RNAi drugs for hepatitis B virus infection

HBV-specific RNAi drugs targeting specific HBV mRNA sequences provide a method to selectively inhibit HBV gene expression, addressing the limitations of current treatments by achieving complete suppression and reducing liver inflammation and cancer risk.

JP7763907B2Active Publication Date: 2025-11-04ARROWHEAD PHARMACEUTICALS INC +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2024122919
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-11-07
Filing Date
2024-07-30
Publication Date
2025-11-04
Estimated Expiration
2040-02-07

AI Technical Summary

Technical Problem

Current treatments for hepatitis B virus (HBV) infection, such as nucleoside analogues and interferon alpha, face challenges with incomplete remission, drug resistance, and severe side effects, making it difficult to achieve sustained suppression of the virus, especially in co-infections with human immunodeficiency virus (HIV).

Method used

The use of HBV-specific RNA interference (RNAi) drugs, comprising sense and antisense strands targeting specific HBV mRNA sequences, administered in various dosages and intervals, to selectively inhibit HBV gene expression, potentially combined with targeting groups for enhanced delivery and efficacy.

Benefits of technology

These RNAi drugs effectively reduce HBV gene expression, offering potential for complete and sustained suppression of HBV, reducing liver inflammation and preventing chronic liver diseases, including hepatocellular carcinoma, with reduced risk of drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007763907000093
    Figure 0007763907000093
  • Figure 0007763907000094
    Figure 0007763907000094
  • Figure 0007763907000095
    Figure 0007763907000095
Patent Text Reader

Abstract

To provide pharmaceutical compositions for inhibiting hepatitis B virus gene expression or treating symptoms and / or diseases associated with hepatitis B virus infection.SOLUTION: The invention relates to a pharmaceutical composition for use in treating or preventing a disease associated with an infection caused by the hepatitis B virus in a human subject, the use comprising administering an effective amount of the pharmaceutical composition to the human subject. The pharmaceutical composition comprises (a) a first RNAi agent comprising specific sequences and (b) a second RNAi agent comprising specific sequences. The first and second RNAi agents are administered in a combined amount of about 25-400 mg per 28 days.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application is a continuation of U.S. Provisional Patent Application No. 62 / 802,614, filed February 7, 2019. U.S. Provisional Patent Application No. 62 / 853,659, filed May 28, 2019, and Priority to U.S. Provisional Patent Application No. 62 / 932,315, filed November 7, 2019 and claims the benefit thereof, the disclosure of each of which is incorporated herein by reference in its entirety. The bodies are incorporated herein by reference.

[0002] (Submission of sequence listing as an ASCII text file) The contents of the following submission on an ASCII text file are incorporated herein by reference in their entirety. Incorporated herein: Computer Readable Form (CRF) of Sequence Listing (Filename: 16500 2000540SEQLIST.TXT, Recorded on: February 5, 2020, Size: 78K B).

[0003] FIELD OF THE INVENTION Disclosed herein are RNA inhibitors for inhibiting gene expression of hepatitis B virus. and methods of use thereof. Regarding infection caused by the hepatitis B virus in subjects in need thereof Methods for treating and / or preventing associated conditions or diseases are also disclosed. [Background technology]

[0004] Hepatitis B virus (HBV) is a double-stranded DNA virus with strict liver tropism. DNA is the genetic material, and during the replication cycle, pregenomic RNA is copied into DNA. Hepatitis B virus is a member of the hepadnavirus family. Hepatitis B virus is classified as a virus that causes hepatitis B and belongs to the family Hepadnaviridae. Primary infection in humans causes organ inflammatory symptoms, fever, jaundice, and an increase in liver transaminases in the blood. Patients who are unable to overcome the viral infection may develop acute hepatitis with prolonged This leads to a chronic disease that progresses over time, increasing the risk of developing cirrhosis and liver cancer. Perinatal transmission from infected mothers to their newborns can also lead to chronic hepatitis.

[0005] Upon uptake by hepatocytes, the nucleocapsid translocates to the nucleus and the DNA is released. Here, DNA strand synthesis is completed, the gap is repaired, and a 3.2 kb covalently closed circular (c cc) supercoiled DNA. This cccDNA is composed of five major viral mRNAs. of the transcripts of NA (which are 3.5, 3.5, 2.4, 2.1, and 0.7 kb in length). All mRNAs are capped at the 5' end and polynucleotides at the 3' end. All five mRNAs share a sequence overlap at their 3' ends.

[0006] A single 3.5 kb mRNA contains the core protein and a template for polymerase production. The same transcripts also act as pre-genome replication intermediates, thereby The core protein is capable of initiating reverse transcription of the virus polymerase into DNA. The other 3.5 kb mRNA is required for nucleocapsid formation. In the absence of replication inhibitors, it encodes the precore of the HBeAg antigen. Antigen abundance correlates with hepatitis B virus replication in the liver and can be used to monitor disease progression. This will be an important diagnostic marker for targeting.

[0007] The 2.4 kb and 2.1 kb mRNAs encode the large, medium, and small surface antigens of the virus. The open reading frames ("ORFs") pre-S1, pre-S2 and pre-S3 for expression of The S antigen is associated with the infectious, intact particle. The blood of the infected individuals contains non-infectious particles derived from the S antigen alone, without genomic DNA or polymerase. The function of these particles is not fully understood. Detectable S antigen in blood Complete and sustained depletion of HBV is a reliable indicator of hepatitis B virus clearance. It is thought that...

[0008] The 0.7 kb mRNA encodes the X protein. This gene product is expressed in the viral genome. Important for efficient gene transcription and as a transcriptional activator for host gene expression The latter activity appears to be important for hepatocellular transformation during the development of liver cancer. can be.

[0009] Detectable S antigen, e antigen, and / or viral DNA in the blood for more than 6 months Patients with this condition are considered to be chronically infected. Nucleoside analogues are typically the first treatment option for many patients. Administration of rifavir, tenofovir, and / or entecavir has been shown to improve liver function and reduce the risk of recurrence of liver cirrhosis, typically the most serious of which is liver cirrhosis. The study found that the reduction of hepatitis B virus, sometimes to undetectable levels, was accompanied by a reduction in liver inflammation, which is considered a key benefit. However, complete and sustained remission after treatment has not been achieved. Furthermore, hepatitis B virus is a virus that is difficult to treat with long-term therapy. As the virus spreads, it develops resistance to drugs. This is especially true for hepatitis B and human immunodeficiency virus (HIV). ) is difficult for patients who are co-infected with both viruses. It is sensitive to nucleoside analogue drugs and resistance may develop at the same time.

[0010] A second treatment option is the administration of interferon alpha, where patients receive 6 months High doses of interferon alpha are administered for a period of time. Asian genotype B has a high response rate. Co-infection with hepatitis D virus (HDV) or human immunodeficiency virus (HIV) is very unlikely. It has been shown to completely inactivate terferon alpha therapy. It causes severe liver damage and severe fibrosis. Patients with inflammatory conditions are ineligible for interferon-alpha therapy.

[0011] Certain hepatitis B virus-specific RNA interference (RNAi) drugs inhibit HBV gene expression. For example, U.S. Patent Application Publication No. 2013 / 000996 has been shown to inhibit No. 05793 (Chin et al.), which is incorporated herein by reference in its entirety. The compound is a specific double-stranded ribonucleic acid (ds) inhibitor for inhibiting the expression of hepatitis B virus genes. The present invention discloses a method for producing a soluble RNA (RNA) molecule. Summary of the Invention [Means for solving the problem]

[0012] caused by hepatitis B virus (HBV) in subjects in need thereof There is a need for methods of treating and / or preventing symptoms or diseases associated with infections such as: Additionally, there is a need for methods of inhibiting the expression of one or more Hepatitis B virus genes. In particular, it is possible to selectively and efficiently inhibit the expression of hepatitis B virus (HBV) genes. Hepatitis B virus (HBV)-specific RNA interference (RNAi) drugs (referred to herein as RNAi drugs, RNAi triggers, or triggers) are used to induce H Treating or preventing a BV-related disease or condition, or preventing one or more HBV genes There is a need for methods to inhibit the expression of HBV genes. Targeted Use of Novel HBV-Specific RNAi Drug Combinations for the Prevention of HBV-Related Disease to treat or prevent, or one or more HBV-related diseases or conditions in There is a need for methods of inhibiting the expression of HBV genes.

[0013] Described herein are methods for administering to a subject (e.g., a human or animal subject) in need thereof. The present invention relates to a method for treating and / or preventing symptoms or diseases associated with HBV infection in an animal. The method involves one or more antibodies capable of selectively and efficiently reducing the expression of HBV genes. In some embodiments, the method comprises administering a number of HBV gene-specific RNAi agents. Symptoms and diseases associated with HBV infection include chronic liver disease / injury, inflammation, fibrotic conditions, Proliferative diseases (including cancers such as hepatocellular carcinoma), hepatitis D virus (HDV) infection, and acute H In some embodiments, symptoms and The disease is associated with chronic HBV and / or HDV infection.

[0014] Additionally, described herein are methods for treating HBV infection in a subject in need thereof. and a method for treating and / or preventing a symptom or disease associated with HB, the method comprising administering to a subject a Disclosed HBV RNA capable of selectively and efficiently reducing V gene expression The method includes administering a pharmaceutical composition containing one or more of the following drugs:

[0015] Also, for example, by administering an effective amount of the pharmaceutical composition to a human subject, Pharmaceutical compositions for use in the treatment and / or prevention of symptoms or diseases associated with HBV infection in Also described herein are symptoms or diseases associated with HBV infection in human subjects. The use of the pharmaceutical composition in the manufacture of a medicament for use in the treatment and / or prevention of can be.

[0016] In some embodiments, one or more of the disclosed HBV RNAi agents and administering to a subject a pharmaceutical composition comprising the steps of: In some embodiments, methods exist for preventing HBV infection in a subject. Pharmaceutical compositions for use in the treatment or prevention of diseases associated with HBV infection include those comprising the disclosed HBV R In some embodiments, the disclosed HBV inhibitors include one or more of the following NAi agents: administering to a subject a pharmaceutical composition comprising one or more of the RNAi agents. In some embodiments, there are methods for treating diseases associated with HBV infection. The pharmaceutical composition for use in treating a disease associated with HBV infection in a subject is disclosed. In some embodiments, the HBV RNAi agents include one or more of the HBV RNAi agents listed. administering a pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents. There are methods for preventing disease associated with HBV infection in a subject, including: In some embodiments, for use in preventing a disease associated with HBV infection in a subject. The pharmaceutical compositions comprise one or more of the disclosed HBV RNAi agents.

[0017] In some embodiments, the one or more HBV RNAi agents are administered in a single dose. In some embodiments, one or more of the above-mentioned compounds are administered to a subject in an amount of about 25 to 400 mg. The HBV RNAi drugs are administered in a combined dose of approximately 100 mg per dose. In some embodiments, one or more HBV RNAi agents are administered in a single dose. The dose is approximately 35 mg, 50 mg, 200 mg, 300 mg, or 400 mg per dose. In some embodiments, one or more HBV RNAi agents are administered in a single dose. Approximately 40 mg per dose, approximately 100 mg per dose, or approximately 200 mg per dose In some embodiments, one or more HBV antibodies are administered in a combined amount of 1 g. The RNAi agents are administered in a combined dose of approximately 40 mg per dose. In embodiments, the one or more HBV RNAi agents are administered in a dose of about 100 mg per dose. In some embodiments, one or more HBV R NAi drugs are administered in a combined dose of approximately 200 mg per dose. In embodiments, the one or more HBV RNAi agents are administered in an amount of about 1-10 ml per dose. In some embodiments, one or more of H BV RNAi drugs are administered at a combined dose of approximately 1-5 mg / kg per dose. In some embodiments, one or more HBV RNAi agents are administered for about 1 to 18 weeks. In some embodiments, the one or more HBV RNAi agents are administered at intervals. In some embodiments, the doses are administered at intervals of about one month (i.e., once a month). Therefore, one or more HBV RNAi agents are administered at intervals of about once every four weeks. In some embodiments, the one or more HBV RNAi agents are administered in a dose of about 40 The combination dose is administered at intervals of approximately once every four weeks in a dose of approximately 100 mg, approximately 100 mg, or approximately 200 mg. In some embodiments, the one or more HBV RNAi agents are administered for about 7 days. In some embodiments, one or more of the following are administered at intervals of 4 days, 21 days, or 28 days: Several HBV RNAi agents are administered at or about 28 day intervals. In embodiments, the one or more HBV RNAi agents are administered in a dose of about 40 mg per dose. , about 100 mg or about 200 mg at intervals of 28 days or at intervals of about 28 days ( In some embodiments, one or more HBV The RNAi drug is administered at a combined dose of approximately 40 mg per dose, at intervals of 28 days or approximately 2 In some embodiments, one or The HBV RNAi drugs are administered in a combined dose of approximately 100 mg per dose for 28 days. In some embodiments, the doses are administered at intervals of about 10 days or about 28 days (i.e., Q4W). In this case, one or more HBV RNAi agents are administered in a combined dose of approximately 200 mg per dose. The doses are administered at or about 28 day intervals (i.e., Q4W).

[0018] Further described herein are compounds that inhibit the expression of one or more Hepatitis B virus genes. In some embodiments, the method comprises administering to a subject a therapeutic agent selected from the group consisting of one or more HBV strains. In some embodiments, the method inhibits expression of most or all of the transcripts. In some embodiments, the method inhibits expression of a number of HBV transcripts. In some embodiments, the method comprises administering one or more HBV RNAi agents described in wherein the method comprises one or more of the HBV RNAi agents described herein. In some embodiments, the method comprises administering a pharmaceutical composition as described herein. In some embodiments, the method comprises administering two HBV RNAi agents described herein. The method includes administering a pharmaceutical composition comprising two HBV RNAi agents described herein. In some embodiments, the method comprises treating a cell infected with HBV with the method described herein. In some embodiments, the method includes contacting the HBV with one or more of the HBV RNAi agents described above. In this method, the HBV-infected cells are treated with two HBV RNAi agents described herein. In some embodiments, the method comprises contacting one or more HBV RNAs. The drugs are administered in a combined dose of approximately 25 to 400 mg per dose. In embodiments, the one or more HBV RNAi agents are administered in a dose of about 100 ml per dose. In some embodiments, one or more HBV antibodies are administered in a combined amount of 1 g. The RNAi drug is administered in a single dose of approximately 35 mg, 50 mg, 200 mg, 300 mg, or 4 In some embodiments, one or more of H The BV RNAi agent is administered in a single dose of about 40 mg, about 100 mg, or about 200 mg. In some embodiments, one or more HBV RNA The i agents are administered in a combined amount of about 40 mg per dose. In the present invention, the one or more HBV RNAi agents are administered in a combination of about 100 mg per dose. In some embodiments, one or more HBV RNAi The drugs are administered in a combined amount of about 200 mg per dose. wherein the one or more HBV RNAi agents are administered at a dose of about 1 to 10 mg / kg per dose. In some embodiments, one or more HBV antibodies are administered in a combined amount of 1 g. The RNAi agents are administered in a combined amount of about 1-5 mg / kg per dose. In some embodiments, the one or more HBV RNAi agents are administered at intervals of about 1 to 18 weeks. In some embodiments, the one or more HBV RNAi agents are administered at a dose of about 1 In some embodiments, the dose is administered at monthly intervals (i.e., once a month). One of the combination doses of 40, 100 or 200 mg per dose or multiple HBV RNAi drugs, such as one or more HBV RNAi drugs, administered approximately every 4 weeks. In some embodiments, one or more HBV RNA The drugs are administered at intervals of about 7 days, 14 days, 21 days, or 28 days. wherein the one or more HBV RNAi agents are administered at or about 28 day intervals. In some embodiments, one or more HBV RNAi agents are administered in a single dose. Approximately 40 mg per dose, approximately 100 mg per dose, or approximately 200 mg per dose administered at or about 28-day intervals (i.e., Q4W) In some embodiments, one or more HBV RNAi agents are administered in a single dose. A combination dose of approximately 40 mg administered 28 days apart or approximately 28 days apart (i.e., Q4W) In some embodiments, the one or more HBV RNAi agents are administered in a dose of 1 A combination dose of approximately 100 mg per dose is administered at intervals of 28 days or approximately 28 days (i.e., In some embodiments, one or more HBV R The NAi drug is administered at a combined dose of approximately 200 mg per dose, at intervals of 28 days or approximately 28 days. The doses are administered at intervals of 24 hours (i.e., Q4W).

[0019] The HBV RNAi agents disclosed herein comprise at least one sense strand and one agonist. The sense strand and the antisense strand may be partially, substantially, or completely The sense and antisense strands of the RNAi agents described herein can be complementary to each other. The length of each strand may be 16 to 30 nucleotides. In some cases, the sense and antisense strands are independently 17 to 26 nucleotides in length. In this embodiment, the sense strand and the antisense strand are independently 19 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand independently comprise 21 to 26 nucleotides. In some embodiments, the sense strand and the antisense strand are independently The sense and antisense strands are of the same or different lengths. The HBV RNAi agents disclosed herein can be any length of known HBV At least partially in a sequence in the HBV genome that is conserved across most V serotypes The nucleic acid sequence is designed to contain an antisense strand sequence that is complementary to the nucleic acid sequence described herein. The RNAi agents described above, when delivered to cells expressing HBV, have been shown to inhibit HBV in vivo or in vivo In vitro, it inhibits the expression of one or more HBV genes.

[0020] The HBV RNAi drug contains a sense strand (also called a passenger strand) that contains the first sequence. and an antisense strand (also called a guide strand) comprising a second sequence. The sense strand of the HBV RNAi drug is designed to target at least 16 nucleotides in the HBV mRNA. having at least about 85% identity to the nucleotide sequence of consecutive nucleotides of In some embodiments, the sequence in the HBV mRNA comprises the core stretch. The sense strand core nucleotide stretch having at least about 85% identity to 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. The antisense strand of the RNAi drug targets a sequence in the HBV mRNA and the corresponding sense strand. over a core stretch of at least 16 consecutive nucleotides, In some embodiments, the HB V mRNA or the corresponding sense strand sequence has at least about 85% complementarity The antisense strand core nucleotide sequences are: or 23 nucleotides in length.

[0021] Sense and antisense strands of HBV RNAi drugs that can be used for HBV RNAi drugs Examples of HBV RNAi drug duplexes are provided in Tables 3 and 4. 5. Sense and antisense strands of HBV RNAi agents disclosed herein Examples of 19 nucleotide core stretch sequences consisting of or contained in the strand are shown in Table 1. 2 will be provided.

[0022] In some embodiments, the one or more HBV RNAi agents are any of those known in the art. Any known oligonucleotide delivery technique may be used to deliver to the target cell or tissue. Nucleic acid delivery methods include liposomal encapsulation and iontophoresis. or other vehicles (e.g., hydrogels, cyclodextrins, biodegradable nanocapsules) and bioadhesive microspheres), proteinaceous vectors, or Dynamic Pol These include, but are not limited to, incorporation into dimer conjugates (DPCs). (e.g., International Publication Nos. 2000 / 053722 and 2008 / 00223) See No. 09, No. 2011 / 104169, and No. 2012 / 083185. (Each of which is incorporated herein by reference.) In some embodiments, H BV RNAi agents are administered to target cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group is delivered to the asialoglycoprotein The antibody may include a cell receptor ligand, such as an ASGPr ligand. In this embodiment, the ASGPr ligand comprises or consists of a galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises N-acetyl Some examples contain N-acetyl-galactosamine trimers or N-acetyl-galactosamine tetramers. In an embodiment, the galactose derivative cluster is an N-acetyl-galactosamine trimer. or N-acetyl-galactosamine tetramer.

[0023] The targeting group is attached to the 3' or 5' end of the sense or antisense strand of the HBV RNAi agent. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0024] The targeting group may be any of the sensors disclosed in Tables 2, 3, and 4, with or without a linker. The linker may be attached to the 5' or 3' end of the sense strand and / or the antisense strand. Any sense strand and / or antisense strand disclosed in Tables 2, 3, and 4, with or without a group. It can be attached to the 5' or 3' end of the sense strand.

[0025] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes and a method for inhibiting the nucleotide sequence of a nucleic acid molecule comprising: or administering a composition comprising multiple HBV RNAi agents.

[0026] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. and a method for treating or preventing a disease, the method comprising administering to a subject a duplex composition disclosed in Table 5. The method includes administering a composition comprising one or more HBV RNAi agents having a sequence.

[0027] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. a method for treating a disease comprising administering to a subject a vaccine comprising administering to a subject a vaccine having a duplex sequence disclosed in Table 5. The method includes administering a composition comprising one or more HBV RNAi agents.

[0028] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. The method comprises administering to a patient a vaccine comprising a 1-nucleotide polynucleotide having a duplex sequence as disclosed in Table 5. The method includes administering a composition comprising one or more HBV RNAi agents.

[0029] In some embodiments, the composition comprises at least one nucleotide sequence having different nucleotide sequences. In some embodiments, the combination or cocktail of two HBV RNAi agents is In this manner, two or more different HBV RNAi agents are each separately and independently linked to a targeting group. In some embodiments, two or more different HBV RNAi agents are Each is linked to a targeting group consisting of N-acetyl-galactosamine. In embodiments, when two or more RNAi agents are included in the composition, each of the RNAi agents In some embodiments, two or more RNAs are linked to the same targeting group. When RNAi agents are included in a composition, each of the RNAi agents may have a different targeting group (e.g., a different a targeting group having the chemical structure

[0030] In some embodiments, the targeting group can be H without the use of an additional linker. In some embodiments, the targeting group is linked to an HBV RNAi agent. It is designed to have a pre-existing linker to facilitate linking to an RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the two The above RNAi agents can be linked to targeting groups using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents are linked to the targeting group using different linkers.

[0031] HBV mRNA is known to be polycistronic, meaning that it contains multiple polypeptides. The polypeptides are translated and each mRNA overlaps in its RNA sequence. A single gene-targeted RNAi drug inhibits most or all HBV transcripts However, without being bound by theory, it is possible to Two or more HBV RNAi agents targeting a location or region (and, in particular, one HBV One RNAi agent targets the S ORF and a second HBV RNAi agent targets the X ORF. A composition containing two or more HBV RNAi agents (i.e., two or more HBV RNAi agents) may contain only a single HBV RNAi agent. It is hypothesized that these compositions may provide additional benefits over compositions containing For example, (a) ensuring that all HBV viral transcripts are targeted ( That is, a 3.5 kb pregenomic RNA, a 3.5 kb precore mRNA, a 2.4 kb Pre-S1 mRNA, 2.1 kb pre-S2 / S mRNA, 0.7 kb X mRNA (b) any S antigen-expressing mRNA produced from the integrated HBV DNA; working to expand genotype coverage to potentially address a larger patient population; and / or (c) potentially reducing viral resistance through mutations in the siRNA binding site. Examples include:

[0032] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes and a method for inhibiting HBV RNase activity, the method comprising: administering a pharmaceutical composition comprising a combination of Ai drugs, wherein each HBV RNAi agent is In some embodiments, different positions or regions of the HBV gene are targeted. Described herein are methods for treating or preventing an HBV-related disease or condition in a subject. a method for preventing or inhibiting the expression of one or more HBV genes, administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents , each HBV RNAi drug is designed to target a different HBV transcript (e.g., For example, in a composition comprising two HBV RNAi agents, the first HBV RNAi agent is An amplicon that is at least partially complementary to a nucleotide sequence located in the S ORF of a gene. The first HBV RNAi agent contains a sense strand, while the second HBV RNAi agent is located in the X ORF of the HBV gene. (including an antisense strand that is at least partially complementary to a nucleotide sequence located at the site of the gene.) As used herein, a sequence of nucleotides located at least in part in an S ORF The RNAi agent comprising the complementary antisense strand is located at positions 1-13 of the HBV genome in SEQ ID NO: 1. 07 and a portion of 3185-3221. As used herein, X OR RNA containing an antisense strand at least partially complementary to the nucleotide sequence located at F The Ai drug targets part of positions 1308-1930 of the HBV genome in SEQ ID NO: 1. In some embodiments, the conditions and diseases are associated with chronic HBV infection and / or HDV infection. In some embodiments, the subject has been diagnosed with HBeA for at least 6 months. Have a diagnosis of chronic HBV infection with HBeAg positive or HBeAg negative.

[0033] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. a method for treating or preventing a disease, the method comprising administering to a subject at least two nucleic acids having different sequences. and administering to a subject a pharmaceutical composition comprising a combination of HBV RNAi agents, each of which is an HBV RNAi agents target different locations or regions of the HBV gene. In one embodiment, described herein are methods for treating or preventing HBV-related disease in a subject. and a method for preventing HBV infection, the method comprising administering a combination of at least two HBV RNAi drugs. wherein each HBV RNAi agent targets a different HBV transcript. (e.g., in a composition comprising two HBV RNAi agents, the first HBV RNAi drugs target a specific nucleotide sequence located in the S ORF of the HBV gene. the first HBV RNAi agent comprises an antisense strand that is at least partially complementary to the first HBV RNAi agent, while the second HBV RNAi agent comprises an antisense strand that is at least partially complementary to the first HBV RNAi agent. At least partially complementary to a nucleotide sequence located in the X ORF of the HBV gene (including the antisense strand).

[0034] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. The present invention relates to a method for treating HBV infection, the method comprising administering to a patient a HBV R gene having at least two different sequences. administering a pharmaceutical composition comprising a combination of HBV RNAi agents, wherein each HBV RNAi agent is In some embodiments, the HBV gene is targeted to a different position or region. Described herein is a method of treating HBV-associated disease in a subject, the method comprising administering to the subject a therapeutically effective amount of HBV. The method involves administering a pharmaceutical composition comprising a combination of at least two HBV RNAi agents. Each HBV RNAi agent is designed to target a different HBV transcript. (For example, in a composition comprising two HBV RNAi agents, the first HBV RNAi agent is at least partially complementary to a nucleotide sequence located in the S ORF of the BV gene The second HBV RNAi agent contains the antisense strand, while the second HBV RNAi agent contains the X ORF of the HBV gene. (including an antisense strand at least partially complementary to a nucleotide sequence located in .

