Hydrogels for stimulating nerve regeneration, osteogenesis, and angiogenesis

Abstract

The present invention relates to hydrogels useful for promoting nerve regeneration, osteogenesis, and angiogenesis.

Description

[Technical Field]

[0001] The present invention relates to hydrogels useful for promoting nerve regeneration, osteogenesis, and angiogenesis. [Background technology]

[0002] Even today, the peripheral nervous system has received little consideration in the field of regenerative medicine and tissue engineering in relation to bone tissue regeneration. However, biological, experimental, and clinical data indicate an interplay between the key events of bone remodeling, namely bone vascularization, bone innervation, and new bone formation.

[0003] Recent biological data obtained by our team (Silva et al., Cell Death and Disease, 2017 December, 13;8(12):3209) demonstrated, in a two-dimensional co-culture model of sensory neurons and mesenchymal cells, the influence of communication between these two cell types on bone formation. However, currently no three-dimensional materials or matrices exist that would allow us to put these observations into practical use, both experimentally and therapeutically, with a view to developing new innovative materials specifically for bone regeneration.

[0004] In this context, the inventors have developed novel hydrogels that are able to recruit neurons, particularly sensory neurons, and accommodate other cell types, more particularly osteogenic and endothelial cells. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] WO2017021334 [Non-patent literature]

[0006] [Non-Patent Document 1] Silva et al., Cell Death and Disease, December 2017, 13;8(12):3209 [Non-patent document 2] Petitdemange et al., Biomacromolecules, February 2017, 13;18(2):544-550 [Non-patent document 3] Petitdemange et al., Bioconjug Chem., May 2017, 17;28(5):1403-1412 [Non-patent document 4] Gilbert et al., J Biomed Mater Res 1990, 24, 1221 [Non-patent document 5] Wang et al., Biochim Biophys Acta 1978, pp. 544, 555. [Non-patent document 6] Malin et al., Nat Protoc, 2007, 2, 152 [Non-Patent Document 7] O'Brien et al., Eur J Biochem, 2000, 267, 5421 Summary of the Invention [Means for solving the problem]

[0007] A first aspect of the present invention is i) an elastin-like polypeptide comprising at least one alkenylated residue, and ii) peptides capable of recruiting neurons and / or endothelial cells, in particular the IKVAV peptide The present invention relates to a hydrogel comprising:

[0008] According to one particular embodiment, the hydrogel according to the invention comprises: i) elastin-like polypeptides containing at least one alkenylated residue, in particular an alkenylated methionine; ii) peptides capable of recruiting neuronal and / or endothelial cells, in particular the IKVAV peptide, and iii) cross-linked polymers, especially cross-linked polymers with thiol end groups Includes.

[0009] According to one particular embodiment, the elastin-like polypeptide is a polypeptide comprising at least one occurrence of the sequence VPGMG. In a non-limiting example, the elastin-like peptide is, in particular, MGTELAAASEFTHMW[VPGMG] 20 (ELP20), MW[VPGVGVPGMG(VPGVG)2]5 (ELPM20) or MW[VPGVGVPGMG(VPGVG)2] 10 (ELPM40) polypeptide.

[0010] According to one particular embodiment, the peptide is an IKVAV peptide, in particular an IKVAV peptide of the formula Cys-{β-Ala}-Ile-Lys-Val-Ala-Val-{β-Ala}-Cys.

[0011] In another variant, the crosslinked polymer, particularly a crosslinked polymer with thiol end groups, is a multi-arm polymer. More specifically, the crosslinked polymer may be a four-arm poly(ethylene glycol), particularly a four-arm poly(ethylene glycol) with thiol end groups, particularly a four-arm poly(ethylene glycol) PEG having an average molecular weight between 10 and 30 kDa, more particularly a four-arm PEG containing four arms with thiol end groups having an average molecular weight between 10 and 30 kDa. The four-arm poly(ethylene glycol), particularly a four-arm poly(ethylene glycol) with thiol end groups, may have an average molecular weight of 20 kDa. In the context of the present invention, average molecular weight refers to mass molecular weight.

[0012] In one particular embodiment, the crosslinked polymer having thiol end groups, the elastin-like polypeptide comprising alkenylated methionine residues, and the IKVAV peptide are present in the hydrogel in an equimolar thiol / alkene ratio.

[0013] According to another particular embodiment, the concentration of the hydrogel is between 5 and 15% by density (w / v), in particular between 7 and 8% (w / v).

[0014] In another embodiment, the storage modulus G' of the hydrogel is between 1 and 5, preferably between 1 and 1.5 kPa.

[0015] The hydrogel according to the invention may also comprise at least one biologically active agent, in particular at least one growth factor.

[0016] Another aspect of the present invention relates to a hydrogel as described in the present application for use as a medicament.

[0017] According to another aspect, the present invention relates to a hydrogel as described herein for use in a method for bone regeneration.

[0018] Furthermore, the present invention also relates to an in vitro cell culture method comprising culturing cells in a hydrogel as defined in the present application. [Brief explanation of the drawings]

