Systems and methods for lung cell growth and differentiation

Abstract

The present disclosure provides a system for growing and modeling lung cells in organoid culture, and the method of using it.This document discloses the chemically defined conditions for lung stem cell proliferation, maintenance and differentiation in ex vivo organoid culture.These defined culture conditions provide the means for studying cell type specific effects and for high-throughput pharmacogenomics research to discover drugs for treating disease.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 906,241, filed September 26, 2019, the entire contents of which are hereby incorporated by reference herein.

[0002] Federal Funding Statement This invention was made with government support under Grant Nos. UC6-AI058607, AI132178 and AI149644 from the National Institutes of Health, National Institute of Allergy and Infectious Diseases. The federal government has certain rights in this invention.

[0003] Sequence Listing Description A computer-readable form of the Sequence Listing has been filed with this application by electronic submission and is incorporated herein by reference in its entirety. The Sequence Listing is contained in a 10 kb file created on September 25, 2020, with the file name "20-1324-WO_Sequence-Listing_SEQ.txt."

[0004] background Field The present disclosure provides systems and methods for growing pulmonary stem and progenitor cells in organoid cultures, and methods of using the same. [Background technology]

[0005] 2. Description of Related Art Tissue regeneration is orchestrated by the coordinated activity of stem and progenitor cell populations guided by the surrounding environment. After injury, progenitors transition from a quiescent state to an activated state in which they rapidly proliferate or differentiate into functional, differentiated cells. In some tissues, progenitors generate intermediate, transient amplifying cells that rapidly generate more cells before undergoing differentiation. Multiple factors within the microenvironment, as well as systemic factors, are known to direct the fate of progenitor cells. For example, chronic inflammation, aging, and excess extracellular matrix (ECM) deposition are frequently associated with defective regeneration, which in some cases leads to tissue degeneration and ultimately to fibrosis. Therefore, understanding the cellular states that stem and progenitor cells undergo to repair damaged tissue and the influence of the microenvironment on the trajectory of such cells has clinical significance.

[0006] In the lung, maintenance of alveolar epithelial homeostasis and regeneration after injury are supported by surfactant-producing cuboidal type 2 alveolar epithelial cells (AEC2s), which can self-renew and differentiate into thin, flat, gas-exchanging type 1 alveolar epithelial cells (AEC1s). AEC2s also play a key role in providing a first line of defense against viruses and pathogens, such as the novel coronavirus SARS-CoV-2. However, the nature of pathways dysregulated in human AEC2s in response to SARS-CoV-2 infection and how these pathways intersect with other forms of defense are currently unknown. Whether and how AEC2s maintain stem cell characteristics while activating antiviral defense mechanisms is also unknown.

[0007] Recent studies have identified a subset of AEC2s enriched for active Wnt signaling and possessing higher "stemness" compared to neighboring Wnt-inactive AEC2s. This difference in alveolar progenitor cell subsets is apparently due to differences in microenvironmental signals. In this case, Wnt-active AEC2s are in close proximity to PDGFRa-expressing alveolar fibroblasts, which produce ligands to activate Wnt signaling in AEC2s. The transformation from cuboidal AEC2s to thin, extremely flat AEC1s requires dramatic changes in cell shape, architecture, and mechanical properties. While recent studies have described pathways, including Wnt, BMP, Notch, TGF, YAP, and NFkB, involved in AEC2 proliferation and differentiation, the transitional cellular context AEC2s undergo during their differentiation into AEC1s remains difficult to understand. Additionally, the influence of microenvironmental changes on this transition is important in the context of defect regeneration. Indeed, recent studies have demonstrated that sustained Notch signaling can block the AEC2-to-AEC1 transition.

[0008] Elucidating these cellular transitions and the mechanisms that control these processes is largely hindered by the lack of a tractable model. Although AEC2 can be expanded and differentiated into AEC1 in alveolar spheres, the lack of defined conditions for either the expansion, maintenance, or differentiation of AEC2 in organoid or 3D culture or alveolar sphere models limits these studies.

[0009] Organoid cultures derived from adult AEC2 cells offer an opportunity to address these issues. Current conditions require co-culture of AEC2 cells with PDGFRa+ fibroblasts isolated from the alveolar stem cell niche or pulmonary endothelial cells isolated from fetal tissue. In addition, current culture media are poorly defined and contain unknown factors derived from bovine or calf fetal serum and bovine pituitary extract. Such complex conditions do not provide a modulatory system by which AEC2 cells can be selectively expanded or differentiated into AEC1 cells. Therefore, defined culture conditions are needed to study cell-type-specific effects and for high-throughput pharmacogenomics studies to discover drugs for treating diseases. Summary of the Invention [Means for solving the problem]

[0010] Described herein are chemically defined conditions for pulmonary stem cell proliferation, maintenance, and differentiation in ex vivo organoid cultures.

[0011] A brief summary of the disclosure The present disclosure is based, in part, on the inventors' discovery of a chemically defined culture system for the growth of pulmonary stem cells in three-dimensional cultures (organoids) that does not require the use of unknown growth components or feeder cells in culture.

[0012] One aspect of the present disclosure provides a type 2 alveolar epithelial cell culture medium comprising a serum-free medium and extracellular matrix components, wherein the culture medium is chemically defined and stroma-free.

[0013] In some embodiments of the present disclosure, the serum-free medium and extracellular matrix components are mixed in a ratio of about 1:1.

[0014] In some embodiments of the present disclosure, the extracellular matrix component is matrigel, type I collagen, Cultrex growth factor reduced basement membrane, R-type or human laminin.

[0015] In some embodiments, the serum-free medium of the present disclosure comprises at least one growth nutrient selected from the group consisting of SB431542, CHIR 99021, BIRB796, heparin, human EGF, FGF10, Y27632, insulin-transferrin-selenium, Glutamax, B27, N2, HEPES, N-acetylcysteine, antibiotic-antimycotic, and combinations thereof in modified DMEM / F12.

[0016] In some embodiments of the present disclosure, the medium is a type 2 alveolar epithelial cell culture growth medium. In some embodiments of the present disclosure, the growth medium further comprises a cytokine selected from the group consisting of IL-1β, TNFα, and combinations thereof. The IL-1β and TNFα can be derived from a mouse.