[0035] In some embodiments, at least two HBV RNAi agents are administered per dose. In some embodiments, the combined dose is about 25 to 400 mg per dose. At least two HBV RNAi drugs are available in doses of approximately 25-50 mg and 50-75 mg per dose. mg, 75~100mg, 100~125mg, 125~150mg, 150~175m g, 175~200mg, 200~225mg, 225~250mg, 250~275m g, 275~300mg, 300~325mg, 325~350mg, 350~375m g, 375~400mg, 25~75mg, 50~100mg, 100~150mg, 1 50~200mg, 200~250mg, 250~300mg, 300~350mg, 3 50~400mg, 25~100mg, 50~150mg, 100~200mg, 150 ~250mg, 200~300mg, 300~400mg, 25~200mg, or 20 In some embodiments, at least one of the following is administered: The two HBV RNAi drugs are approximately 30-50 mg per dose and approximately 90-110 mg or a combination dose of approximately 190-210 mg per dose. In some embodiments, at least two HBV RNAi agents are administered in a single dose. In some embodiments, the combined dose is about 30-50 mg per dose. At least two HBV RNAi drugs are combined in a dose of approximately 90-110 mg per dose. In some embodiments, at least two HBV RNAi The drug is administered in a combined dose of approximately 190-210 mg per dose. In an embodiment, the at least two HBV RNAi agents are administered in a dose of about 25 mg per dose. g, approx. 50mg, approx. 100mg, approx. 125mg, approx. 150mg, approx. 175mg, approx. 200 mg, about 225mg, about 250mg, about 275mg, about 300mg, about 325mg, about 3 It is administered in a combined dose of about 50 mg, about 375 mg, or about 400 mg. In embodiments, the at least two HBV RNAi agents are administered in a dosage of about 50 mg per dose. , about 75 mg, about 100 mg, or about 125 mg. In one embodiment, the one or more HBV RNAi agents are administered in a dose of about 35 mg / dose. 50 mg, 100 mg, 200 mg, 300 mg, or 400 mg combination doses In some embodiments, at least two HBV RNAi agents are administered at a single dose. Approximately 35 mg, 50 mg, 100 mg, 200 mg, 300 mg or 400 mg per minute dose In some embodiments, at least two HBV antibodies are administered in a combined amount of 100 mg / kg. The RNAi agent is administered in a dosage of about 40 mg, about 100 mg, or about 200 mg. In some embodiments, at least two HBV RNA The i agents are administered in a combined amount of about 40 mg per dose. In this study, at least two HBV RNAi drugs were administered in a combination of approximately 100 mg per dose. In some embodiments, at least two HBV RNs are administered in a combined amount. The AI ​​drugs are administered in a combined dose of approximately 200 mg per dose. In some embodiments, the at least two HBV RNAi agents are administered for about 7 days, about 14 days, about 21 days, or are administered at intervals of about 28 days. In some embodiments, at least two HBV The RNAi agent is administered at or about 28 day intervals (ie, Q4W). In some embodiments, at least two HBV RNAi agents are administered per dose. At a combined dose of about 40 mg, about 100 mg, or about 200 mg, administered at intervals of 28 days or about 2 In some embodiments, the dose is administered at intervals of 8 days (i.e., Q4W). The two HBV RNAi drugs are administered in a combined dose of approximately 40 mg per dose, and last for 28 days. In some embodiments, the doses are administered at intervals of about 10 days or about 28 days (i.e., Q4W). In this study, at least two HBV RNAi drugs were administered in a combination of approximately 100 mg per dose. The combined doses are administered at or about 28-day intervals (i.e., Q4W). In some embodiments, the at least two HBV RNAi agents are administered in a dose of about 2 00 mg combination dose, administered at or approximately 28-day intervals (i.e., Q4W) It is given.

[0036] In some embodiments, at least two HBV RNAi agents are administered per dose. In some embodiments, the combined dose is about 1 to 10 mg / kg. At least two HBV RNAi drugs are administered in combination at approximately 1-5 mg / kg per dose. In some embodiments, at least two HBV RNAi The drug is administered at a dose of approximately 1-1.5 mg / kg, approximately 1.5-2.0 mg / kg, or approximately 2. 0~2.5mg / kg, approx. 2.5~3.0mg / kg, approx. 3.0~3.5mg / kg, approx. 3.5~4.0mg / kg, about 4.0~4.5mg / kg, about 4.5~5.0mg / kg , about 5.0~5.5mg / kg, about 5.5~6.0mg / kg, about 6.0~6.5mg / kg, approximately 6.5-7.0 mg / kg, approximately 7.0-7.5 mg / kg, approximately 7.5-8.0 m g / kg, about 8.0~8.5mg / kg, about 8.5~9.0mg / kg, about 9.0~9. 5mg / kg, about 9.5~10mg / kg, about 1~2.5mg / kg, about 2.5~5.0 mg / kg, about 5.0~7.5mg / kg, about 7.5~10mg / kg, about 1~5.0m g / kg, or a combined dose of about 5.0-10 mg / kg.

[0037] In some embodiments, at least two HBV RNAi agents are administered within about 1 to 18 weeks. In some embodiments, at least two HBV RNAi The medicine is given at intervals of about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, and about 6 weeks. Every week, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks Every 12 weeks, every 13 weeks, every 14 weeks, every 15 weeks, or every 16 weeks In some embodiments, the doses are administered every 17 weeks, at intervals of about 17 weeks, or at intervals of about 18 weeks. At least two HBV RNAi drugs are administered approximately 1 to 6 months apart. In embodiments, the at least two HBV RNAi agents are administered at intervals of about one month, about two months, or , approximately 3-month intervals, approximately 4-month intervals, approximately 5-month intervals, or approximately 6-month intervals In some embodiments, the at least two HBV RNAi agents are administered in a 4-week interval. In some embodiments, one or more H The BV RNAi agent is administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In some embodiments, the one or more HBV RNAi agents are administered at intervals of 28 days or about 28 days. It is administered at intervals of .

[0038] In some embodiments, the at least two HBV RNAi agents comprise from about 1 to 12 In some embodiments, at least two HBV The RNAi agent may be used for at least about 1 month, at least about 2 months, at least about 3 months, or at least At least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months or In some embodiments, the at least one agonist is administered for a period of at least about 12 months. At least two HBV RNAi drugs are administered over a period of approximately 1 to 18 weeks. In some embodiments, the at least two HBV RNAi agents are administered in a manner similar to that described above for at least about one week. At least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about In some embodiments, at least two H The BV RNAi agent is administered over a period of about 12 weeks or 3 months.

[0039] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes This method targets the S ORF of HBV RNA (i.e., These include S transcripts (S, pre-S1, and pre-S2), pregenomic RNA (core and polymerase chain reaction), and The antisense strand targets the HBV genome pre-core transcript (HBeAg). One HBV RNAi drug targets the X ORF of HBV RNA (i.e., That is, the X transcript of the HBV genome, the S transcript (S, pre-S1, and pre-S2), the pre-genome RNA (core and polymerase), and the precore transcript of the HBV genome (HBeAg) Therapeutic approaches include combining one HBV RNAi drug with another (with a targeting antisense strand) In some embodiments, the pharmaceutical compositions described herein are administered. The pharmaceutical composition comprises at least one HBV antibody containing a sequence targeting the S ORF of the HBV gene. RNAi drugs and a second HBV RNA containing a sequence targeting the X ORF of the HBV gene Includes AI drugs.

[0040] In some embodiments, described herein is a method for treating HBV-associated disease in a subject. The present invention relates to a method for treating or preventing HBV disease, the method comprising: (i.e., S transcripts (S, pre-S1, and pre-S2), pre-genomic RNA (core and polymerase), and the pre-core transcript of the HBV genome (HBeAg). One HBV RNAi drug (having an antisense strand) and one targeting the X ORF of HBV RNA. The target is the X transcript, S transcript (S, pre-S1, and pre-S2 transcripts) of the HBV genome. ), pregenomic RNA (core and polymerase), and precore transcripts of the HBV genome ( Combination of an HBV RNAi drug with an antisense strand targeting HBeAg In some embodiments, the method comprises administering a pharmaceutical composition comprising the combination of The pharmaceutical composition described in the above is a composition comprising at least one HBV gene targeting sequence S ORF. Another HBV RNAi drug and a second one containing a sequence targeting the X ORF of the HBV gene HBV RNAi drugs and

[0041] In some embodiments, the two HBV RNAi agents are substituted at a ratio of about 1:1, 2:1, 3: In some embodiments, two HBV antibodies are administered in a ratio of 1, 4:1, or 5:1. The RNAi agents are administered in a ratio of about 2:1.

[0042] In some embodiments, the two HBV RNAi agents are administered in a dose of about 25 mg / kg or more per dose. At a combination dose of up to 75 mg, about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or In some embodiments, the two HBV RNAi agents are administered in a ratio of about 1:2. , with a combination dose of approximately 50 to 125 mg per dose, and approximately 2:1, approximately 3:1, and approximately 1: In some embodiments, the medicament is administered in a ratio of about 1:1, about 4:1, about 5:1, or about 1:2. The two HBV RNAi drugs are administered in a combined dose of approximately 75-150 mg per dose. The ratio is about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a dose of about 100 to about 100 ribozymes per dose. At a 200 mg combination dose, about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or In some embodiments, the two HBV RNAi agents are administered in a ratio of about 1:2. , with a combination dose of approximately 150 to 250 mg per dose, and In some embodiments, the medicament is administered in a ratio of about 4:1, about 4:1, about 5:1, or about 1:2. The two HBV RNAi drugs are administered in a combined dose of approximately 200-300 mg per dose. and administered in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a dose of about 30 Combination doses of 0 to 400 mg are approximately 2:1, 3:1, 1:1, 4:1, and 5:1. or in a ratio of about 1:2. In some embodiments, two HBV RNAi The drugs are administered in combinations of approximately 50 to 100 mg per dose, with ratios of approximately 2:1, approximately 3:1, and approximately In some embodiments, the ratio is about 1:1, about 4:1, about 5:1, or about 1:2. The two HBV RNAi drugs are administered in a combined dose of approximately 25-400 mg per dose. In some embodiments, two HBV RNAi The drugs are administered in a combination dose of approximately 25 to 75 mg per dose, in a ratio of approximately 2:1. In some embodiments, the two HBV RNAi agents are administered in a dose of about 50 In some embodiments, the combined dose is about 125 mg, administered in a ratio of about 2:1. The two HBV RNAi drugs are administered in a combined dose of approximately 75-150 mg per dose. In some embodiments, two HBV RNAi The drugs are administered in a ratio of approximately 2:1, with a combined dose of approximately 100-200 mg per dose. In some embodiments, the two HBV RNAi agents are administered in doses of about The combined dose is 125-225 mg, administered in a ratio of about 2:1. In this study, the two HBV RNAi drugs were administered in a combination of approximately 150-250 mg per dose. In some embodiments, the combined doses are administered in a ratio of about 2:1. The RNAi drug is administered in a combination dose of approximately 200-300 mg per dose, at a ratio of approximately 2:1. In some embodiments, the two HBV RNAi agents are administered in a single dose. The combined dose is approximately 300-400 mg per day, administered in a ratio of approximately 2:1. In embodiments, the two HBV RNAi agents are combined in a single dose of about 35 mg. In some embodiments, two HBV R The NAi drugs will be administered in a ratio of approximately 2:1, with a combined dose of approximately 40 mg per dose. In some embodiments, the two HBV RNAi agents are administered in a dose of about 10 In some embodiments, the combined dose is 20 mg, and the combined dose is administered in a ratio of about 2:1. The two HBV RNAi drugs were administered at a combined dose of approximately 200 mg per dose, with a ratio of approximately 2:1. In some embodiments, the two HBV RNAi agents are administered in a ratio of The combined dose is about 300 mg per dose, administered in a ratio of about 2:1. In this formulation, the two HBV RNAi drugs are combined in a single dose of approximately 400 mg. In some embodiments, two HBV RNs are administered in a ratio of about 2:1. The AI ​​drugs are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In embodiments, the two HBV RNAi agents are administered at or about 28 days apart (i.e., In some embodiments, two HBV RNAi agents are administered in a single dose. is one of approximately 40 mg, approximately 100 mg, or approximately 200 mg per dose. and a combination of 28 days or about 28 days apart (i.e., Q4 In some embodiments, the two HBV RNAi agents are administered in a single dose. A combination dose of about 40 mg per dose, in a ratio of about 2:1, at intervals of 28 days or about 28 days apart. In some embodiments, two HBV The RNAi agents were administered in a combination dose of approximately 100 mg per dose, in a ratio of approximately 2:1. In some embodiments, the doses are administered at intervals of about 28 days or about 28 days (i.e., Q4W). In this study, the two HBV RNAi drugs were administered at a combined dose of approximately 200 mg per dose. , at a ratio of about 2:1, administered at or about 28 day intervals (i.e., Q4W) .

[0043] In some embodiments, the first RNAi agent is administered in a dose of about 3 to 650 ml per dose. g of the second RNAi agent, and the second RNAi agent is administered in an amount of about 2-325 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 35 to 400 mg / dose. In some embodiments, the first RNAi agent is administered in an amount of 265 mg. In some embodiments, the second RNAi agents are administered in amounts of approximately 20-125 mg per dose. In some embodiments, the second RNAi agent is administered in an amount of about 25-50 mg per dose. do.

[0044] In some embodiments, the two RNAi agents are administered in a dose of 25-400 ml. In one embodiment, the two RNAi agents are administered in a combined dose of 25 to 4 g. 00 mg combination dose, and the first RNAi agent is administered in combination with the second RNAi agent at 100 mg. In one embodiment, the respective doses of the first and second RNAi agents are administered in a ratio of 1:1. In one embodiment, the amount is about 12 mg for a combined dose of about 25 mg. , wherein the dose of each of the first and second RNAi agents is about 35 mg for a combined dose of about 35 mg. In one embodiment, the amount of each of the first and second RNAi agents is about 17 mg. In one embodiment, the amount is about 20 mg for a combined dose of about 40 mg. , wherein the dose of each of the first and second RNAi agents is about 50 mg for a combined dose of about 50 mg. In one embodiment, the amount of each of the first and second RNAi agents is about 25 mg. The amount is about 50 mg for a combined dose of about 100 mg. Thus, the doses of each of the first and second RNAi agents are about 200 mg for a combined dose of about 200 mg. In one embodiment, each of the first and second RNAi agents is in an amount of about 100 mg. The dose is about 150 mg for a combined dose of about 300 mg. In some embodiments, the dose of each of the first and second RNAi agents is about 400 mg of the combination. In some embodiments, the two RNAi agents are in an amount of about 200 mg per dose. are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In the method, the two RNAi agents are administered 28 days apart or approximately 28 days apart (i.e., Q4W). In one embodiment, the dose of each of the first and second RNAi agents is about In an amount of about 20 mg for a 40 mg combination dose, or in an amount of about 100 mg for a 100 mg combination dose or in an amount of about 1 mg for a combined dose of about 200 mg. The two RNAi agents are administered at or about 28 days apart (i.e., In one embodiment, each of the first and second RNAi agents is administered The dose is approximately 20 mg for a combined dose of approximately 40 mg. The NAi drug is administered at or about 28 day intervals (i.e., Q4W). In embodiments, the dose of each of the first and second RNAi agents is about 100 mg of the combination. The combined dose is approximately 50 mg, and the two RNAi agents are administered at intervals of 28 days or approximately In one embodiment, the first and second The dose of each RNAi agent is approximately 100 mg for a combined dose of approximately 200 mg. and the two RNAi agents are administered at or about 28 days apart (i.e., Q4 It is administered at 100 W.

[0045] In one embodiment, the two RNAi agents are combined in a single dose of 25-400 mg. The first RNAi agent is administered in a 2:1 ratio with the second RNAi agent. In one embodiment, the dose of the first RNAi agent is in an amount of about 16 mg and the dose of the second RNAi agent is about 16 mg. The dose of the RNAi agent is in an amount of about 8 mg for a combination dose of about 25 mg. In embodiments, the dose of the first RNAi agent is in an amount of about 24 mg and the dose of the second RNAi agent is about 24 mg. In one embodiment, the dose is about 12 mg for a combined dose of about 35 mg. wherein the dose of the first RNAi agent is in an amount of about 27 mg and the dose of the second RNAi agent is In one embodiment, the first the dose of the first RNAi agent is in an amount of about 33 mg, and the dose of the second RNAi agent is in an amount of about 50 mg In one embodiment, the first RNAi The dose of the first RNAi agent is about 65 mg, and the dose of the second RNAi agent is about 100 mg of the combination. In one embodiment, the dose of the first RNAi agent is about 35 mg. is an amount of about 133 mg, and the dose of the second RNAi agent is about 200 mg for the combination. In one embodiment, the dose of the first RNAi agent is about and the dose of the second RNAi agent is about 200 mg for a combined dose of about 300 mg. In one embodiment, the dose of the first RNAi agent is about 27 mg. 0 mg of the second RNAi agent, and the dose of the second RNAi agent is about 400 mg for a combined dose of about In some embodiments, the two RNAi agents are administered in an amount of about 7 days. In some embodiments, the two doses are administered at intervals of about 14 days, about 21 days, or about 28 days. The two RNAi agents are administered at or about 28-day intervals (i.e., Q4W). In one embodiment, the dose of the first RNAi agent is in an amount of about 27 mg and the dose of the second RNAi agent is about 27 mg. The dose of the AI ​​drug is approximately 13 mg for a combined dose of approximately 40 mg. The RNAi agents are administered at or about 28 day intervals (i.e., Q4W). In one embodiment, the dose of the first RNAi agent is in an amount of about 65 mg and the dose of the second RNAi agent is about 65 mg. The dose of the drug is approximately 35 mg for a combined dose of approximately 100 mg. The RNAi agents are administered at or about 28 day intervals (i.e., Q4W). In one embodiment, the dose of the first RNAi agent is in an amount of about 133 mg and the dose of the second RNAi agent is about 133 mg. The dose of the AI ​​drug is approximately 67 mg for a combined dose of approximately 200 mg. The two RNAi agents are administered at or about 28-day intervals (i.e., Q4W). .

[0046] In one embodiment, the two RNAi agents are combined in a single dose of 25-400 mg. The first RNAi agent is administered in a 3:1 ratio with the second RNAi agent. In one embodiment, the dose of the first RNAi agent is in an amount of about 18 mg and the dose of the second RNAi agent is about 18 mg. The dose of the RNAi agent is in an amount of about 6 mg for a combination dose of about 25 mg. In embodiments, the dose of the first RNAi agent is in an amount of about 27 mg and the dose of the second RNAi agent is about 27 mg. In one embodiment, the dose is about 9 mg for a combined dose of about 35 mg. wherein the dose of the first RNAi agent is in an amount of about 30 mg and the dose of the second RNAi agent is in an amount of about In one embodiment, the first The dose of the RNAi agent is in an amount of about 36 mg and the dose of the second RNAi agent is in an amount of about 50 mg. In one embodiment, the first RNAi agent is in an amount of about 12 mg for the combined dose. The dose of the first RNAi agent is about 75 mg, and the dose of the second RNAi agent is about 100 mg of the combined In one embodiment, the dose of the first RNAi agent is in an amount of about 25 mg. , in an amount of about 150 mg, and the dose of the second RNAi agent is a combined dose of about 200 mg. In one embodiment, the dose of the first RNAi agent is about 2 and the dose of the second RNAi agent is about 25 mg for a combined dose of about 300 mg. In one embodiment, the dose of the first RNAi agent is about 300 mg. g of the second RNAi agent for a combined dose of about 1 mg for a combined dose of about 400 mg. In some embodiments, the two RNAi agents are administered in an amount of about 7 days, about 100 mg. In some embodiments, the two are administered at intervals of about 4 days, about 21 days, or about 28 days. The RNAi agent is administered at or about 28 day intervals (i.e., Q4W). In an embodiment, the dose of the first RNAi agent is in an amount of about 30 mg and the dose of the second RNAi agent is about 30 mg. The dose of the drug is about 10 mg for a combined dose of about 40 mg, and the two R The NAi drug is administered at or about 28 day intervals (i.e., Q4W). In embodiments, the dose of the first RNAi agent is in an amount of about 75 mg and the dose of the second RNAi agent is about 100 mg. The dose of R is about 25 mg for a combined dose of about 100 mg. The NAi drug is administered at or about 28 day intervals (i.e., Q4W). In embodiments, the dose of the first RNAi agent is in an amount of about 150 mg and the dose of the second RNAi agent is about 150 mg. The dose of the drug is about 50 mg for a combined dose of about 200 mg. The RNAi agent is administered at or about 28 day intervals (ie, Q4W).

[0047] In some embodiments, the two HBV RNAi agents are administered in a dose of about 1 to 20 mg / kg of HBV RNAi agent per dose. In some embodiments, two HBs are administered at a combined dose of 10 mg / kg. The V RNAi agent is administered in a combined amount of about 1-5 mg / kg per dose. In some embodiments, the two HBV RNAi agents are administered in a dose of about 1 to 1 .5mg / kg, about 1.5~2.0mg / kg, about 2.0~2.5mg / kg, about 2.5 ~3.0mg / kg, about 3.0-3.5mg / kg, about 3.5-4.0mg / kg, about 4 .0~4.5mg / kg, about 4.5~5.0mg / kg, about 5.0~5.5mg / kg, Approximately 5.5 to 6.0 mg / kg, approximately 6.0 to 6.5 mg / kg, approximately 6.5 to 7.0 mg / kg g, about 7.0~7.5mg / kg, about 7.5~8.0mg / kg, about 8.0~8.5mg / kg, about 8.5~9.0mg / kg, about 9.0~9.5mg / kg, about 9.5~10m g / kg, about 1~2.5mg / kg, about 2.5~5.0mg / kg, about 5.0~7.5m g / kg, about 7.5 to 10 mg / kg, about 1 to 5.0 mg / kg, or about 5.0 to 10 m In some embodiments, two HBV R The NAi agent is administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In embodiments, the two HBV RNAi agents are administered 28 days apart or about 28 days apart (all It is administered Q4W.

[0048] In some embodiments, the first RNAi agent is administered at a dose of about 0.6-7 ml per dose. g / kg, and the second RNAi agent is administered at about 0.3-5 mg / kg per dose. In some embodiments, the second RNAi agent is administered in an amount of 100 mg / kg per dose. In some embodiments, the second The RNAi agent is administered in an amount of about 0.3 to 1.5 mg / kg per dose. In some embodiments, the first RNAi agent is administered at a dose of about 0.6-5 mg / kg. g per dose. In some embodiments, the first RNAi agent is administered in an amount of In some embodiments, the first R The NAi agent and the second RNAi agent are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, the first RNAi agent and the second RNAi agent are administered The doses are administered at 8 day intervals or at intervals of about 28 days (ie, Q4W).

[0049] Disclosed herein is a method for inhibiting HBV gene expression, the method comprising: The method comprises transfecting one or more HBV vectors with an antisense strand comprising any of the sequences in Table 3. administering an RNAi agent.

[0050] Disclosed herein is a method for inhibiting HBV gene expression, the method comprising: The method comprises: 1) generating one or more HBV RNA fragments having a sense strand comprising any of the sequences in Table 4; This includes administering Ai drugs.

[0051] Disclosed herein is a method for inhibiting HBV gene expression, the method comprising: The method comprises: an antisense strand containing any one of the sequences in Table 3; and a nucleic acid sequence encoding the antisense strand. and a sense strand comprising a sequence of any of the sequences in Table 4 that is at least partially complementary to The method includes administering one or more HBV RNAi agents.

[0052] Disclosed herein is a method for inhibiting HBV gene expression, the method comprising: The method involves combining an antisense strand consisting of any of the sequences in Table 3 with a target sequence for the antisense strand. and a sense strand consisting of a sequence of any of the sequences in Table 4 that is at least partially complementary to the sequence of the sequence in Table 4. The method includes administering one or more HBV RNAi agents to the patient.

[0053] Disclosed herein are methods for inhibiting HBV gene expression in cells. and the method comprises: This includes administering medication.

[0054] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions caused by HBV infection. or a method for preventing a condition, the method comprising administering to a subject an antibody comprising any of the sequences in Table 3. This involves administering one or more HBV RNAi agents that have a sense strand.

[0055] Disclosed herein are methods for treating diseases associated with infection caused by HBV. or a method of preventing the infection, the method comprising administering an anti-cancer drug containing any of the sequences in Table 3. This involves administering one or more HBV RNAi agents that have a sense strand.

[0056] Disclosed herein are methods for treating diseases associated with infection caused by HBV. The method comprises: The method includes administering one or more HBV RNAi agents having the formula:

[0057] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions caused by HBV infection. or a method for preventing a condition, the method comprising: The method includes administering one or more HBV RNAi agents having a strand.

[0058] Disclosed herein are methods for treating diseases associated with infection caused by HBV. or a method for preventing, the method comprising: The method includes administering one or more HBV RNAi agents having a strand.

[0059] Disclosed herein are methods for treating diseases associated with infection caused by HBV. The method comprises the step of: The method includes administering one or more HBV RNAi agents.

[0060] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions caused by HBV infection. or a method for preventing a condition, the method comprising administering to a subject an antibody comprising any of the sequences in Table 3. a sense strand and any of the sequences of Table 4 at least partially complementary to the antisense strand thereof; and administering one or more HBV RNAi agents having a sense strand comprising the sequence of Includes:

[0061] Disclosed herein are methods for treating diseases associated with infection caused by HBV. or a method of preventing the infection, the method comprising administering an anti-cancer drug containing any of the sequences in Table 3. A sequence of Table 4 that is at least partially complementary to the sense strand and its antisense strand. and a sense strand comprising any one of the sequences of This includes:

[0062] Disclosed herein are methods for treating diseases associated with infection caused by HBV. The method comprises: and any of the sequences in Table 4 that are at least partially complementary to the antisense strand thereof. and administering one or more HBV RNAi agents having a sense strand containing the sequence include.

[0063] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions caused by HBV infection. or a method for preventing a symptom, the method comprising: a sense strand and any of the sequences listed in Table 4 that are at least partially complementary to the antisense strand and a sense strand consisting of the sequence of This includes:

[0064] Disclosed herein are methods for treating diseases associated with infection caused by HBV. or a method for preventing the infection, the method comprising administering to a subject an antibody having any of the sequences in Table 3. a sequence of Table 4 that is at least partially complementary to the antisense strand of the antisense strand; and one or more HBV RNAi agents having a sense strand consisting of any of the sequences listed above. This includes giving.

[0065] Disclosed herein are methods for treating diseases associated with infection caused by HBV. The method comprises: and one of the sequences in Table 4 that is at least partially complementary to the antisense strand. and administering one or more HBV RNAi agents having a sense strand consisting of one or more of the sequences. Includes:

[0066] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions caused by HBV infection. or a method for preventing symptoms, the method comprising administering to a subject one or more of the following compounds having the duplex structure of Table 5: involves administering multiple HBV RNAi drugs.

[0067] Disclosed herein are methods for treating diseases associated with infection caused by HBV. or a method for preventing, the method comprising: The method includes administering an HBV RNAi drug.

[0068] Disclosed herein are methods for treating diseases associated with infection caused by HBV. The method comprises: administering an RNAi agent.

[0069] Disclosed herein is a method for inhibiting HBV gene expression, the method comprising: The method comprises: (i) an antibody comprising or consisting of any of the sequences in Table 2 or Table 3; an HBV RNAi agent having an antisense strand, and (ii) a sequence in Table 2 or Table 3 a second HBV RNA having an antisense strand comprising or consisting of any of the sequences This includes administering medication.