[0019] [Figure 1] A) Schematic of the hydrogel components and preparation method, B) Photograph showing the ELPM40+PEG hydrogel. Bar = 1 mm. [Figure 2] Figure 1 shows the rheological properties of ELPM40+PEG hydrogels at various final concentrations at 37° C. The elastic modulus (G') for each concentration is shown in the figure. [Figure 3] Scanning electron microscopy images showing the pore structure of hydrogels: (A) ELPM40+PEG, (B) ELPM40+25%IKVAV, (C) ELPM40+25%VKAIV, (D) ELPM40+50%IKVAV, and (E) ELPM40+50%VKAIV. F) Pore size quantification: The 25% adhesive peptide composition has smaller pores than the other compositions. [Figure 4] FIG. 10. In vitro analysis of hydrogel degradation by quantification of free amines in solution after 7 hours of incubation with proteinase K (0.5 U / mL). [Figure 5]Figure 1 shows the metabolic activity of endothelial cells (EC), bone marrow mesenchymal stromal cells (BMSC), and sensory neurons (SN). All hydrogel compositions allowed the attachment and culture of the three cell types. [Figure 6] Endothelial cell morphology at 7 days after culture in (A) ELPM40 + PEG, (B) ELPM40 + 25% IKVAV, (C) ELPM40 + 25% VKAIV, (D) ELPM40 + 50% IKVAV, and (E) ELPM40 + 50% VKAIV. In all compositions, cells were able to invade and migrate into the hydrogel and form various structures. [Figure 7] Figure 1 shows BMSCs associated with (A) ELPM40 + PEG, (B) ELPM40 + 25% IKVAV, (C) ELPM40 + 25% VKAIV, (D) ELPM40 + 50% IKVAV, and (E) ELPM40 + 50% VKAIV hydrogels. Cells exhibit spheroid morphology in all hydrogel compositions. (F) Detail of a cell immersed in an ELPM40 + 50% IKVAV hydrogel shows two connected nuclei (indicated by white arrows), suggesting that the cells can proliferate within the gel. [Figure 8] Morphology and spreading of sensory neurons cultured in (A) ELPM40 + PEG, (B) ELPM40 + 25% IKVAV, (C) ELPM40 + 25% VKAIV, (D) ELPM40 + 50% IKVAV, and (E) ELPM40 + 50% VKAIV. Bars are 100 μm. (F) Average neurite length measured for all hydrogel compositions. [Figure 9] 1 shows gene expression in BMSCs cultured for 7 days in osteogenic medium in combination with various hydrogels. Expression is shown relative to the ELPM40+PEG composition used as a control. [Figure 10] FIG. 1 shows Tek gene expression after 7 days of culturing endothelial cells in ELPM40+PEG, ELPM40+25% IKVAV, ELPM40+25% VKAIV, ELPM40+50% IKVAV, and ELPM40+50% VKAIV compositions. [Figure 11]Subcutaneous evaluation of ELPM40 + 50% IKVAV and ELPM40 + 50% VKAIV compositions after 11 and 26 days. (A) Histological sections were analyzed to determine i) inflammatory potential (HE), ii) the ability to induce angiogenesis (CD31 immunohistochemistry), and iii) innervation (tubulin βIII immunohistochemistry (β3T)). Bar = 50 μm for HE and CD31. Magnification of CD31 and β3T staining is shown; bar = 20 μm. (B) Quantification of blood vessels formed around the implanted area of ​​ELPM40 + 50% IKVAV and ELPM40 + 50% VKAIV compositions. DETAILED DESCRIPTION OF THE INVENTION

[0020] The present invention relates to a biocompatible hydrogel capable of promoting nerve regeneration, osteogenesis, and angiogenesis. The hydrogel is characterized by comprising an elastin-like polypeptide containing at least one alkenylated methionine residue and a peptide capable of recruiting nerve cells and / or endothelial cells, particularly the IKVAV peptide. More specifically, the hydrogel according to the present invention is characterized by comprising i) an elastin-like polypeptide containing at least one alkenylated methionine residue, ii) a peptide capable of recruiting nerve cells and / or endothelial cells, particularly the IKVAV peptide, and iii) a crosslinked polymer, particularly a crosslinked polymer with a thiol terminal group.

[0021] The hydrogels according to the present invention can be formed, in particular, using crosslinked polymers with thiol end groups. In the context of the present invention, the term "crosslinked polymer with thiol end groups" is intended to mean a polymer that has at least one free SH thiol function before forming the hydrogel, i.e., before contacting with elastin-like peptides. According to a particular embodiment, if the thiol / alkene ratio is equimolar or if the thiol / alkene ratio is greater than 1 (more thiols than alkenes), the polymer with thiol end groups in the hydrogel no longer has free SH thiol functions after reaction with ELP. According to another embodiment, if the thiol / alkene ratio is less than 1 (a lack of thiols or an excess of alkenes), the polymer with thiol end groups in the hydrogel can have free SH thiol functions after reaction with ELP. The polymer is selected from polymers that allow the formation of biocompatible hydrogels, in the sense that they are not toxic to cells. They also advantageously allow the diffusion of oxygen and nutrients, carbon dioxide, and metabolic waste products to nourish and sustain cell survival. The polymers of the hydrogel solution may be of natural origin, such as extracellular matrix proteins, or of synthetic origin, such as poly(ethylene glycol) (PEG), poly(oxazoline) (POx), or poly(sarcosine) (PSar). According to one embodiment, the crosslinked polymer is more particularly a multi-armed polymer, in particular a linear polymer or a multi-armed polymer having at least three arms, more particularly at least four arms, said multi-armed linear polymer comprising a thiol group at each of its termini. Thus, the crosslinked polymer may more particularly be a multi-armed polymer, in particular a linear polymer or a multi-armed polymer having at least three arms, more particularly at least four arms, said multi-armed linear polymer comprising a thiol group at each of its termini. According to one particular embodiment, the multi-armed polymer is a four-armed polymer, in particular comprising a thiol group at the terminus of each of its arms. In particular, it may be linear or have three or four arms, or more than four arms, more particularly four. In one embodiment, the use may be made of a poly(ethylene glycol) (or PEG) type polymer containing three or four arms. According to one embodiment, the use is made of a poly(ethylene glycol) (or PEG) type polymer that is linear or contains three or four arms, or more than four arms, more particularly four arms, wherein each end of the linear PEG contains a thiol group, or each arm of the multi-arm PEG contains a thiol group at its end. In one embodiment, the hydrogel comprises a four-arm PEG containing a thiol group at its end, the average molecular weight of said PEG being between 1 and 100 kDa, more particularly between 10 and 30 kDa, and even more particularly, the PEG having an average molecular weight of 20 kDa.

