be used include flow cytometry, e.g., FACS, MACS, immunohistochemistry, competitive immunoassays, and non-competitive immunoassays (either direct or indirect). Antigen detection using the monoclonal antibodies of the present invention can be carried out using immunoassays performed in either forward, reverse, or simultaneous modes, e.g., immunohistochemical assays on physiological samples. Those skilled in the art will know of other immunoassay formats or can readily identify other immunoassay formats without undue experimentation.

[0049] The monoclonal antibodies of the present invention can be bound to many different carriers and used to detect the presence of CD47-expressing cells. Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylase, natural and modified cellulose, polyacrylamide, agarose, and magnetite. The nature of the carrier can be either soluble or insoluble for the purposes of the present invention. Those skilled in the art will know of other suitable carriers for binding monoclonal antibodies, or will be able to ascertain such using routine experimentation.

[0050] Many different labels and methods of labeling are known to those of skill in the art and find use as tracers in therapeutic methods, for use in diagnostic methods, and the like. For diagnostic purposes, labels can be covalently or noncovalently attached to the antibodies of the invention or fragments thereof, e.g., fragments consisting of or including the CDR sequences. Examples of the types of labels that can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, and bioluminescent compounds. Those of skill in the art will know of other suitable labels for binding to the monoclonal antibodies of the invention, or will be able to ascertain such using routine experimentation. Furthermore, the binding of these labels to the monoclonal antibodies of the invention can be accomplished using standard techniques common to those of skill in the art.

[0051] In some embodiments, antibodies or fragments thereof are attached to nanoparticles, e.g., for use in imaging. Useful nanoparticles are known in the art, including, but not limited to, Raman-silica-gold-nanoparticles (R-Si-Au-NPs). R-Si-Au-NPs consist of Raman organic molecules with narrow-band spectral signatures adsorbed to a gold core. Because the Raman organic molecules can be varied, each nanoparticle can possess its own signature, allowing multiple nanoparticles to be detected independently and simultaneously by multiplexing. The entire nanoparticle is encapsulated in a silica shell, which holds the Raman organic molecules on the gold nanocore. Optional polyethylene glycol (PEG)ation of R-Si-Au-NPs increases their bioavailability and provides a functional "handle" for attaching targeting moieties (see Thakor et al. (2011) Sci Transl Med. 3(79):79ra33; Jokerst et al. (2011) Small. 7(5):625-33; Gao et al. (2011) Biomaterials. 32(8):2141-8; all of which are specifically incorporated herein by reference).

[0052] For purposes of the present invention, CD47, when present in body fluids and on tissues, can be detected in vivo or in vitro by the monoclonal antibodies of the present invention. Any sample containing a detectable amount of CD47 can be used. The sample can be a liquid, such as urine, saliva, cerebrospinal fluid, blood, serum, etc., or a solid or semi-solid, such as tissue, feces, etc., or a solid tissue, such as those commonly used in histological diagnosis.

[0053] Another labeling technique that can provide greater sensitivity consists of coupling the antibody to low molecular weight haptens. These haptens can then be specifically detected by secondary reactions. For example, it is common to use haptens such as biotin, which reacts with avidin, or dinitrophenol, pyridoxal, or fluorescein, which can react with specific anti-hapten antibodies.

[0054] For convenience, the antibodies of the present invention can be provided in a kit, i.e., a packaged combination of predetermined amounts of reagents and instructions for performing the diagnostic assay. When the antibody is labeled with an enzyme, the kit will include substrates and cofactors necessary for the enzyme (e.g., a substrate precursor that generates a detectable chromophore or fluorophore). Additionally, other additives such as stabilizers, buffers (e.g., blocking buffers or lysis buffers), and the like may be included. The relative amounts of the various reagents can be varied over a wide range to produce concentrations in solution of the reagents that substantially optimize the sensitivity of the assay. In particular, the reagents can be provided as dry powders, usually lyophilized, containing excipients that, upon dissolution, provide a reagent solution having the appropriate concentration.

[0055] Therapeutic formulations containing one or more antibodies of the invention are prepared for storage in the form of lyophilized formulations or aqueous solutions by mixing antibodies of the desired purity with optional physiologically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences, 16th ed., Osol, A., ed. (1980)). Antibody compositions are formulated, dosed, and administered as consistent with good medical practice. Factors to consider in this regard include the disorder being treated, the mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of drug delivery, the method of administration, the administration schedule, and other factors known to physicians. The "therapeutically effective amount" of antibody to be administered will depend on such considerations and is the minimum amount necessary to prevent CD47-related disease.