[0070] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions caused by HBV infection. or a method for preventing a condition, the method comprising: (i) administering to a subject a sequence selected from the group consisting of any of the sequences in Table 2 or Table 3; an HBV RNAi agent having an antisense strand comprising or consisting of any of the sequences; and (ii) an antibody comprising or consisting of any of the sequences in Table 2 or Table 3; administering a second HBV RNAi agent having a sense strand.

[0071] Disclosed herein are methods for treating diseases associated with infection caused by HBV. or a method of preventing, the method comprising: (i) a gene encoding any of the sequences in Table 2 or Table 3; an HBV RNAi agent having an antisense strand comprising or consisting of the sequence of ) Antisense comprising or consisting of any of the sequences of Table 2 or Table 3 and administering a second HBV RNAi agent having a strand.

[0072] Disclosed herein are methods for treating diseases associated with infection caused by HBV. a method for detecting a sequence of a nucleic acid molecule comprising: (i) detecting a sequence of a nucleic acid molecule selected from the sequences of Table 2 or Table 3; and (ii) an HBV RNAi agent having an antisense strand comprising or consisting of a compound according to Table 2 or or having an antisense strand comprising or consisting of any of the sequences in Table 3. and administering a second HBV RNAi agent that inhibits HBV replication.

[0073] Disclosed herein is a method for inhibiting HBV gene expression, the method comprising: The method comprises: (i) an antibody comprising or consisting of any of the sequences in Table 2 or Table 3; an antisense strand and a sequence of Table 2 or Table 3 that is at least partially complementary to the antisense strand; a first H having a sense strand comprising or consisting of any of the sequences in Table 4; BV RNAi agent, and (ii) a sequence comprising any of the sequences in Table 2 or Table 3. or an antisense strand consisting of the same and a A sense strand comprising or consisting of any of the sequences of complementary Table 2 or Table 4 and administering a second HBV RNAi agent having

[0074] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions caused by HBV infection. or a method for preventing a condition, the method comprising: (i) administering to a subject a sequence selected from the group consisting of any of the sequences in Table 2 or Table 3; an antisense strand containing or consisting of any of the sequences, and a small amount of or a sequence at least partially complementary to any of the sequences of Table 2 or Table 4. and (ii) a first HBV RNAi agent having a sense strand consisting of a sequence selected from the group consisting of a sequence identified in Table 2 or Table 3. an antisense strand comprising or consisting of any one of the sequences of the three sequences; Any of the sequences in Table 2 or Table 4 that are at least partially complementary to the sense strand and a second HBV RNAi agent having a sense strand comprising or consisting of the sequence This includes:

[0075] Disclosed herein are methods for treating diseases associated with infection caused by HBV. or a method of preventing, the method comprising: (i) a gene encoding any of the sequences in Table 2 or Table 3; and an antisense strand comprising or consisting of the sequence of or a sequence of any of the sequences of Table 2 or Table 4 which is partially complementary to and (ii) a first HBV RNAi agent having a sequence of any one of Table 2 and Table 3. an antisense strand comprising or consisting of any of the sequences of the any of the sequences in Table 2 or Table 4 that are at least partially complementary to the strand and a second HBV RNAi agent having a sense strand comprising or consisting of include.

[0076] Disclosed herein are methods for treating diseases associated with infection caused by HBV. a method for detecting a sequence of a nucleic acid molecule comprising: (i) detecting a sequence of a nucleic acid molecule selected from the sequences of Table 2 or Table 3; an antisense strand comprising or consisting of an antisense strand at least partially A sequence comprising or consisting of any of the sequences in Table 2 or Table 4 complementary to and (ii) a first HBV RNAi agent having a sequence of any one of Table 2 or Table 3. and an antisense strand comprising or consisting of any of the sequences of or a sequence of any of the sequences of Table 2 or Table 4 that is at least partially complementary to and administering a second HBV RNAi agent having a sense strand consisting of the second HBV RNAi agent.

[0077] In some embodiments, the HBV RNAi agents disclosed herein are: : a. From the sequence (5'→3') AUUGAGAGAAGUCCACCAC (SEQ ID NO: 7) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; and , the sequence (5'→3') GUGGUGGACUUCUCUCAAU (SEQ ID NO: 34) to 0 a sense strand comprising a nucleobase sequence that differs by 1, 1, 2 or 3 nucleobases; or b. From the sequence (5'→3') UUUGAGAGAAGUCCACCAC (SEQ ID NO: 8) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; and , the sequence (5'→3') GUGGUGGACUUCUCUCAAA (SEQ ID NO: 35) to 0 a sense strand comprising a nucleobase sequence that differs by 1, 1, 2 or 3 nucleobases; or c. The sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or d. The sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or e. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or f. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or g. The sequence (5' to 3') ACCAAUUUAUGCCUACAGC (SEQ ID NO: 22) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 49) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or h. The sequence (5' to 3') UCCAAUUUAUGCCUACAGC (SEQ ID NO: 23) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 50) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or i. The sequence (5' to 3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or j. The sequence (5' to 3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or k. The sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) The sense strands include those containing nucleobase sequences that differ by 0, 1, 2 or 3 nucleobases.

[0078] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. wherein the composition comprises an HBV RNAi agent.

[0079] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of HBV RNAi V genes, Including medicines.

[0080] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV gene, the composition comprising an HBV RNAi agent. .

[0081] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. wherein the composition comprises two or more HBV RNAi agents, and a first HBV V RNAi drugs: i) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi drug is: i) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the iii) the sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the

[0082] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of V genes, the composition inhibiting expression of two or more HBV The first HBV RNAi agent comprises: iii) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from iv) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi drug is: iv) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the v) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or vi) the sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) The sense strand includes a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sense strand.

[0083] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of two or more HBV RNAs. The first HBV RNAi drugs include: v) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or vi) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi drug is: vii) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from viii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 2 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. strand, and the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55 a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from ix) sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) The sense strand includes a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sense strand.

[0084] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. wherein the composition comprises two or more HBV RNAi agents, and a first HBV V RNAi drugs: i) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi drug is: i) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the iii) the sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the

[0085] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of V genes, the composition inhibiting expression of two or more HBV The first HBV RNAi agent comprises: iii) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from iv) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi drug is: iv) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the v) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or vi) the sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) The sense strand includes a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sense strand.

[0086] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of two or more HBV RNAs. The first HBV RNAi drugs include: v) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or vi) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi drug is: vii) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from viii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 2 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. strand, and the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55 a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from ix) sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) The sense strand includes a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sense strand.

[0087] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method is a method for inhibiting the expression of HBV genes in cells. administering a composition comprising two or more HBV RNAi agents, HBV RNAi drugs are: i) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence that is essentially complementary to the antisense strand.

[0088] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition for inhibiting expression of V genes, the composition comprising two or more and a first HBV RNAi agent, the first HBV RNAi agent being: iii) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from iv) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence that is essentially complementary to the antisense strand.

[0089] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition for inhibiting expression of two or more HBVs. The first HBV RNAi agent comprises: v) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or vi) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence that is essentially complementary to the antisense strand.

[0090] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. wherein the composition comprises two or more HBV RNAi agents, and a first HBV V RNAi drugs: i) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence that is essentially complementary to the antisense strand.

[0091] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of V genes, the composition inhibiting expression of two or more HBV The first HBV RNAi agent comprises: iii) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from iv) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence that is essentially complementary to the antisense strand.

[0092] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of two or more HBV RNAs. The first HBV RNAi drugs include: v) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or vi) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence that is essentially complementary to the antisense strand.

[0093] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. wherein the composition comprises two or more HBV RNAi agents, and a first HBV The V RNAi agent is at least partially complementary to a portion of the S ORF of HBV mRNA. and the second HBV RNAi agent comprises an antisense strand having the sequence: i) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the iii) the sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) and a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the

[0094] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of V genes, the composition inhibiting expression of two or more HBV a first HBV RNAi agent targeting a portion of the S ORF of HBV mRNA; an antisense strand having a sequence at least partially complementary to a second HBV R NAi drugs are: iv) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the v) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) antisense strands containing nucleobase sequences differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or vi) the sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) The sense strand includes a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sense strand.

[0095] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of two or more HBV RNAs. The first HBV RNAi drug targets a small portion of the S ORF of HBV mRNA. a second HBV RNAi agent comprising an antisense strand having a sequence at least partially complementary to the second HBV RNAi agent; teeth: vii) the sequence (5'→3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from viii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 2 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. strand, and the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55 a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from ix) sequence (5'→3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56) The sense strand includes a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sense strand.

[0096] In some embodiments, the HBV RNAi agents disclosed herein are: : a. Sequence (5'→3') UACCAAUUUAUGCCUACAGGCCUUAU (sequence Column 149) contains nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. antisense strand, or b. Sequence (5'→3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or c. The sequence (5' to 3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 15 Antisense containing a nucleic acid base sequence that differs from 1) by 0, 1, 2, or 3 nucleic acid bases Chain, or d. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 15 2) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or e. The sequence (5' to 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 15 4) Antisense containing a nucleic acid base sequence that differs from the above by 0, 1, 2, or 3 nucleic acid bases Chain, or f. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 16 0) antisense containing a nucleic acid base sequence that differs by 0, 1, 2, or 3 nucleic acid bases Chain, or g. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 16 2) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or h. Sequence (5'→3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or i. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 1) 70) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or j. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 17 Antisense containing a nucleic acid base sequence that differs from 1) by 0, 1, 2, or 3 nucleic acid bases Chain, or k. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 1) 72) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or l. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1) 73) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or m. sequence (5'→3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 17 4) Antisense containing a nucleic acid base sequence that differs from the above by 0, 1, 2, or 3 nucleic acid bases Chain, or n. Sequence (5'→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 1 75) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or o. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 17 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or p. sequence (5'→3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 179) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or q. The sequence (5'→3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 1 80) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or r. The sequence (5'→3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 18 Antisense containing a nucleic acid base sequence that differs from 1) by 0, 1, 2, or 3 nucleic acid bases Chain, or s. sequence (5'→3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 2) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or t. Sequence (5'→3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 83) containing antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or u. Sequence (5'→3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 1 84) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or v. The sequence (5'→3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 5) Antisense containing a nucleic acid base sequence that differs from the above by 0, 1, 2, or 3 nucleic acid bases Chain, or w. sequence (5'→3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 86) containing antisense oligonucleotides that differ by 0, 1, 2, or 3 nucleotides. chain, or x. sequence (5'→3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 18 7) Antisense containing a nucleic acid base sequence that differs from the above by 0, 1, 2, or 3 nucleic acid bases Chain, or y. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 18 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or z. The sequence (5' to 3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 18) 9) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or aa. sequence (5'→3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 90) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or bb. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 91) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or cc. sequence (5'→3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 92) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or dd. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 93) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or ee. The sequence (5'→3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 1 94) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Su chain, the HBV RNAi agent comprises at least partially complementary to each antisense strand; It further comprises a complementary sense strand.

[0097] In some embodiments, the HBV RNAi agents disclosed herein are: : a. Sequence (5'→3') UACCAAUUUAUGCCUACAGGCCUUAU (sequence Column number 149) consists of a nucleic acid base sequence that differs by 0, 1, 2 or 3 nucleic acid bases the antisense strand, or b. Sequence (5'→3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150) and an antisense oligonucleotide consisting of a nucleic acid base sequence that differs by 0, 1, 2, or 3 nucleic acid bases. the sense strand, or c. The sequence (5' to 3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 15 1) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. chain, or d. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 15 2) Antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or e. The sequence (5' to 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 15 4) Antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or f. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 16 0) to antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or g. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 16 2) Antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or h. Sequence (5'→3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163) and an antisense oligonucleotide consisting of a nucleic acid base sequence that differs by 0, 1, 2, or 3 nucleic acid bases. the sense strand, or i. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 1) 70) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or j. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 17 1) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. chain, or k. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 1) 72) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or l. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1) 73) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or m. sequence (5'→3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 17 4) Antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or n. Sequence (5'→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 1 75) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or o. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 17 8) Antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or p. sequence (5'→3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 179) and an antisense oligonucleotide consisting of a nucleic acid base sequence that differs by 0, 1, 2, or 3 nucleic acid bases. the sense strand, or q. The sequence (5'→3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 1 80) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or r. The sequence (5'→3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 18 1) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. chain, or s. sequence (5'→3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 2) Antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or t. Sequence (5'→3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 83) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or u. Sequence (5'→3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 1 84) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or v. The sequence (5'→3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 5) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. chain, or w. sequence (5'→3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 86) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or x. sequence (5'→3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 18 7) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. chain, or y. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 18 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or z. The sequence (5' to 3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 18) 9) Antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or aa. sequence (5'→3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 90) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or bb. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 91) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or cc. sequence (5'→3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 92) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, or dd. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 93) and antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. chain, or ee. The sequence (5'→3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 1 94) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. ance chain, the HBV RNAi agent comprises at least partially complementary to each antisense strand; It further comprises a complementary sense strand.

[0098] In some embodiments, the HBV RNAi agents disclosed herein are: : i. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfcA fgGfccsusuAu (SEQ ID NO: 61) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence different from the base; or ii. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfc 0, 1, 2 or 3 nucleotides from AfgGfcscsu (SEQ ID NO: 62) an antisense strand containing a different sequence, or iii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuA 0, 1, 2 or 3 nucleotides from fcAfgGfccsu (SEQ ID NO: 63) or an antisense strand containing a sequence different from iv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAf cAfgGfsc (SEQ ID NO: 64) differs by 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence v. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAfc A sequence differing by 0, 1, 2 or 3 nucleotides from Afgusu (SEQ ID NO: 68) an antisense strand containing the sequence, or vi. Sequence (5'→3') usAfscscaauUfuAfuGfcCfuacag csc (SEQ ID NO: 85) by 0, 1, 2, or 3 nucleotides. the antisense strand, or vii. Sequence (5'→3') usAfsusugagAfgAfaGfuCfcacc acsg (SEQ ID NO: 94) with a sequence that differs by 0, 1, 2, or 3 nucleotides an antisense strand comprising viii. Sequence (5'→3') usAfsusUfgAfgAfgAfaGfuCfc 0, 1, 2 or 3 nucleotides from AfcCfaCfgsa (SEQ ID NO: 98) or an antisense strand containing a sequence different from ix. Sequence (5'→3')usAfscsCfaAfuuuauGfcCfuAfcA A sequence differing by 0, 1, 2 or 3 nucleotides from fgcsc (SEQ ID NO: 102) an antisense strand containing the sequence, or x.Sequence (5'→3')usAfscsCfaAfuuuauGfcCfuAfcAf A sequence that differs from gcusu (SEQ ID NO: 103) by 0, 1, 2, or 3 nucleotides an antisense strand containing the sequence, or xi. Sequence (5'→3')usAfscsCfaAfuuuauGfcCfuAfcA differs by 0, 1, 2 or 3 nucleotides from fgccsu (SEQ ID NO: 104) an antisense strand containing the sequence, or xii. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfc Afgccusu (SEQ ID NO: 105) differs by 0, 1, 2, or 3 nucleotides. an antisense strand comprising the sequence xiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf cCfuAfcAfgusu (SEQ ID NO: 107) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence with a different octide; or xiv. Sequence (5'→3') cPrpusAfsusUfgAfgAfgAfaGfu CfcAfcCfaCfsg (SEQ ID NO: 108) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence with a different octide; or xv. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfcC A sequence that differs from fausu (SEQ ID NO: 109) by 0, 1, 2, or 3 nucleotides an antisense strand containing the sequence, or xvi. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc differs from Cfacsg (SEQ ID NO: 110) by 0, 1, 2 or 3 nucleotides an antisense strand containing the sequence, or xvii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAf 0, 1, 2 or 3 nucleotides from cCfacsusu (SEQ ID NO: 111) an antisense strand containing a different sequence, or xviii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcA 0, 1, 2 or 3 nucleotides from fcCfacsgsa (SEQ ID NO: 112) or an antisense strand containing a sequence different from xix. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc Cfacusu (SEQ ID NO: 120) differs by 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence xx.Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaGf uCfcusu (SEQ ID NO: 125) differs by 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence xxi. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaG fuCfcasc (SEQ ID NO: 126) differs by 0, 1, 2, or 3 nucleotides. an antisense strand comprising the sequence xxii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfa 0, 1, 2 or 3 nucleotides from GfuCfcacusu (SEQ ID NO: 127) an antisense strand containing a sequence different from the base; or xxiii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAf aGfuCfcacsc (SEQ ID NO: 128) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence different from the base; or xxiv. Sequence (5'→3')usGfsasAfaAfuUfgAfgAfgAfa 0, 1, 2 or 3 nucleotides from GfuCfcusu (SEQ ID NO: 129) an antisense strand containing a different sequence, or xxv. Sequence (5'→3')usGfsasAfaAfuUfgAfgAfgAfaG fuCfcasc (SEQ ID NO: 130) differs by 0, 1, 2, or 3 nucleotides. an antisense strand comprising the sequence xxvi.Array(5'→3')asCfscsAfaUfuUfaUfgCfcUfa 0, 1, 2 or 3 nucleotides from CfaGfcusu (SEQ ID NO: 131) an antisense strand containing a different sequence, or xxvii. Sequence (5'→3') asCfscsAfaUfuUfaUfgCfcUf aCfaGfccusu (SEQ ID NO: 132) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence different from the base; or xxviii.Sequence (5'→3')asCfscsAfaUfuUfaUfgCfcU 0, 1, 2 or 3 nucleotides from faCfaGfccusc (SEQ ID NO: 133) an antisense strand containing a sequence different from the base; or xxix.Array(5'→3')usCfscsAfaUfuUfaUfgCfcUfa 0, 1, 2 or 3 nucleotides from CfaGfcusu (SEQ ID NO: 134) an antisense strand containing a different sequence, or xxx.Sequence (5'→3')usCfscsAfaUfuUfaUfgCfcUfaC 0, 1, 2 or 3 nucleotides from faGfccusu (SEQ ID NO: 135) an antisense strand containing a different sequence, or xxxi. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf cCfuAfcAfgcsc (SEQ ID NO: 136) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence with a different octide; or xxxii. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfgscsc (SEQ ID NO: 137) an antisense strand containing a sequence different from the base; or xxxiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfu GfcCfuAfcAfgscsc (SEQ ID NO: 138) to 0, 1, 2 or 3 an antisense strand containing a sequence that differs in nucleotides, or xxxiv. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfgcsu (SEQ ID NO: 139) or an antisense strand containing a sequence different from xxxv. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCfu 0, 1, 2 or 3 nucleotides from AfcAfgcsg (SEQ ID NO: 140) an antisense strand containing a different sequence, or xxxvi. Sequence (5'→3') asAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfgcsc (SEQ ID NO: 141) or an antisense strand containing a sequence different from xxxvii. Sequence (5'→3')usAfscsCfaAfuUfUfAfuGfc CfuAfcAfgusu (SEQ ID NO: 142) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence different from the base; or xxxviii. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfc CfuAfcAfgCfsc (SEQ ID NO: 143) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence with a different octide; or xxxix.Array(5'→3')asCfscAfaUfuUfaUfgCfcUfa 0, 1, 2 or 3 nucleotides from CfaGfcCfsu (SEQ ID NO: 144) or an antisense strand containing a sequence different from xl.Sequence (5'→3')usCfscAfaUfuUfaUfgCfcUfaCfa GfcCfsu (SEQ ID NO: 145) differs by 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence xli.Sequence (5'→3')asCfscAfaUfuUfaUfgCfcUfaCf aGfccsg (SEQ ID NO: 146) differing by 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence xlii. Sequence (5'→3')usCfscAfaUfuUfaUfgCfcUfaC faGfccsg (SEQ ID NO: 147) differs by 0, 1, 2, or 3 nucleotides. an antisense strand comprising the sequence xliii. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfggsg (SEQ ID NO: 148) an antisense strand containing a sequence different from that of wherein a, g, c, and u are 2'-O-methyl (2'-OMe) modified nucleotides. Af, Cf, Gf, and Uf are 2'-fluoro-modified nucleotides, and s is phosphorothioate. etheno-nucleoside linkages, and the remaining nucleotide monomers are phosphodiester bonds The cPrpu is linked by 5'-cyclopropylphosphonate-2'-O-methyl modification. This HBV RNAi drug contains at least one modified nucleotide for each antisense strand. The sense strand also contains a partially complementary sense strand.

[0099] In some embodiments, the HBV RNAi agents disclosed herein are: : i. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfcA an antisense strand consisting of fgGfccsusuAu (SEQ ID NO: 61); or ii. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfc an antisense strand consisting of AfgGfcscsu (SEQ ID NO: 62); or iii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuA an antisense strand consisting of fcAfgGfccsu (SEQ ID NO: 63); or iv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAf an antisense strand consisting of cAfgGfsc (SEQ ID NO: 64); or v. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAfc an antisense strand consisting of Afgusu (SEQ ID NO: 68); or vi. Sequence (5'→3') usAfscscaauUfuAfuGfcCfuacag an antisense strand consisting of csc (SEQ ID NO: 85); or vii. Sequence (5'→3') usAfsusugagAfgAfaGfuCfcacc an antisense strand consisting of acsg (SEQ ID NO: 94); or viii. Sequence (5'→3') usAfsusUfgAfgAfgAfaGfuCfc An antisense strand consisting of AfcCfaCfgsa (SEQ ID NO: 98), or ix. Sequence (5'→3')usAfscsCfaAfuuuauGfcCfuAfcA an antisense strand consisting of fgcsc (SEQ ID NO: 102); or x.Sequence (5'→3')usAfscsCfaAfuuuauGfcCfuAfcAf an antisense strand consisting of gcusu (SEQ ID NO: 103); or xi. Sequence (5'→3')usAfscsCfaAfuuuauGfcCfuAfcA an antisense strand consisting of fgccsu (SEQ ID NO: 104); or xii. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfc an antisense strand consisting of Afgccusu (SEQ ID NO: 105); or xiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf an antisense strand consisting of cCfuAfcAfgusu (SEQ ID NO: 107); or xiv. Sequence (5'→3') cPrpusAfsusUfgAfgAfgAfaGfu an antisense strand consisting of CfcAfcCfaCfsg (SEQ ID NO: 108); or xv. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfcC an antisense strand consisting of fausu (SEQ ID NO: 109); or xvi. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc an antisense strand consisting of Cfacsg (SEQ ID NO: 110); or xvii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAf an antisense strand consisting of cCfacsusu (SEQ ID NO: 111); or xviii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcA an antisense strand consisting of fcCfacsgsa (SEQ ID NO: 112), or xix. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc an antisense strand consisting of Cfacusu (SEQ ID NO: 120); or xx.Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaGf an antisense strand consisting of uCfcusu (SEQ ID NO: 125); xxi. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaG an antisense strand consisting of fuCfcasc (SEQ ID NO: 126); or xxii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfa an antisense strand consisting of GfuCfcacusu (SEQ ID NO: 127); or xxiii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAf an antisense strand consisting of aGfuCfcacsc (SEQ ID NO: 128); or xxiv. Sequence (5'→3')usGfsasAfaAfuUfgAfgAfgAfa an antisense strand consisting of GfuCfcusu (SEQ ID NO: 129); or xxv. Sequence (5'→3')usGfsasAfaAfuUfgAfgAfgAfaG an antisense strand consisting of fuCfcasc (SEQ ID NO: 130); or xxvi.Array(5'→3')asCfscsAfaUfuUfaUfgCfcUfa an antisense strand consisting of CfaGfcusu (SEQ ID NO: 131); or xxvii. Sequence (5'→3') asCfscsAfaUfuUfaUfgCfcUf an antisense strand consisting of aCfaGfccusu (SEQ ID NO: 132); or xxviii.Sequence (5'→3')asCfscsAfaUfuUfaUfgCfcU an antisense strand consisting of faCfaGfccusc (SEQ ID NO: 133); or xxix.Array(5'→3')usCfscsAfaUfuUfaUfgCfcUfa an antisense strand consisting of CfaGfcusu (SEQ ID NO: 134); or xxx.Sequence (5'→3')usCfscsAfaUfuUfaUfgCfcUfaC an antisense strand consisting of faGfccusu (SEQ ID NO: 135); or xxxi. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf an antisense strand consisting of cCfuAfcAfgcsc (SEQ ID NO: 136); or xxxii. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCf an antisense strand consisting of uAfcAfgscsc (SEQ ID NO: 137); or xxxiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfu an antisense strand consisting of GfcCfuAfcAfgscsc (SEQ ID NO: 138); or xxxiv. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCf an antisense strand consisting of uAfcAfgcsu (SEQ ID NO: 139); or xxxv. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCfu an antisense strand consisting of AfcAfgcsg (SEQ ID NO: 140); or xxxvi. Sequence (5'→3') asAfscsCfaAfuUfuAfuGfcCf an antisense strand consisting of uAfcAfgcsc (SEQ ID NO: 141); or xxxvii. Sequence (5'→3')usAfscsCfaAfuUfUfAfuGfc an antisense strand consisting of CfuAfcAfgusu (SEQ ID NO: 142); or xxxviii. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfc an antisense strand consisting of CfuAfcAfgCfsc (SEQ ID NO: 143); or xxxix.Array(5'→3')asCfscAfaUfuUfaUfgCfcUfa an antisense strand consisting of CfaGfcCfsu (SEQ ID NO: 144); or xl.Sequence (5'→3')usCfscAfaUfuUfaUfgCfcUfaCfa an antisense strand consisting of GfcCfsu (SEQ ID NO: 145); or xli.Sequence (5'→3')asCfscAfaUfuUfaUfgCfcUfaCf an antisense strand consisting of aGfccsg (SEQ ID NO: 146); or xlii. Sequence (5'→3')usCfscAfaUfuUfaUfgCfcUfaC an antisense strand consisting of faGfccsg (SEQ ID NO: 147); or xliii. Sequence (5'→3')usAfscsCfaAfuUfuAfuGfcCf an antisense strand consisting of uAfcAfggsg (SEQ ID NO: 148); wherein a, g, c, and u are 2'-O-methyl (2'-OMe) modified nucleotides. Af, Cf, Gf, and Uf are 2'-fluoro-modified nucleotides, and s is phosphorothioate. etheno-nucleoside linkages, and the remaining nucleotide monomers are phosphodiester bonds The cPrpu is linked by 5'-cyclopropylphosphonate-2'-O-methyl modification. This HBV RNAi drug contains at least one modified nucleotide for each antisense strand. The sense strand also contains a partially complementary sense strand.