[0022] The second component of the hydrogel according to the present invention is an elastin-like polypeptide (ELP) containing at least one alkenylated methionine residue. Polypeptides of this type, methods for their production by genetic engineering, and their purification are known to those skilled in the art, who may refer in particular to International Application WO2017021334 and Petitdemange et al. (Biomacromolecules, February 2017, 13;18(2):544-550) and Petitdemange et al. (Bioconjug Chem., May 2017, 17;28(5):1403-1412). In the context of the present invention, the term "alkenylated methionine residue" means that the side chain of the methionine residue is covalently bound to a group containing an alkene group, i.e., a group containing at least one double bond between two carbon atoms. Preferably, the term "alkene group" denotes the presence of a -CH=CH group in the group attached to the methionine residue. According to one particular embodiment, the methionine group has formula (I):

[0023] [ka]

[0024] is bonded to the group

[0025] According to one embodiment, the synthesis of alkenylated ELPs with groups of formula (I) can be carried out by chemoselective thioalkylation at the methionine side chain using allyl glycidyl ether according to the procedure described by Petitdemange et al. (Bioconjug Chem., May 2017, 17;28(5):1403-1412).

[0026] According to one embodiment, an alkenylated ELP as used in the context of the present invention comprises at least one occurrence of the amino acid sequence VPGMG in which the methionine residue is alkenylated.

[0027] In one embodiment, the alkenylated ELP has formula (II): Z-[VPGXG] n -OH (II) wherein: Z is a peptide containing 1 to 20 amino acids; X is a glycine residue, a valine residue or an alkenylated methionine residue, particularly of formula (III):

[0028] [ka]

[0029] represents an alkenylated methionine residue of n is an integer between 1 and 200, more particularly between 10 and 200, even more particularly between 15 and 50, and especially between 20 and 40; and The molar ratio of valine / alkenylated methionine at position X is between 0:1 and 10:1, more particularly between 1:1 and 5:1, and more particularly said molar ratio is 3:1.

[0030] According to one embodiment, X represents a glycine residue or an alkenylated methionine residue, in particular an alkenylated methionine residue of formula (III).

[0031] According to another preferred embodiment, X represents a valine residue or an alkenylated methionine residue, in particular an alkenylated methionine residue of formula (III).

[0032] According to one embodiment, n is an integer comprised between 30 and 50, in particular between 35 and 45, and more particularly n is equal to 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45. More particularly, n is equal to 40.

[0033] According to one particular embodiment, Z is a peptide whose amino terminal amino acid residue is methionine.

[0034] According to one particular embodiment, Z does not comprise the amino acid sequence IKVAV.

[0035] According to another embodiment, [VPGXG] n The amino acids contained in Z immediately upstream of the unit correspond to the MW dipeptide. Z can specifically consist of or comprise the MW dipeptide. For illustration, the ELP20 peptide described below contains the sequence Z in which the MW dipeptide is C-terminal to the sequence MGTELAAASEFTHMW.

[0036] According to one embodiment, the ELP used has the formula Z-[VPGXG] n wherein X is an alkenylated methionine.

[0037] According to another embodiment, the ELP used has the formula Z-[VPGXG] n wherein the molar ratio of valine / alkenylated methionine in position X is between 0:1 and 10:1, more particularly between 1:1 and 5:1, said molar ratio being more particularly 3:1.

[0038] According to another embodiment, the ELP used has the formula Z-[VPGVGVPGMG(VPGVG)] x , especially MW[VPGVGVPGMG(VPGVG)2] xwherein x is an integer comprised between 2 and 15, more particularly between 5 and 10.

[0039] According to one embodiment, the ELP used is the peptide MGTELAAASEFTHMW[VPGMG] described in WO2017021334. 20 (ELP20), peptide MW[VPGVGVPGMG(VPGVG)2]5 (ELPM20), or peptide MW[VPGVGVPGMG(VPGVG)2] 10 (ELPM40), wherein said peptide comprises at least one alkenylated methionine residue.

[0040] According to one embodiment, the ELP has the following structure:

[0041] [ka]

[0042] and More specifically, the structure MW[VPGVGVPGM a G(VPGVG)2] 10 (ELP-M(alkene)-40), wherein M a represents the alkenylated methionine residue of formula (III) above.

[0043] According to one variant embodiment of all the above ELPs, the amino-terminal methionine of said ELP is an alkenylated methionine, in particular an alkenylated methionine of formula (III) above. By way of example, the ELP may in particular have the following structure:

[0044] [ka]

[0045] It can have:

[0046] In one embodiment, the structure has the following formula:

[0047] [ka]

[0048] can alternatively be expressed according to

[0049] Component iii) of the hydrogel is a peptide capable of recruiting neurons and / or endothelial cells. Examples of peptides capable of recruiting endothelial cells include, in particular, the fibronectin-derived peptides REDV, RGD, and GRGDSP, the laminin-derived peptides IKLLI, IKVAV, PDSGR, and YIGSR, and the collagen type I-derived peptide DGEA. Examples of peptides capable of recruiting neurons include, in particular, the laminin-derived peptides YIGSR, RNIAEIIKDI, and IKVAV. According to a particular embodiment, the peptide capable of recruiting neurons and / or endothelial cells is the IKVAV peptide, i.e., a peptide comprising the amino acid sequence IKVAV derived from laminin A. In a particular embodiment, the peptide capable of recruiting neurons and / or endothelial cells contained in the hydrogel of the present invention is a peptide, in particular a peptide comprising the sequence IKVAV, which comprises a cysteine ​​residue at each end. The cysteine ​​residues can be directly covalently bound to the amino acid sequence IKVAV or can be attached via a spacer. According to a particular embodiment, the cysteine ​​residue is linked to a peptide capable of recruiting neuronal and / or endothelial cells, in particular an IKVAV peptide, via a spacer, in particular a peptide spacer or pseudopeptide spacer. The spacer may in particular be an amino acid or an amino acid sequence (in particular a dipeptide or tripeptide), in particular a β-amino acid, more particularly a β-Ala amino acid. Thus, according to a particular embodiment, the peptide capable of recruiting neuronal and / or endothelial cells is an IKVAV peptide of the formula Cys-{spacer}-Ile-Lys-Val-Ala-Val-{spacer}-Cys, in particular a peptide of the formula Cys-{β-Ala}-Ile-Lys-Val-Ala-Val-{β-Ala}-Cys.