[0017] Another aspect of the present disclosure provides a type 2 alveolar epithelial cell culture maintenance medium comprising the growth medium of the present disclosure, the maintenance medium further comprising a bone morphogenetic protein (BMP) inhibitor.

[0018] In some embodiments of the present disclosure, the BMP inhibitor is selected from the group consisting of noggin, DMH-1, chordin, gremlin, crossveinless, LDN193189, USAG-1 and follistatin, and combinations thereof.

[0019] Another aspect of the present disclosure provides a type 2 alveolar epithelial cell culture differentiation medium, comprising at least one growth medium component selected from the group consisting of ITS, Glutamax, heparin, EFG, FGF10, antibiotic-antimycotic (anti-anti), and / or combinations thereof in modified DMEM / F12.

[0020] In some embodiments, the differentiation medium comprises serum (e.g., fetal bovine serum or human serum). In other embodiments, the differentiation medium is serum-free.

[0021] In some embodiments, the differentiation medium of the present disclosure does not contain inhibitors of TGFβ and p38 kinase.

[0022] In some embodiments, the differentiation medium of the present disclosure comprises IL-6.

[0023] Yet another aspect of the present disclosure provides the chemically defined stroma-free organoid culture system for the culture, proliferation, maintenance and / or differentiation of alveolar epithelial cell, comprising the isolated alveolar epithelial cell cultured in the medium of the present disclosure.In some embodiments, alveolar epithelial cell comprises type 2 alveolar epithelial cell.

[0024] Yet another aspect of the present disclosure provides a method for growing, maintaining and / or differentiating type 2 alveolar epithelial cells in an ex vivo organoid culture, comprising obtaining type 2 alveolar epithelial cells and culturing the cells in any of the media disclosed herein.

[0025] In some embodiments of the present disclosure, cytokines are added to the culture medium for about the first four days of culture.

[0026] In some embodiments of the present disclosure, the type 2 alveolar epithelial cells are expanded in sufficient quantities for engraftment in a subject. In some embodiments of the present disclosure, the type 2 alveolar epithelial cells are harvested and injected into a subject.

[0027] In some embodiments of the present disclosure, organoid cultures are grown in sufficient quantities for use for gene editing or lung disease modeling.

[0028] Yet another aspect of the present disclosure provides a method of culturing lung tumor cells in the absence of fibroblasts, the method comprising isolating tumor cells from a subject and contacting the tumor cells with a growth medium of the present disclosure.

[0029] Yet another aspect of the present disclosure provides a method for culturing pathogen-infected pneumocytes, the method comprising culturing lung cells with a growth medium of the present disclosure and inoculating the lung cells with the pathogen in an amount effective to infect the lung cells.

[0030] Yet another aspect of the present disclosure provides a method for identifying an agent capable of treating or preventing pathogen infection in an organoid culture, the method comprising: i) culturing cells in a growth medium of the present disclosure; ii) inoculating the cells with a pathogen in an amount effective to infect the cells; iii) contacting the cells with the agent; and iv) determining whether the agent causes a reduction in the amount of pathogen in the cells compared to cells not treated with the agent.

[0031] In some embodiments of the above method, step iii is optionally performed before step ii.

[0032] In some embodiments of the present disclosure, the pathogen is a bacterium (e.g., Bordetella pertussis, Streptococcus pneumonia, Haemophilus influenza, Staphylococcus aureus, Moraxella catarrhalis, Streptococcus pyogenes, Neisseria meningitidis, Pseudomonas aeruginosa, or Klebsiellapneumoniae), a virus (e.g., 229E, NL63, OC43, HKU1, MERS-CoV, SARS-CoV, or SARS-CoV-2, influenza A virus, influenza B virus, or enterovirus), or a fungus (e.g., Aspergillus (Aspergillosis)).

[0033] In some embodiments of the present disclosure, the cell is a tracheal basal cell, a bronchiolar secretory cell, a club variant cell, an alveolar epithelial progenitor cell, a Clara variant cell, a distal lung progenitor, a p63+Krt5− airway cell, a lineage-negative epithelial progenitor, a bronchoalveolar epithelial stem cell, a Sox9+p63+ cell, a neuroendocrine progenitor cell, a distal airway stem cell, a submucosal gland duct cell, an induced pluripotent stem cell-derived lung stem cell, or an alveolar type 2 epithelium.

[0034] Yet another aspect of the present disclosure provides a method for reducing viral titer in pneumospheres infected with SARS-CoV-2, the method comprising contacting the pneumospheres with an agent before the pneumospheres are exposed to SARS-CoV-2, wherein the pneumospheres exhibit a reduced viral titer compared to pneumospheres that have not been contacted with the agent.

[0035] In some embodiments of the present disclosure, the agent is an interferon (eg, IFNα and IFNγ).

[0036] Yet another aspect of the present disclosure provides a kit comprising a chemically defined, stroma-free organoid culture system for the culture, growth, maintenance and / or differentiation of alveolar epithelial cells, the kit comprising the medium of the present disclosure and instructions for use.

[0037] Yet another aspect of the present disclosure provides a kit comprising a chemically defined, stroma-free organoid culture system for determining agents that treat or prevent bacterial, viral, and fungal infections in organoid cultures, the kit comprising the medium of the present disclosure and instructions for use.