[0100] In some embodiments, the HBV RNAi agents disclosed herein are: : a. Sequence (5'→3') UUGCCUGUAGGCAUAAAUUGGUAUT (sequence nucleotide sequence that differs from the nucleic acid sequence of nucleotides 275 by 0, 1, 2, or 3 nucleotides. chain, or b. Sequence (5'→3') UAUAUGCCUGUAGGCAUAAAUUGGUA (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases from column 276 ance chain, or c. The sequence (5' to 3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 27 8), or a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from teeth d. The sequence (5' to 3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 28 5) a sense strand containing a nucleobase sequence that differs from the nucleotide sequence of nucleotide 1 by 0, 1, 2, or 3 nucleobases; teeth e. The sequence (5' to 3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 28 9), or a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from teeth f. The sequence (5' to 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from g. The sequence (5' to 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 29 4) a sense strand containing a nucleobase sequence that differs from the nucleotide sequence of nucleotide 1 by 0, 1, 2, or 3 nucleobases; teeth h. The sequence (5' to 3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 3 a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from (Asp- ... or i. The sequence (5' to 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 30) 2) a sense strand containing a nucleobase sequence that differs from the nucleotide sequence of nucleotide 1 by 0, 1, 2, or 3 nucleobases; teeth j. Sequence (5'→3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 3 03), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases; or k. Sequence (5'→3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases , or l. The sequence (5' to 3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 30 6), or a sense strand containing a nucleobase sequence that differs from the nucleotide sequence of nucleotide 6 by 0, 1, 2, or 3 nucleobases; teeth m. sequence (5'→3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 3 07), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from or n. Sequence (5'→3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases , or o. Sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from p. sequence (5'→3')GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 19), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from or q. Sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from r. Sequence (5'→3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 32 a sense strand containing a nucleobase sequence that differs from 1) by 0, 1, 2, or 3 nucleobases; teeth s. sequence (5'→3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from t. sequence (5'→3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 323 a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from u. Sequence (5'→3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 3 24), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from or v. sequence (5'→3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from w. sequence (5'→3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326 a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from x. sequence (5'→3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 32 7) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases; or teeth y. The sequence (5'→3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 32 8), or a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from teeth z. The sequence (5' to 3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 32 9), or a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from teeth aa. sequence (5'→3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 3 30) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases chain, or bb. Sequence (5'→3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 3 31), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from or cc. sequence (5'→3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 3 32), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from or dd. Sequence (5'→3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 3 33), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from or ee. The sequence (5'→3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 3 34), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases from the HBV RNAi agent comprises at least partially complementary to each antisense strand; It further comprises a complementary antisense strand.

[0101] In some embodiments, the HBV RNAi agents disclosed herein are: : a. Nucleic acid base sequence (5'→3') UUGCCUGUAGGCAUAAAUUGGUAU a sense strand consisting of T (SEQ ID NO: 275), or b. Nucleic acid base sequence (5'→3') UAUAUGCCUGUAGGCAUAAAUUGG A sense strand consisting of UA (SEQ ID NO: 276), or c. Nucleic acid base sequence (5'→3') CUGUAGGCAUAAAUUGGUAUU (sequence No. 278), or d. Nucleic acid base sequence (5'→3') CGUGGUGGACUUCUCUCAAUU (sequence 285), or e. Nucleic acid base sequence (5'→3') CGUGGUGGACUUCUCUCAAUA (sequence No. 289), or f. Nucleic acid base sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292), or g. Nucleic acid base sequence (5'→3') GGCUGUAGGCAUAAAUUGGUA (sequence No. 294), or h. Nucleic acid base sequence (5'→3') UCGUGGUGGACUUCUCUCAAUU (sequence a sense strand consisting of sequence number 300), or i. Nucleic acid base sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (sequence 302), or j. Nucleic acid base sequence (5'→3') GCUGUAGGCAUAAAUUGGUAUU (sequence a sense strand consisting of sequence number 303), or k. Nucleic acid base sequence (5'→3')GGCUGUAGGCAUAAAUUGGUAUU( SEQ ID NO: 304), or l. Nucleic acid base sequence (5'→3') UGGUGGACUUCUCUCAAUAUU (sequence No. 306), or m. Nucleic acid base sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU(sequence a sense strand consisting of sequence number 307), or n. Nucleic acid base sequence (5'→3') AAUGGUGGACUUCUCUCAAUAUU( SEQ ID NO: 308), or o. Nucleic acid base sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318), or p. Nucleic acid base sequence (5'→3')GGUGGACUUCUCUCAAUUUUCU(sequence a sense strand consisting of sequence number 319), or q. Nucleic acid base sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320), or r. Nucleic acid base sequence (5'→3')GUGGACUUCUCUCAAUUUUCA (sequence No. 321), or s. Nucleic acid base sequence (5'→3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322), or t. Nucleic acid base sequence (5'→3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: No. 323), or u. Nucleic acid base sequence (5'→3') GAGGCUGUAGGCAUAAAUUGGU (sequence a sense strand consisting of sequence number 324), or v. Nucleic acid base sequence (5'→3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325), or w. Nucleic acid base sequence (5'→3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: No. 326), or x. Nucleic acid base sequence (5'→3') AGCUGUAGGCAUAAAUUGGUA (sequence No. 327), or y. Nucleic acid base sequence (5'→3') CGCUGUAGGCAUAAAUUGGUA (sequence No. 328), or z. Nucleic acid base sequence (5'→3') GGCUGUAGGCAUAAAUUGGUU (sequence No. 329), or aa. Nucleic acid base sequence (5'→3') AGGCUGUAGGCAUAAAUUGGU (sequence a sense strand containing the sequence number 330), or bb. Nucleic acid base sequence (5'→3') AGGCUGUAGGCAUAAAUUGGA (sequence a sense strand consisting of sequence number 331), or cc. Nucleic acid base sequence (5'→3') CGGCUGUAGGCAUAAAUUGGU (sequence a sense strand consisting of sequence number 332), or dd. Nucleic acid base sequence (5'→3') CGGCUGUAGGCAUAAAUUGGA (sequence a sense strand consisting of sequence number 333), or ee. Nucleic acid base sequence (5'→3') CCCUGUAGGCAUAAAUUGGUA (sequence Sense strand consisting of (sequence number 334), the HBV RNAi agent comprises at least partially complementary to each antisense strand; It further comprises a complementary antisense strand.

[0102] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprising two HBV RNAi agents, a first HBV The RNAi drug is a nucleotide sequence (5'→3')UAUUGAGAGAAGUCCACCACUU (sequence Column 175) contains nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. The antisense strand and the sequence (5'→3')GUGGUGGACUUCUCUCAAUAU A nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from U (SEQ ID NO: 307) and the second HBV RNAi agent comprises a sense strand containing the sequence (5'→3')UACCAAU 0, 1, 2 or 3 nucleic acids from UUAUGCCUACAGUU (SEQ ID NO: 154) The antisense strand contains a nucleic acid sequence with a different base, and the sequence (5'→3')CUGUA 0, 1, 2 or 3 nucleic acids from GGCAUAAAUUGGUA (SEQ ID NO: 292) and a sense strand that contains a nucleobase sequence that differs in bases.

[0103] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, the first HBV RNAi agent has the sequence (5'→3')UAUUGAGAG 0, 1, 2 or 3 nucleoside salts from AAGUCCACCACUU (SEQ ID NO: 175) an antisense strand containing a nucleobase sequence with a different base and the sequence (5'→3')GUGGUG 0, 1, 2 or 3 of GACUUCUCUCAAUAUU (SEQ ID NO: 307) a sense strand comprising a nucleobase sequence that differs by a nucleobase; and a second HBV RNAi agent comprising a From the sequence (5'→3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154) an antisense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; and , from the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292) The sense strands include those containing nucleobase sequences that differ by 0, 1, 2 or 3 nucleobases.

[0104] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. and the first HBV RNAi agent comprises the sequence (5'→3')UAUUGAGAGAAGU CCACCACUU (SEQ ID NO: 175) differing by 0, 1, 2 or 3 nucleobases and an antisense strand containing the nucleic acid base sequence (5'→3')GUGGUGGACU 0, 1, 2 or 3 nucleobases from UCUCUCAAUAUU (SEQ ID NO: 307) a sense strand comprising a different nucleobase sequence, and a second HBV RNAi agent comprising a sequence (5' → 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154) 0, 1 an antisense strand containing a nucleobase sequence that differs by one, two, or three nucleobases, and 0, 1 from 5'→3')CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292) The sense strands include those containing nucleobase sequences that differ by one, two, or three nucleobases.

[0105] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprising two HBV RNAi agents, a first HBV RNAi drugs are composed of the nucleic acid sequence (5'→3')UAUUGAGAGAAGUCCACCAC An antisense strand consisting of UU (SEQ ID NO: 175) and the nucleic acid base sequence (5'→3')G Contains a sense strand consisting of UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) The second HBV RNAi drug has the nucleobase sequence (5'→3')UACCAAUUUAU An antisense strand consisting of GCCUACAGUU (SEQ ID NO: 154) and a nucleic acid base sequence (5'→3')CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292) Contains the ance chain.

[0106] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, the first HBV RNAi agent has the nucleobase sequence (5'→3')UAUUG An antisense strand consisting of AGAGAAGUCCACCACUU (SEQ ID NO: 175), and , nucleic acid base sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: No. 307), and the second HBV RNAi agent comprises a sense strand consisting of the nucleobase sequence (5' → 3')UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154) The sense strand and the nucleic acid base sequence (5'→3') CUGUAGGCAUAAAUUGGU A (SEQ ID NO: 292).

[0107] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. the first HBV RNAi agent comprises the nucleobase sequence (5'→3')UAUUGAGAG An antisense strand consisting of AAGUCCACCACUU (SEQ ID NO: 175) and a nucleic acid salt Base sequence (5'→3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307 ), and the second HBV RNAi agent comprises a sense strand consisting of the nucleobase sequence (5'→3') Antisense consisting of UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154) The strand and the nucleic acid base sequence (5'→3') CUGUAGGCAUAAAUUGGUA (sequence The sense strand comprises the nucleotide sequence 292.

[0108] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprising two HBV RNAi agents, a first HBV The RNAi drug is a nucleotide sequence of the sequence (5'→3')AGAAAAUUGAGAGAAGUCCAC (sequence nucleotide sequence that differs from the nucleic acid sequence of nucleotides 171 by 0, 1, 2, or 3 nucleotides. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU( SEQ ID NO: 302) and contains a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases. The second HBV RNAi agent contains the sense strand and the sequence (5'→3')UACCAAUUU 0, 1, 2 or 3 nucleobases from AUGCCUACAGCG (SEQ ID NO: 188) and an antisense strand containing a nucleic acid base sequence different from the sequence (5'→3')CGCUGUA 0, 1, 2 or 3 nucleic acids from GGCAUAAAUUGGUA (SEQ ID NO: 328) and a sense strand that contains a nucleobase sequence that differs in bases.

[0109] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, the first HBV RNAi agent has the sequence (5'→3')AGAAAAUUG 0, 1, 2 or 3 nucleobases from AGAGAAGUCCAC (SEQ ID NO: 171) and an antisense strand containing a nucleic acid base sequence different from the sequence (5'→3')GUGGACU 0, 1, 2 or 3 nucleic acids from UCUCUCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand that comprises a nucleobase sequence that differs by a base, and a second HBV RNAi agent comprising a sequence ( 5'→3')UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188) to 0 antisense strands containing nucleobase sequences that differ by one, two or three nucleobases; From the sequence (5'→3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328) The sense strands include those containing nucleobase sequences that differ by 0, 1, 2 or 3 nucleobases.

[0110] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. and the first HBV RNAi agent comprises the sequence (5'→3')AGAAAAUUGAGAG differs from AAGUCCAC (SEQ ID NO: 171) by 0, 1, 2, or 3 nucleobases an antisense strand containing the nucleobase sequence and the sequence (5'→3')GUGGACUUCUC 0, 1, 2, or 3 nucleobases differ from UCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand comprising a nucleobase sequence consisting of the sequence (5'→3 ')UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188) 0, 1, an antisense strand containing a nucleobase sequence that differs by two or three nucleobases, and a sequence (5' → 3') 0, 1 from CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328) The sense strands include those containing nucleobase sequences that differ by one, two, or three nucleobases.

[0111] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method is a method for inhibiting the expression of HBV genes in cells. administering a composition comprising two HBV RNAi agents, a first HBV RNAi agent, and a second HBV RNAi agent. The BV RNAi drug has the nucleobase sequence (5'→3')AGAAAAUUGAGAGAAGU An antisense strand consisting of CCAC (SEQ ID NO: 171) and a nucleic acid base sequence (5'→3' )GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) and the second HBV RNAi agent has the nucleobase sequence (5'→3')UACCAAUUUA An antisense strand consisting of UGCCUACAGCG (SEQ ID NO: 188) and a nucleic acid base sequence From the sequence (5'→3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328) The sense strand comprises:

[0112] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition for inhibiting expression of HBV genes, the composition inhibiting expression of two HBV genes V RNAi agents, wherein the first HBV RNAi agent has the nucleobase sequence (5'→3')AG an antisense strand consisting of AAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); and the nucleic acid base sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (sequence No. 302), and the second HBV RNAi agent comprises a sense strand consisting of the nucleobase sequence (5 '→3')UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188) Antisense strand and nucleic acid base sequence (5'→3')CGCUGUAGGCAUAAAUU It contains a sense strand consisting of GGUA (SEQ ID NO: 328).

[0113] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition for inhibiting expression of two HBV RNs. The first HBV RNAi drug contains the nucleobase sequence (5'→3')AGAAAA an antisense strand consisting of UUGAGAGAAGUCCAC (SEQ ID NO: 171), and Acid-base sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 30 2), and the second HBV RNAi agent comprises a sense strand consisting of the nucleobase sequence (5'→3' )UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188) The base sequence (5'→3')CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).

[0114] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprising two HBV RNAi agents, a first HBV The RNAi drug is a nucleotide sequence of the sequence (5'→3')AGAAAAUUGAGAGAAGUCCAC (sequence nucleotide sequence that differs from the nucleic acid sequence of nucleotides 171 by 0, 1, 2, or 3 nucleotides. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU( SEQ ID NO: 302) and contains a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases. The second HBV RNAi agent contains the sense strand and the sequence (5'→3')UACCAAUUU 0, 1, 2 or 3 nucleobases from AUGCCUACAGCC (SEQ ID NO: 162) and an antisense strand containing a nucleic acid base sequence different from the sequence (5'→3')GGCUGUA 0, 1, 2 or 3 nucleic acids from GGCAUAAAUUGGUA (SEQ ID NO: 294) and a sense strand that contains a nucleobase sequence that differs in bases.

[0115] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, the first HBV RNAi agent has the sequence (5'→3')AGAAAAUUG 0, 1, 2 or 3 nucleobases from AGAGAAGUCCAC (SEQ ID NO: 171) and an antisense strand containing a nucleic acid base sequence different from the sequence (5'→3')GUGGACU 0, 1, 2 or 3 nucleic acids from UCUCUCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand that comprises a nucleobase sequence that differs by a base, and a second HBV RNAi agent comprising a sequence ( 5'→3')UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) to 0 antisense strands containing nucleobase sequences that differ by one, two or three nucleobases; From the sequence (5'→3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294) The sense strands include those containing nucleobase sequences that differ by 0, 1, 2 or 3 nucleobases.

[0116] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. and the first HBV RNAi agent comprises the sequence (5'→3')AGAAAAUUGAGAG differs from AAGUCCAC (SEQ ID NO: 171) by 0, 1, 2, or 3 nucleobases an antisense strand containing the nucleobase sequence and the sequence (5'→3')GUGGACUUCUC 0, 1, 2, or 3 nucleobases differ from UCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand comprising a nucleobase sequence consisting of the sequence (5'→3 ')UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) 0, 1, an antisense strand containing a nucleobase sequence that differs by two or three nucleobases, and a sequence (5' → 3') 0, 1 from GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294) The sense strands include those containing nucleobase sequences that differ by one, two, or three nucleobases.

[0117] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprising two HBV RNAi agents, a first HBV RNAi drugs have the nucleic acid sequence (5'→3')AGAAAAUUGAGAGAAGUCCA C (SEQ ID NO: 171), and an antisense strand consisting of the nucleic acid base sequence (5'→3')GU comprising a sense strand consisting of GGACUUCUCUCAAUUUUCU (SEQ ID NO: 302), The second HBV RNAi drug has the nucleobase sequence (5'→3')UACCAAUUUAUGC An antisense strand consisting of CUACAGCC (SEQ ID NO: 162) and a nucleic acid base sequence (5 '→3')GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294) Contains the ance chain.

[0118] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, The first HBV RNAi agent has the nucleobase sequence (5'→3')AGAAA an antisense strand consisting of AUUGAGAGAAGUCCAC (SEQ ID NO: 171), and Nucleic acid base sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 02), and the second HBV RNAi agent comprises a sense strand consisting of the nucleobase sequence (5'→3 An antisense oligonucleotide consisting of UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) The sequence of the base pair (5'→3') is GGCUGUAGGCAUAAAUUGGU. A (SEQ ID NO: 294).

[0119] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. and the first HBV RNAi agent comprises the nucleobase sequence (5'→3')AGAAAAUUG An antisense strand consisting of AGAGAAGUCCAC (SEQ ID NO: 171), and nucleobases The sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand consisting of the nucleobase sequence (5'→3')UA an antisense strand consisting of CCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); and the nucleic acid base sequence (5'→3') GGCUGUAGGCAUAAAUUGGUA (sequence The sense strand comprises the nucleotide sequence 294.

[0120] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprising two HBV RNAi agents, a first HBV The RNAi drug is a nucleotide sequence of the sequence (5'→3')AGAAAAUUGAGAGAAGUCCAC (sequence nucleotide sequence that differs from the nucleic acid sequence of nucleotides 171 by 0, 1, 2, or 3 nucleotides. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU( SEQ ID NO: 302) and contains a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases. The second HBV RNAi agent contains the sense strand and the sequence (5'→3')UACCAAUUU 0, 1, 2 or 3 nucleobases from AUGCCUACAGCC (SEQ ID NO: 162) and an antisense strand containing a nucleobase sequence that differs from the sequence (5'→3')GUGGUGG ACUUCUCUCAAUAUU (SEQ ID NO: 307) to 0, 1, 2 or 3 nuclei The sense strand contains a nucleobase sequence that differs in acid base.

[0121] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, the first HBV RNAi agent has the sequence (5'→3')AGAAAAUUG 0, 1, 2 or 3 nucleobases from AGAGAAGUCCAC (SEQ ID NO: 171) and an antisense strand containing a nucleic acid base sequence different from the sequence (5'→3')GUGGACU 0, 1, 2 or 3 nucleic acids from UCUCUCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand that comprises a nucleobase sequence that differs by a base, and a second HBV RNAi agent comprising a sequence ( 5'→3')UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) to 0 antisense strands containing nucleobase sequences that differ by one, two or three nucleobases; Sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) The sense strand includes a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the sense strand.

[0122] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. and the first HBV RNAi agent comprises the sequence (5'→3')AGAAAAUUGAGAG differs from AAGUCCAC (SEQ ID NO: 171) by 0, 1, 2, or 3 nucleobases an antisense strand containing the nucleobase sequence and the sequence (5'→3')GUGGACUUCUC 0, 1, 2, or 3 nucleobases differ from UCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand comprising a nucleobase sequence consisting of the sequence (5'→3 ')UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) 0, 1, an antisense strand containing a nucleobase sequence that differs by two or three nucleobases, and a sequence (5' → 3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) to 0 The sense strand comprises a nucleobase sequence that differs by one, two or three nucleobases.

[0123] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprising two HBV RNAi agents, a first HBV RNAi drugs have the nucleic acid sequence (5'→3')AGAAAAUUGAGAGAAGUCCA C (SEQ ID NO: 171), and an antisense strand consisting of the nucleic acid base sequence (5'→3')GU comprising a sense strand consisting of GGACUUCUCUCAAUUUUCU (SEQ ID NO: 302), The second HBV RNAi drug has the nucleobase sequence (5'→3')UACCAAUUUAUGC An antisense strand consisting of CUACAGCC (SEQ ID NO: 162) and a nucleic acid base sequence (5 '→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) In some embodiments, disclosed herein are HBV-associated nucleotide sequences comprising the sense strand. The present invention relates to a method for treating or preventing a disease associated with an infection caused by a cellular The composition inhibits the expression of HBV genes in cells, The first HBV RNAi agent comprises a nucleic acid sequence (5'→3 An antisense oligonucleotide consisting of AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) The sequence of the bases (5'→3') is GUGGACUUCUCUCAAUUUUC. and a second HBV RNAi agent comprising a sense strand consisting of nucleobase The sequence (5'→3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) and an antisense strand consisting of the nucleic acid base sequence (5'→3')GUGGUGGACUUCU It contains a sense strand consisting of CUCAAUAUU (SEQ ID NO: 307).

[0124] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. and the first HBV RNAi agent comprises the nucleobase sequence (5'→3')AGAAAAUUG An antisense strand consisting of AGAGAAGUCCAC (SEQ ID NO: 171), and nucleobases The sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) and a second HBV RNAi agent comprising a sense strand consisting of the nucleobase sequence (5'→3')UA an antisense strand consisting of CCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); and the nucleic acid base sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU (sequence The sense strand comprises the sequence number 307).

[0125] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, 2 from UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175) an antisense strand containing a nucleobase sequence that differs by one or three nucleobases, and an antisense strand containing a nucleobase sequence that differs by one or three nucleobases 0, 1, or 3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) a sense strand comprising a nucleobase sequence that differs by one, two, or three nucleobases; The RNAi drug is a nucleotide sequence (5'→3')UACCAAUUUAUGCCUACAGUU (sequence Column 154) contains nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. The antisense strand and the sequence (5'→3')CUGUAGGCAUAAAUUGGUA (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases from column 292 Contains the ance chain.

[0126] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R The NAi drug has the sequence (5'→3')UAUUGAGAGAAGUCCACCACUU (sequence nucleotide sequence that differs from the nucleic acid sequence of nucleotides 175 by 0, 1, 2, or 3 nucleotides. The sense strand and the sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) by 0, 1, 2 or 3 nucleobases. and the second HBV RNAi agent contains a sense strand containing the sequence (5'→3')UACCAAUU 0, 1, 2 or 3 nucleoside salts from UAUGCCUACAGUU (SEQ ID NO: 154) an antisense strand containing a nucleobase sequence with a different base, and the sequence (5'→3')CUGUAG 0, 1, 2 or 3 nucleoside salts from GCAUAAAUUGGUA (SEQ ID NO: 292) The groups include a sense strand that contains a different nucleobase sequence.

[0127] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 17 5) Antisense containing a nucleic acid base sequence that differs from the above by 0, 1, 2, or 3 nucleic acid bases The strand and the sequence (5'→3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: No. 307) containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases. and the second HBV RNAi agent comprises the sequence (5'→3')UACCAAUUUAUG CCUACAGUU (SEQ ID NO: 154) differing by 0, 1, 2, or 3 nucleobases and an antisense strand containing the nucleobase sequence (5'→3')CUGUAGGCAU AAAUUGGUA (SEQ ID NO: 292) differing by 0, 1, 2, or 3 nucleobases The sense strand comprises a nucleic acid sequence corresponding to the nucleic acid sequence of the nucleic acid sequence of the present invention.

[0128] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, or 2 of AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) or an antisense strand containing a nucleic acid base sequence that differs by three nucleic acid bases, and a sequence (5'→3 ')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) 0, 1, a sense strand containing a nucleobase sequence that differs by two or three nucleobases, and a second HBV R The NAi drug has the sequence (5'→3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: No. 188) containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. The sense strand and the sequence (5'→3')CGCUGUAGGCAUAAAUUGGUA (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases from column 328 Contains the ance chain.

[0129] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R NAi drugs have the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: No. 171) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases from column 302 the second HBV RNAi agent contains the sequence (5'→3')UACCAAUUUA 0, 1, 2 or 3 nucleobases from UGCCUACAGCG (SEQ ID NO: 188) an antisense strand containing a different nucleobase sequence and the sequence (5'→3')CGCUGUAG 0, 1, 2 or 3 nucleoside salts from GCAUAAAUUGGUA (SEQ ID NO: 328) The groups include a sense strand that contains a different nucleobase sequence.

[0130] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 02) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases and the second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCC Nucleotides differing by 0, 1, 2 or 3 nucleobases from UACAGCG (SEQ ID NO: 188) The antisense strand contains the acid-base sequence and the sequence (5'→3')CGCUGUAGGCAU AAAUUGGUA (SEQ ID NO: 328) differing by 0, 1, 2, or 3 nucleobases The sense strand comprises a nucleic acid sequence corresponding to the nucleic acid sequence of the nucleic acid sequence of the present invention.

[0131] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, or 2 of AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) or an antisense strand containing a nucleic acid base sequence that differs by three nucleic acid bases, and a sequence (5'→3 ')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) 0, 1, a sense strand containing a nucleobase sequence that differs by two or three nucleobases, and a second HBV R The NAi drug has the sequence (5'→3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: No. 162) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GGCUGUAGGCAUAAAUUGGUA (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases from column 294 Contains the ance chain.

[0132] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R NAi drugs have the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: No. 171) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases from column 302 the second HBV RNAi agent contains the sequence (5'→3')UACCAAUUUA 0, 1, 2 or 3 nucleobases from UGCCUACAGCC (SEQ ID NO: 162) an antisense strand containing a different nucleobase sequence and the sequence (5'→3')GGCUGUAG 0, 1, 2 or 3 nucleoside salts from GCAUAAAUUGGUA (SEQ ID NO: 294) The groups include a sense strand that contains a different nucleobase sequence.

[0133] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 02) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases and the second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCC Nucleotides differing by 0, 1, 2 or 3 nucleobases from UACAGCC (SEQ ID NO: 162) The antisense strand contains the acid-base sequence and the sequence (5'→3')GGCUGUAGGCAU AAAUUGGUA (SEQ ID NO: 294) differing by 0, 1, 2, or 3 nucleobases The sense strand comprises a nucleic acid sequence corresponding to the nucleic acid sequence of the nucleic acid sequence of the present invention.

[0134] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, or 2 of AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) or an antisense strand containing a nucleic acid base sequence that differs by three nucleic acid bases, and a sequence (5'→3 ')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) 0, 1, a sense strand containing a nucleobase sequence that differs by two or three nucleobases, and a second HBV R The NAi drug has the sequence (5'→3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: No. 162) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU( SEQ ID NO: 307) and contains a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases. Contains the sense strand.

[0135] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R NAi drugs have the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: No. 171) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases from column 302 the second HBV RNAi agent contains the sequence (5'→3')UACCAAUUUA 0, 1, 2 or 3 nucleobases from UGCCUACAGCC (SEQ ID NO: 162) an antisense strand containing a different nucleobase sequence and the sequence (5'→3')GUGGUGGA 0, 1, 2 or 3 nucleic acids from CUUCUCUCAAUAUU (SEQ ID NO: 307) and a sense strand that contains a nucleobase sequence that differs in bases.