[0056] Therapeutic doses can be at least about 0.01 μg / kg body weight, at least about 0.05 μg / kg body weight, at least about 0.1 μg / kg body weight, at least about 0.5 μg / kg body weight, at least about 1 μg / kg body weight, at least about 2.5 μg / kg body weight, at least about 5 μg / kg body weight, and up to about 100 μg / kg body weight. Those skilled in the art will appreciate that such guidelines will be adjusted for the molecular weight of the active agent, for example, when using antibody fragments or antibody conjugates. Dosages can vary by local administration, e.g., intranasal administration, inhalation administration, etc., or by systemic administration, e.g., intramuscular administration, intraperitoneal administration, intravenous administration, etc.

[0057] It is not necessary, but is optional, to combine the antibody with one or more agents that enhance activity or otherwise increase therapeutic effect, generally at the same dosages and by the routes of administration used above, or at about 1-99% of the dosages previously used.

[0058] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and examples include buffers such as phosphate, citrate, and other organic acids; antioxidants such as ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens such as methyl paraben or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (fewer than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamic acid, and the like. The preferred saccharides include amino acids, ...

[0059] The active ingredient may be encapsulated in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, such as hydroxymethylcellulose or gelatin microcapsules and poly(methyl methacrylate) microcapsules, respectively, in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules), or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences, 16th ed., Osol, A. (ed.) (1980).

[0060] The anti-CD47 antibody is administered by any suitable means, including parenteral, subcutaneous, intraperitoneal, intrapulmonary, and intranasal administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Furthermore, the anti-CD47 antibody is preferably administered by pulse infusion, particularly with declining doses of the antibody.

[0061] For the prevention or treatment of disease, the appropriate dosage of antibody will depend on the type of disease being treated, as defined above, the severity and course of the disease, whether the antibody is being administered prophylactically, previous therapy, the patient's medical history and response to the antibody, and the discretion of the attending physician. The antibody is suitably administered to the patient at one time or over a series of treatments.

[0062] In another embodiment of the present invention, an article of manufacture containing materials useful for treating the aforementioned disorders is provided. The article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The container can be formed from a variety of materials, such as glass or plastic. The container holds a composition effective for treating a condition and can have a sterile access port (e.g., the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The active agent in the composition is an anti-CD47 antibody. A label on or associated with the container indicates that the composition is used for treating a selected condition. The article of manufacture may further comprise a second container containing a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution, and dextrose solution. The article of manufacture may further include other materials desirable from a commercial and user standpoint, such as other buffers, diluents, filters, needles, syringes, and package inserts containing instructions for use.

[0063] Now that the present invention has been fully described, it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit or scope of the invention.

[0064] experiment The following examples are presented so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should be accounted for. Unless otherwise specified, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric.

[0065] All publications and patent applications cited in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0066] The present invention has been described with reference to specific embodiments that the inventors have discovered or suggest to comprise preferred modes for carrying out the invention. Those skilled in the art will recognize, in light of this disclosure, that many modifications and variations can be made to the specific embodiments exemplified without departing from the intended scope of the invention. For example, due to codon redundancy, changes can be made to the underlying DNA sequence without affecting the protein sequence. Furthermore, due to considerations of biological functional equivalence, changes can be made to the protein structure without affecting biological activity in kind or amount. All such modifications are intended to be within the scope of the appended claims. [Example]

[0067] Cloning and production of monoclonal antibodies against human CD47. Here, we describe the cloning, production, and expression of a monoclonal antibody against human CD47. Total RNA was prepared from a mouse hybridoma cell line secreting a functional inhibitory antibody against human CD47, B6H12, and converted to cDNA using Ig-specific oligonucleotides. The heavy and light chain-encoding cDNA fragments were isolated and sequenced. A chimeric gene was then generated by ligating the mouse V-region cDNA fragment to a human immunoglobulin constant region. Competitive FACS analysis showed that the chimeric B6H12 antibody inhibited the binding of the native mouse B6H12 antibody to CD47, demonstrating that the chimeric and mouse B6H12 antibodies recognize the same epitope on CD47. Furthermore, we designed and generated a humanized B6H12 antibody by CDR grafting. The humanized B6H12 antibody exhibited CD47 binding comparable to that of the chimeric B6H12. Both chimeric and humanized B6H12 antibodies enable phagocytosis of cancer cells in vitro, and we predict that chimeric and humanized antibodies will be less immunogenic than native murine antibodies when administered to human patients as part of anti-cancer therapy.