[0038] Yet another aspect of the present disclosure provides a kit comprising a chemically defined, stroma-free organoid culture system for determining agents that treat or prevent bacterial, viral, and fungal infections ex vivo and in vivo in organoid cultures or derivatives thereof, the kit comprising the medium of the present disclosure and instructions for use. In an embodiment of the present invention, for example, the following items are provided: (Item 1) A type 2 alveolar epithelial cell culture medium comprising a serum-free medium and extracellular matrix components, the culture medium being chemically defined and stroma-free. (Item 2) 2. The medium of item 1, wherein the serum-free medium and the extracellular matrix components are mixed in a ratio of about 1:1. (Item 3) 4. The medium of item 3, wherein the extracellular matrix component is Matrigel™, type I collagen, Cultrex growth factor-reduced basement membrane, R-type or human laminin. (Item 4) 8. The medium of any preceding item, wherein the serum-free medium comprises at least one growth nutrient selected from the group consisting of SB431542, CHIR 99021, BIRB796, heparin, human EGF, FGF10, Y27632, insulin-transferrin-selenium, Glutamax, B27, N2, HEPES, N-acetylcysteine, antibiotic-antimycotic, and combinations thereof in modified DMEM / F12. (Item 5) 5. The medium of item 4, wherein the serum-free medium comprises SB431542, CHIR 99021, BIRB796, heparin, human EGF, FGF10, Y27632, insulin-transferrin-selenium, Glutamax, B27, N2, HEPES, N-acetylcysteine, and antibiotic-antimycotic in modified DMEM / F12. (Item 6) 1. A type 2 alveolar epithelial cell culture medium comprising a 1:1 mixture of serum-free medium and Matrigel, wherein the serum-free medium comprises 10 μM SB431542, 3 μM CHIR 9902, 1 μM BIRB796, 5 μg / ml heparin, 50 ng / ml human EGF, 10 ng / ml mouse FGF10, 10 nM Y27632, insulin-transferrin-selenium, 1% Glutamax, 2% B27, 1% N2, 15 mM HEPES, 1.25 mM N-acetylcysteine, and 1% antibiotic-antimycotic in modified DMEM / F12, and wherein the medium is stroma-free. (Item 7) 4. The medium according to item 3, wherein the Matrigel is BD Biosciences #354230. (Item 8) 10. The medium of any of the preceding items, wherein the medium is a type 2 alveolar epithelial cell culture growth medium. (Item 9) 9. The growth medium of item 8, wherein the medium further comprises a cytokine selected from the group consisting of IL-1β, TNFα, and combinations thereof. (Item 10) 9. The growth medium of item 8, wherein the IL-1β comprises mouse IL-1β. (Item 11) 9. The growth medium of item 8, wherein the TNFα comprises mouse TNFα. (Item 12) 9. The growth medium of item 8, wherein the IL-1β is at a concentration of about 10 ng / ml. (Item 13) 9. The growth medium of item 8, wherein the TNFα is at a concentration of about 10 ng / ml. (Item 14) 14. A culture and maintenance medium for type 2 alveolar epithelial cells, comprising the growth medium according to any one of items 1 to 13, further comprising a bone morphogenetic protein (BMP) inhibitor. (Item 15) 15. The maintenance medium of item 14, wherein the BMP inhibitor is selected from the group consisting of noggin, DMH-1, chordin, gremlin, crossbainless, LDN193189, USAG-1 and follistatin, and combinations thereof. (Item 16) 15. The maintenance medium according to item 14, wherein the noggin comprises mouse noggin. (Item 17) 17. The maintenance medium of either of items 15 or 16, wherein the Noggin is at a concentration of about 10 ng / ml. (Item 18) 18. The maintenance medium of item 17, wherein the DMH-1 is at a concentration of about 1 μM. (Item 19) A type 2 alveolar epithelial cell culture differentiation medium, comprising at least one growth medium component selected from the group consisting of ITS, Glutamax, heparin, EFG, FGF10 and antibiotic-antimycotic, and / or combinations thereof in modified DMEM / F12. (Item 20) 20. The differentiation medium according to item 19, wherein the medium further comprises serum. (Item 21) 20. The differentiation medium of item 19, wherein the medium further comprises fetal bovine serum or human serum. (Item 22) 22. The differentiation medium according to item 18 or 21, wherein the medium comprises ITS, Glutamax, heparin, EFG, FGF10, fetal bovine serum and 1% antibiotic-antimycotic in modified DMEM / F12. (Item 23) 23. The differentiation medium according to item 22, wherein the medium comprises ITS, Glutamax, about 5 μg / ml heparin, about 5 ng / ml human EFG, about 1 ng / ml mouse FGF10, about 10% fetal bovine serum, and about 1% antibiotic-antimycotic in improved DMEM / F12. (Item 24) 24. The differentiation medium according to any one of items 19 to 23, which does not contain an inhibitor of TGFβ and p38 kinase. (Item 25) 20. The differentiation medium according to item 19, wherein the medium comprises IL-6. (Item 26) Item 26. The differentiation medium according to Item 25, wherein the medium contains 10 ng / mL to 50 ng / mL of IL-6. (Item 27) 20. The differentiation medium according to item 19, wherein the medium is a serum-free medium. (Item 28) 26. A chemically defined, stroma-free organoid culture system for the culture, proliferation, maintenance, and / or differentiation of alveolar epithelial cells, comprising isolated alveolar epithelial cells cultured in the medium according to any one of items 1 to 25. (Item 29) 29. The system of claim 28, wherein the alveolar epithelial cells comprise type 2 alveolar epithelial cells. (Item 30) 28. A method for growing, maintaining and / or differentiating type 2 alveolar epithelial cells in ex vivo organoid culture, comprising obtaining type 2 alveolar epithelial cells and culturing the cells in the medium according to any one of items 1 to 27. (Item 31) 31. The method of claim 30, wherein cytokines are added to the culture medium during the first about 4 days of culture. (Item 32) 31. The method of claim 30, wherein the type 2 alveolar epithelial cells are expanded in a quantity sufficient for engraftment in the subject. (Item 33) 31. The method of claim 30, wherein the type 2 alveolar epithelial cells are collected and injected into a subject. (Item 34) 31. The method of claim 30, wherein the organoid culture is grown in sufficient quantity for use in gene editing or lung disease modeling. (Item 35) 14. A method for culturing lung tumor cells in the absence of fibroblasts, comprising the steps of isolating tumor cells from a subject and contacting the tumor cells with the growth medium according to any one of items 1 to 13. (Item 36) 28. A method for culturing pneumocytes infected with a pathogen, the method comprising the steps of culturing pneumocytes in the growth medium according to any one of items 7 to 27, and inoculating the pneumocytes with the pathogen in an amount effective to infect the pneumocytes. (Item 37) 1. A method for identifying an agent capable of treating or preventing pathogen infection in an organoid culture, comprising: i) culturing the cells in a growth medium according to any one of items 1 to 27; ii) inoculating said cells with a pathogen in an amount effective to infect said cells; iii) contacting the cells with an agent; iv) determining whether the agent causes a reduction in the amount of the pathogen in the cells compared to cells not treated with the agent; A method comprising: (Item 38) Item 38. The method according to item 37, wherein step iii is carried out before step ii, if necessary. (Item 39) 38. The method of claim 36 or 37, wherein the pathogen is a bacterium, a virus or a fungus. (Item 40) 40. The method of claim 39, wherein the virus is 229E, NL63, OC43, HKU1, MERS-CoV, SARS-CoV or SARS-CoV-2, influenza A virus, influenza B virus, or enterovirus. (Item 41) 40. The method of claim 39, wherein the bacterium is Bordetella pertussis, Streptococcus pneumonia, Haemophilus influenza, Staphylococcus aureus, Moraxella catarrhalis, Streptococcus pyogenes, Neisseria meningitidis, or Klebsiellapneumoniae. (Item 42) Item 39. The method of item 39, wherein the fungus is Aspergillus. (Item 43) 38. The method of item 36 or 37, wherein the cell is a tracheal basal cell, a bronchiolar secretory cell, a club variant cell, an alveolar epithelial progenitor cell, a Clara variant cell, a distal lung progenitor, a p63+Krt5− airway cell, a lineage-negative epithelial progenitor, a bronchoalveolar epithelial stem cell, a Sox9+p63+ cell, a neuroendocrine progenitor cell, a distal airway stem cell, a submucosal gland duct cell, an induced pluripotent stem cell-derived lung stem cell, or an alveolar type 2 epithelium. (Item 44) 38. The method of item 36 or 37, wherein the cells are alveolar type 2 epithelial cells. (Item 45) A method for reducing viral titer in pneumospheres infected with SARS-CoV-2, comprising contacting the pneumospheres with an agent before the pneumospheres are exposed to SARS-CoV-2, wherein the pneumospheres exhibit a reduced viral titer compared to pneumospheres that have not been contacted with the agent. (Item 46) 46. ​​The method of claim 45, wherein the agent is an interferon. (Item 47) Item 47. The method of item 46, wherein the interferon is IFNα and IFNγ. (Item 48) 28. A kit comprising a chemically defined, stroma-free organoid culture system for the culture, proliferation, maintenance and / or differentiation of alveolar epithelial cells, the kit comprising the medium according to any one of items 1 to 27 and instructions for use. (Item 49) 28. A kit comprising a chemically defined, stroma-free organoid culture system for determining agents that treat or prevent bacterial, viral, and fungal infections in organoid cultures, the kit comprising the medium described in any one of items 1 to 27 and instructions for use. (Item 50) 28. A kit comprising a chemically defined, stroma-free organoid culture system for determining agents that treat or prevent bacterial, viral, and fungal infections ex vivo and in vivo in organoid cultures or derivatives thereof, the kit comprising the medium of any of items 1 to 27 and instructions for use. [Brief explanation of the drawings]