[0136] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 02) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases and the second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCC Nucleotides differing by 0, 1, 2 or 3 nucleobases from UACAGCC (SEQ ID NO: 162) The antisense strand contains the acid-base sequence and the sequence (5'→3')GUGGUGGACUUC 0, 1, 2, or 3 nucleobases differ from UCUCAAUAUU (SEQ ID NO: 307) The sense strand comprises a nucleic acid base sequence comprising:

[0137] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, 2 from UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175) an antisense strand containing a nucleobase sequence that differs by one or three nucleobases, and an antisense strand containing a nucleobase sequence that differs by one or three nucleobases 0, 1, or 3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) a sense strand comprising a nucleobase sequence that differs by one, two, or three nucleobases; The RNAi drug is a nucleotide sequence (5'→3')UACCAAUUUAUGCCUACAGUU (sequence Column 154) contains nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. The antisense strand and the sequence (5'→3')CUGUAGGCAUAAAUUGGUA (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases from column 292 the sense strand of the first HBV RNAi agent and the sense strand of the second HBV RNAi agent It is conjugated to a targeting ligand containing N-acetyl-galactosamine.

[0138] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R The NAi drug has the sequence (5'→3')UAUUGAGAGAAGUCCACCACUU (sequence nucleotide sequence that differs from the nucleic acid sequence of nucleotides 175 by 0, 1, 2, or 3 nucleotides. The sense strand and the sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) by 0, 1, 2 or 3 nucleobases. and the second HBV RNAi agent contains a sense strand containing the sequence (5'→3')UACCAAUU 0, 1, 2 or 3 nucleoside salts from UAUGCCUACAGUU (SEQ ID NO: 154) an antisense strand containing a nucleobase sequence with a different base, and the sequence (5'→3')CUGUAG 0, 1, 2 or 3 nucleoside salts from GCAUAAAUUGGUA (SEQ ID NO: 292) a first HBV RNAi agent and a second H The sense strand of the BV RNAi drug binds to a targeting ligand containing N-acetyl-galactosamine. It is conjugated.

[0139] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 17 5) Antisense containing a nucleic acid base sequence that differs from the above by 0, 1, 2, or 3 nucleic acid bases The strand and the sequence (5'→3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: No. 307) containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases. and the second HBV RNAi agent comprises the sequence (5'→3')UACCAAUUUAUG CCUACAGUU (SEQ ID NO: 154) differing by 0, 1, 2, or 3 nucleobases and an antisense strand containing the nucleobase sequence (5'→3')CUGUAGGCAU AAAUUGGUA (SEQ ID NO: 292) differing by 0, 1, 2, or 3 nucleobases a sense strand comprising a nucleobase sequence The sense strand of the NAi drug is conjugated to an N-acetyl-galactosamine-containing targeting ligand. It's gated.

[0140] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, or 2 of AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) or an antisense strand containing a nucleic acid base sequence that differs by three nucleic acid bases, and a sequence (5'→3 ')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) 0, 1, a sense strand containing a nucleobase sequence that differs by two or three nucleobases, and a second HBV R The NAi drug has the sequence (5'→3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: No. 188) containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. The sense strand and the sequence (5'→3')CGCUGUAGGCAUAAAUUGGUA (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases from column 328 the sense strand of the first HBV RNAi agent and the sense strand of the second HBV RNAi agent It is conjugated to a targeting ligand containing N-acetyl-galactosamine.

[0141] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R NAi drugs have the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: No. 171) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases from column 302 the second HBV RNAi agent contains the sequence (5'→3')UACCAAUUUA 0, 1, 2 or 3 nucleobases from UGCCUACAGCG (SEQ ID NO: 188) an antisense strand containing a different nucleobase sequence and the sequence (5'→3')CGCUGUAG 0, 1, 2 or 3 nucleoside salts from GCAUAAAUUGGUA (SEQ ID NO: 328) a first HBV RNAi agent and a second H The sense strand of the BV RNAi drug binds to a targeting ligand containing N-acetyl-galactosamine. It is conjugated.

[0142] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 02) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases and the second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCC Nucleotides differing by 0, 1, 2 or 3 nucleobases from UACAGCG (SEQ ID NO: 188) The antisense strand contains the acid-base sequence and the sequence (5'→3')CGCUGUAGGCAU AAAUUGGUA (SEQ ID NO: 328) differing by 0, 1, 2, or 3 nucleobases a sense strand comprising a nucleobase sequence The sense strand of the NAi drug is conjugated to an N-acetyl-galactosamine-containing targeting ligand. It's gated.

[0143] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, or 2 of AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) or an antisense strand containing a nucleic acid base sequence that differs by three nucleic acid bases, and a sequence (5'→3 ')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) 0, 1, a sense strand containing a nucleobase sequence that differs by two or three nucleobases, and a second HBV R The NAi drug has the sequence (5'→3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: No. 162) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GGCUGUAGGCAUAAAUUGGUA (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases from column 294 the sense strand of the first HBV RNAi agent and the sense strand of the second HBV RNAi agent It is conjugated to a targeting ligand containing N-acetyl-galactosamine.

[0144] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R NAi drugs have the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: No. 171) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases from column 302 the second HBV RNAi agent contains the sequence (5'→3')UACCAAUUUA 0, 1, 2 or 3 nucleobases from UGCCUACAGCC (SEQ ID NO: 162) an antisense strand containing a different nucleobase sequence and the sequence (5'→3')GGCUGUAG 0, 1, 2 or 3 nucleoside salts from GCAUAAAUUGGUA (SEQ ID NO: 294) a first HBV RNAi agent and a second H The sense strand of the BV RNAi drug binds to a targeting ligand containing N-acetyl-galactosamine. It is conjugated.

[0145] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 02) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases and the second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCC Nucleotides differing by 0, 1, 2 or 3 nucleobases from UACAGCC (SEQ ID NO: 162) The antisense strand contains the acid-base sequence and the sequence (5'→3')GGCUGUAGGCAU AAAUUGGUA (SEQ ID NO: 294) differing by 0, 1, 2, or 3 nucleobases a sense strand comprising a nucleobase sequence The sense strand of the NAi drug is conjugated to an N-acetyl-galactosamine-containing targeting ligand. It's gated.

[0146] In some embodiments, disclosed herein is a method for treating HBV-associated disease in a subject. Treating or preventing a disease or condition, or inhibiting the expression of one or more HBV genes The method comprises administering to a subject a composition that inhibits the expression of an HBV gene in a cell. the composition comprises two HBV RNAi agents, All or substantially all of the nucleotides in the first and / or second nucleotides are modified and / or All or substantially all of the nucleotides in the antisense strand of the second HBV RNAi agent The nucleotide is a modified nucleotide, and the first HBV RNAi agent has the sequence (5'→3') 0, 1, or 2 of AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) or an antisense strand containing a nucleic acid base sequence that differs by three nucleic acid bases, and a sequence (5'→3 ')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) 0, 1, a sense strand containing a nucleobase sequence that differs by two or three nucleobases, and a second HBV R The NAi drug has the sequence (5'→3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: No. 162) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU( SEQ ID NO: 307) and contains a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases. the sense strands of the first HBV RNAi agent and the second HBV RNAi agent , conjugated to an N-acetyl-galactosamine-containing targeting ligand.

[0147] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating or preventing a disease associated with an infection caused by HBV in a cell, the method comprising: administering a composition that inhibits expression of two HBV R V genes, NAi drug, and all or substantially all nucleotides in the sense strand are modified and / or in the antisense strand of the first and / or second HBV RNAi agent all or substantially all of the nucleotides are modified nucleotides, and the first HBV R NAi drugs have the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: No. 171) containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases. The sense strand and the sequence (5'→3')GUGGACUUCUCUCAAUUUUCU (sequence Cells containing nucleic acid base sequences that differ by 0, 1, 2 or 3 nucleic acid bases from column 302 the second HBV RNAi agent contains the sequence (5'→3')UACCAAUUUA 0, 1, 2 or 3 nucleobases from UGCCUACAGCC (SEQ ID NO: 162) an antisense strand containing a different nucleobase sequence and the sequence (5'→3')GUGGUGGA 0, 1, 2 or 3 nucleic acids from CUUCUCUCAAUAUU (SEQ ID NO: 307) a sense strand comprising a nucleobase sequence differing by base, The sense strand of the HBV RNAi drug contains a targeting ligand containing N-acetyl-galactosamine. It is conjugated to

[0148] In some embodiments, disclosed herein are HBV-caused and a method for treating a disease associated with an infection with HBV, the method comprising: and administering a composition that inhibits expression of an HBV RNAi agent, the composition comprising two HBV RNAi agents. wherein all or substantially all nucleotides in the sense strand are modified, and / or or all or none of the antisense strands in the first and / or second HBV RNAi agents or substantially all of the nucleotides are modified nucleotides, is the sequence (5'→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 02) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases and the second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCC Nucleotides differing by 0, 1, 2 or 3 nucleobases from UACAGCC (SEQ ID NO: 162) The antisense strand contains the acid-base sequence and the sequence (5'→3')GUGGUGGACUUC 0, 1, 2, or 3 nucleobases differ from UCUCAAUAUU (SEQ ID NO: 307) a first HBV RNAi agent and a second HBV RNAi agent, the first HBV RNAi agent and the second HBV RNAi agent comprising a sense strand comprising a nucleobase sequence The sense strand of an RNAi drug is conjugated to a targeting ligand containing N-acetyl-galactosamine. It is gated.

[0149] In some embodiments, disclosed herein are methods for treating HBV infection, or A method for preventing a disease or condition caused by BV infection, which method comprises administering to a patient who is unaware of the disease or condition. and administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD05070. In some embodiments, the AD administered to a subject in need thereof The ratio of 04872 to AD05070 is about 2:1. The ratio of AD04872 to AD05070 administered to subjects in need thereof is approximately 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of 04872 to AD05070 is about 1:1. The ratio of AD04872 to AD05070 administered to subjects in need thereof is approximately 4: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of 04872 to AD05070 is about 5:1. The ratio of AD04872 to AD05070 administered to subjects in need thereof is approximately 1: It is 2.

[0150] In some embodiments, disclosed herein are HBV-caused and a method for treating or preventing a disease associated with an infection, the method comprising administering to a patient in need thereof. The method comprises administering to a subject having the disease an effective amount of AD04872 and an effective amount of AD05070. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD05070 is about 2:1. The ratio of AD04872 to AD05070 administered to subjects in need is approximately 3:1. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD05070 is about 1:1. The ratio of AD04872 to AD05070 administered to subjects in need is approximately 4:1. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD05070 is about 5:1. The ratio of AD04872 to AD05070 administered to subjects in need is approximately 1:2. do.

[0151] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating a disease associated with an infection, which method is directed to a patient in need thereof. The method comprises administering to an elephant an effective amount of AD04872 and an effective amount of AD05070. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D05070 to D05070 is about 2:1. The ratio of AD04872 to AD05070 administered to subjects receiving the treatment is approximately 3:1. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D05070 to D05070 is about 1:1. The ratio of AD04872 to AD05070 administered to subjects receiving the treatment is approximately 4:1. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D05070 to D05070 is about 5:1. The ratio of AD04872 to AD05070 administered to a subject receiving the treatment is approximately 1:2.

[0152] In some embodiments, AD04872 and AD05070 are administered in a single dose. In some embodiments, the AD 04872 and AD05070 are approximately 25 to 50 mg and 50 to 75 mg per dose, respectively. , 75~100mg, 100~125mg, 125~150mg, 150~175mg, 175~200mg, 200~225mg, 225~250mg, 250~275mg, 275~300mg, 300~325mg, 325~350mg, 350~375mg, 375~400mg, 25~75mg, 50~100mg, 100~150mg, 150 ~200mg, 200~250mg, 250~300mg, 300~350mg, 350 ~400mg, 25~100mg, 50~150mg, 100~200mg, 150~2 50mg, 200-300mg, 300-400mg, 25-200mg, or 200- In some embodiments, AD04872 is administered in a combined dose of 400 mg. and AD05070, about 30 to 50 mg, about 90 to 110 mg per dose, or In some embodiments, the AD 04872 and AD05070 are administered in a combined dose of approximately 30-50 mg per dose. In some embodiments, AD04872 and AD05070 are administered in a single dose. In some embodiments, the combined dose is about 90 to 110 mg per minute. AD04872 and AD05070 are administered at a dose of approximately 190-210 mg. In some embodiments, AD04872 vs. AD050 are administered in a combined amount. 70 is approximately 25 mg, approximately 50 mg, approximately 100 mg, approximately 125 mg, and approximately 1 50mg, about 175mg, about 200mg, about 225mg, about 250mg, about 275mg, A combination of about 300 mg, about 325 mg, about 350 mg, about 375 mg, or about 400 mg In some embodiments, AD04872 and AD05070 are administered in a combined dose. Each dose is about 50 mg, about 75 mg, about 100 mg, or about 125 mg. In some embodiments, AD04872 and AD0507 are administered in a combined dose. 0 is a combination of about 35 mg, about 50 mg, about 100 mg, or about 125 mg per dose. In some embodiments, AD04872 and AD050 are administered in a combined amount. 70 is a combination dose of about 40 mg, about 100 mg, or about 200 mg per dose In some embodiments, AD04872 and AD05070 are administered at 1 In some embodiments, the combined dose is about 40 mg per dose. AD04872 and AD05070 are administered at a combined dose of approximately 100 mg per dose. In some embodiments, AD04872 and AD05070 are administered in a single dose. In some embodiments, the combined dose is about 200 mg per dose. AD04872 and AD05070 were administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD05070 are administered at 2 The doses are administered at 8 day intervals or at intervals of about 28 days (i.e., Q4W). In the study, AD04872 and AD05070 were administered at doses of approximately 40 mg and approximately 10 mg per dose. 0 mg or about 200 mg combination doses at intervals of 28 days or about 28 days (i.e. In some embodiments, AD04872 and AD050 are administered Q4W. 70 is a combination dose of approximately 40 mg per dose, administered at 28-day intervals or for approximately 28 days. In some embodiments, AD04872 and and AD05070 at a combined dose of approximately 100 mg per dose, administered 28 days apart or is administered at intervals of about 28 days (i.e., Q4W). D04872 and AD05070 are administered in a combined dose of approximately 200 mg per dose. The doses are administered at or about 28 day intervals (ie, Q4W).

[0153] In some embodiments, AD04872 and AD05070 are administered at a dose of about 1 to 18 weeks. In some embodiments, AD04872 and AD05070 are administered at intervals. , about 1 week interval, about 2 week interval, about 3 week interval, about 4 week interval, about 5 week interval, about 6 week interval intervals, approximately 7 week intervals, approximately 8 week intervals, approximately 9 week intervals, approximately 10 week intervals, approximately 11 week intervals, Approximately 12 week intervals, approximately 13 week intervals, approximately 14 week intervals, approximately 15 week intervals, approximately 16 week intervals, In some embodiments, the AD 04872 and AD05070 are administered approximately 1 to 6 months apart. In this state, AD04872 and AD05070 are administered at intervals of about 1 month, about 2 months, The doses are administered at about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, AD04872 and AD05070 are administered at intervals of about 4 weeks or In some embodiments, AD04872 and AD05 are administered one month apart. 070 is administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In this study, AD04872 and AD05070 are administered approximately 28 days apart.

[0154] In some embodiments, AD04872 and AD05070 are administered for about 1 to 12 months. In some embodiments, AD04872 and AD0 5070 is at least about 1 month, at least about 2 months, at least about 3 months, at least at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months or less In some embodiments, the AD0 4872 and AD05070 are administered over a period of approximately 1 to 18 weeks. In an embodiment, AD04872 and AD05070 are administered for at least about 1 week. at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks , at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks In some embodiments, AD04872 and AD05 are administered over a period of time. 070 is administered over a period of approximately 12 weeks or 3 months.

[0155] In some embodiments, AD04872 and AD05070 are administered in a single dose. The combination dose is approximately 25 to 75 mg, and the ratios are approximately 2:1, 3:1, 1:1, 4:1, and 5:1. In some embodiments, AD04872 and AD05070 is administered at a dose of approximately 50 to 125 mg, with a ratio of approximately 2:1. The doses are administered in a ratio of about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, AD04872 and AD05070 are administered in an amount of about 75-150 mg / dose. At a combination dose of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1 In some embodiments, AD04872 and AD0507 are administered in a ratio of 0:2. 0 is a combination dose of approximately 100 to 200 mg per dose, with a ratio of approximately 2:1, approximately 3:1, In some embodiments, the ratio is about 1:1, about 4:1, about 5:1, or about 1:2. AD04872 and AD05070 are administered at a dose of approximately 150 to 250 mg per dose. Combination amounts in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2 In some embodiments, AD04872 and AD05070 are administered at 1 The combination dose is approximately 200-300 mg per dose, with approximately 2:1, 3:1, and 1:1 In some embodiments, A is administered in a ratio of about 4:1, about 5:1, or about 1:2. D04872 and AD05070 are combined in a single dose of approximately 300 to 400 mg. and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, AD04872 and AD05070 are administered in a single dose. The combination dose is about 50 to 100 mg per dose, and the ratios are about 2:1, 3:1, 1:1, and 4:1. In some embodiments, AD0487 is administered at a ratio of about 5:1 or about 1:2. 2 and AD05070 are administered in a combined dose of approximately 25 to 400 mg per dose. In some embodiments, AD04872 and AD0507 are administered in a ratio of 1:1. 0 is administered in a combination dose of approximately 25-75 mg per dose in a ratio of approximately 2:1 In some embodiments, AD04872 and AD05070 are administered in a single dose. The combined dose is about 50-125 mg, administered in a ratio of about 2:1. In this condition, AD04872 and AD05070 are administered in a dose of approximately 75 to 150 mg / dose. In some embodiments, the AD0 The combined dose of 4872 and AD05070 is approximately 100-200 mg per dose. In some embodiments, AD04872 and AD 05070 is a combination of approximately 125-225 mg per dose, with a ratio of approximately 2:1. In some embodiments, AD04872 and AD05070 are administered at 1 The combined dose is approximately 150-250 mg per dose, administered in a ratio of approximately 2:1. In some embodiments, AD04872 and AD05070 are administered in a dose of about The combined dose is 200-300 mg, administered in a ratio of about 2:1. In this study, AD04872 and AD05070 were administered in a dose of approximately 300 to 400 mg. In some embodiments, the AD0 4872 and AD05070 are administered in a combined dose of approximately 35 mg per dose, with a dose of approximately 2: In some embodiments, AD04872 and AD05070 are administered in a ratio of 1:1. are administered in a ratio of about 2:1 with a combined dose of about 40 mg per dose. In some embodiments, AD04872 and AD05070 are administered in a dose of about 10 In some embodiments, the combined dose is about 2:1, with the combined dose being 0 mg. D04872 and AD05070 are administered in a combined dose of approximately 200 mg per dose. In some embodiments, AD04872 and AD05 are administered in a ratio of about 2:1. 070 will be administered in a ratio of approximately 2:1 at a combined dose of approximately 300 mg per dose In some embodiments, AD04872 and AD05070 are administered in a single dose. In some embodiments, the combined dose is about 400 mg, and the combined dose is administered in a ratio of about 2:1. AD04872 and AD05070 lasted for about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD05070 are administered at intervals of 10 min. The drugs are administered at or about 28-day intervals (i.e., Q4W). In an embodiment, AD04872 and AD05070 are administered at about 40 mg per dose; A combination dose of about 100 mg or about 200 mg, in a ratio of about 2:1, at intervals of 28 days or about In some embodiments, AD04872 and AD05 are administered at intervals of 28 days. 070 is a combination of approximately 40 mg per dose, administered in a ratio of approximately 2:1 for 28 days. In some embodiments, the doses are administered every other day or about every 28 days (i.e., Q4W). , AD04872 and AD05070 are administered in a combined dose of approximately 100 mg per dose. at about a 2:1 ratio, at or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered in a single dose. A combination dose of about 200 mg per dose, in a ratio of about 2:1, at intervals of 28 days or about 28 days apart. (i.e., Q4W).

[0156] In some embodiments, AD04872 is administered in an amount of about 3 to 650 mg; AD05070 is administered in amounts of approximately 2 to 325 mg per dose. In some embodiments, AD04872 is administered in an amount of about 35 to 265 mg per dose. In some embodiments, AD04872 is administered in an amount of about 50-75 mg / dose. In some embodiments, AD05070 is administered in an amount of 1 mg per dose. In some embodiments, AD0507 is administered in an amount of about 20 to 125 mg per dose. 0 is administered in an amount of approximately 25-50 mg per dose.

[0157] In some embodiments, AD04872 and AD05070 are administered in a single dose. In some embodiments, the combined dose is about 1 to 10 mg / kg. D04872 and AD05070 are combined at a dose of approximately 1 to 5 mg / kg per dose. In some embodiments, AD04872 and AD05070 are administered in amounts of: Approximately 1 to 1.5 mg / kg, approximately 1.5 to 2.0 mg / kg, or approximately 2.0 to 2.0 mg / kg per dose .5mg / kg, about 2.5~3.0mg / kg, about 3.0~3.5mg / kg, about 3.5 ~4.0mg / kg, about 4.0-4.5mg / kg, about 4.5-5.0mg / kg, about 5 .0~5.5mg / kg, about 5.5~6.0mg / kg, about 6.0~6.5mg / kg, Approximately 6.5 to 7.0 mg / kg, approximately 7.0 to 7.5 mg / kg, approximately 7.5 to 8.0 mg / kg g, about 8.0~8.5mg / kg, about 8.5~9.0mg / kg, about 9.0~9.5mg / kg, about 9.5~10mg / kg, about 1~2.5mg / kg, about 2.5~5.0mg / kg, about 5.0~7.5mg / kg, about 7.5~10mg / kg, about 1~5.0mg / k g, or a combined dose of about 5.0-10 mg / kg.

[0158] In some embodiments, AD05070 is about 0.3 to 5 mg per dose. / kg, and AD04872 is administered at a dose of approximately 0.6 to 7 mg / kg per dose. In some embodiments, AD05070 is administered in an amount of about In some embodiments, AD050 is administered in an amount of 0.5 to 2.5 mg / kg. 70 is administered in an amount of approximately 0.3 to 1.5 mg / kg per dose. In some embodiments, AD04872 is administered in an amount of about 0.6 to 5 mg / kg per dose. In some embodiments, AD04872 is administered in about 1 to 2 doses per administration. It is administered at a dose of 0.5mg / kg.

[0159] In some embodiments, AD04872 and AD05070 are administered in a single dose. In one embodiment, AD0487 is administered in a combined dose of 25 to 400 mg. 2 and AD05070 were administered at a combined dose of 25 to 400 mg, and AD0487 2 is administered in a 1:1 ratio with AD05070. The 72 doses were administered with AD05070 at approximately 25 mg for a combined dose of approximately In one embodiment, each of AD04872 and AD05070 is in an amount of 12 mg. This dose is in an amount of about 17 mg for a combined dose of about 35 mg. In this study, the dose of each of AD04872 and AD05070 was approximately 40 mg. In one embodiment, AD04872 and AD04873 are administered in an amount of about 20 mg per dose. Each dose of 5070 is about 25 mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04872 and AD05070 is about 1 In one embodiment, the amount is about 50 mg for a combined dose of AD0. The individual doses of 4872 and AD05070 were approximately 200 mg for a combined dose of In one embodiment, the amount of AD04872 and AD05070 is about 100 mg. Each dose is about 150 mg for a combined dose of about 300 mg. In an embodiment, the dose of each of AD04872 and AD05070 is about 400 mg In some embodiments, the amount is about 200 mg for a combined dose of A D04872 and AD05070 are administered at intervals of approximately 7 days, approximately 14 days, approximately 21 days, or approximately 28 days. In some embodiments, AD04872 and AD05070 are administered within 28 In one embodiment, the doses are administered at intervals of about 28 days (i.e., Q4W). The doses of AD04872 and AD05070 were each approximately 40 mg for a combined dose. or about 50 mg for a combination dose of about 100 mg. or in an amount of about 100 mg for a combination dose of about 200 mg, 4872 and AD05070 are administered at or about 28-day intervals (i.e., Q4W) In one embodiment, the doses of AD04872 and AD05070 are The amount is about 20 mg for a combined dose of about 40 mg, and AD04872 and AD05070 is administered at or about 28 day intervals (i.e., Q4W) In one embodiment, the dose of each of AD04872 and AD05070 is about 10 The amount of AD04872 and AD050 is approximately 50 mg for a combined dose of 0 mg. 70 are administered at or about 28 day intervals (i.e., Q4W). In this case, the dose of each of AD04872 and AD05070 is approximately 200 mg of the combination. The combined dose is approximately 100 mg, and AD04872 and AD05070 are The doses are administered at or about 28 day intervals (ie, Q4W).

[0160] In one embodiment, AD04872 and AD05070 are administered in a dose of 25 to 100 mg / dose. AD05070 was administered at a combined dose of 400 mg with AD04872 at a 1: In one embodiment, the dose of AD04872 is administered in an amount of about 16 mg. The dose of AD05070 is about 8 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD05070 is in an amount of about 12 mg, and the dose of AD048 The dose of 72 is in an amount of about 24 mg for a combined dose of about 35 mg. wherein the dose of AD05070 is about 13 mg and the dose of AD04872 is In one embodiment, the AD The dose of 04872 is approximately 33 mg, and the dose of AD05070 is approximately 50 mg. In one embodiment, the amount of AD05070 is about 17 mg for the combined dose. The dose of AD04872 is about 100 mg combined dose. In one embodiment, the dose of AD05070 is about 67 mg. mg, and the dose of AD04872 is about 1 mg for a combined dose of about 200 mg. In one embodiment, the dose of AD05070 is in an amount of about 100 mg. and the dose of AD04872 is about 200 mg for a combined dose of about 300 mg. In one embodiment, the dose of AD05070 is in an amount of about 135 mg, The dose of AD04872 is approximately 270 mg for a combined dose of approximately 400 mg. In some embodiments, AD04872 and AD05070 are administered for about 7 days, about 1 In some embodiments, the AD0 is administered at intervals of 4 days, about 21 days, or about 28 days. 4872 and AD05070 are administered at or about 28-day intervals (i.e., Q4W) In one embodiment, the dose of AD05070 is in an amount of about 13 mg, the dose of AD04872 is in an amount of about 27 mg for a combination dose of about 40 mg; AD04872 and AD05070 were administered at or about 28-day intervals (i.e., Q In one embodiment, the dose of AD05070 is administered in an amount of about 35 mg. and the dose of AD04872 is about 65 mg for a combined dose of about 100 mg. AD04872 and AD05070 were administered at intervals of 28 days or approximately 28 days (i.e., In one embodiment, the dose of AD05070 is about 67 mg / kg. g, and the dose of AD04872 is about 13 mg for a combined dose of about 200 mg. AD04872 and AD05070 are administered at intervals of 28 days or approximately every 28 days. It is administered at intervals (i.e., Q4W).