[0068] We confirmed and validated the preferential expression of CD47 on leukemia stem cells using an antigen-specific monoclonal antibody. Although CD47 is a ubiquitously expressed transmembrane protein, we found that CD47 is more highly expressed on AML LSCs than on its normal counterparts, and that increased CD47 expression predicted shorter overall survival in three independent cohorts of adult AML patients. CD47 serves as a ligand for signal-regulatory protein α (SIRPα), which is expressed on phagocytes, including macrophages and dendritic cells. When activated, SIRPα initiates a signaling cascade that inhibits phagocytosis. We used an inhibitory monoclonal antibody against CD47, which preferentially enabled phagocytosis of AML LSCs and inhibited their engraftment in vivo. Furthermore, treatment of human AML LSC-engrafted mice with an anti-CD47 antibody nearly eliminated AML and targeted AML LSCs. These results confirm the rationale for anti-CD47 monoclonal antibodies as monotherapy or combination therapy for AML and other cancers.

[0069] Here, we report the isolation, synthesis, and production of a human IgG1 chimeric monoclonal antibody derived from B6H12 and a humanized B6H12 antibody engineered by CDR grafting. We describe the generation of chimeric and humanized immunoglobulin genes consisting of cDNAs encoding the heavy and light chain variable regions, respectively, fused to human γ1 and κ constant regions. Introduction of these genes into mammalian cells produced functional chimeric and humanized antibodies capable of binding human CD47 and triggering phagocytosis of target cells.

[0070] Materials and Methods Cloning and sequencing of antibody V. The cloning strategy used here involved the initial isolation of RNA from hybridoma cells (Qiagen) and preparation of cDNA. The cDNA sequences encoding the heavy and light chain variable regions of the B6H12 monoclonal antibody were obtained using 5' RACE-PCR technology (Clontech) and sequenced using standard DNA sequencing methods.

[0071] Generation of B6H12 / hIgG1 chimeric antibody. The following primers were used to generate the heavy and light chain variable regions of B6H12 in an expression vector: VH sense primer, 5'CAGACCCGTCGACATGAACTTCGGGCTCAGCTTGATTTTCCTT3' VH antisense primer, 5'GCCCTTGGTGCTAGCTGAGGAGACGGTGACTGAGGTTCCTTGACC3' VL sense primer, 5'CGCCATCACAGATCTATGGTGTCCACTTCTCAGCTCCTTGGACTT3' VL antisense primer, 5'TGCAGCCACCGTACGTTTGATTTCCAGCTTGGTGCCTCCACCGAA3'. PCR was then performed using cloned pfu DNA polymerase (Invitrogen). These PCR products were digested with SalI / NheI for VH and BglII / BsiwI for VL and ligated into expression vectors encoding human γ1 and κ constant regions digested with SalI / NheI or BglII / BsiwI, respectively. All constructs were sequenced to confirm sequence integrity.

[0072] Molecular Modeling. Humanization of the murine anti-CD47 B6H12 antibody was performed by incorporating CDR residues from the murine antibody into human germline framework (FR) sequences. Briefly, murine B6H12 was humanized by appropriate recruitment of the corresponding CDR residues and several FR residues to the human sequence. Differences between murine B6H12 and human FR residues were modeled separately to examine their possible effects on CDR conformation. Humanized VH and VL genes were synthesized by McLab (South San Francisco, CA).

[0073] Cell transfection and establishment of stable cell lines. Stable cell lines expressing chimeric or humanized B6H12 were established by transfecting CHOS cells with the expression constructs using DMRIEC transfection reagent (Invitrogen) according to the manufacturer's instructions. After 3 days, transfected cells were selected under 500 μg / ml G418. Stable clones were isolated by limiting dilution in 96-well plates. To screen G418-resistant clones for their ability to secrete antibodies, the supernatants of transfected cells were tested by ELISA. Briefly, 96-well plates (Nunc, Roskilde, Denmark) were coated with 1 μg / ml goat anti-human Fcγ antibody in PBS for 16 hours at 4°C. After blocking with 0.4% BSA in PBS for 1 hour at room temperature, the isolated supernatants were added in 1 / 3 serial dilutions and incubated for 1 hour at room temperature. The plates were then washed three times and incubated with HRP-conjugated goat anti-human κ-specific antibody at room temperature for 1 hour. After washing, the plates were developed with OPT. The reaction was stopped with 2M H2SO4, and the OD was measured at 520 nM. Positive clones were further expanded, and expression was confirmed by ELISA.

[0074] Antibody purification and characterization. The culture supernatant was applied to a protein G Sepharose column. The column was washed with phosphate-buffered saline (PBS) pH 8.0, and then the protein was eluted with elution buffer (glycine pH 2.0). The eluted fraction was collected in a tube containing neutralization buffer (2 M Tris-HCl, pH 8.0) to adjust the pH to approximately 7.0. Finally, the purified sample was dialyzed against phosphate-buffered saline (PBS). The purity of the eluted antibody fraction was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% gel under reducing or non-reducing conditions. Bands were visualized by Coomassie brilliant blue staining.