[0039] [Figure 1-1]Figures 1A-1C show experiments to examine stromal cell dependency in the alveolar organoid culture system. Figure 1A is a schematic diagram of the organoid culture used to examine stromal cell dependency. AEC2s were cultured in Matrigel alone (left), with stromal cells spaced between the two (center), or mixed with stromal cells in Matrigel (right). Figure 1B shows representative images of organoid cultures in each condition on day 20. Figure 1C shows quantification of colony-forming efficiency (CFE) in each condition. Error bars are mean ± sem (n = 3). [Figure 1-2] Figures 1A-1C show experiments to examine stromal cell dependency in the alveolar organoid culture system. Figure 1A is a schematic diagram of the organoid culture used to examine stromal cell dependency. AEC2s were cultured in Matrigel alone (left), with stromal cells spaced between the two (center), or mixed with stromal cells in Matrigel (right). Figure 1B shows representative images of organoid cultures in each condition on day 20. Figure 1C shows quantification of colony-forming efficiency (CFE) in each condition. Error bars are mean ± sem (n = 3).

[0040] [Figure 2-1]Figures 2A-2E show the alveolar stem cell niche receptor-ligand interactome-guided optimization of media components for defined conditions for alveolar sphere culture. Figure 2A is a schematic diagram of the scRNA-seq experiment. Figure 2B is a t-SNE visualization of epithelial cells and fibroblasts from mouse alveolar sphere cultures. Cells are shaded by cluster assignment based on marker gene expression. Figure 2C shows a tSNE plot showing the expression of marker genes in each cluster. Cells are shaded by the normalized expression of each gene. Figure 2D shows a schematic diagram of receptor-ligand interactions between AT2 and fibroblasts in alveolar sphere cultures. Figure 2E is a dot plot showing gene expression of receptors, ligands, and regulators in key signaling pathways in each cluster. The size of the dot and the shading intensity indicate the number of cells expressing the indicated transcript and the expression level, respectively. [Figure 2-2] Figures 2A-2E show the alveolar stem cell niche receptor-ligand interactome-guided optimization of media components for defined conditions for alveolar sphere culture. Figure 2A is a schematic diagram of the scRNA-seq experiment. Figure 2B is a t-SNE visualization of epithelial cells and fibroblasts from mouse alveolar sphere cultures. Cells are shaded by cluster assignment based on marker gene expression. Figure 2C shows a tSNE plot showing the expression of marker genes in each cluster. Cells are shaded by the normalized expression of each gene. Figure 2D shows a schematic diagram of receptor-ligand interactions between AT2 and fibroblasts in alveolar sphere cultures. Figure 2E is a dot plot showing gene expression of receptors, ligands, and regulators in key signaling pathways in each cluster. The size of the dot and the shading intensity indicate the number of cells expressing the indicated transcript and the expression level, respectively. [Figure 2-3]Figures 2A-2E show the alveolar stem cell niche receptor-ligand interactome-guided optimization of media components for defined conditions for alveolar sphere culture. Figure 2A is a schematic diagram of the scRNA-seq experiment. Figure 2B is a t-SNE visualization of epithelial cells and fibroblasts from mouse alveolar sphere cultures. Cells are shaded by cluster assignment based on marker gene expression. Figure 2C shows a tSNE plot showing the expression of marker genes in each cluster. Cells are shaded by the normalized expression of each gene. Figure 2D shows a schematic diagram of receptor-ligand interactions between AT2 and fibroblasts in alveolar sphere cultures. Figure 2E is a dot plot showing gene expression of receptors, ligands, and regulators in key signaling pathways in each cluster. The size of the dot and the shading intensity indicate the number of cells expressing the indicated transcript and the expression level, respectively. [Figure 2-4] Figures 2A-2E show the alveolar stem cell niche receptor-ligand interactome-guided optimization of media components for defined conditions for alveolar sphere culture. Figure 2A is a schematic diagram of the scRNA-seq experiment. Figure 2B is a t-SNE visualization of epithelial cells and fibroblasts from mouse alveolar sphere cultures. Cells are shaded by cluster assignment based on marker gene expression. Figure 2C shows a tSNE plot showing the expression of marker genes in each cluster. Cells are shaded by the normalized expression of each gene. Figure 2D shows a schematic diagram of receptor-ligand interactions between AT2 and fibroblasts in alveolar sphere cultures. Figure 2E is a dot plot showing gene expression of receptors, ligands, and regulators in key signaling pathways in each cluster. The size of the dot and the shading intensity indicate the number of cells expressing the indicated transcript and the expression level, respectively.