[0050] The amount of the components of the hydrogel can vary widely, provided that the resulting hydrogel promotes nerve regeneration, bone formation and / or angiogenesis. According to a particular embodiment, the various components are present in amounts that take into account a thiol / alkene molar ratio between 10:1 and 1:10, particularly between 5:1 and 1:5, and particularly between 2:1 and 1:2. According to a particular embodiment, the thiol / alkene ratio is equimolar (i.e., corresponding to a molar ratio of 1:1). It should be understood that the thiol groups are present on the cross-linked polymer and / or on a peptide that can mobilize nerve cells and / or endothelial cells, particularly the IKVAV peptide as described above. Thus, the hydrogel can contain variable amounts of its components while taking into account the ratios defined above. For example, the thiol groups carried by the IKVAV peptide can be between 10 and 75 mol%, more particularly between 20 and 60 mol%, and particularly between 25 and 50 mol% of the total thiol groups provided by the IKVAV peptide and the cross-linked polymer. According to a particular embodiment, the thiol groups carried by the IKVAV peptide represent 25 mol% of the total thiol groups provided by the IKVAV peptide and the cross-linked polymer. According to another particular embodiment, the thiol groups carried by the IKVAV peptide represent 50 mol% of the total thiol groups provided by the IKVAV peptide and the cross-linked polymer.

[0051] The proportion of the components of the hydrogel is also selected so as to obtain a hydrogel having rheological properties suitable for the development of cells, particularly nerve cells, bone cells or endothelial cells, particularly nerve cells. Thus, according to the present invention, the structure of the hydrogel can be very finely adjusted to the type of cells whose development has to be promoted. According to one embodiment, the stiffness of the hydrogel corresponds to a storage modulus G' parameter included in the following range: 1 kPa < G' < 5 kPa, particularly 1 kPa < G' < 1.5 kPa.

[0052] According to another particular embodiment, the concentration of the hydrogel is between about 5 and about 15% by density (w / v), in particular between about 7 and about 8% (w / v), this density being more particularly equal to about 7.5% (w / v).

[0053] Furthermore, the hydrogels according to the invention may be microporous and may in particular comprise pores with an average size ranging between 5 and 20 μm, more particularly between 10 and 17 μm.

[0054] According to a particular embodiment, the hydrogel of the present invention may contain one or more other elements, other peptide sequences for targeting other functions, or bioactive agents such as growth factors, particularly for further stimulating nerve regeneration, osteogenesis, and / or angiogenesis. However, according to a particular embodiment, the hydrogel lacks growth factors or contains only 0-10% by weight of growth factors relative to the total weight of the hydrogel, more particularly 0-5% by weight, even more particularly 0-1% by weight, and particularly 0-0.1% by weight relative to the weight of the hydrogel. As will be seen below, hydrogels can also be used as carriers for cell therapy. Thus, hydrogels as defined above can also contain cells of therapeutic interest, such as stem cells, particularly stem cells induced toward a desired lineage, hematopoietic stem cells, mesenchymal stromal stem cells derived from bone marrow or adipose tissue, neural stem cells, or a mixture of cells of different lineages to stimulate cell communication processes. In a particular embodiment, the cells are stem cells, excluding human embryonic stem cells. Cells are introduced into the hydrogel after formation of the hydrogel, and the cells are allowed to colonize the hydrogel by contacting the hydrogel and culturing the cells for a sufficient period of time (particularly, at least 1, 2, 3, 4, 5, 6, or at least 7 days).

[0055] The hydrogels according to the invention can also contain mineral components, in particular hydroxyapatite or calcium phosphate nanoparticles (especially in amounts between 10 and 40% (w / v)), in order to increase the osteogenic potential of the hydrogel.

[0056] The hydrogels of the present invention can be produced by mixing these various components i) to iii) with any other elements, such as growth factors. The components i) to iii) and their amounts are selected to prepare a hydrogel with physical and support properties suited to the problem addressed by the user. Advantageously, the formation of the hydrogel by crosslinking is carried out under the influence of a stimulus, such as a change in temperature or pH, or by using a crosslinking agent, particularly a photosensitive crosslinking agent (or photoinitiator). By way of illustration, mention may be made of the induction of photopolymerization by a photoinitiator, such as the Irgacure 2959 compound, used in a concentration of 0.5% (w / v) in the mixture and activated by ultraviolet-visible light (λ = 305 to 405 nm, particularly 305 nm). In another variant, the photoinitiator can be selected, in particular, from lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) and riboflavin. The LAP concentration ranges from 0.005% to 0.5% (w / v) in the mixture, and its photoinitiation can be triggered at wavelengths between 365 and 475 nm.