[0161] In one embodiment, AD04872 and AD05070 are administered in a dose of 25 to 100 mg / dose. AD05070 was administered at a combined dose of 400 mg with AD04872 at a 1: In one embodiment, the dose of AD04872 is administered in an amount of about 18 mg. and the dose of AD05070 is about 6 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD05070 is in an amount of about 9 mg, and AD0487 The dose of 2 is in an amount of about 27 mg for a combined dose of about 35 mg. wherein the dose of AD05070 is about 10 mg and the dose of AD04872 is about In one embodiment, the amount is about 30 mg for a combined dose of 40 mg. The dose of 4872 is approximately 36 mg, and the dose of AD05070 is approximately 50 mg. In one embodiment, the dose of AD05070 is about 12 mg. is in an amount of about 25 mg, and the dose of AD04872 is in a combined dose of about 100 mg. In one embodiment, the dose of AD05070 is about 50 mg. g, and the dose of AD04872 is about 15 mg for a combined dose of about 200 mg. In one embodiment, the dose of AD05070 is in an amount of about 75 mg. The dose of AD04872 is approximately 225 mg for a combined dose of approximately 300 mg. In one embodiment, the dose of AD05070 is in an amount of about 100 mg, The dose of 04872 is in an amount of about 300 mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD05070 are administered for about 7 days, about 14 days, or , about 21 days or about 28 days apart. 72 and AD05070 were administered at or about 28-day intervals (i.e., Q4W). In one embodiment, the dose of AD05070 is in an amount of about 10 mg, The dose of 04872 is about 30 mg for a combined dose of about 40 mg, and AD 04872 and AD05070 are administered at or about 28-day intervals (i.e., Q4W In one embodiment, the dose of AD05070 is about 25 mg. The dose of AD04872 is about 75 mg for a combined dose of about 100 mg. AD04872 and AD05070 were administered at intervals of 28 days or approximately 28 days (i.e. In one embodiment, the dose of AD05070 is about 50 mg. and the dose of AD04872 is about 150 mg for a combined dose of about 200 mg. g, and AD04872 and AD05070 were administered at intervals of 28 days or approximately 28 days. (i.e., Q4W).

[0162] In some embodiments, about 1 mg / kg (mpk) of AD04872 and about 1 mg / kg of AD05070 is administered to a subject in need thereof. In the form of about 1.5 mg / kg AD04872 and about 1.5 mg / kg AD050 70 is administered to a subject in need thereof. In some embodiments, about 2 AD04872 at 0.0 mg / kg and AD05070 at approximately 1.0 mg / kg were used to In some embodiments, about 3.0 mg / kg of A D04872 and approximately 1.0 mg / kg of AD05070 for those in need. In some embodiments, about 3.2 mg / kg of AD04872 and about 0 0.8mg / kg of AD05070 will be administered to subjects in need. In some embodiments, about 2.7 mg / kg AD04872 and about 1.3 mg / kg A D05070 is administered to a subject in need thereof. Approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD05070 were In some embodiments, about 3.3 mg / kg of niacin is administered to a subject in need thereof. kg of AD04872 and approximately 1.7 mg / kg of AD05070. In some embodiments, about 0.05 to about 5 mg / kg of AD is administered to a subject. 04872 and approximately 0.05 to approximately 5 mg / kg AD05070 are required. In some embodiments, a combination of about AD04872 and about AD0507 is administered to a subject. 0 and are administered separately (e.g., in separate injections). Each dose of 04872 and each dose of AD05070 are administered together (e.g., in the same injection). In some embodiments, each dose of AD04872 and each dose of AD05070 The doses are prepared in a single pharmaceutical composition.

[0163] In some embodiments, disclosed herein are methods for treating HBV infection, or A method for preventing a disease or condition caused by BV infection, which method comprises administering to a patient who is unaware of the disease or condition. and administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD04776. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04776 is about 2:1. The ratio of AD04872 to AD04776 administered to subjects in need thereof is about 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04776 is about 4:1. The ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04776 is about 5:1. The ratio of AD04872 to AD04776 administered to subjects in need thereof is 1:2. is.

[0164] In some embodiments, disclosed herein are HBV-caused and a method for treating or preventing a disease associated with an infection, the method comprising administering to a patient in need thereof. The method comprises administering to a subject having the disease an effective amount of AD04872 and an effective amount of AD04776. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD04776 is about 2:1. The ratio of AD04872 to AD04776 administered to subjects in need is approximately 3:1. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD04776 is about 4:1. The ratio of AD04872 to AD04776 administered to subjects in need is approximately 1:1. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD04776 is about 5:1. The ratio of AD04872 to AD04776 administered to subjects in need is 1:2 .

[0165] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating a disease associated with an infection, which method is directed to a patient in need thereof. The method comprises administering to an elephant an effective amount of AD04872 and an effective amount of AD04776. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D04776 to D04776 is about 2:1. The ratio of AD04872 to AD04776 administered to subjects receiving the treatment is approximately 3:1. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D04776 to D04776 is about 4:1. The ratio of AD04872 to AD04776 administered to subjects receiving the treatment is approximately 1:1. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D04776 to D04776 is about 5:1. The ratio of AD04872 to AD04776 administered to subjects receiving the treatment is 1:2.

[0166] In some embodiments, AD04872 and AD04776 are administered in a single dose. In some embodiments, the AD 04872 and AD04776 are approximately 25 to 50 mg and 50 to 75 mg per dose, respectively. , 75~100mg, 100~125mg, 125~150mg, 150~175mg, 175~200mg, 200~225mg, 225~250mg, 250~275mg, 275~300mg, 300~325mg, 325~350mg, 350~375mg, 375~400mg, 25~75mg, 50~100mg, 100~150mg, 150 ~200mg, 200~250mg, 250~300mg, 300~350mg, 350 ~400mg, 25~100mg, 50~150mg, 100~200mg, 150~2 50mg, 200-300mg, 300-400mg, 25-200mg, or 200- In some embodiments, AD04872 is administered in a combined dose of 400 mg. and AD04776, about 30 to 50 mg, about 90 to 110 mg per dose, or In some embodiments, the AD 04872 and AD04776 are administered in a combined dose of approximately 30-50 mg per dose. In some embodiments, AD04872 and AD04776 are administered in a single dose. In some embodiments, the combined dose is about 90 to 110 mg per minute. AD04872 and AD04776 are administered at a dose of approximately 190-210 mg. In some embodiments, AD04872 and AD04872 are administered in a combined amount. 776 is available in doses of approximately 25 mg, approximately 50 mg, approximately 100 mg, approximately 125 mg, and approximately 150mg, about 175mg, about 200mg, about 225mg, about 250mg, about 275mg , about 300 mg, about 325 mg, about 350 mg, about 375 mg, or about 400 mg In some embodiments, AD04872 and AD0477 are administered in a combined dose. 6 is a combination of about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose. In some embodiments, AD04872 and AD047 are administered in a combined amount. 76 is available in doses of approximately 35 mg, approximately 50 mg, approximately 100 mg, approximately 200 mg, and approximately 3 In some embodiments, the combined dose is about 400 mg or about 400 mg. AD04872 and AD04776 are administered at doses of approximately 40 mg, approximately 100 mg, or In some embodiments, AD048 is administered in a combined amount of about 200 mg. 72 and AD04776 are administered in a combined dose of approximately 40 mg per dose. In some embodiments, AD04872 and AD04776 are administered in amounts per dose. In some embodiments, AD0487 is administered in a combined dose of about 100 mg. 2 and AD04776 are administered in a combined dose of approximately 200 mg per dose. In some embodiments, AD04872 and AD04776 are administered for about 7 days, about 14 days, or , about 21 days or about 28 days apart. 72 and AD04776 were administered at or approximately 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered in a single dose. A combination dose of about 40 mg, about 100 mg, or about 200 mg per dose, administered 28 days apart or at intervals of about 28 days (i.e., Q4W). AD04872 and AD04776 are administered at a combined dose of approximately 40 mg per dose. The doses are administered at or about 28 day intervals (i.e., Q4W). In this condition, AD04872 and AD04776 are administered in a combination dose of approximately 100 mg per dose. The combined dose is administered at or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered in a dose of about At a combined dose of 200 mg, at or about 28-day intervals (i.e., Q4W) It is administered.

[0167] In some embodiments, AD04872 and AD04776 are administered at a dose of about 1 to 18 weeks. In some embodiments, AD04872 and AD04776 are administered at intervals. , about 1 week interval, about 2 week interval, about 3 week interval, about 4 week interval, about 5 week interval, about 6 week interval intervals, approximately 7 week intervals, approximately 8 week intervals, approximately 9 week intervals, approximately 10 week intervals, approximately 11 week intervals, Approximately 12 week intervals, approximately 13 week intervals, approximately 14 week intervals, approximately 15 week intervals, approximately 16 week intervals, In some embodiments, the AD 04872 and AD04776 are administered approximately 1 to 6 months apart. In this state, AD04872 and AD04776 are administered at intervals of about 1 month, about 2 months, The doses are administered at about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, AD04872 and AD04776 are administered at intervals of about 4 weeks or In some embodiments, AD04872 and AD04872 are administered one month apart. 776 is administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In this study, AD04872 and AD04776 were administered at intervals of approximately 28 days (i.e., Q4W). It is administered at .

[0168] In some embodiments, AD04872 and AD04776 are administered for about 1 to 12 months. In some embodiments, AD04872 and AD0 4776 is at least about 1 month, at least about 2 months, at least about 3 months, at least at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months or less In some embodiments, the AD0 4872 and AD04776 are administered over a period of approximately 1 to 18 weeks. In an embodiment, AD04872 and AD04776 are administered for at least about 1 week. at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks , at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks In some embodiments, AD04872 and AD04872 are administered over a period of time. 776 is administered over a period of approximately 12 weeks or 3 months.

[0169] In some embodiments, AD04872 and AD04776 are administered in a single dose. The combination dose is approximately 25 to 75 mg, and the ratios are approximately 2:1, 3:1, 1:1, 4:1, and 5:1. In some embodiments, AD04872 and AD04776 is administered at a dose of approximately 50 to 125 mg per dose, with a ratio of approximately 2:1. The doses are administered in a ratio of about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, AD04872 and AD04776 are administered in an amount of about 75-15 mg / dose. At a combination dose of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1 In some embodiments, AD04872 and AD0477 are administered in a ratio of 0:2. 6 is a combination of approximately 100 to 200 mg per dose, with a ratio of approximately 2:1, approximately 3:1, In some embodiments, the ratio is about 1:1, about 4:1, about 5:1, or about 1:2. AD04872 and AD04776 are administered at a dose of approximately 150 to 250 mg per dose. Combination amounts in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2 In some embodiments, AD04872 and AD04776 are administered at 1 The combination dose is approximately 200-300 mg per dose, with approximately 2:1, 3:1, and 1:1 In some embodiments, A is administered in a ratio of about 4:1, about 5:1, or about 1:2. D04872 and AD04776 are combined in a single dose of approximately 300 to 400 mg. and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, AD04872 and AD04776 are administered in a single dose. The combination dose is about 50 to 100 mg per dose, and the ratios are about 2:1, 3:1, 1:1, and 4:1. In some embodiments, AD0487 is administered at a ratio of about 5:1 or about 1:2. 2 and AD04776 are administered in a combined dose of approximately 25 to 400 mg per dose. In some embodiments, AD04872 and AD0477 are administered in a ratio of 1:1. 6 is administered in a combination dose of approximately 25-75 mg per dose in a ratio of approximately 2:1 In some embodiments, AD04872 and AD04776 are administered in a single dose. The combined dose is about 50-125 mg, administered in a ratio of about 2:1. In this condition, AD04872 and AD04776 are administered in a dose of approximately 75 to 150 mg per dose. In some embodiments, the AD0 The combined dose of 4872 and AD04776 is approximately 100-200 mg per dose. In some embodiments, AD04872 and AD 04776 is a combination of approximately 125-225 mg per dose, in a ratio of approximately 2:1. In some embodiments, AD04872 and AD04776 are administered at 1 The combined dose is approximately 150-250 mg per dose, administered in a ratio of approximately 2:1. In some embodiments, AD04872 and AD04776 are administered in a dose of about The combined dose is 200-300 mg, administered in a ratio of about 2:1. In this study, AD04872 and AD04776 were administered in a dose of approximately 300-400 mg. In some embodiments, the AD0 4872 and AD04776 are administered at a combined dose of approximately 35 mg per dose, with a combined dose of approximately 2: In some embodiments, AD04872 and AD04776 are administered in a ratio of 1:1. are administered in a ratio of about 2:1 with a combined dose of about 40 mg per dose. In some embodiments, AD04872 and AD04776 are administered in a dose of about 10 In some embodiments, the combined dose is about 2:1, with the combined dose being 0 mg. D04872 and AD04776 are administered in a combined dose of approximately 200 mg per dose. In some embodiments, AD04872 and AD04872 are administered in a ratio of about 2:1. 776 will be administered in a ratio of approximately 2:1 at a combined dose of approximately 300 mg per dose. In some embodiments, AD04872 and AD04776 are administered in a single dose. In some embodiments, the combined dose is about 400 mg, and the combined dose is administered in a ratio of about 2:1. AD04872 and AD04776 lasted for about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04776 are administered at intervals of 10 min. The drugs are administered at or about 28-day intervals (i.e., Q4W). In an embodiment, AD04872 and AD04776 are administered at about 40 mg per dose; A combination dose of about 100 mg or about 200 mg, in a ratio of about 2:1, at intervals of 28 days or about In some embodiments, the AD0 4872 and AD04776 are administered in a combined dose of approximately 40 mg per dose, with a dose of approximately 2: 1 at intervals of 28 days or about 28 days (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered in a dose of about 10 0 mg combination dose, in a ratio of about 2:1, at intervals of 28 days or about 28 days (i.e. In some embodiments, AD04872 and AD047 are administered Q4W. 76 is a combination dose of approximately 200 mg per dose, in a ratio of approximately 2:1, for 28 days. The doses are administered every other week or about every 28 days (i.e., Q4W).

[0170] In some embodiments, AD04872 is administered in an amount of about 3 to 650 mg; AD04776 is administered in amounts ranging from approximately 2 to 325 mg per dose. In some embodiments, AD04872 is administered in an amount of about 35 to 265 mg per dose. In some embodiments, AD04872 is administered in an amount of about 50-75 mg / dose. In some embodiments, AD04776 is administered in an amount of 1 mg per dose. In some embodiments, AD0477 is administered in an amount of about 20 to 125 mg per dose. 6 is administered in an amount of approximately 25-50 mg per dose.

[0171] In some embodiments, AD04872 and AD04776 are administered in a single dose. In some embodiments, the combined dose is about 1 to 10 mg / kg. D04872 and AD04776 are combined at approximately 1 to 5 mg / kg per dose. In some embodiments, AD04872 and AD04776 are administered in amounts of: Approximately 1 to 1.5 mg / kg, approximately 1.5 to 2.0 mg / kg, or approximately 2.0 to 2.0 mg / kg per dose .5mg / kg, about 2.5~3.0mg / kg, about 3.0~3.5mg / kg, about 3.5 ~4.0mg / kg, about 4.0-4.5mg / kg, about 4.5-5.0mg / kg, about 5 .0~5.5mg / kg, about 5.5~6.0mg / kg, about 6.0~6.5mg / kg, Approximately 6.5 to 7.0 mg / kg, approximately 7.0 to 7.5 mg / kg, approximately 7.5 to 8.0 mg / kg g, about 8.0~8.5mg / kg, about 8.5~9.0mg / kg, about 9.0~9.5mg / kg, about 9.5~10mg / kg, about 1~2.5mg / kg, about 2.5~5.0mg / kg, about 5.0~7.5mg / kg, about 7.5~10mg / kg, about 1~5.0mg / k g, or a combined dose of about 5.0-10 mg / kg.

[0172] In some embodiments, AD04776 is administered in a dose of about 0.3 to 5 mg per dose. / kg, and AD04872 is administered at a dose of approximately 0.6 to 7 mg / kg per dose. In some embodiments, AD04776 is administered in an amount of about In some embodiments, AD04776 is administered in an amount of 0.5 to 2.5 mg. In some embodiments, the amount is about 0.3 to 1.5 mg per dose. AD04872 is administered in an amount of approximately 0.6 to 5 mg per dose. In this embodiment, AD04872 is administered in an amount of about 1 to 2.5 mg per dose. will be done.

[0173] In some embodiments, AD04872 and AD04776 are administered in a single dose. In one embodiment, AD0487 is administered in a combined dose of 25 to 400 mg. 2 and AD04776 were administered at a combined dose of 25 to 400 mg, and AD0487 2 is administered in a 1:1 ratio with AD04776. The doses of AD04776 and AD04772 were approximately 1 mg for a combined dose of approximately 25 mg. In one embodiment, each of AD04872 and AD04776 is in an amount of 2 mg. In one embodiment, the dose is about 17 mg for a combined dose of about 35 mg. In this study, the dose of each of AD04872 and AD04776 was approximately 40 mg. In one embodiment, AD04872 and AD04 are administered in an amount of about 20 mg per dose. Each dose of 776 is about 25 mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04872 and AD04776 is about 10 In one embodiment, the amount is about 50 mg for a combined dose of AD04. The individual doses of 872 and AD04776 were approximately 200 mg for a combined dose of In one embodiment, the amount of AD04872 and AD04776 is about 100 mg. Each dose is about 150 mg for a combined dose of about 300 mg. In embodiments, the dose of each of AD04872 and AD04776 is about 400 mg. In some embodiments, the amount is about 200 mg for a combined dose of AD 04872 and AD04776 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04776 are administered over 28 days. or about 28 days apart (i.e., Q4W). The individual doses of D04872 and AD04776 correspond to a combined dose of approximately 40 mg. or in an amount of about 50 mg for a combination dose of about 100 mg. or in an amount of about 100 mg for a combined dose of about 200 mg, AD04 872 and AD04776 at or about 28-day intervals (i.e., Q4W). In one embodiment, the respective doses of AD04872 and AD04776 are administered. is in an amount of about 20 mg for a combined dose of about 40 mg, and AD04872 and A D04776 is administered at or about 28 day intervals (ie, Q4W). In one embodiment, the dose of each of AD04872 and AD04776 is about 100 The amount of AD04872 and AD0477 is about 50 mg for a combined dose of 100 mg. 6 are administered at or about 28 day intervals (i.e., Q4W). In this study, the dose of each of AD04872 and AD04776 was approximately 200 mg. The combined dose is approximately 100 mg, and AD04872 and AD04776 are 2 The doses are administered at 8 day intervals or at intervals of about 28 days (ie, Q4W).

[0174] In one embodiment, AD04872 and AD04776 are administered in a dose of 25 to 100 mg / dose. AD04776 was administered at a combined dose of 400 mg with AD04872 at a 1: In one embodiment, the dose of AD04872 is administered in an amount of about 16 mg. The dose of AD04776 is about 8 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04776 is in an amount of about 12 mg, and the dose of AD048 The dose of 72 is in an amount of about 24 mg for a combined dose of about 35 mg. wherein the dose of AD04776 is about 13 mg and the dose of AD04872 is In one embodiment, the AD The dose of 04872 is approximately 33 mg, and the dose of AD04776 is approximately 50 mg. In one embodiment, the amount of AD04776 is about 17 mg for the combined dose. The dose of AD04872 is about 100 mg combined dose. In one embodiment, the dose of AD04776 is about 67 mg. mg, and the dose of AD04872 is about 1 mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04776 is in an amount of about 100 mg. and the dose of AD04872 is about 200 mg for a combined dose of about 300 mg. In one embodiment, the dose of AD04776 is in an amount of about 135 mg, The dose of AD04872 is approximately 270 mg for a combined dose of approximately 400 mg. In some embodiments, AD04872 and AD04776 are administered for about 7 days, about 1 In some embodiments, the AD0 is administered at intervals of 4 days, about 21 days, or about 28 days. 4872 and AD04776 were administered at or about 28-day intervals (i.e., Q4W) In one embodiment, the dose of AD04776 is administered in an amount of about 13 mg, the dose of AD04872 is in an amount of about 27 mg for a combination dose of about 40 mg; AD04872 and AD04776 were administered at or about 28-day intervals (i.e., Q In one embodiment, the dose of AD04776 is administered in an amount of about 35 mg. and the dose of AD04872 is about 65 mg for a combined dose of about 100 mg. and AD04872 and AD04776 were administered at intervals of 28 days or approximately 28 days (i.e., In one embodiment, the dose of AD04776 is about 67 mg / kg. g, and the dose of AD04872 is about 13 mg for a combined dose of about 200 mg. AD04872 and AD04776 are administered at intervals of 28 days or approximately every 28 days. It is administered at intervals (i.e., Q4W).

[0175] In one embodiment, AD04872 and AD04776 are administered in a dose of 25 to 100 mg / dose. AD04776 was administered at a combined dose of 400 mg with AD04872 at a 1: In one embodiment, the dose of AD04872 is administered in an amount of about 18 mg. The dose of AD04776 is about 6 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04776 is in an amount of about 9 mg, and AD0487 The dose of 2 is in an amount of about 27 mg for a combined dose of about 35 mg. wherein the dose of AD04776 is about 10 mg and the dose of AD04772 is about In one embodiment, the amount is about 30 mg for a combined dose of 40 mg. The dose of 4872 is approximately 36 mg, and the dose of AD04776 is approximately 50 mg. In one embodiment, the dose of AD04776 is about 12 mg. is in an amount of about 25 mg, and the dose of AD04872 is in a combined dose of about 100 mg. In one embodiment, the dose of AD04776 is about 50 mg. g, and the dose of AD04872 is about 15 mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04776 is in an amount of about 75 mg. The dose of AD04872 is approximately 225 mg for a combined dose of approximately 300 mg. In one embodiment, the dose of AD04776 is in an amount of about 100 mg, The dose of 04872 is in an amount of about 300 mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04776 are administered for about 7 days, about 14 days, or , about 21 days or about 28 days apart. 72 and AD04776 were administered at or approximately 28-day intervals (i.e., Q4W). In one embodiment, the dose of AD04776 is in an amount of about 10 mg, and The dose of 04872 is about 30 mg for a combined dose of about 40 mg, and AD 04872 and AD04776 are administered at or about 28-day intervals (i.e., Q4W In one embodiment, the dose of AD04776 is administered in an amount of about 25 mg. The dose of AD04872 is about 75 mg for a combined dose of about 100 mg. AD04872 and AD04776 were administered at intervals of 28 days or approximately 28 days (i.e. In one embodiment, the dose of AD04776 is about 50 mg. and the dose of AD04872 is about 150 mg for a combined dose of about 200 mg. g, and AD04872 and AD04776 were administered at intervals of 28 days or approximately 28 days. (i.e., Q4W).

[0176] In some embodiments, about 1 mg / kg (mpk) of AD04872 and about 1 mg / kg of AD04776 is administered to a subject in need thereof. In the form of about 1.5 mg / kg AD04872 and about 1.5 mg / kg AD047 76 is administered to a subject in need thereof. In some embodiments, about 2 AD04872 at 0.0 mg / kg and AD04776 at approximately 1.0 mg / kg were used to In some embodiments, about 3.0 mg / kg of A D04872 and approximately 1.0 mg / kg of AD04776 for those in need. In some embodiments, about 3.2 mg / kg of AD04872 and about 0 0.8mg / kg of AD04776 will be administered to subjects in need. In some embodiments, about 2.7 mg / kg AD04872 and about 1.3 mg / kg A D04776 is administered to a subject in need thereof. Approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04776 were In some embodiments, about 3.3 mg / kg of niacin is administered to a subject in need thereof. kg of AD04872 and approximately 1.7 mg / kg of AD04776. In some embodiments, about 0.05 to about 5 mg / kg of AD is administered to a subject. 04872 and approximately 0.05 to approximately 5 mg / kg AD04776 are required. In some embodiments, AD04872 and AD04776 are administered to a subject. Each dose is administered separately (e.g., in a separate injection). The doses of D04872 and AD04776 are administered together (eg, in the same injection). In some embodiments, each dose of AD04872 and AD04776 is administered as a single pharmaceutical agent. The composition is prepared.

[0177] In some embodiments, disclosed herein are methods for treating HBV infection, or A method for preventing a disease or condition caused by BV infection, which method comprises administering to a patient who is unaware of the disease or condition. and administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD04982. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04982 is about 2:1. The ratio of AD04872 to AD04982 administered to subjects in need thereof is about 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04982 is about 4:1. The ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04982 is about 5:1. The ratio of AD04872 to AD04982 administered to subjects in need thereof is 1:2. is.

[0178] In some embodiments, disclosed herein are HBV-caused and a method for treating or preventing a disease associated with an infection, the method comprising administering to a patient in need thereof. administering an effective amount of AD04872 and an effective amount of AD04982 to a subject In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD04982 is about 2:1. The ratio of AD04872 to AD04982 administered to subjects in need is approximately 3:1. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD04982 is about 4:1. The ratio of AD04872 to AD04982 administered to a subject in need is approximately 1:1. In some embodiments, AD048 is administered to a subject in need thereof. The ratio of 72 to AD04982 is about 5:1. The ratio of AD04872 to AD04982 administered to subjects in need is 1:2 .

[0179] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating a disease associated with an infection, which method is directed to a patient in need thereof. The method comprises administering to an elephant an effective amount of AD04872 and an effective amount of AD04982. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D04982 to D04982 is about 2:1. The ratio of AD04872 to AD04982 administered to subjects receiving the treatment is approximately 3:1. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D04982 to D04982 is about 4:1. The ratio of AD04872 to AD04982 administered to subjects receiving the treatment is approximately 1:1. In some embodiments, AD04872 vs. A is administered to a subject in need thereof. In some embodiments, the ratio of D04982 to D04982 is about 5:1. The ratio of AD04872 to AD04982 administered to subjects receiving the treatment is 1:2.