[0041] [Figure 3-1]Figures 3A-3C show the effects of medium components on organoid growth. Figure 3A shows representative images of alveolar spheres in each culture condition. SCE refers to the presence of SB431542, CHIR99021, and EGF, without the p38 inhibitor (BIRB796). Scale bar, 1 mm. Figure 3B shows a graph depicting quantification of CFE in each condition shown in Figure 2A. Error bars indicate mean ± s.e.m. (n = 3, at least two wells per condition). Figure 3C shows a graph depicting alveolar spheres with a circumference greater than 300 μm, which were quantified in each condition shown in Figure 3A. SCE vs SCE+p38i, p=1.65×10-10; SCE vs SCE+p38i+FGF7, p=5.47×10-14; SCE vs SCE+p38i+FGF10, p=4.94×10-14; SCE vs SCE+p38i+FGF7_FGF10, p=5.1×10-6; ns, not significant; Steel-Dwass test. [Figure 3-2] Figures 3A-3C show the effects of medium components on organoid growth. Figure 3A shows representative images of alveolar spheres in each culture condition. SCE refers to the presence of SB431542, CHIR99021, and EGF, without the p38 inhibitor (BIRB796). Scale bar, 1 mm. Figure 3B shows a graph depicting quantification of CFE in each condition shown in Figure 2A. Error bars indicate mean ± s.e.m. (n = 3, at least two wells per condition). Figure 3C shows a graph depicting alveolar spheres with a circumference greater than 300 μm, which were quantified in each condition shown in Figure 3A. SCE vs SCE+p38i, p=1.65×10-10; SCE vs SCE+p38i+FGF7, p=5.47×10-14; SCE vs SCE+p38i+FGF10, p=4.94×10-14; SCE vs SCE+p38i+FGF7_FGF10, p=5.1×10-6; ns, not significant; Steel-Dwass test.

[0042] [Figure 4]Figures 4A-4C show the establishment of a chemically defined, interstitium-free alveolar organoid culture system. Figure 4A is a schematic diagram and representative images of organoid cultures in MTEC and serum-free medium on days 10 and 15. Figure 4B is a graph showing quantification of CFE. Figure 4C is a graph showing organoid size.

[0043] [Figure 5] Figures 5A-5C show the establishment of a chemically defined, interstitium-free alveolar organoid culture system. Figure 5A is a schematic diagram and representative images of organoid cultures with and without IL-1β / TNFα on days 10 and 15. Figure 5B is a graph showing quantification of CFE. Figure 5C is a graph showing organoid size.

[0044] [Figure 6] Figures 6A-6B show the establishment of a chemically defined, interstitium-free alveolar organoid culture system. Figure 6A is a schematic diagram showing IL-1β pulse stimulation. Figure 6B is a graph showing quantification of CFE from the data in Figure 6A. Error bars are mean ± s.e.m. (n = 3, except for -IL-1β d3 (n = 2)).

[0045] [Figure 7-1] Figures 7A-7D show the characterization of primary human alveolar spheres. Figure 7A is a schematic diagram of human alveolar sphere culture in SFFF medium. hIL-1β was removed from the medium on day 7, and the cells were cultured for an additional 7-15 days. Figure 7B shows representative images of alveolar spheres from three individual donors on day 14. Figure 7C is a graph showing quantification of colony-forming efficiency (CFE). Figure 7D is a graph showing the size (perimeter) of alveolar spheres collected on day 14. [Figure 7-2]Figures 7A-7D show the characterization of primary human alveolar spheres. Figure 7A is a schematic diagram of human alveolar sphere culture in SFFF medium. hIL-1β was removed from the medium on day 7, and the cells were cultured for an additional 7-15 days. Figure 7B shows representative images of alveolar spheres from three individual donors on day 14. Figure 7C is a graph showing quantification of colony-forming efficiency (CFE). Figure 7D is a graph showing the size (perimeter) of alveolar spheres collected on day 14.

[0046] [Figure 8] Figures 8A-8B show the defined conditions for alveolar sphere culture. Figure 8A shows a schematic diagram and representative images of labeled (tdTomato+) derived alveolar sphere cultures in SFFF medium on days 10 and 15. Figure 8B shows a representative TEM image of alveolar spheres cultured in SFFF medium. Scale bar, 2 μm. The higher magnification image (right) shows lamellar-like structures. Scale bar, 500 nm.

[0047] [Figure 9] Figures 9A-9B show functional analysis of alveolar organoids in alveolar (alveo-) growth medium. Figure 9A is a schematic diagram showing the subculture of organoid cultures. Figure 9B is a graph showing the growth curve based on cumulative cell number during subculture in alveolar growth medium.