[0057] According to one aspect, the present invention provides a method for producing a fluororesin comprising the steps of: (a) i) an elastin-like polypeptide comprising at least one alkenylated methionine residue; and ii) peptides capable of recruiting neuronal and / or endothelial cells, in particular the IKVAV peptide, and Optionally, (iii) a crosslinked polymer having thiol end groups; and iv) a polymerization initiator, especially a photoinitiator (and optionally other components such as one or more growth factors); mixing the b) applying a stimulus, in particular light irradiation, in particular ultraviolet irradiation, to activate the polymerization The present invention relates to a hydrogel obtainable or obtained by a process comprising:

[0058] Advantageously, as shown above, the rheological properties of the hydrogel can be very precisely defined. Furthermore, the inventors have been able to show that the hydrogel described in the present invention is degradable and has a porous structure. Finally, the inventors have been able to demonstrate that this hydrogel is suitable for culturing very different cell types, namely neurons, mesenchymal cells, bone cells, endothelial cells, or their progenitor cells, that these cells can migrate within the hydrogel structure, and that it does not have cytotoxic effects. Thus, it combines all the advantageous properties useful for the development of tools suitable for tissue regeneration.

[0059] Thus, the hydrogels described in the present invention can effectively support the in vitro culture of various cell types. Consequently, according to a particular embodiment, the present invention relates to a novel three-dimensional support capable of accommodating various cells in vitro, in particular neural, osteocyte, or endothelial cells, for the purpose of bone regeneration. The present invention therefore provides those skilled in the art with a particularly advantageous three-dimensional cell culture system that not only allows cells to grow in a favorable environment, but also allows the interaction of various cell types with each other to be studied. This parameter is important for studying regenerative phenomena that may require complex interactions between various cell types. The support of the present invention can be used in particular to accommodate osteogenic and endothelial cells and to study angiogenesis, osteogenesis, and neuroregenerative effects in in vitro cell culture methods that involve culturing cells in the support as defined above. The use of the support according to the present invention can further include the addition of agents to the culture, such as growth factors or any other agents that have or may have a biological effect (candidate agents), in order to determine their effect on one or more parameters and cellular responses, such as cell growth, induction of quiescence, induction of cell death, induction of protein secretion or induction of other molecules, induction of ions (in particular calcium ions, potassium ions), or expression of specific genes.

[0060] According to another aspect, the hydrogels of the present invention are used in therapeutic methods, in particular as implants. The hydrogels are particularly used in therapeutic methods in regenerative medicine. In particular, they can be used to stimulate the innervation of tissues, in particular bone tissue, and in particular in bone engineering. Advantageously, the hydrogels according to the present invention promote nerve regeneration, especially in regenerative situations. More particularly, the hydrogels according to the present invention can be advantageously used to promote the recruitment and stimulation of the sensory nervous system, more particularly bone regeneration. The hydrogels according to the present invention can also be used to optimize or restore the vascularization and innervation of tissues.

[0061] According to another embodiment, the hydrogel can be used as a carrier for cell therapy. Thus, the hydrogel as defined above is pre-colonized with cells of therapeutic interest, such as stem cells, in particular stem cells induced to a desired lineage, hematopoietic stem cells, mesenchymal stromal stem cells from bone marrow or adipose tissue, neural stem cells, or a mixture of cells of different lineages. Such hydrogels can be used in therapeutic methods based on cell or tissue regeneration.

[0062] The hydrogels according to the present invention may also be used to modify implant systems, improving their biocompatibility and their integration. [Example]

[0063] Preparation of ELP-M(alkene)-40 peptide Petitdemange et al. (Biomacromolecules, February 2017, 13;18(2):544-550, doi:10.1021 / acs.biomac.6b01696. Epub 2017 Jan 27. PubMed PMID:28075561) reported that MX[VPGVGVPGMG(VPGVG)2] 10 The construction of an expression vector for the peptide (ELPM40), its expression in Escherichia coli (E. coli), isolation from bacterial lysate, purification, and characterization are described.

[0064] Chemoselective thioalkylation of the methionine side chain of the ELPM40 peptide with allyl glycidyl ether

[0065] [ka]

[0066] A method for producing the ELP-M(alkene)-40 peptide having the structure shown above is described by Petitdemange et al. (Bioconjug Chem., May 2017, 17;28(5):1403-1412, doi:10.1021 / acs.bioconjchem.7b00082. Epub 2017 Apr 18. PubMed PMID: 28381088).

[0067] In the remainder of the experimental section, the term ELPM40 will be used to refer to the ELP-M(alkene)-40 peptide.

[0068] Development of composite hydrogels Hydrogel fabrication The hydrogels prepared contained the ELPM40 peptide, thiol-terminated PEG (SH-PEG, 20 kDa, JenKem, USA), and the Cys-{β-Ala}-Ile-Lys-Val-Ala-Val-{β-Ala}-Cys (IKVAV) adhesion peptide or its randomized version, Cys-{β-Ala}-Val-Lys-Ala-Ile-Val-{β-Ala}-Cys (VKAIV), in an equimolar thiol / alkene ratio. Photopolymerization was performed using Irgacure 2959 photoinitiator (0.5% w / v) with 305 nm UV light for 8 minutes to induce a thiol-ene reaction. A schematic diagram of the resulting hydrogel is shown in Figure 1.

[0069] Various mass ratios of ELP to PEG were tested to obtain optimal stiffness, sensory neuron attachment, and neurite outgrowth. Briefly, SH-PEG was substituted with various adhesive peptides. The compositions tested were as follows: (i) ELPM40 + PEG, 100% (mol) of the thiol groups are represented by SH-PEG; (ii) ELPM40 + 25% IKVAV or VKAIV, in which 25% (mol) of the thiol groups are represented by adhesive peptides; (iii) ELPM40+50%IKVAV or VKAIV, where 50% (mol) of the thiol groups are represented by the adhesive peptide.

[0070] Rheological properties The rheological properties of the hydrogels were evaluated by measuring the frequency dependence of the elastic modulus (G') and loss modulus (G'') after immersion in PBS for 24 hours. Frequency sweeps were performed at various hydrogel concentrations of ELPM40 + PEG compositions: 5%, 7.5%, 10%, and 15% (w / v). Measurements were performed at 37°C.