[0075] Binding specificity by ELISA. Microtiter plates were coated with 100 μl of purified human CD47Fc fusion protein at 1.0 μg / ml in PBS and then blocked with 100 μl of 0.4% BSA in PBS. Dilutions of B6H12 chimeric or humanized antibody were added to each well and incubated for 1 hour at room temperature. A known mouse anti-CD47 antibody was used as a positive control, and human IgG1 was used as an isotype control. Plates were washed with PBS / Tween and then incubated with goat anti-human kappa-specific secondary reagent conjugated to horseradish peroxidase for 1 hour at room temperature. After washing, plates were developed with OPT substrate and analyzed at OD 520 nm.

[0076] Binding specificity by FACS. YB2 / 0 cells stably transfected with human CD47 were incubated with various amounts of chimeric B6H12, humanized B6H12, or a human IgG1 isotype control antibody on ice for 1 hour. Cells were washed three times with FACS buffer (PBS containing 0.5% BSA and 0.05% NaN). PE-labeled goat anti-human antibody was added as a secondary antibody, and samples were incubated for an additional hour on ice. Samples were washed and analyzed using a FACSAria (Becton-Dickinson, San Jose, CA, USA).

[0077] Competitive binding assay by FACS. Inhibition of binding of chimeric B6H12 antibody to human CD47 by mouse antibody B6H12 or isotype control antibody was measured using FACS. CD47-transfected YB2 / 0 cells were harvested and washed twice with FACS buffer (PBS containing 0.5% BSA and 0.05% NaN3). Chimeric B6H12 was then added to the cells at a final concentration of 1 μg / ml along with various amounts of mouse B6H12 antibody or isotype control antibody, and the cells were incubated on ice for 1 hour. Similarly, inhibition of binding of mouse B6H12 antibody to human CD47 was measured by adding various amounts of chimeric B6H12 or isotype control antibody. Samples were washed with FACS buffer, and PE-labeled goat anti-human or anti-mouse antibody was added. The samples were then incubated on ice for another hour. The samples were washed and analyzed using a FACSAria (Becton-Dickinson, San Jose, CA, USA).

[0078] In vitro phagocytosis assay. HL-60 cells were labeled with CFSE and incubated with mouse bone marrow-derived macrophages for 2 hours in the presence of 10 μg / ml of IgG1 isotype control, mouse B6H12, chimeric B6H12, or humanized B6H12 antibody. Cells were then analyzed by fluorescence microscopy to determine the phagocytic index (number of ingested cells per 100 macrophages). Statistical analysis was performed using Student's t-test using GraphPad Prism.

[0079] result Cloning of the murine B6H12 variable region. Using universal antibody primers, clones encoding the heavy and light chain variable regions were successfully isolated from the anti-CD47 B6H12 hybridoma. Multiple clones of each V gene product were sequenced to monitor PCR-induced errors. The VH and VL sequences are shown in Figures 1A and 1B, respectively. DNA sequence analysis of the products confirmed that the B6H12 heavy chain uses a V segment of the Igh-v7183 VH5 family and that the light chain belongs to the IGKV23 subgroup. The heavy chain variable region contains CDR1, CDR2, and CDR3 sequences, and the light chain variable region contains CDR1, CDR2, and CDR3 sequences (Figure 1).

[0080] Production and Characterization of B6H12 Chimeric Antibody. To create an expression vector for the chimeric B6H12 antibody, the heavy chain variable region of B6H12, including its native signal peptide sequence at its NH2-terminus, was fused to the constant region of the human γ1 heavy chain and then cloned into a mammalian expression vector. Similarly, the light chain variable region of B6H12, including its native signal peptide sequence at its NH2-terminus, was fused to the constant region of the human κ light chain and introduced into a vector encoding the B6H12 heavy chain. The resulting single expression vector was then transfected into mammalian cells. The expressed chimeric B6H12 antibody was purified and examined by SDS-PAGE analysis. As expected, a single band with a molecular weight of approximately 150 kDa was observed under non-reducing conditions (Figure 2). After reduction with 2-mercaptoethanol, two bands corresponding to the heavy and light chains appeared at 50 and 25 kDa, respectively. These results indicate that the chimeric heavy and light chain peptides produced in the transfectants assemble to form native IgG molecules.

[0081] To verify that the B6H12 variable region cloned from the mouse hybridoma retained antigen-binding activity similar to that of the original mouse B6H12 antibody, a competitive binding assay between the chimeric and mouse B6H12 antibodies was performed by flow cytometry. Human CD47 was stably transfected into YB2 / 0 cells, and CD47 expression was confirmed by flow cytometry. As shown in Figure 3A, chimeric B6H12 competed with mouse B6H12 for CD47 binding in a dose-dependent manner, whereas a human IgG1 isotype control antibody did not affect mouse B6H12 binding. Similarly, mouse B6H12 antibodies inhibited chimeric B6H12 antibodies for CD47 binding (Figure 3B). This suggests that the chimeric B6H12 antibodies recognize the same epitope on CD47 as the native mouse B6H12 antibody.