[0048] [Figure 10-1]Figures 10A-10N show the establishment of a chemically defined human lung alveolar sphere culture system. Figure 10A is a schematic representation of human alveolar sphere culture and subculture in SFFF medium. Figure 10B is a representative image of human alveolar spheres from different passages. Scale bar: 100 µm. Figure 10C is a graph showing the quantification of the colony formation efficiency of human alveolar spheres at different passages. Figure 10D shows images of immunostaining for SFTPC, SFTPB, and AGER (left panel) or SFTPB, HTII-280, and DC-LAMP (right panel) in P1 and P3 human alveolar spheres cultured in SFFF medium for 14 days. Figure 10E shows images of immunostaining for SFTPC and HTII-280 in cells dissociated from alveolar spheres at P2 (top) and P8 (bottom). Figure 10F is a graph showing quantification of HTII-280+SFTPC+ cells / total DAPI+ cells derived from dissociated alveolar spheres from P2 and P8. Figure 10G is an image of brightfield (left) and immunostaining for SFTPC, Ki67, and AGER in human alveolar spheres at P10. Figure 10H is a graph showing quantitative RT-PCR for SFTPC and LAMP3 in human alveolar spheres at P1 and P6. Figure 10I is an image of immunostaining for SFTPC, TP63, and SOX2 in alveolar sphere sections cultured in SFFF medium for 20 days. Figure 10J is an image of immunostaining for NKX2-1, SCGB1A1, and HTII-280 in alveolar sphere sections cultured in SFFF medium for 20 days. Figure 10K is an image of immunostaining for AGER and SFTPC in alveolar spheres after induction of differentiation with 10% FBS for 10 days. Figure 10L shows images of immunostaining for AGER and SFTPC in alveolar spheres after induction of differentiation with human serum for 10 days. The high-power image (right) shows AGER+ cells. Scale bar, 50 μm. Data are presented as mean ± sem. Figure 10M shows a schematic representation of differentiation of human AT2 to AT1 in alveolar spheres. AT2 was cultured in SFFF medium for 10 days, followed by culture in ADM for 14 days. Figure 10N shows images of immunostaining for SFTPC and AGER in human alveolar spheres cultured in ADM conditions for 14 days.Scale bars: B, 100 μm; D, 50 μm; E, 20 μm; H, 20 μm. DAPI indicates nuclei in Figures 10D, 10E, and 10H. Data are presented as mean ± sem. [Figure 10-2] Same as above. [Figure 10-3] Same as above. [Figure 10-4] Same as above. [Figure 10-5] Same as above. [Figure 10-6] Same as above. [Figure 10-7] Same as above.

[0049] [Figure 11-1] Figures 11A-11I show functional analysis of alveolar organoids in alveolar growth medium. Figure 11A is a schematic of the gene editing experiment. Overlay of fluorescent and brightfield images of GFP-expressing organoids introduced by AAV6-based gene delivery (right). Scale bar, 50 µm. Figure 11B shows a schematic diagram of tumor organoid culture. Figure 11C is a representative image of tumor organoids in various media on day 7. Figure 11D is a graph showing quantification of CFE in tumor organoids on day 5 (right). Error bars, mean ± sem (n = 3). ***P < 0.001. Figure 11E is an image of immunostaining for RAGE (white), SPC, and TOMATO in tumor organoids on day 7. Figure 11F is a schematic of the grafting experiment. Figure 11G is a representative image of purified lungs grafted with organoid-derived cells. The white dashed line indicates the edge of the lung tissue. Scale bar, 1 mm. Figure 11H shows a representative image of organoid-derived cell engraftment in the lung. The engrafted cells were detected by endogenous TOMATO expression. Scale bar, 100 μm. Figure 11I shows an image of a lung section from a mouse engrafted with organoid-derived cells, immunostained for RAGE and SPC. The engrafted cells were detected by endogenous TOMATO expression. Scale bar, 50 μm. The engraftment experiment was performed three times independently. [Figure 11-2] Same as above. [Figure 11-3] Same as above. [Figure 11-4] Same as above. [Figure 11-5] Same as above.

[0050] [Figure 12-1] Figures 12A-12J show modulation of cell identity in organoid cultures. Figure 12A is a schematic diagram of an experiment in growth medium. Figure 12B is a representative whole-mount image of organoids in growth conditions on day 10. Figure 12C is a tSNE plot showing the expression of the indicated genes. Figure 12D is a schematic diagram of an experiment in maintenance medium with BMP inhibition. Figure 12E is a representative whole-mount image of organoids in maintenance conditions on day 10. Figure 12F is an image of immunostaining for SFTPC, Tdt, and AGER (left panel) or SFTPB, Tdt, and DC-LAMP (right panel) in P1 and P6 mouse alveolar spheres cultured in AMM. Figure 12G is a schematic representation of mouse alveolar sphere subculture. Figure 12H is a representative alveolar sphere image at passages 1, 3, and 6. Figure 12I is a graph showing quantification of CFE at different passages. Figure 12J is a graph showing quantitative RT-PCR for Sftpc, Abca3, and Lamp3 in P1 and P6 mouse alveolar spheres. Asterisks indicate p<0.05. [Figure 12-2] Same as above. [Figure 12-3] Same as above. [Figure 12-4] Same as above. [Figure 12-5] Same as above.

[0051] [Figure 13] Figure 13 shows representative whole-mount images of organoids in alveolar growth (left) and alveolar maintenance medium (right) on day 7.

[0052] [Figure 14-1]Figures 14A-14D show modulation of cell identity in organoid cultures. Figure 14A is a schematic diagram for organoids in differentiation conditions on day 20. Figure 14B is an image showing immunostaining for AGER, SFTPC (left) and HOPX, PDPN (right) in organoids in differentiation conditions on day 20. Scale bar, 50 μm. Figure 14C is an image showing immunostaining for SFTPC and AGER in mouse alveolar spheres cultured in ADM at P1 (left) and P6 (right). Scale bar: D, 1 mm; B and G, 50 μm. Data are presented as mean ± s.e.m. Figure 14D shows a tSNE plot showing expression of AEC2 markers (Sftpc, Lamp3, Lpcat1) (left) and AEC1 markers (Ager, Hopx, Cav1) (right). [Figure 14-2] Figures 14A-14D show modulation of cell identity in organoid cultures. Figure 14A is a schematic diagram for organoids in differentiation conditions on day 20. Figure 14B is an image showing immunostaining for AGER, SFTPC (left) and HOPX, PDPN (right) in organoids in differentiation conditions on day 20. Scale bar, 50 μm. Figure 14C is an image showing immunostaining for SFTPC and AGER in mouse alveolar spheres cultured in ADM at P1 (left) and P6 (right). Scale bar: D, 1 mm; B and G, 50 μm. Data are presented as mean ± s.e.m. Figure 14D shows a tSNE plot showing expression of AEC2 markers (Sftpc, Lamp3, Lpcat1) (left) and AEC1 markers (Ager, Hopx, Cav1) (right).