[0071] It could be shown that the modulus increased proportionally with the final concentration of the hydrogel (Figure 2).

[0072] Structural analysis using a scanning electron microscope Scanning electron microscopy analysis was performed to determine the pore size of the hydrogels prepared at different concentrations and to visualize their structure.

[0073] All hydrogel compositions had a fine pore structure (Figure 3A-3E), with pore sizes ranging from 10.49 ± 1.61 µm (ELPM40 + 25% IKVAV) to 16.39 ± 2.81 µm (ELPM40 + 50% IKVAV). The hydrogel composition containing 25% adhesive peptide had smaller pore sizes compared to the compositions obtained with the other conditions (Figure 3F).

[0074] In vitro degradation analysis of hydrogels Fifteen microliters of hydrogel was incubated for 7 hours at 37°C in 150 μL of proteinase K solution (0.5 U / mL) (Amresco, #0706) in 50 mM Tris base buffer containing 1 mM EDTA, 5 mM CaCl2, and 0.5% (v / v) Triton X-100 (pH 8.0). The free amine content, expressed as the number of free amine groups per 1000 amino acids (n / 1000), was determined using 2,4,6-trinitrobenzenesulfonic acid (TNBS) according to the procedure described by Gilbert et al., J Biomed Mater Res 1990, 24, 1221. The free amine content was calculated using the molar extinction coefficient of trinitrophenyllysine, 14600 L / mol / cm (Wang et al., Biochim Biophys Acta 1978, 544, 555).

[0075] After incubation with proteinase K, free primary amines in solution were detected in all hydrogel compositions (Figure 4), indicating that the crosslinking process did not interfere with in vitro degradation. This is an important characteristic for materials with biomedical applications. Various cell types must be able to enter and migrate within the hydrogel structure. The most common cell migration mechanism is the secretion of proteases that slowly digest the hydrogel structure, thereby allowing cells to colonize the hydrogel.

[0076] Biological evaluation using primary cells Cell isolation and culture Primary sensory neurons (SNs) were obtained from the dorsal root ganglia (DRGs) of 6- to 10-week-old Wistar rats according to the procedure described by Malin et al., Nat Protoc, 2007, 2, 152.

[0077] Bone marrow-derived mesenchymal stromal cells (BMSCs) were isolated from 6- to 10-week-old Wistar rats. Briefly, the femurs and tibias of the animals were removed and their ends were cut to expose the bone marrow. The bones were transferred to 1.5 mL tubes and then centrifuged at 1500 × g for 30 seconds to remove the bone marrow. The resulting pellet was resuspended in low-glucose DMEM (Gibco) supplemented with 10% (v / v) fetal bovine serum (PANTM-Biotech, Aidenbach, Germany) and 1% (v / v) penicillin / streptomycin and passed 4-6 times through 16G and 21G needles. The contents of the femurs and tibias were then collected and separated into 75 cm tubes. 2 The BMSCs were seeded into flasks and cultured in a humidified incubator (37°C, 5% CO2). The culture medium was changed twice a week to remove non-adherent cells. The adherent cells were cultured to 90% confluency and then transferred to a container with a larger surface area. These cells were used up to passage P3. When combining the BMSCs with the hydrogel, 10 -9 The cells were cultured in osteogenic medium equivalent to the medium described above supplemented with 10 mM dexamethasone (Sigma-Aldrich), 10 mM β-glycerophosphate (Sigma-Aldrich), and 50 μg / mL ascorbic acid (Sigma-Aldrich).

[0078] Bone marrow-derived endothelial stem cells (ECs) were obtained from Cell Biologics (catalog number RA-6221). Cells were cultured on gelatin-coated plates (2%) in EGM-2 MV medium (Lonza-Verviers, France) containing all kit supplements and 5% (v / v) fetal bovine serum (Gibco Life Technologies, Karlsruhe, Germany) and incubated at 37°C in a humidified atmosphere containing 5% CO2. When the cells reached 90% confluency, they were transferred onto another gelatin-coated plate (2%).

[0079] Due to their tissue engineering advantages, three cell types were studied on the hydrogels of the present invention: (i) BMSCs, which have osteoblast differentiation potential; (ii) ECs, which have a major role in angiogenesis; and (iii) sensory neurons, to demonstrate the attachment ability of neural tissue and allow neurite outgrowth in the hydrogel.

[0080] Each cell type was characterized before being cultured in the hydrogels of the present invention.

[0081] Cell metabolic activity of each cell type in the hydrogel The metabolic activity of the cells was determined using a test based on the use of resazurin (O'Brien et al., Eur J Biochem, 2000, 267, 5421). Briefly, cells were plated at 20,000 cells / cm in 96-well plates. 2 Cells were seeded at a density of 100 μL in 7.5% (w / v) hydrogel. 150 μL of cell culture medium containing resazurin (0.01 mg / mL) was added to each well, and the microplate was incubated at 37°C for 3 hours. 100 μL of the supernatant was then transferred to another 96-well microplate, and fluorescence was measured (exc = 530 nm, em = 590 nm, Victor X3, Perkin Elmer). Metabolic activity was measured on days 4 and 7 (n = 5).

[0082] Figure 5 shows the results. The hydrogels allowed the attachment and culture of the various primary cell types tested without cytotoxicity. For ECs, the ELPM40 + 25% IKVAV hydrogels induced greater metabolic activity compared to the corresponding random peptide controls. For SNs, the ELPM40 + 50% IKVAV hydrogels induced greater metabolic activity compared to the ELPM40 + PEG composition.

[0083] Other experiments also showed that hydrogels containing different ELP sequences linked to PEG did not induce an inflammatory response when implanted subcutaneously in mice.