[0082] Design and Analysis of Humanized B6H12 Antibody. To select a human antibody framework (FR) to use as a template for CDR grafting, the mouse B6H12 VL and LH regions were compared with the VL and LH regions of human germline sequences. The FRs of the mouse B6H12 VL region were found to have the highest homology to the human VK3 subgroup, suggesting that a member of subgroup III might be the best choice. The FRs of the mouse B6H12 VH region showed the highest homology to the human VH-3 subgroup. FRs from human VH-3-7 and VK3-11 were ultimately selected as the starting point for designing humanized B6H12. Residues in the FRs identical to those in the mouse sequence were retained, while non-identical residues were either retained or substituted based on molecular modeling. Humanized B6H12 was transfected and purified as described above. SDS-PAGE analysis showed a single band with a molecular weight of approximately 150 kDa under non-reducing conditions (Figure 2), and two bands of 50 kDa and 25 kDa appeared under reducing conditions. The sequence is shown in Figure 4.

[0083] Next, we examined the ability of humanized B6H12 to recognize human CD47. Human CD47-transfected YB2 / 0 cells, which have been shown to express membrane-bound CD47, were used for flow cytometry analysis. Humanized B6H12 bound to cell surface-expressed CD47, and the binding activity was comparable to that of the chimeric B6H12 antibody (Figure 5). No binding with the B6H12 antibody was detected when untransfected YB2 / 0 cells were used. Similar results were obtained when soluble CD47 binding was determined by ELISA. In this assay, humanized B6H12 exhibited binding activity comparable to that of the chimeric B6H12 antibody (Figure 6).

[0084] Phagocytosis by chimeric and humanized B6H12 antibodies. The murine B6H12 antibody is known to block the interaction between CD47 and the inhibitory receptor SIRPα expressed on macrophages, thus enabling phagocytosis of CD47-expressing cells. To examine the ability of chimeric and humanized B6H12 antibodies to enable phagocytosis, we performed an in vitro phagocytosis assay. CFSE-labeled HL-60 cells were incubated with mouse bone marrow-derived macrophages for 2 hours in the presence of control or native, chimeric, or humanized B6H12 antibodies. Phagocytosis was assessed by counting the number of ingested CFSE-labeled HL-60 target cells within the mouse macrophages, as visualized by fluorescence microscopy. As shown in Figure 7, both chimeric and humanized B6H12 efficiently enabled phagocytosis at levels comparable to those of the native murine B6H12 antibody. In contrast, an isotype control antibody did not trigger macrophage-mediated phagocytosis. These results demonstrate that chimeric and humanized B6H12 can function in a manner similar to the native murine B6H12 antibody.

[0085] To date, antibodies against human CD47 have been murine. The major disadvantage of using murine antibodies to treat human patients is the development of human anti-mouse responses (HAMA). Therefore, improved therapeutic antibodies against CD47 with lower immunogenicity are needed. In this study, we constructed and expressed chimeric and humanized antibodies engineered from the variable region of a murine anti-human CD47 mAb (B6H12). These antibodies were fused to human immunoglobulin constant regions. SDS-PAGE analysis revealed that both the chimeric and humanized B6H12 antibodies were expressed as native IgG proteins consisting of two pairs of heavy and light chains. The chimeric and murine B6H12 antibodies competed with each other for antigen binding (Figure 3). This indicates that the chimeric B6H12 antibody retains the antigen binding ability of the murine antibody and recognizes the same antigen epitope. Furthermore, the humanized B6H12 antibody binds to both soluble and membrane-bound CD47 comparably to the chimeric antibody (Figures 5 and 6). Chimeric and humanized B6H12 also demonstrated the ability to mediate phagocytosis more efficiently than the original murine B6H12 antibody (Figure 7). These results suggest that our engineered antibodies form functionally active IgG.

[0086] In particular, in humanizing the B6H12 antibody, we utilized human VH-3-7 and VK3-11 as the basis for our design. However, mouse B6H12 also showed sequence homology with other family members of the human VH-3 and VK3 subgroups, as well as with other variable domains outside these two subgroups. Other frameworks may also function equally well.