[0180] In some embodiments, AD04872 and AD04982 are administered in a single dose. In some embodiments, the AD 04872 and AD04982 are approximately 25-50 mg, 50-75 mg, and 75-100 mg. g, 100~125mg, 125~150mg, 150~175mg, 175~200m g, 200~225mg, 225~250mg, 250~275mg, 275~300m g, 300~325mg, 325~350mg, 350~375mg, 375~400m g, 25~75mg, 50~100mg, 100~150mg, 150~200mg, 2 00~250mg, 250~300mg, 300~350mg, 350~400mg, 2 5~100mg, 50~150mg, 100~200mg, 150~250mg, 200 ~300mg, 300-400mg, 25-200mg, or 200-400mg combinations In some embodiments, AD04872 and AD0498 are administered in a combined dose. 2 is about 30 to 50 mg, about 90 to 110 mg, or about 190 to 210 mg per dose. In some embodiments, AD04872 and A are administered in a combined amount of 100 mg. D04982 is administered in a combined dose of approximately 30 to 50 mg per dose. In some embodiments, AD04872 and AD04982 are administered at a dose of about 9 mg / dose. In some embodiments, AD048 is administered in a combined dose of 0 to 110 mg. 72 and AD04982 are administered at a combined dose of approximately 190-210 mg per dose. In some embodiments, AD04872 and AD04982 are administered in a single dose. Approximately 25 mg, approximately 50 mg, approximately 100 mg, approximately 125 mg, approximately 150 mg, approximately 1 75mg, about 200mg, about 225mg, about 250mg, about 275mg, about 300mg, administered in a combined dose of about 325 mg, about 350 mg, about 375 mg, or about 400 mg. In some embodiments, AD04872 and AD04982 are administered in a single dose. Administered at a combined dose of about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose In some embodiments, AD04872 and AD04982 are administered in a single dose. Approximately 35 mg, approximately 50 mg, approximately 100 mg, approximately 200 mg, approximately 300 mg, or approximately 4 mg per dose In some embodiments, AD04872 and and AD04982 at a dose of approximately 40 mg, approximately 100 mg, or approximately 200 mg per dose. In some embodiments, AD04872 and AD04872 are administered in a combined amount. 982 is administered in a combined amount of about 40 mg per dose. In this condition, AD04872 and AD04982 are administered in a combination dose of approximately 100 mg per dose. In some embodiments, AD04872 and AD049 are administered in a combined amount. 82 is administered in a combined amount of about 200 mg per dose. In this embodiment, AD04872 and AD04982 are administered for about 7 days, about 14 days, about 21 days, or about In some embodiments, AD04872 and AD04872 are administered at intervals of 28 days. 982 is administered at or about 28 day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered in a dose of about 40 mg / dose. mg, about 100 mg, or about 200 mg at 28-day intervals or for about 28 days In some embodiments, AD04872 and and AD04982 at a combined dose of approximately 40 mg per dose, administered 28 days apart or In some embodiments, the AD 04872 and AD04982 are administered in a combined dose of approximately 100 mg per dose. The doses are administered at 8 day intervals or at intervals of about 28 days (i.e., Q4W). In this study, AD04872 and AD04982 were administered in a combination of approximately 200 mg per dose. The combined doses are administered at or about 28 day intervals (ie, Q4W).

[0181] In some embodiments, AD04872 and AD04982 are administered for about 1 to 18 weeks. In some embodiments, AD04872 and AD04982 are administered at intervals. , about 1 week interval, about 2 week interval, about 3 week interval, about 4 week interval, about 5 week interval, about 6 week interval intervals, approximately 7 week intervals, approximately 8 week intervals, approximately 9 week intervals, approximately 10 week intervals, approximately 11 week intervals, Approximately 12 week intervals, approximately 13 week intervals, approximately 14 week intervals, approximately 15 week intervals, approximately 16 week intervals, In some embodiments, the AD 04872 and AD04982 are administered approximately 1 to 6 months apart. In this state, AD04872 and AD04982 are administered at intervals of about 1 month, about 2 months, The doses are administered at about 3 month intervals, about 4 month intervals, about 5 month intervals, or about 6 month intervals. In some embodiments, AD04872 and AD04982 are administered at intervals of about 4 weeks or In some embodiments, AD04872 and AD04872 are administered one month apart. 982 is administered at intervals of about 7 days, 14 days, 21 days, or 28 days. In this study, AD04872 and AD04982 were administered at intervals of approximately 28 days (i.e., Q4W). It is administered at .

[0182] In some embodiments, AD04872 and AD04982 are administered for about 1 to 12 months. In some embodiments, AD04872 and AD0 4982 is at least about 1 month, at least about 2 months, at least about 3 months, at least at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months or less In some embodiments, the AD0 4872 and AD04982 are administered over a period of approximately 1 to 18 weeks. In an embodiment, AD04872 and AD04982 are administered for at least about 1 week. at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks , at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks In some embodiments, AD04872 and AD04872 are administered over a period of time. 982 is administered over a period of approximately 12 weeks or 3 months.

[0183] In some embodiments, AD04872 and AD04982 are administered in a single dose. The combination dose is approximately 25 to 75 mg, and the ratios are approximately 2:1, 3:1, 1:1, 4:1, and 5:1. In some embodiments, AD04872 and AD04982 is administered at a dose of approximately 50 to 125 mg per dose, with a ratio of approximately 2:1. The doses are administered in a ratio of about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, AD04872 and AD04982 are administered in an amount of about 75-15 mg / dose. At a combination dose of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1 In some embodiments, AD04872 and AD0498 are administered in a ratio of 0:2. 2 is a combination of approximately 100 to 200 mg per dose, with a ratio of approximately 2:1, approximately 3:1, In some embodiments, the ratio is about 1:1, about 4:1, about 5:1, or about 1:2. AD04872 and AD04982 are administered at a dose of approximately 150 to 250 mg per dose. Combination amounts in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2 In some embodiments, AD04872 and AD04982 are administered at 1 The combination dose is approximately 200-300 mg per dose, with approximately 2:1, 3:1, and 1:1 In some embodiments, A is administered in a ratio of about 4:1, about 5:1, or about 1:2. D04872 and AD04982 are combined in a single dose of approximately 300 to 400 mg. and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, AD04872 and AD04982 are administered in a single dose. The combination dose is about 50 to 100 mg per dose, and the ratios are about 2:1, 3:1, 1:1, and 4:1. In some embodiments, AD0487 is administered at a ratio of about 5:1 or about 1:2. 2 and AD04982 are administered in a combined dose of approximately 25 to 400 mg per dose. In some embodiments, AD04872 and AD0498 are administered in a ratio of 1:1. 2 are administered in a ratio of approximately 2:1 at a combined dose of approximately 25-75 mg per dose. In some embodiments, AD04872 and AD04982 are administered in a single dose. The combined dose is about 50-125 mg, administered in a ratio of about 2:1. In this condition, AD04872 and AD04982 are administered in a dose of approximately 75 to 150 mg / dose. In some embodiments, the AD0 The combined dose of 4872 and AD04982 is approximately 100-200 mg per dose. In some embodiments, AD04872 and AD 04982 is a combination of approximately 125-225 mg per dose, with a ratio of approximately 2:1. In some embodiments, AD04872 and AD04982 are administered at 1 The combined dose is approximately 150-250 mg per dose, administered in a ratio of approximately 2:1. In some embodiments, AD04872 and AD04982 are administered in a dose of about The combined dose is 200-300 mg, administered in a ratio of about 2:1. In this study, AD04872 and AD04982 were administered in a dose of approximately 300 to 400 mg. In some embodiments, the AD0 4872 and AD04982 are administered at a combined dose of approximately 35 mg per dose, with a combined dose of approximately 2: In some embodiments, AD04872 and AD04982 are administered in a ratio of 1:1. are administered in a ratio of about 2:1 with a combined dose of about 40 mg per dose. In some embodiments, AD04872 and AD04982 are administered at a dose of about 10 In some embodiments, the combined dose is about 2:1, with the combined dose being 0 mg. D04872 and AD04982 are administered in a combined dose of approximately 200 mg per dose. In some embodiments, AD04872 and AD04872 are administered in a ratio of about 2:1. 982 will be administered in a ratio of approximately 2:1 at a combined dose of approximately 300 mg per dose. In some embodiments, AD04872 and AD04982 are administered in a single dose. In some embodiments, the combined dose is about 400 mg, and the combined dose is administered in a ratio of about 2:1. AD04872 and AD04982 lasted for about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04982 are administered at intervals of 10 min. The drugs are administered at or about 28-day intervals (i.e., Q4W). In an embodiment, AD04872 and AD04982 are administered at about 40 mg per dose; A combination dose of about 100 mg or about 200 mg, in a ratio of about 2:1, at intervals of 28 days or about In some embodiments, the AD0 4872 and AD04982 are administered at a combined dose of approximately 40 mg per dose, with a combined dose of approximately 2: 1 at intervals of 28 days or about 28 days (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered at a dose of about 10 0 mg combination dose, in a ratio of about 2:1, at intervals of 28 days or about 28 days (i.e. In some embodiments, AD04872 and AD049 are administered Q4W. 82 is a combination of approximately 200 mg per dose, administered in a ratio of approximately 2:1 for 28 days. The doses are administered every other week or about every 28 days (i.e., Q4W).

[0184] In some embodiments, AD04872 is administered in an amount of about 3 to 650 mg; AD04982 is administered in amounts ranging from approximately 2 to 325 mg per dose. In some embodiments, AD04872 is administered in an amount of about 35 to 265 mg per dose. In some embodiments, AD04872 is administered in an amount of about 50-75 mg / dose. In some embodiments, AD04982 is administered in an amount of 1 mg per dose. In some embodiments, AD0498 is administered in an amount of about 20 to 125 mg per dose. 2 is administered in an amount of approximately 25-50 mg per dose.

[0185] In some embodiments, AD04872 and AD04982 are administered in a single dose. In some embodiments, the combined dose is about 1 to 10 mg / kg. D04872 and AD04982 are combined at approximately 1 to 5 mg / kg per dose. In some embodiments, AD04872 and AD04982 are administered in amounts of: Approximately 1 to 1.5 mg / kg, approximately 1.5 to 2.0 mg / kg, or approximately 2.0 to 2.0 mg / kg per dose .5mg / kg, about 2.5~3.0mg / kg, about 3.0~3.5mg / kg, about 3.5 ~4.0mg / kg, about 4.0-4.5mg / kg, about 4.5-5.0mg / kg, about 5 .0~5.5mg / kg, about 5.5~6.0mg / kg, about 6.0~6.5mg / kg, Approximately 6.5 to 7.0 mg / kg, approximately 7.0 to 7.5 mg / kg, approximately 7.5 to 8.0 mg / kg g, about 8.0~8.5mg / kg, about 8.5~9.0mg / kg, about 9.0~9.5mg / kg, about 9.5~10mg / kg, about 1~2.5mg / kg, about 2.5~5.0mg / kg, about 5.0~7.5mg / kg, about 7.5~10mg / kg, about 1~5.0mg / k g, or a combined dose of about 5.0-10 mg / kg.

[0186] In some embodiments, AD04982 is administered in a dose of about 0.3 to 5 mg per dose. / kg, and AD04872 is administered at a dose of approximately 0.6 to 7 mg / kg per dose. In some embodiments, AD04982 is administered in an amount of about In some embodiments, AD049 is administered in an amount of 0.5 to 2.5 mg / kg. 82 is administered in an amount of approximately 0.3 to 1.5 mg / kg per dose. In some embodiments, AD04872 is administered in an amount of about 0.6 to 5 mg / kg per dose. In some embodiments, AD04872 is administered in about 1 to 2 doses per administration. It is administered at a dose of 0.5mg / kg.

[0187] In some embodiments, AD04872 and AD04982 are administered in a single dose. In one embodiment, AD0487 is administered in a combined dose of 25 to 400 mg. 2 and AD04982 were administered at a combined dose of 25 to 400 mg, and AD0487 2 is administered with AD04982 in a 1:1 ratio. The doses of each of AD04982 and AD04982 were approximately 1 mg for a combined dose of approximately 25 mg. In one embodiment, each of AD04872 and AD04982 is in an amount of 2 mg. In one embodiment, the dose is about 17 mg for a combined dose of about 35 mg. The dose of each of AD04872 and AD04982 is approximately 40 mg. In one embodiment, AD04872 and AD04 are administered in an amount of about 20 mg per dose. Each dose of 982 is about 25 mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04872 and AD04982 is about 10 In one embodiment, the amount is about 50 mg for a combined dose of AD04. The individual doses of 872 and AD04982 were approximately 200 mg for a combined dose of In one embodiment, the amount of AD04872 and AD04982 is about 100 mg. Each dose is about 150 mg for a combined dose of about 300 mg. In embodiments, the dose of each of AD04872 and AD04982 is about 400 mg. In some embodiments, the amount is about 200 mg for a combined dose of AD 04872 and AD04982 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04872 and AD04982 are administered over 28 days. or about 28 days apart (i.e., Q4W). The individual doses of D04872 and AD04982 correspond to a combined dose of approximately 40 mg. or in an amount of about 50 mg for a combination dose of about 100 mg. or in an amount of about 100 mg for a combined dose of about 200 mg, AD04 872 and AD04982 at or about 28-day intervals (i.e., Q4W). In one embodiment, the respective doses of AD04872 and AD04982 are administered. is in an amount of about 20 mg for a combined dose of about 40 mg, and AD04872 and A D04982 is administered at or about 28 day intervals (ie, Q4W). In one embodiment, the dose of each of AD04872 and AD04982 is about 100 The amount of AD04872 and AD0498 is about 50 mg for a combined dose of 100 mg. 2 are administered at or about 28 day intervals (i.e., Q4W). In this study, the dose of each of AD04872 and AD04982 was approximately 200 mg. The combined dose is approximately 100 mg, and AD04872 and AD04982 are 2 The doses are administered at 8 day intervals or at intervals of about 28 days (ie, Q4W).

[0188] In one embodiment, AD04872 and AD04982 are administered in a dose of 25 to 100 mg / dose. AD04982 was administered at a combined dose of 400 mg with AD04872 at a 1: In one embodiment, the dose of AD04872 is administered in an amount of about 16 mg. The dose of AD04982 is about 8 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04982 is in an amount of about 12 mg, and The dose of 72 is in an amount of about 24 mg for a combined dose of about 35 mg. wherein the dose of AD04982 is about 13 mg and the dose of AD04872 is In one embodiment, the AD The dose of 04872 is approximately 33 mg, and the dose of AD04982 is approximately 50 mg. In one embodiment, the amount of AD04982 is about 17 mg for the combined dose. The dose of AD04872 is about 100 mg combined dose. In one embodiment, the dose of AD04982 is about 67 mg. mg, and the dose of AD04872 is about 1 mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04982 is in an amount of about 100 mg. and the dose of AD04872 is about 200 mg for a combined dose of about 300 mg. In one embodiment, the dose of AD04982 is in an amount of about 135 mg, The dose of AD04872 is approximately 270 mg for a combined dose of approximately 400 mg. In some embodiments, AD04872 and AD04982 are administered for about 7 days, about 1 In some embodiments, the AD0 is administered at intervals of 4 days, about 21 days, or about 28 days. 4872 and AD04982 were administered at or about 28-day intervals (i.e., Q4W) In one embodiment, the dose of AD04982 is in an amount of about 13 mg, the dose of AD04872 is in an amount of about 27 mg for a combination dose of about 40 mg; AD04872 and AD04982 were administered at or about 28-day intervals (i.e., Q In one embodiment, the dose of AD04982 is administered in an amount of about 35 mg. and the dose of AD04872 is about 65 mg for a combined dose of about 100 mg. AD04872 and AD04982 were administered at intervals of 28 days or approximately 28 days (i.e., In one embodiment, the dose of AD04982 is about 67 mg / kg. g, and the dose of AD04872 is about 13 mg for a combined dose of about 200 mg. AD04872 and AD04982 were administered at intervals of 28 days or approximately every 28 days. It is administered at intervals (i.e., Q4W).

[0189] In one embodiment, AD04872 and AD04982 are administered in a dose of 25 to 100 mg / dose. AD04982 was administered at a combined dose of 400 mg with AD04872 at a 1: In one embodiment, the dose of AD04872 is administered in an amount of about 18 mg. The dose of AD04982 is about 6 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04982 is in an amount of about 9 mg and AD0487 The dose of 2 is in an amount of about 27 mg for a combined dose of about 35 mg. wherein the dose of AD04982 is about 10 mg and the dose of AD04872 is about In one embodiment, the amount is about 30 mg for a combined dose of 40 mg. The dose of 4872 is approximately 36 mg, and the dose of AD04982 is approximately 50 mg. In one embodiment, the dose of AD04982 is about 12 mg. is in an amount of about 25 mg, and the dose of AD04872 is in a combined dose of about 100 mg. In one embodiment, the dose of AD04982 is about 50 mg. g, and the dose of AD04872 is about 15 mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04982 is in an amount of about 75 mg. The dose of AD04872 is approximately 225 mg for a combined dose of approximately 300 mg. In one embodiment, the dose of AD04982 is in an amount of about 100 mg, The dose of 04872 is in an amount of about 300 mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04982 are administered for about 7 days, about 14 days, or , about 21 days or about 28 days apart. 72 and AD04982 were administered at or approximately 28-day intervals (i.e., Q4W). In one embodiment, the dose of AD04982 is in an amount of about 10 mg, and The dose of 04872 is about 30 mg for a combined dose of about 40 mg, and AD 04872 and AD04982 are administered at or about 28-day intervals (i.e., Q4W In one embodiment, the dose of AD04982 is about 25 mg. The dose of AD04872 is about 75 mg for a combined dose of about 100 mg. AD04872 and AD04982 were administered at intervals of 28 days or approximately 28 days (i.e. In one embodiment, the dose of AD04982 is about 50 mg. and the dose of AD04872 is about 150 mg for a combined dose of about 200 mg. g, and AD04872 and AD04982 were administered at intervals of 28 days or approximately 28 days. (i.e., Q4W).

[0190] In some embodiments, about 1 mg / kg (mpk) of AD04872 and about 1 mg / kg of AD04982 is administered to a subject in need thereof. In the form of about 1.5 mg / kg AD04872 and about 1.5 mg / kg AD049 82 is administered to a subject in need thereof. In some embodiments, about 2 AD04872 at 0.0 mg / kg and AD04982 at approximately 1.0 mg / kg were used to In some embodiments, about 3.0 mg / kg of A D04872 and approximately 1.0 mg / kg of AD04982 for those in need. In some embodiments, about 3.2 mg / kg of AD04872 and about 0 0.8mg / kg of AD04982 will be administered to subjects in need. In some embodiments, about 2.7 mg / kg AD04872 and about 1.3 mg / kg A D04982 is administered to a subject in need thereof. Approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04982 were In some embodiments, about 3.3 mg / kg of niacin is administered to a subject in need thereof. kg of AD04872 and approximately 1.7 mg / kg of AD04982. In some embodiments, about 0.05 to about 5 mg / kg of AD is administered to a subject. 04872 and approximately 0.05 to approximately 5 mg / kg AD04982 are required. In some embodiments, AD04872 and AD04982 are administered to a subject. Each dose is administered separately (e.g., in a separate injection). The doses of D04872 and AD04982 are administered together (eg, in the same injection). In some embodiments, the doses of AD04872 and AD04982 are administered as a single pharmaceutical agent. The composition is prepared.

[0191] In some embodiments, disclosed herein are methods for treating HBV infection, or A method for preventing a disease or condition caused by BV infection, which method comprises administering to a patient who is unaware of the disease or condition. and administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD04585. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04580 to AD04585 is about 2:1. The ratio of AD04580 to AD04585 administered to a subject in need thereof is about 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04580 to AD04585 is about 4:1. The ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04580 to AD04585 is about 1:1. The ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1: 2. In some embodiments, about 1 mg / kg (mpk) of AD04580 and Approximately 1 mg / kg of AD04585 is administered to a subject in need thereof. In some embodiments, about 1.5 mg / kg AD04580 and about 1.5 mg / kg A D04585 is administered to a subject in need thereof. and about 0.05 to about 5 mg / kg of AD04580 and about 0.05 to about 5 mg / kg of A D04585 will be administered to subjects in need thereof.

[0192] In some embodiments, disclosed herein are HBV-caused and a method for treating or preventing a disease associated with an infection, the method comprising administering to a patient in need thereof. The method comprises administering to a subject having the disease an effective amount of AD04580 and an effective amount of AD04585. In some embodiments, AD045 is administered to a subject in need thereof. The ratio of 80 to AD04585 is about 2:1. The ratio of AD04580 to AD04585 administered to subjects in need is approximately 3:1. In some embodiments, AD045 is administered to a subject in need thereof. The ratio of 80 to AD04585 is about 4:1. The ratio of AD04580 to AD04585 administered to subjects in need is approximately 5:1. In some embodiments, AD045 is administered to a subject in need thereof. The ratio of 80 to AD04585 is about 1:1. The ratio of AD04580 to AD04585 administered to a subject in need is approximately 1:2. In some embodiments, about 1 mg / kg (mpk) of AD04580 and about 1 mg g / kg of AD04585 is administered to subjects in need thereof. In one embodiment, about 1.5 mg / kg of AD04580 and about 1.5 mg / kg of AD04 585 is administered to a subject in need thereof. AD04580 at 0.05 to approximately 5 mg / kg and AD04 at approximately 0.05 to approximately 5 mg / kg 585 will be administered to subjects in need thereof.

[0193] In some embodiments, disclosed herein are HBV-caused The present invention relates to a method for treating a disease associated with an infection, which method is directed to a patient in need thereof. The method comprises administering to an elephant an effective amount of AD04580 and an effective amount of AD04585. In some embodiments, AD04580 is administered to a subject in need thereof. In some embodiments, the ratio of D04585 to D04585 is about 2:1. The ratio of AD04580 to AD04585 administered to subjects receiving the treatment is approximately 3:1. In some embodiments, AD04580 is administered to a subject in need thereof. In some embodiments, the ratio of D04585 to D04585 is about 4:1. The ratio of AD04580 to AD04585 administered to subjects receiving the treatment is approximately 5:1. In some embodiments, AD04580 is administered to a subject in need thereof. In some embodiments, the ratio of D04585 to D04585 is about 1:1. The ratio of AD04580 to AD04585 administered to subjects receiving the treatment is approximately 1:2. In some embodiments, about 1 mg / kg (mpk) of AD04580 and about 1 mg / kg In some embodiments, the amount of AD04585 administered to a subject in need thereof. In this study, approximately 1.5 mg / kg of AD04580 and approximately 1.5 mg / kg of AD04585 were and administered to a subject in need thereof. In some embodiments, about 0.05 ~5 mg / kg AD04580 and ~0.05 to ~5 mg / kg AD04585 and administered to a subject in need thereof.

[0194] In some embodiments, AD04580 and AD04585 are from about 25 to 400 In some embodiments, AD04580 and A are administered in a combined amount of 100 mg. D04585 is administered in a dose of about 50 mg, about 75 mg, about 100 mg, or about 12 mg per dose. In some embodiments, AD04580 and AD04585 is available in a combination of about 40 mg, about 100 mg, or about 200 mg per dose. In some embodiments, AD04580 and AD045 are administered in a combined amount. 85 is administered in a combined amount of about 40 mg per dose. In this study, AD04580 and AD04585 were administered in a combination dose of approximately 100 mg per dose. In some embodiments, AD04580 and AD0458 are administered in a combined dose. 5 is administered in a combined amount of about 200 mg per dose. In this study, AD04580 and AD04585 are administered at intervals of about 1 to 18 weeks. In some embodiments, AD04580 and AD04585 are administered at intervals of about 1 to 6 months. In some embodiments, AD04580 and AD04585 are administered at about In some embodiments, AD0458 is administered at 4-week intervals or at monthly intervals. AD04585 and AD04585 are administered approximately 7, 14, 21, or 28 days apart. In some embodiments, AD04580 and AD04585 are administered at intervals of 28 days or about 2 days. In some embodiments, AD04580 and AD045 are administered at an interval of 8 days. 85 is a combination dose of approximately 40 mg, approximately 100 mg, or approximately 200 mg per dose. , at or about 28 day intervals (i.e., Q4W). In this formulation, AD04580 and AD04585 are combined in a single dose of approximately 40 mg. The combined dose is administered at or about 28-day intervals (i.e., Q4W). In some embodiments, AD04580 and AD04585 are administered in a dose of about At a combination dose of 100 mg, at or about 28-day intervals (i.e., Q4W) In some embodiments, AD04580 and AD04585 are administered in a single dose. At a combined dose of approximately 200 mg per minute, at intervals of 28 days or approximately 28 days (i.e., It is administered Q4W.

[0195] In some embodiments, AD04580 and AD04585 are administered for about 1 to 12 months. In some embodiments, AD04580 and AD0 4585 is administered for a period of about 3 months. The combined dose of 04580 and AD04585 is approximately 25 to 400 mg per dose. and administered in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, AD04580 and AD04585 are administered in a single dose. The combined dose is approximately 100 mg, administered in a ratio of approximately 2:1.

[0196] In some embodiments, AD04580 is administered in a dose of about 3 to 650 mg per dose. AD04585 is administered in an amount of approximately 2 to 325 mg per dose. In some embodiments, AD04580 is administered in an amount of about 35 to 265 mg / dose. In some embodiments, AD04580 is administered in an amount of 1 mg per dose. In some embodiments, AD04585 is administered in an amount of about 50 to 75 mg per dose. is administered in an amount of about 20 to 125 mg per dose. AD04585 is administered in an amount of approximately 25 to 50 mg per dose.

[0197] In some embodiments, AD04580 and AD04585 are administered in a single dose. In some embodiments, the combined dose is about 1 to 10 mg / kg. D04580 and AD04585 are combined at a dose of approximately 1 to 5 mg / kg per dose. In some embodiments, AD04580 and AD04585 are administered in amounts of: Approximately 1 to 1.5 mg / kg, approximately 1.5 to 2.0 mg / kg, or approximately 2.0 to 2.0 mg / kg per dose .5mg / kg, about 2.5~3.0mg / kg, about 3.0~3.5mg / kg, about 3.5 ~4.0mg / kg, about 4.0-4.5mg / kg, about 4.5-5.0mg / kg, about 5 .0~5.5mg / kg, about 5.5~6.0mg / kg, about 6.0~6.5mg / kg, Approximately 6.5 to 7.0 mg / kg, approximately 7.0 to 7.5 mg / kg, approximately 7.5 to 8.0 mg / kg g, about 8.0~8.5mg / kg, about 8.5~9.0mg / kg, about 9.0~9.5mg / kg, about 9.5~10mg / kg, about 1~2.5mg / kg, about 2.5~5.0mg / kg, about 5.0~7.5mg / kg, about 7.5~10mg / kg, about 1~5.0mg / k g, or a combined dose of about 5.0-10 mg / kg.

[0198] In some embodiments, AD04585 is about 0.3 to 5 mg per dose. / kg, and AD04580 is administered at a dose of approximately 0.6 to 7 mg / kg per dose. In some embodiments, AD04585 is administered in an amount of about In some embodiments, AD045 is administered in an amount of 0.5 to 2.5 mg / kg. 85 is administered in an amount of approximately 0.3 to 1.5 mg / kg per dose. In one embodiment, AD04580 is administered in an amount of about 0.6 to 5 mg / kg per dose. In some embodiments, AD04580 is administered in about 1 to 2 doses per administration. It is administered at a dose of 0.5mg / kg.