[0084] Confocal microscopy of cell-laden hydrogels BMSC, EC and SN cells at 20,000 cells / cm 2 The cells were seeded into the hydrogel at a concentration of 0.01g and cultured for 7 days.

[0085] After incubation, SNs were fixed with 4% (w / v) formaldehyde for 30 min at 4°C, permeabilized with 0.1% (v / v) Triton X-100 for 30 min at 4°C, and blocked with 1% (w / v) BSA for 1 h. Anti-βIII tubulin primary antibody was used for cell detection. For BMSCs and ECs, actin filaments were labeled with phalloidin conjugated to Alexa Fluor 568. SN morphology was visualized using a confocal microscope (SPE, Leica Microsystems). Neurite length was quantified using the "simple neurite tracer" tool in ImageJ software. Neurite length was measured by tracing the path from the neuronal cell body to the visible terminal, and the length was then converted to μm.

[0086] After 7 days of culture, ECs invaded the hydrogel and formed stable branched structures there (Figure 6). These structures are important for the delivery of oxygen and nutrients to vascularized tissues. Branched structures were observed in the ELPM40 + 50% IKVAV hydrogel and the two compositions containing random peptides. Although the random sequence of adhesive peptides does not have the same adhesive function as the IKVAV peptide, no morphological differences were observed in the hydrogel composition containing random peptides compared to the ELPM40 + 50% IKVAV composition. This phenomenon may be due to the increased positive charge of the lysine residues.

[0087] When BMSCs were attached to the hydrogel, they grew into spheroid-like aggregates in all compositions (Figure 7). Our study showed that for the ELPM40 + 50% IKVAV composition, some BMSCs entered the hydrogel structure and formed branches. Some cells were binucleated, with a distinct connection between the two nuclei, suggesting that the cells could divide within the gel (Figure 7F).

[0088] Regarding SNs, cells behaved differently depending on the hydrogel composition (Figure 8). In ELPM40 + PEG, cells formed larger aggregates, and neurites surrounded the cell body rather than being dispersed throughout the hydrogel structure (Figure 8A). When IKVAV sequences were added to the hydrogel composition, neurites were able to spread out. In the ELPM40 + 50% IKVAV composition, cells adopted a more dispersed distribution with an extensive, branched, and complex network of neurites compared to the other compositions (Figure 8D). Measurement of neurite length confirmed this morphological observation. Indeed, SNs cultured in the ELPM40 + 50% IKVAV composition were able to form longer neurites (Figure 8F).

[0089] Importantly, the medium used in this study did not contain growth factors (especially NGF) because we wanted to analyze the specific effects of the hydrogel on neurite structure and extension. The average neurite length for the ELPM40 + 50% IKVAV composition was 266.44 ± 63.95 µm, which is comparable to that measured in other studies performed in 2D with NGF added to the medium.

[0090] Molecular analysis of bone-specific markers expressed by BMSCs in hydrogels Total RNA was extracted from BMSCs using the RNeasy® Plus Micro Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. 100 ng of total RNA from 4 wells was reverse transcribed to cDNA using the Maxima Reverse Transcriptase Kit (Thermo Scientific™, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's protocol. RT-PCR reactions were performed using the CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) and analyzed using CFX Manager™ software, version 3.0 (Bio-Rad Laboratories). The primers used are as follows (SEQ ID NOs: 1 to 12): Runx2 F: 5'CCTTCCCTCCGAGACCCTAA 3' and R: 5'ATGGCTGCTCCCTTCTGAAC 3', Sp7 F: 5'TGCTTGAGGAAGAAGCTCACTA 3' and R: 5'GGGGCTGAAAGGTCAGTGTA 3', Ctnnb1 (βcat) F: 5'GAAAATGCTTGGGTCGCCAG 3' and R: 5'CGCACTGCCATTTTAGCTCC 3', Bsp1 (Opn) F: 5'GAGTTTGGCAGCTCAGAGGA 3' and R: TCTGCTTCTGAGATGGGTCA 3', Smad1 F: 5'ATGGACACGAACATGACGAA 3' and R: 5'GCACCAGTGTTTTGGTTCCT 3', Rplp0 F: 5'CACTGGCTGAAAAGGTCAAGG 3' and 5'GTGTGAGGGGCTTAGTCGAA 3', and Tek F: 5'CCACAGATAGAGGATTTGCCAG 3' and R: 5'AAGTCATTTGGTTGGAGCACTG 3'.

[0091] Expression was quantified using threshold cycle (Ct) values. -DDCt The mRNA expression levels were calculated according to the method.

[0092] To investigate whether the hydrogel composition can support the osteogenic differentiation of BMSCs, we analyzed a group of osteogenic markers for early differentiation (Runx2 and Sp7) and late differentiation (Opn), as well as genes that trigger the osteogenic signaling pathway (Smad1 and βcat). Furthermore, we analyzed Vegfa, which induces angiogenesis, and Bmp2, which induces osteoblast differentiation, which are key factors in the bone repair process (Figure 9).

[0093] After 7 days of culture in osteogenic medium, increased expression of Runx2 and Sp7 was observed in the ELPM40 + 50% IKVAV composition compared to the ELPM40 + PEG composition, and increased expression of Opn was observed in the ELPM40 + 50% IKVAV composition compared to the random peptide control (Figure 9). Analysis of signaling pathways that may induce osteogenic differentiation revealed increased expression of Smad1 and βcat in the ELPM40 + 50% IKVAV composition compared to the ELPM40 + PEG composition, suggesting that these two signaling pathways play a role in the differentiation of BMSCs associated with these hydrogels. Therefore, these results indicate that the ELP peptide may be an excellent substrate for promoting BMSC osteogenesis. Furthermore, the expression levels of all genes tested in this study increased in a dose-dependent manner with the concentration of IKVAV peptide. The overexpression of genes that directly trigger various stages of osteogenic differentiation supports the role of the ELPM40 + 50% IKVAV composition in the differentiation of BMSCs toward the osteogenic lineage. Expression of the Vegfa angiogenic factor was increased in the ELPM40 + 50% IKVAV composition compared to ELPM40 + PEG or ELPM40 + 50% VKAIV. Bmp2 expression was increased in the presence of ELPM40 + 25% IKVAV. Interestingly, expression of all genes studied was increased in the ELPM40 + 50% IKVAV composition compared to the ELPM40 + PEG composition, and this increase was proportional to the IKVAV concentration.