[0053] [Figure 15-1]Figures 15A-15C show the differentiation of mouse and human AEC2 to AEC1 in serum-free differentiation medium. Figure 15A is a plot showing the enrichment of IL6 transcripts in fibroblasts. Figure 15B is a schematic diagram showing mouse AEC2 cultured in alveolar growth medium for 10 days before replacing the medium with ADM (serum-free) supplemented with IL6 (20 ng / mL), and an immunofluorescence image (bottom) showing the expression of the AEC1 marker AGER. Figure 15C is a schematic diagram showing human AEC2 cultured in SFFF medium for 14 days before replacing the medium with ADM (serum-free) supplemented with IL6 (20 ng / mL), and an immunofluorescence image (bottom) showing the expression of the AEC1 marker AGER. [Figure 15-2] Figures 15A-15C show the differentiation of mouse and human AEC2 to AEC1 in serum-free differentiation medium. Figure 15A is a plot showing the enrichment of IL6 transcripts in fibroblasts. Figure 15B is a schematic diagram showing mouse AEC2 cultured in alveolar growth medium for 10 days before replacing the medium with ADM (serum-free) supplemented with IL6 (20 ng / mL), and an immunofluorescence image (bottom) showing the expression of the AEC1 marker AGER. Figure 15C is a schematic diagram showing human AEC2 cultured in SFFF medium for 14 days before replacing the medium with ADM (serum-free) supplemented with IL6 (20 ng / mL), and an immunofluorescence image (bottom) showing the expression of the AEC1 marker AGER.

[0054] [Figure 16-1]Figures 16A-16E show that alveolar sphere-derived AT2 expresses viral receptors and is permissive for SARS-CoV-2 infection. Figure 16A is a schematic representation of SARS-CoV-2-GFP infection in human alveolar spheres. AT2 were cultured in SFFF medium on matrigel-coated plates for 10-12 days and subsequently infected with SARS-CoV-2 virus. RNA isolation or histological analysis was performed after different time points. Figure 16B shows representative wide-field microscopy images of control and SARS-CoV-2-GFP-infected human lung alveolar spheres. Figure 16C shows a graph depicting viral titers measured by plaque assay using medium harvested from lung alveolar sphere cultures at 24, 48, and 72 hours postinfection. Figure 16D shows quantitative RT-PCR analysis of SARS-CoV-2 transcripts in control and SARS-CoV-2-infected human AEC alveolar spheres. Figure 16E shows quantification of SARS-CoV-2 minus-strand-specific reverse transcription followed by RT-qPCR targeting two distinct genomic loci (1202-1363 and 848-981) in mock- and SARS-CoV-2-infected human alveolar spheroids 72 hours after infection. Asterisks indicate p<0.05. Scale bars: A, B, and C, 30 μm; D, 20 μm; F, 20 μm. White boxes in merged images indicate the regions of the single-channel images. All quantification data are presented as mean ± sem. [Figure 16-2] Same as above. [Figure 16-3] Same as above.

[0055] [Figure 17-1]Figures 17A-17D show that transcriptome profiling revealed enrichment of interferon, inflammatory, and cell death pathways in SARS-CoV-2-infected lung cells. Figure 17A is a volcano plot showing upregulated (right) and downregulated (left) genes in SARS-CoV-2-infected human alveolar spheres cultured in SFFFs. Statistical analysis was performed using DESeq2. Figure 17B is a graph showing the expression levels of IFN ligands in mock- and SARS-CoV-2-infected human alveolar spheres, as detected by bulk RNA-seq. Figure 17C is a graph showing the expression levels of receptors in mock- and SARS-CoV-2-infected human alveolar spheres, as detected by bulk RNA-seq. Figure 17D is a graph showing the expression levels of downstream targets in mock- and SARS-CoV-2-infected human alveolar spheres, as detected by bulk RNA-seq. Data are presented as FPKM mean ± sem. [Figure 17-2] Same as above. [Figure 17-3] Same as above.

[0056] [Figure 18-1] Figures 18A-18E show that SARS-CoV-2 infection induces surfactant loss and AT2 cell death. Figure 18A is a graph showing quantification of the percent of SARS-CoV-2-infected pneumocytes. Figure 18B is a graph showing quantification of low-infected (1-10 SARS-CoV-2+ cells) and highly-infected (10 or more SARS-CoV-2+ cells) pneumocytes. Figure 18C is a graph showing quantification of SFTPC+ cells in uninfected controls and in SARS- and SARS+ cells in virus-infected pneumocytes. Figure 18D is a graph showing quantification of active CASP3+ cells in uninfected controls (gray), SARS-CoV-2- cells (blue), and SARS-CoV-2+ cells in infected pneumocytes. Figure 18E is a graph showing quantification of Ki67+ cells in SARS-CoV-2- cells (blue) and SARS-CoV-2+ cells in infected pneumocytes, in uninfected controls (gray). [Figure 18-2] Same as above. [Figure 18-3] Same as above.

[0057] [Figure 19] Figure 19 is a dot plot showing cell type-specific marker gene expression in epithelial cells obtained from severe COVID-19 patients.

[0058] [Figure 20-1] Figures 20A-B show transcriptome-wide similarities in AT2 cells derived from SARS-CoV-2-infected pneumocytes and COVID-19 lungs. Figure 20A is a volcano plot showing specific genes enriched in AT2 cells in bronchoalveolar lavage fluid from severe COVID-19 patients (right) and in AT2 cells isolated from healthy lungs (control) (left). The Wilcoxon rank-sum test was used for statistical analysis. Figure 20B is a violin plot showing gene expression of cytokines and chemokines (CXCL10, CXCL14, and IL32), interferon targets (IFIT1, ISG15, and IFI6), apoptosis (TNFSF10, ANXA5, and CASP4), surfactant-related (SFTPC, SFTPD, and NAPSA), and AT2 cell-related (LAMP3, NKX2-1, and ABCA3) in AT2 cells derived from control and severe COVID-19 patient lungs. [Figure 20-2] Same as above.