[0199] In some embodiments, AD04580 and AD04585 are administered in a single dose. In one embodiment, AD0458 is administered in a combined dose of 25 to 400 mg. AD0458 and AD04585 were administered in a combined dose of 25 to 400 mg. In one embodiment, AD04585 is administered in a 1:1 ratio with AD04585. The doses of each of AD04585 and AD04580 are approximately 1 mg for a combined dose of approximately 25 mg. In one embodiment, each of AD04580 and AD04585 is in an amount of 2 mg. In one embodiment, the dose is about 17 mg for a combined dose of about 35 mg. The dose of each of AD04580 and AD04585 is approximately 40 mg. In one embodiment, AD04580 and AD04580 are administered in an amount of about 20 mg per dose. Each dose of 585 is about 25 mg for a combined dose of about 50 mg. In one embodiment, the dose of each of AD04580 and AD04585 is about 10 In one embodiment, the amount is about 50 mg for a combined dose of AD04. The individual doses of 580 and AD04585 were approximately 200 mg for a combined dose of In one embodiment, the amount of AD04580 and AD04585 is about 100 mg. Each dose is about 150 mg for a combined dose of about 300 mg. In embodiments, the dose of each of AD04580 and AD04585 is about 400 mg. In some embodiments, the amount is about 200 mg for a combined dose of AD 04580 and AD04585 are administered at intervals of about 7 days, about 14 days, about 21 days, or about 28 days. In some embodiments, AD04580 and AD04585 are administered for 28 days. or about 28 days apart (i.e., Q4W). The individual doses of D04580 and AD04585 correspond to a combined dose of approximately 40 mg. or in an amount of about 50 mg for a combination dose of about 100 mg. or in an amount of about 100 mg for a combined dose of about 200 mg, AD04 580 and AD04585 at or about 28-day intervals (i.e., Q4W). In one embodiment, the respective doses of AD04580 and AD04585 are administered. is in an amount of about 20 mg for a combined dose of about 40 mg, and AD04580 and A D04585 is administered at or about 28 day intervals (ie, Q4W). In one embodiment, the dose of each of AD04580 and AD04585 is about 100 The amount of AD04580 and AD0458 is about 50 mg for a combined dose of 100 mg. 5 are administered at or about 28 day intervals (i.e., Q4W). In this study, the dose of each of AD04580 and AD04585 was approximately 200 mg. The combined dose is approximately 100 mg, and AD04580 and AD04585 are 2 The doses are administered at 8 day intervals or at intervals of about 28 days (ie, Q4W).

[0200] In one embodiment, AD04580 and AD04585 are administered in a dose of 25 to 100 mg / dose. AD04585 is administered at a combined dose of 400 mg with AD04580 at a 1: In one embodiment, the dose of AD04580 is administered in an amount of about 16 mg. The dose of AD04585 is about 8 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04585 is in an amount of about 12 mg, The 80 dose is in an amount of about 24 mg for a combined dose of about 35 mg. wherein the dose of AD04585 is about 13 mg and the dose of AD04580 is In one embodiment, the AD The dose of 04580 is approximately 33 mg, and the dose of AD04585 is approximately 50 mg. In one embodiment, the amount of AD04585 is about 17 mg for the combined dose. The dose of AD04580 is about 100 mg combined dose. In one embodiment, the dose of AD04585 is about 67 mg. mg, and the dose of AD04580 is about 1 mg for a combination dose of about 200 mg. In one embodiment, the dose of AD04585 is in an amount of about 100 mg. and the dose of AD04580 is about 200 mg for a combined dose of about 300 mg. In one embodiment, the dose of AD04585 is in an amount of about 135 mg, The dose of AD04580 is approximately 270 mg for a combined dose of approximately 400 mg. In some embodiments, AD04580 and AD04585 are administered for about 7 days, about 1 In some embodiments, the AD0 is administered at intervals of 4 days, about 21 days, or about 28 days. 4580 and AD04585 are administered at or about 28-day intervals (i.e., Q4W) In one embodiment, the dose of AD04585 is in an amount of about 13 mg, The dose of AD04580 is in an amount of about 27 mg for a combination dose of about 40 mg; AD04580 and AD04585 were administered at or about 28-day intervals (i.e., Q In one embodiment, the dose of AD04585 is administered in an amount of about 35 mg. and the dose of AD04580 is about 65 mg for a combined dose of about 100 mg. and AD04580 and AD04585 are administered at intervals of 28 days or approximately 28 days (i.e., In one embodiment, the dose of AD04585 is about 67 mg / kg. g, and the dose of AD04580 is about 13 mg for a combined dose of about 200 mg. AD04580 and AD04585 are administered at intervals of 28 days or approximately every 28 days. It is administered at intervals (i.e., Q4W).

[0201] In one embodiment, AD04580 and AD04585 are administered in a dose of 25 to 100 mg / dose. AD04585 is administered at a combined dose of 400 mg with AD04580 at a 1: In one embodiment, the dose of AD04580 is administered in an amount of about 18 mg. The dose of AD04585 is about 6 mg for a combined dose of about 25 mg. In one embodiment, the dose of AD04585 is in an amount of about 9 mg, and In one embodiment, the dose of 0 is about 27 mg for a combined dose of about 35 mg. wherein the dose of AD04585 is about 10 mg and the dose of AD04580 is about In one embodiment, the amount is about 30 mg for a combined dose of 40 mg. The dose of AD04580 is approximately 36 mg, and the dose of AD04585 is approximately 50 mg. In one embodiment, the dose of AD04585 is about 12 mg. is in an amount of about 25 mg, and the dose of AD04580 is in a combined dose of about 100 mg. In one embodiment, the dose of AD04585 is about 50 mg. g, and the dose of AD04580 is about 15 mg for a combined dose of about 200 mg. In one embodiment, the dose of AD04585 is in an amount of about 75 mg. The dose of AD04580 is approximately 225 mg for a combined dose of approximately 300 mg. In one embodiment, the dose of AD04585 is in an amount of about 100 mg, The dose of 04580 is in an amount of about 300 mg for a combined dose of about 400 mg. In some embodiments, AD04580 and AD04585 are administered for about 7 days, about 14 days, or , at intervals of about 21 days or about 28 days. 80 and AD04585 were administered at or approximately 28-day intervals (i.e., Q4W). In one embodiment, the dose of AD04585 is in an amount of about 10 mg, The dose of 04580 is about 30 mg for a combined dose of about 40 mg, and AD 04580 and AD04585 are administered at or about 28-day intervals (i.e., Q4W In one embodiment, the dose of AD04585 is in an amount of about 25 mg. The dose of AD04580 is about 75 mg for a combined dose of about 100 mg. AD04580 and AD04585 were administered at or about 28-day intervals (i.e., In one embodiment, the dose of AD04585 is about 50 mg. and the dose of AD04580 is about 150 mg for a combined dose of about 200 mg. g, and AD04580 and AD04585 were administered at intervals of 28 days or approximately 28 days. (i.e., Q4W).

[0202] Provided herein is a method for treating hepatitis B virus infection in a human subject in need thereof. a method for inhibiting expression of a gene, the method comprising administering to the human subject an effective amount of a pharmaceutical composition. The pharmaceutical composition comprises administering a composition comprising: (a) a first RNAi agent, (i) SEQ ID NO: 100, SEQ ID NO: 111, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: No. 128, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179 and SEQ ID NO: 180 an antisense strand containing one of the nucleotide sequences; (ii) SEQ ID NO: 229, SEQ ID NO: 235, SEQ ID NO: 252, SEQ ID NO: 253, Any one of SEQ ID NOs: 273, 307, 302 and 319 a sense strand comprising a nucleic acid sequence; and (b) a second RNAi agent, (i) SEQ ID NO: 140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: No. 188, SEQ ID NO: 154 and SEQ ID NO: 162. an antisense strand; (ii) SEQ ID NO: 262, SEQ ID NO: 271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO: Any one of SEQ ID NO: 274, SEQ ID NO: 328, SEQ ID NO: 292, and SEQ ID NO: 294 a sense strand comprising the nucleotide sequence; and a second RNAi agent comprising: The first and second RNAi agents are administered at a combined dose of approximately 50-400 mg per month. will be done.

[0203] Further provided herein are methods for treating hepatitis B virus infection in a human subject in need thereof. Methods for treating a disease, disorder, or condition associated with infection caused by a genus of the method comprising administering to the human subject an effective amount of a pharmaceutical composition; The pharmaceutical composition comprises (a) a first RNAi agent, (i) SEQ ID NO: 100, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: No. 171, SEQ ID NO: 179 and SEQ ID NO: 180 an antisense strand; (ii) SEQ ID NO: 229, SEQ ID NO: 252, SEQ ID NO: 253, SEQ ID NO: 273, a sense strand comprising any one of the nucleotide sequences of SEQ ID NO: 302 and SEQ ID NO: 319; a first RNAi agent comprising: (b) a second RNAi agent, (i) SEQ ID NO: 140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: No. 188, SEQ ID NO: 154 and SEQ ID NO: 162. an antisense strand; (ii) SEQ ID NO: 262, SEQ ID NO: 271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO: Any one of SEQ ID NO: 274, SEQ ID NO: 328, SEQ ID NO: 292, and SEQ ID NO: 294 a sense strand comprising the nucleotide sequence; and a second RNAi agent comprising: The first and second RNAi agents are administered in amounts of about 50-400 mg per month.

[0204] In some embodiments, the first and second HBV RNAi agents are in a ratio of about 1:1, 2: In some embodiments, the first and second steroids are administered in a ratio of 1, 3:1, 4:1, or 5:1. and the second HBV RNAi agent are administered in a ratio of about 2:1.

[0205] In some embodiments, the first and second HBV RNAi agents are The combination dose is approximately 25 to 75 mg, and the ratios are approximately 2:1, 3:1, 1:1, 4:1, and 5:1. In some embodiments, the first and second HBs are administered in a ratio of about 1:1 or about 1:2. V RNAi drugs are administered in a dose of approximately 50 to 125 mg, with a ratio of approximately 2:1. The doses are administered in a ratio of about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In embodiments, the first and second HBV RNAi agents are administered in a dose of about 75-150 mg / dose. At a combination dose of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1 In some embodiments, the first and second HBV RNAi The drug is administered in a combination dose of approximately 100 to 200 mg per dose, with a ratio of approximately 2:1, approximately 3:1, In some embodiments, the ratio is about 1:1, about 4:1, about 5:1, or about 1:2. The first and second HBV RNAi drugs are administered at a dose of approximately 150-250 mg per dose. Combination amounts in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2 In some embodiments, the first and second HBV RNAi agents are administered in a dose of 1 The combination dose is approximately 200-300 mg per dose, with approximately 2:1, 3:1, and 1:1 In some embodiments, the medicament is administered in a ratio of about 4:1, about 5:1, or about 1:2. The first and second HBV RNAi drugs are combined at approximately 300-400 mg per dose. and in a ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1, or about 1:2. In some embodiments, the first and second HBV RNAi agents are administered in a single dose. The combination dose is about 50 to 100 mg per dose, and the ratios are about 2:1, 3:1, 1:1, and 4:1. In some embodiments, the first and second The HBV RNAi drug is administered in a combination dose of approximately 25 to 400 mg per dose. In some embodiments, the first and second HBV RNAi The drugs are administered in a combination dose of approximately 25 to 75 mg per dose, in a ratio of approximately 2:1. In some embodiments, the first and second HBV RNAi agents are The combined dose is about 50-125 mg, administered in a ratio of about 2:1. In this embodiment, the first and second HBV RNAi agents are administered in a dose of about 75 to 150 mg / dose. In some embodiments, the first and second steroids are administered in a combined amount of about 1:1. and the second HBV RNAi drug, each in a combined dose of approximately 100-200 mg. In some embodiments, the first and second HBV The RNAi drugs were administered in a combination dose of approximately 125-225 mg per dose, at a ratio of approximately 2:1. In some embodiments, the first and second HBV RNAi agents are administered in a dose of 1 The combined dose is approximately 150-250 mg per dose, administered in a ratio of approximately 2:1. In some embodiments, the first and second HBV RNAi agents are administered in amounts of about The combined dose is 200-300 mg, administered in a ratio of about 2:1. In this study, the first and second HBV RNAi drugs were administered at approximately 300-400 mg / dose. In some embodiments, the first and second steroids are administered in a combined amount of about 1:1. and the second HBV RNAi drug, at a combined dose of approximately 35 mg per dose, approximately 2: In some embodiments, the first and second HBV RNAi agents are administered in a ratio of 1:1. are administered in a ratio of about 2:1 with a combined dose of about 40 mg per dose. In some embodiments, the first and second HBV RNAi agents are administered in a dose of about 10 In some embodiments, the combined dose is about 2:1. The first and second HBV RNAi agents are administered in a combined dose of approximately 200 mg per dose. In some embodiments, the first and second HBV RNs are administered in a ratio of about 2:1. The AI ​​drugs are administered in a ratio of approximately 2:1, with a combined dose of approximately 300 mg per dose. In some embodiments, the first and second HBV RNAi agents are The combined dose is approximately 400 mg, administered in a ratio of approximately 2:1.

[0206] In some embodiments, the first RNAi agent is administered in a dose of about 3 to 650 ml per dose. g of the second RNAi agent, and the second RNAi agent is administered in an amount of about 2-325 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 35 to 400 mg / dose. In some embodiments, the first RNAi agent is administered in an amount of 265 mg. In some embodiments, the second RNAi agents are administered in amounts of approximately 20-125 mg per dose. In some embodiments, the second RNAi agent is administered in an amount of about 25-50 mg per dose. do.

[0207] In some embodiments, the first and second HBV RNAi agents are In some embodiments, the combined dose is about 1 to 10 mg / kg. The first and second HBV RNAi agents are combined at a dose of approximately 1 to 5 mg / kg per dose. In some embodiments, the first and second HBV RNAi agents are administered in amounts Approximately 1 to 1.5 mg / kg, approximately 1.5 to 2.0 mg / kg, or approximately 2.0 to 2.0 mg / kg per dose .5mg / kg, about 2.5~3.0mg / kg, about 3.0~3.5mg / kg, about 3.5 ~4.0mg / kg, about 4.0-4.5mg / kg, about 4.5-5.0mg / kg, about 5 .0~5.5mg / kg, about 5.5~6.0mg / kg, about 6.0~6.5mg / kg, Approximately 6.5 to 7.0 mg / kg, approximately 7.0 to 7.5 mg / kg, approximately 7.5 to 8.0 mg / kg g, about 8.0~8.5mg / kg, about 8.5~9.0mg / kg, about 9.0~9.5mg / kg, about 9.5~10mg / kg, about 1~2.5mg / kg, about 2.5~5.0mg / kg, about 5.0~7.5mg / kg, about 7.5~10mg / kg, about 1~5.0mg / k g, or a combined dose of about 5.0-10 mg / kg.

[0208] In some embodiments, the first RNAi agent is administered at a dose of about 0.6-7 ml per dose. g / kg, and the second RNAi agent is administered at about 0.3-5 mg / kg per dose. In some embodiments, the second RNAi agent is administered in an amount of 100 mg / kg per dose. In some embodiments, the second The RNAi agent is administered in an amount of about 0.3 to 1.5 mg / kg per dose. In some embodiments, the first RNAi agent is administered at a dose of about 0.6-5 mg / kg. g per dose. In some embodiments, the first RNAi agent is administered in an amount of It is administered in an amount of approximately 1 to 2.5 mg / kg.

[0209] In some embodiments, the HBV RNAi agents disclosed herein are AD05070 linked to (NAG37)s shown as the sodium salt with the structure Consisting of or including:

[0210] [ka]

[0211] In some embodiments, the HBV RNAi agents disclosed herein are AD05070 linked to (NAG25)s shown as the sodium salt with the structure Consisting of or including:

[0212] [ka]

[0213] In some embodiments, the HBV RNAi agents disclosed herein are It consists of AD05070 linked to (NAG37)s, shown as the free acid with the structure or contains:

[0214] [ka]

[0215] In some embodiments, the HBV RNAi agents disclosed herein are AD04580 linked to (NAG31)s shown as the sodium salt with the structure Consisting of or including:

[0216] [ka]

[0217] In some embodiments, the HBV RNAi agents disclosed herein are AD04585 linked to (NAG25)s shown as the sodium salt with the structure Consisting of or including:

[0218] [ka]

[0219] In some embodiments, the HBV RNAi agents disclosed herein are AD04872 linked to (NAG37)s shown as the sodium salt with the structure Consisting of or including:

[0220] [ka]

[0221] In some embodiments, the HBV RNAi agents disclosed herein are AD04872 linked to (NAG25)s shown as the sodium salt with the structure Consisting of or including:

[0222] [ka]

[0223] In some embodiments, the HBV RNAi agents disclosed herein are It consists of AD04872 linked to (NAG37)s, shown as the free acid with the structure or contains:

[0224] [ka]

[0225] In some embodiments, the described HBV RNAi agent(s) are desirably In some cases, therapies may be combined with one or more additional (i.e., second, third, etc.) treatments. The second treatment can be another HBV RNAi drug (e.g., one that targets another sequence in the HBV genome). Additional treatments include small molecule drugs, antibodies, antibody fragments, and The HBV RNAi agent may be administered in combination with one or more additional therapeutic agents, and / or a vaccine. and combining with one or more excipients to form a pharmaceutical composition. It is possible.

[0226] In some embodiments, the described HBV RNAi agent(s) are desirably and / or in combination with one or more additional therapies, where the additional therapies are nucleoside inhibitors. In some embodiments, the HBV inhibitor is an HBV inhibitor. The RNAi agent(s) are optionally combined with one or more additional treatments, Additional treatments include entecavir, tenofovir, tenofovir alafenamide, and tenofovir disodium. Proxil, lamivudine, or other antiviral treatment. In some embodiments, the nucleoside inhibitor is entecavir or tenofovir. In some embodiments, entecavir is administered in an amount of 0.5 to 1 mg daily. In this study, tenofovir is administered in an amount of 300 mg once daily.

[0227] In some embodiments, the described HBV RNAi agent(s) are desirably and combination with one or more additional therapies, such as interferon In some embodiments, the HBV RNAi agent(s) described are Optionally, it may be combined with one or more additional treatments, which additional treatments may include interferon. In some embodiments, the HBV RNAi agent (s) described herein are The HBV treatment may be combined with one or more additional HBV treatments, if desired. The treatment is the HBV vaccine.

[0228] In some embodiments, the described HBV RNAi agent(s) are desirably and / or one or more additional therapies in a single dosage form (i.e., In some embodiments, the HBV R The NAi agent(s) can be administered separately from one or more optional additional therapies. In some embodiments, the described HBV RNAi agent(s) are administered subcutaneously. administered to a subject in need thereof via intravenous injection, and one or more optional follow-up Additional treatments are administered orally and together, they are used to treat diseases and conditions associated with HBV infection. In some embodiments, the HBV RNase inhibitors described herein are administered orally. The Ai drug(s) are administered to a subject in need thereof via subcutaneous injection, and One or more optional additional treatments are administered via separate subcutaneous injections.

[0229] In some embodiments, disclosed herein are methods for administering an HBV RNAi agent in A composition for delivery to hepatocytes in vivo, the composition comprising a targeting group conjugated to the targeting group. In some embodiments, this target comprises a gated or linked HBV RNAi agent. The targeting group is an asialoglycoprotein receptor ligand. In some embodiments, H A composition for delivering BV RNAi agents to hepatocytes in vivo is described, The composition comprises an HBV RNAi drug linked to an N-acetyl-galactosamine targeting ligand. Includes.

[0230] In some embodiments, one or more of the described HBV RNAi agents: It is administered to a mammal in a pharmaceutically acceptable carrier or diluent. And this mammal is a human.

[0231] The use of Hepatitis B virus RNAi drug(s) may improve the treatment of diseases / disorders associated with HBV infection. Methods for therapeutic and / or prophylactic treatment are provided. Ai drugs mediate RNA interference to inhibit one of the genes required for hepatitis B virus replication and / or pathogenesis. In particular, for example, HBV RNAi agents inhibit the expression of a gene or genes in cells, tissues, or or in mammals, viral polymerase, core protein, surface antigen, e antigen, and HBV RNAi agents can inhibit the expression of the HBV protein and / or the X protein. HBV RNAi drugs can also be used to treat chronic liver disease / injury associated with HBV infection, They can be used to treat or prevent inflammation, fibrotic conditions, and proliferative disorders (such as cancer). In some embodiments, the method further comprises detecting hepatitis D virus (HDV) in the subject. Such methods include the treatment of HBV in humans or animals infected with HBV. The method further comprises administering an HBV RNAi agent to hepatocytes in vivo. Compositions for delivery in vo are described.

[0232] In another aspect, described herein are methods for treating diseases / disorders associated with HBV infection. for therapeutic and / or prophylactic treatment or inhibition of expression of one or more HBV genes The method comprises administering a pharmaceutical composition, the pharmaceutical composition being administered topically. administration in multiple ways depending on whether local or systemic treatment is desired; The administration may be by intravenous administration, intra-arterial administration, or Subcutaneous administration, intraperitoneal administration, subdermal administration (e.g., via an implanted device), In some embodiments, the administration may be, but is not limited to, intraparenchymal administration. The pharmaceutical compositions described herein are administered by subcutaneous injection.

[0233] The described HBV RNAi agents and / or compositions are useful for the therapeutic treatment of HBV infection, or and the like. Such methods include administering an HBV RNAi agent described herein to a subject (e.g., a human or Examples include administering the compound to an animal subject.

[0234] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to , refers to a polymer of linked nucleosides, each of which may be independently modified or unmodified. could be.

[0235] As used herein, an "RNAi agent" or "RNAi trigger" refers to a sequence-specific and a method for delaying or inhibiting translation of a target messenger RNA (mRNA) transcript. RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can As used herein, an RNAi agent refers to a composition comprising an RNA interference mechanism. mechanism (i.e., the RNA interference pathway machinery in mammalian cells (RNA-induced silencing complex) RISC) (which causes RNA interference by interacting with the RISC) or by any surrogate. RNAi drugs may act by alternative mechanism(s) or pathway(s). The term "antigens," as used herein, refers to genes that are believed to act primarily via an RNA interference mechanism. However, the RNAi agents of the present disclosure are not constrained by any particular pathway or mechanism of action. The RNAi disclosed herein is not intended to be, and is not limited to, the following. The drugs contain sense and antisense strands, including short interfering RNA (siRNA), double stranded stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA) A), and Dicer substrates. The antisense strand of a drug is at least partially complementary to the target mRNA. Ai drugs contain modified nucleotides and / or one or more non-phosphodiester linkages. It can be seen.

[0236] As used herein, the terms "silence," "reduction," "reduced," "reduced" and "reduced" refer to the expression of a given gene. ", "inhibition," "downregulation," or "knockdown" means the reduction or elimination of the expression of the gene. The expression level of RNA transcribed from a gene, or the cells in which the gene is transcribed, Polypeptides, proteins, and other proteins translated from mRNA in a cell population, tissue, organ, or subject. The cell, cell population, or tissue is a tissue, organ, or subject is treated with an oligomeric compound, such as an RNAi agent, described herein. When administered, a second cell, group of cells, tissue, organ, or subject that has not been so treated This means that it is reduced compared to

[0237] As used herein, the term "sequence" or "nucleotide sequence" refers to a nucleic acid or It refers to a sequence or order of nucleotides, written as a sequence of...

Claims

1. A pharmaceutical composition for use in treating an infection caused by hepatitis B virus in a human subject, said use comprising administering said pharmaceutical composition to said human subject, said pharmaceutical composition comprising: (a) a first RNAi agent comprising a sense strand having the structure (NAG37)s-(invAb)sguggacuuCfUfCfucaauuuuucus(invAb) (SEQ ID NO: 252), and an antisense strand having the structure asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); (b) a second RNAi agent comprising a sense strand having the structure (NAG37)s-(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 262) and an antisense strand having the structure usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140); and Including, the first and second RNAi agents are administered in a combined amount of about 50-200 mg, administered about 28 days apart; where (NAG37)s has the following structure: 【Chemistry 1】 and NAG is N-acetyl-galactosamine; a, g, c, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; s is a phosphorothioate internucleoside linkage; (invAb) is an inverted (3'-3' linked) abasic deoxyribonucleotide,

2. A pharmaceutical composition for use as described in claim 1, wherein the first RNAi drug and the second RNAi drug are each in a salt form.

3. the first RNAi agent and the second RNAi agent are each in a sodium salt form; the first RNAi agent has the structure: 【Chemistry 2】 and the second RNAi agent has the structure: 【Transformation 3】 3. The pharmaceutical composition for use according to claim 2, comprising:

4. A pharmaceutical composition for use according to any one of claims 1 to 3, wherein the ratio of the first RNAi agent to the second RNAi agent is approximately 2:

1.

5. A pharmaceutical composition for use according to any one of claims 1 to 3, wherein the first RNAi agent is administered in an amount of about 35 mg and the second RNAi agent is administered in an amount of about 17 mg for a combined dose of about 50 mg.

6. A pharmaceutical composition for use according to any one of claims 1 to 3, wherein the first RNAi agent is administered in an amount of about 133 mg and the second RNAi agent is administered in an amount of about 67 mg for a combined dose of about 200 mg.

7. A pharmaceutical composition for use according to any one of claims 1 to 6, wherein the first and second RNAi agents are administered at intervals of 28 days.

8. A pharmaceutical composition for use according to any one of claims 1 to 7, wherein the first and second RNAi agents are administered over a period of at least about 18 weeks.

9. A pharmaceutical composition for use according to any one of claims 1 to 8, wherein the first and second RNAi agents are administered over a period of at least about six months.

10. A pharmaceutical composition for use according to any one of claims 1 to 9, wherein the pharmaceutical composition is administered via subcutaneous injection.

11. The pharmaceutical composition of claim 10, which is a sterile injectable solution.

12. The composition of claim 10, which is a sterile powder for the preparation of a sterile injectable solution.

13. The composition of claim 11 or claim 12 packaged in a pre-filled syringe or vial.

14. A pharmaceutical composition for use according to any one of claims 1 to 13, wherein said use further comprises administering to said subject a second active agent.

15. The pharmaceutical composition of claim 14, wherein the second active agent is a nucleoside analog, and optionally, the nucleoside analog is entecavir or tenofovir.

16. A pharmaceutical composition for use according to any one of claims 1 to 15, wherein the level of HBsAg, HBeAg, or serum HBV DNA in the human subject is reduced by at least 40% after administration of the composition.

17. A pharmaceutical composition for use according to any one of claims 1 to 16, wherein the HBV infection is a chronic HBV infection.

Citation Information

Patent Citations

  • JPP7585214B

  • RNAi AGENTS FOR HEPATITIS B VIRUS INFECTION

    WO2018027106A2