[0087] Antibodies exhibit four major effector functions: antibody-dependent cellular cytotoxicity (ADCC), phagocytosis, complement-dependent cytotoxicity (CDC), and half-life / clearance rate. Each of these effector functions is mediated by interaction with a specific set of receptors and cell types: ADCC and phagocytosis are mediated by interaction of cell-bound mAbs with Fcγ receptors (FcγRs), CDC is mediated by interaction of cell-bound mAbs with a series of soluble blood proteins that comprise the complement system (e.g., C1q, C3, C4, etc.), and half-life / clearance rate is mediated by antibody binding to neonatal Fc receptors (FcRn). Activating antibodies, typically of the human IgG1 subclass, differ by their activating Fc domains. However, monoclonal antibodies that function by inhibiting ligand-receptor interactions can function without utilizing effector mechanisms. In these cases, effector functions can be a disadvantage because they can contribute to unwanted cytotoxicity. Unwanted antagonism due to cross-linking by FcR-expressing cells can trigger inappropriate activation of FcR-expressing cells, resulting in a subsequent cytokine surge and associated toxic effects. Therefore, appropriate selection of IgG subclasses or the use of IgG engineered to suppress effector function is necessary. As previously reported by the present inventors, murine B6H12 functions as an inhibitory antibody, and the B6H12 F(ab)'2 fragment exhibited efficacy similar to that of full-length murine B6H12 in in vitro phagocytosis assays. Therefore, the development of a non-activating B6H12 monoclonal antibody with fewer side effects would be beneficial.

[0088] Many strategies for engineering non-activated antibodies have been reported. The use of antibody-based fragments lacking the Fc domain offers the simplest way to circumvent Fc-dependent effector mechanisms. From a manufacturing perspective, antibody-based fragments are an attractive strategy because high yields can be routinely obtained in well-characterized, cost-effective expression systems in lower eukaryotes and prokaryotes. Recombinant antibody technology has enabled the development of monovalent (e.g., Fab, scFv, nanobody, and dAb), bivalent (e.g., F(ab')2, diabody, and minibody), and multivalent (e.g., triabody and pentabody) formats. These approaches have already led to FDA-approved therapeutics, and several others are undergoing clinical evaluation, demonstrating confidence in this approach. However, removal of the Fc domain dramatically alters the pharmacokinetic properties of antibody-based fragments and makes antibody purification less convenient. In the absence of an Fc-domain, renal clearance is the primary mechanism affecting serum half-life, and antibody-based fragments below approximately 50-70 kDa are subject to this excretion route. Increasing the apparent molecular size of small antibody fragments, for example, by conjugation with polyethylene glycol (PEG) and human serum albumin (HSA), represents an alternative strategy to increase circulation time and improve their pharmacokinetic properties.

[0089] Therapeutic antibody combinations, which may offer the added benefit of targeting multiple epitopes or antigens, are also increasingly being used. Combinations may be more effective against disease targets that are generally heterogeneous, thus limiting resistance or escape. We demonstrated synergy and cure with the combination of B6H12 and rituximab in a human NHL xenograft model. Our findings suggest that combination therapy with B6H12 represents a promising new treatment modality for NHL. Meanwhile, over the past few years, the concept of bispecific antibody (BsAb)-mediated tumor cell killing has been extensively investigated in both preclinical models and clinical trials. BsAbs share two distinct antigen-recognition moieties within a single molecule. Based on our data, B6H12 synergizes with an additional FcR-binding antibody to eliminate target cells. This synergy can be reproduced with the B6H12 BsAb, which is reactive with CD47 on the one hand and with additional surface antigens on tumor target cells on the other. Such reagents can focus immune effector functions on target cells.

[0090] In summary, we developed therapeutic antibodies based on the murine monoclonal antibody B6H12 against human CD47 by using methods to generate murine / human chimeric and humanized antibodies. The chimeric and humanized B6H12 antibodies retain the ability to specifically bind CD47 and can induce phagocytosis in vitro. These antibodies may be less immunogenic and therefore more suitable candidates for clinical therapy. [Example]

[0091] Cloning of mouse 5F9 and 8B6 variable regions Using universal antibody primers, we successfully cloned DNA fragments encoding the heavy and light chain variable regions from the anti-CD47 hybridomas 5F9 and 8B6. Multiple clones of each V gene product were sequenced to monitor PCR-induced errors. The VH and VL sequences of 5F9 are shown in Figures 9A and 9B, respectively. DNA sequence analysis of the products confirmed that the heavy chain of 5F9 uses a V segment from the Igh-VJ558 VH1 family and that the light chain belongs to the IGKV1 subgroup. The VH and VL sequences of 8B6 are shown in Figures 10A and 10B, respectively. DNA sequence analysis of the products confirmed that the heavy chain of 8B6 uses a V segment from the Igh-VJ558 VH1 family and that the light chain belongs to the IGKV23 subgroup. The heavy chain variable region comprises CDR1, CDR2 and CDR3 sequences, and the light chain variable region comprises CDR1, CDR2 and CDR3 sequences (Figures 9 and 10).