[0094] To determine the angiogenesis-promoting ability of the hydrogels of the present invention, rat bone marrow primary endothelial cells were cultured in various hydrogel compositions. After 7 days of culture, the expression of Tek, which plays a role in angiogenesis, was assessed (Figure 10). Overexpression of Tek was observed in the composition containing 50% IKVAV compared to the composition containing PEG or random VKAIV peptide (p<0.05).

[0095] Finally, ELPM40 + 50% IKVAV or VKAIV compositions were implanted subcutaneously (Figure 11). Neither composition induced major inflammatory signals, as indicated by the absence of multinucleated giant cells. Quantification of blood vessels around the implantation site revealed higher vascular density in the IKVAV-containing composition compared with the VKAIV peptide-containing composition 26 days after implantation, and vascular density increased over time. These results are supported by in vitro data and endothelial cell gene expression, indicating increased Tek expression in the 50% IKVAV-containing composition.

[0096] In conclusion, we have fabricated functional hydrogels based on synthetic peptides containing ELP-M(alkene)-40, SH-PEG, and IKVAV adhesive sequences. These hydrogels have the advantage of having finely adjustable rheological properties. Given the needs of this study, the selected hydrogels have a mass concentration suitable for SN growth. Furthermore, these gels are degradable in vitro and possess a fine pore structure.

[0097] Biological evaluation showed that the hydrogel of the present invention supported the culture of EC, BMSC, and SN cells. After 7 days of culture, these cells were able to migrate within the hydrogel construct, and no cytotoxicity of the hydrogel was observed. Regarding angiogenesis, ECs were able to form stable branched structures in the composition containing 50% adhesion peptide. Regarding osteogenic activity, BMSCs exhibited spheroid histology in all compositions, and a set of genes important for osteogenic differentiation was overexpressed when cultured in the ELPM40 + 50% IKVAV composition. Finally, regarding neural regeneration, SNs cultured in the ELPM40 + 50% IKVAV composition exhibited a more complex neurite network and longer neurite lengths, the latter of which was comparable to those obtained in other neurite cultures performed in medium supplemented with NGF, a growth factor known to promote neurite extension.

[0098] The data presented in this application show that the proposed strategy, based on a specific hydrogel, which is the first developed support that allows angiogenesis, osteogenesis and nerve regeneration without the presence of other cellular or growth factors, exhibits advantageous properties for biomedical applications.

Claims

1. i) an elastin-like polypeptide comprising at least one alkenylated residue and at least one occurrence of the VPGMG sequence; ii) IKVAV peptides capable of recruiting neurons and / or endothelial cells, and iii) cross-linking polymers with thiol end groups prior to the formation of the hydrogel A hydrogel comprising:

2. 2. The hydrogel of claim 1, wherein the IKVAV peptide is a peptide of the formula Cys-{β-Ala}-Ile-Lys-Val-Ala-Val-{β-Ala}-Cys.

3. Elastin-like polypeptide MGTELAAASEFTHMW[VPGMG] 20 (ELP20) polypeptide, MW [VPGVGVPGMG(VPGVG) 2 ] 5 (ELPM20) polypeptide or MW [VPGVGVPGMG(VPGVG) 2 ] 10 3. The hydrogel according to claim 1 or 2, characterized in that it is an (ELPM40) polypeptide.

4. 4. The hydrogel of claim 1, wherein the crosslinked polymer having thiol end groups is a multi-arm polymer.

5. 5. The hydrogel according to claim 1, wherein the crosslinked polymer is a four-arm poly(ethylene glycol) with thiol end groups.

6. 6. The hydrogel according to claim 5, wherein the weight average molecular weight of the four-arm poly(ethylene glycol) with thiol end groups is between 10 and 30 kDa.

7. 7. The hydrogel according to claim 5 or 6, characterized in that the weight average molecular weight of the four-arm poly(ethylene glycol) with thiol end groups is 20 kDa.

8. 8. The hydrogel of claim 1, wherein the crosslinked polymer with thiol end groups, the elastin-like polypeptide containing alkenylated methionine residues, and the IKVAV peptide are present in an equimolar thiol / alkene ratio.

9. 9. The hydrogel according to claim 1, wherein the concentration of the hydrogel is between 5 and 15% by density (w / v).

10. 10. The hydrogel according to claim 9, characterized in that the concentration of the hydrogel is between 7 and 8% (w / v) in terms of density (w / v).

11. 11. The hydrogel according to claim 1, wherein the hydrogel has a storage modulus G' of between 1 and 1.5 kPa.

12. 12. The hydrogel of claim 1, also comprising at least one biologically active agent.

13. 13. The hydrogel of claim 12, wherein the at least one biologically active agent is at least one growth factor.

14. A three-dimensional support capable of accommodating cells of interest, characterized in that it comprises the hydrogel according to any one of claims 1 to 13.

15. A hydrogel according to any one of claims 1 to 13 or a support according to claim 14 for use as a medicament.

16. 15. A hydrogel according to any one of claims 1 to 13 or a support according to claim 14 for use in a method for bone regeneration.

17. 15. An in vitro cell culture method comprising culturing cells in a hydrogel as defined in any one of claims 1 to 13 or in a support as defined in claim 14.

Images