[0092] CD47-binding activity of chimeric 5F9 and 8B6. Chimeric 5F9 and 8B6 were produced and expressed. The purified antibodies were analyzed by SDS-PAGE, demonstrating that native IgG antibodies were formed against both. The binding activity of chimeric 5F9 and 8B6 was then tested using ELISA by coating human CD47 soluble protein in a 96-well plate. As shown in Figure 11, both chimeric 5F9 and 8B6 bound the antigen at levels comparable to the chimeric B6H12 antibody.

[0093] Antibody humanization and characterization of 5F9. To select human antibody framework regions (FRs) to use as templates for CDR grafting, the mouse 5F9 VL and LH regions were compared with the VL and LH regions of human germline sequences. The FRs of the mouse 5F9 VL region were found to have the highest homology with the IGKV2 subgroup. The FRs of the mouse 5F9 VH region showed the highest homology with the human VH-1 subgroup. Identical residues in the FRs were retained, and non-identical residues were either retained or substituted based on molecular modeling. Three versions of each humanized VH and VL were designed. Sequence alignments of each version with the human germline sequences are shown in Figure 12.

[0094] Different versions of the humanized 5F9 heavy and light chains were transfected in combination to generate various versions of humanized 5F9. The ability of the humanized 5F9 antibody to recognize CD47 was then examined. As shown in Figure 13, both humanized 5F9 version 1 and version 2 bound well to soluble CD47. The isotype control antibody did not show any binding activity. These results demonstrate that humanized 5F9 retained its ability to bind to the human CD47 antigen.

[0095] Phagocytosis induced by the 5F9 and 8B6 antibodies. The B6H12 antibody is known to block the interaction between CD47 and SIRPα, which is expressed on macrophages and activates them for phagocytic responses. To examine the ability of the 5F9 and 8B6 antibodies to induce phagocytosis, we incubated the antibodies with human peripheral blood-derived macrophages and HL-60 target cells for 2 hours and assessed phagocytosis by counting the number of ingested CFSE-labeled HL-60 cells under a microscope. As shown in Figure 14, both the murine and chimeric 5F9 antibodies were able to efficiently induce phagocytosis, similar to the chimeric 8B6. Furthermore, the humanized 5F9 antibody also exhibited effective phagocytic activity. In contrast, the isotype control antibody did not trigger macrophage-mediated phagocytosis. These results demonstrate that 5F9 and 8B6 can function in a manner similar to the B6H12 antibody.

[0096] Illustrative Embodiments 1. An isolated chimeric or humanized antibody that specifically binds to human CD47 and comprises at least one CDR sequence shown in SEQ ID NOs: 3 to 8, 20 to 25, or 28 to 33. 2. The isolated chimeric or humanized antibody of embodiment 1, wherein the light chain of the antibody comprises at least one CDR selected from SEQ ID NOs: 6-8, 23-25, or 31-33. 3. The antibody of embodiment 2, wherein the light chain comprises each of the CDR sequences shown in SEQ ID NOs: 6 to 8, 23 to 25, or 31 to 33. 4. The antibody of embodiment 3, wherein the light chain comprises the amino acid sequence shown in SEQ ID NO: 12 or Figure 12B. 5. The isolated chimeric or humanized antibody of embodiment 1, wherein the heavy chain of the antibody comprises at least one CDR selected from SEQ ID NOs: 3-5, SEQ ID NOs: 20-22, or SEQ ID NOs: 28-30. 6. The antibody of embodiment 5, wherein the heavy chain comprises each of the CDR sequences shown in SEQ ID NOs: 3 to 5, 20 to 22, or 28 to 30. 7. The antibody of embodiment 6, wherein the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 11, 17 or Figure 12A. 8. The antibody of embodiment 1, comprising a light chain of any one of embodiments 2 to 4 and a heavy chain of any one of embodiments 5 to 7. 9. The antibody of embodiment 8, wherein the antibody comprises a heavy chain having each of the CDR sequences shown in SEQ ID NOs: 2 to 5 and a light chain having each of the CDR sequences shown in SEQ ID NOs: 5 to 6, or a heavy chain having each of the CDR sequences shown in SEQ ID NOs: 20 to 22 and a light chain having each of the CDR sequences shown in SEQ ID NOs: 23 to 25, or a heavy chain having each of the CDR sequences shown in SEQ ID NOs: 28 to 30 and a light chain having each of the CDR sequences shown in SEQ ID NOs: 31 to 33. 10. An antibody described in any one of embodiments 1 to 8, which does not activate CD47 upon binding. 11. The antibody of embodiment 9, which is a humanized monoclonal antibody. 12. The antibody of embodiment 9, which is a chimeric antibody. 13. A polynucleotide encoding the antibody of any one of embodiments 1 to 12. 14. A cell that produces an antibody described in any one of embodiments 1 to 12. 15. A pharmaceutical composition comprising an antibody described in any one of embodiments 1 to 12. 16. A pharmaceutical composition comprising an antibody according to any one of embodiments 1 to 12 and a pharmaceutically acceptable excipient. 17. A method for modulating phagocytosis, comprising administering to a subject a therapeutically effective amount of an antibody described in any one of embodiments 1 to 12, in a dose effective to modulate phagocytosis. 18. The method of embodiment 17, wherein the subject is a human. 19. An antibody comprising the amino acid sequence shown in any one of SEQ ID NOs: 1 to 8, 11 to 12, or 17. 20. An antibody encoded by the nucleotide sequence set forth in any one of SEQ ID NOs: 9, 10, or 13-16. 21. A method for detecting the presence of CD47 in a biological sample or tissue, comprising contacting the sample or tissue with an antibody described in embodiment 1 and determining the presence of antibody bound to the tissue or sample.

Claims

1. an antibody that specifically binds to CD47, comprising a heavy chain comprising the CDR1 amino acid sequence shown in SEQ ID NO:20, the CDR2 amino acid sequence shown in SEQ ID NO:21, and the CDR3 amino acid sequence shown in SEQ ID NO:22, and a light chain comprising the CDR1 amino acid sequence shown in SEQ ID NO:23, the CDR2 amino acid sequence shown in SEQ ID NO:24, and the CDR3 amino acid sequence shown in SEQ ID NO:25; a heterologous compound conjugated to said antibody 1. An isolated chimeric or humanized antibody conjugate comprising:

2. The antibody conjugate of claim 1 , wherein the heterologous compound comprises a detectable label.

3. The antibody conjugate of claim 2 , wherein the detectable label is a radioisotope.

4. The antibody conjugate of claim 2 , wherein the detectable label is a fluorescent label.

5. The antibody conjugate of claim 2 , wherein the heterologous compound is an enzyme label.

6. The antibody conjugate of claim 1 , wherein the heterologous compound comprises a water-soluble polymer.

7. The antibody conjugate of claim 6, wherein the water-soluble polymer is polyethylene glycol.

8. The antibody conjugate of claim 1 , wherein the heterologous compound is a water-insoluble matrix.

9. The antibody conjugate of claim 1 , wherein the heterologous compound is a nanoparticle.

10. The antibody conjugate of claim 1 , wherein the heterologous compound is an epitope tag.

11. 11. The antibody conjugate of claim 1, wherein the light chain comprises the amino acid sequence set forth in any one of SEQ ID NO: 41, SEQ ID NO: 42 or SEQ ID NO:

43.

12. 11. The antibody conjugate of claim 1, wherein the heavy chain comprises the amino acid sequence set forth in any one of SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO:

38.

13. 13. An antibody conjugate according to any one of claims 1 to 10, comprising a light chain according to claim 11 and a heavy chain according to claim 12.

14. The antibody conjugate of claim 1 , wherein the antibody is a full-length chimeric or humanized antibody.

15. 15. The antibody conjugate of claim 14, wherein the antibody comprises a human IgG1, IgG2a, IgG2b, IgG3, IgG4 or IgA constant region.

16. The antibody conjugate of claim 1 , wherein the antibody is an antibody fragment, and the antibody fragment is an F(ab′)2 or F(ab) fragment.

17. 17. The antibody conjugate of claim 1, wherein the antibody is a monoclonal antibody.

18. 18. A pharmaceutical formulation comprising the antibody conjugate of any one of claims 1 to 17 and a pharmaceutically acceptable excipient.

19. 19. A pharmaceutical formulation according to claim 18 for use in the treatment of a disease.

20. 19. The pharmaceutical formulation of claim 18 for use in the treatment of cancer.

21. 19. The pharmaceutical formulation of claim 18 for use in the treatment of acute myeloid leukemia (AML).

22. 22. A pharmaceutical formulation according to any one of claims 19 to 21 for use in monotherapy.

23. 22. A pharmaceutical formulation according to any one of claims 19 to 21 for use in combination therapy.

24. 24. The pharmaceutical formulation of any one of claims 18 to 23, wherein the subject is a human.

25. A method for detecting the presence of CD47 in a biological sample or tissue in vitro, comprising: contacting the sample or tissue with the antibody conjugate of any one of claims 2 to 5; determining the presence of antibodies bound to said tissue or sample. and a method comprising:

Citation Information

Patent Citations

  • Immunoassay on c-reactive protein

    JP2002040024A

  • Monoclonal antibody against interleukin-13 receptor α1 (il-13rα1)

    JP2006504623A

  • JPP4261907B

  • Humanized Anti-CD47 antibody

    WO2005044857A1