[0001] [Figure 21-1]Figures 21A-21H show that IFN treatment recapitulates features of SARS-CoV-2 infection, including cell death and surfactant loss, in alveolar sphere-derived AT2 cells. Figure 21A shows representative images of alveolar spheres from control and IFN-a, IFN-b, and IFN-g-treated human lungs. Figure 21B shows a graph quantification of active caspase 3+ cells among total DAPI+ cells (per alveolar sphere) in control and interferon-treated human alveolar spheres. Figure 21C shows a graph quantification of Ki67+ cells among total DAPI+ cells in control and interferon-treated human alveolar spheres. *, **, and *** indicate p<0.05, p<0.01, and p<0.001, respectively. Figure 21D shows a graph quantification of RT-PCR analysis for SFTPB in interferon-treated alveolar spheres. Figure 21E is a graph showing quantification of RT-PCR analysis for SFTPC in interferon-treated alveolar spheres. Figure 21F is a graph showing quantification of RT-PCR analysis for ACE2 in interferon-treated alveolar spheres. Figure 21G is a graph showing quantification of RT-PCR analysis for TMPRSS2 in interferon-treated alveolar spheres. Figure 21H is a graph showing quantitative RT-PCR analysis for ACE2 and TMPRSS2 in control and SARS-CoV-2-infected (48 hours post-infection (pst)) alveolar spheres cultured in SFFF. *, ***, **** indicate p<0.05, p<0.001, and p<0.0001, respectively. [Figure 21-2] Same as above. [Figure 21-3] Same as above. [Figure 21-4] Same as above.

[0059] [Figure 22]Figure 22A is a schematic diagram of IFN or IFN inhibitor treatment followed by SARS-CoV-2 infection. Figure 22B is a graph showing viral titers in control, ruxolitinib-treated, IFNa-treated, and IFNg-treated cultures as measured by plaque assay using media harvested from alveolar sphere cultures 24 and 48 hours post-infection. DETAILED DESCRIPTION OF THE INVENTION

[0060] For purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to preferred embodiments and specific language will be used to describe the preferred embodiments. Nonetheless, no limitation of the scope of the disclosure is intended, and it will be understood that such changes and further modifications of the disclosure described herein are contemplated as would normally occur to one skilled in the art to which the disclosure pertains.

[0061] definition

[0062] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means at least one element and can include two or more elements.

[0063] "About" is used to provide flexibility for the endpoints of a numerical range, with the understanding that a given value can be "slightly more" or "slightly less" the endpoint without affecting the desired result.

[0064] Use herein of the terms "including," "comprising," or "having," and variations thereof, is intended to encompass the elements listed before the term, and equivalents thereof, as well as additional elements. As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the sense of alternatives ("or").

[0065] As used herein, the transitional phrase "consisting essentially of" (and grammatical variations) is to be interpreted as inclusive of the recited materials or steps, as well as those "that do not materially affect the basic and novel characteristic(s)" of the claimed invention. Thus, the term "consisting essentially of" as used herein should not be interpreted as the equivalent of "comprising."

[0066] Furthermore, the present disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein may be excluded or omitted. By way of example, if the specification describes a complex as comprising components A, B, and C, it is specifically contemplated that any or combination of A, B, or C, singly or in any combination, may be omitted and negated.

[0067] The recitation of ranges of values ​​herein, unless otherwise indicated herein, is merely intended to serve as a shorthand method of individually referencing each separate value falling within the range, and each separate value is incorporated herein as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, values ​​such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are intended to be expressly recited herein. The foregoing are merely examples of what is specifically intended, and all possible combinations of values ​​between and including the lowest and highest values ​​recited should be considered to be expressly recited in this disclosure.

[0068] The term "disease," as used herein, includes, but is not limited to, an abnormal state and / or disorder, either of structure or function, affecting a part of an organism, which may be caused by external factors such as infectious disease or chemical toxins, or by cancer, cancer metastasis, and other internal dysfunctions.

[0069] The term "effective amount" or "therapeutically effective amount" refers to an amount sufficient to effect beneficial or desired biological and / or clinical results.

[0070] As used herein, "treatment" or "treating" refers to a clinical intervention made in response to a disease, disorder, or pathogen infection manifested by or to which a patient may be susceptible. The goal of treatment includes reducing or preventing the symptoms of, slowing or halting the progression or worsening of, and / or ameliorating the disease, disorder, or condition.

[0071] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0072] Chemically defined, stroma-free organoid culture system

[0073] The present disclosure is based in part on the discovery of the present inventors' chemically defined stroma-free organoid culture system, which can generate functional and distinct cellular context, including alveolar stem cell proliferation, maintenance and differentiation.The chemically defined culture system for the growth of pulmonary stem cells in three-dimensional culture (organoid) does not require the use of unknown growth components or feeder in culture.

[0074] As used herein, term " organoid " refers to the self-formed three-dimensional (3D) structure or entity that originates from stem cell that grows in culture.Organoid culture can reproduce the complexity of organ or express selected aspect of organ, such as by producing only certain types of cells.Alternatively, at a certain stage before differentiation, it can only be composed of stem cells.

[0075] Stem cells are cells that have both the ability to replicate themselves (self-renewal) and the ability to give rise to other cell types.When stem cells divide, the daughter cells can remain stem cells, or can become more specialized types of cells, or can give rise to other daughter cells that differentiate into one or more specialized cell types.Two types of mammalian stem cells are pluripotent embryonic stem cells derived from undifferentiated cells present in blastocysts or preimplantation embryos, and adult stem cells found in adult tissues or organs.Adult stem cells can maintain the normal turnover or regeneration of tissues or organs, and can repair and replenish cells in tissues or organs after damage.

[0076] As used herein, the term "stem cell" refers to an undifferentiated cell that can proliferate and self-renew and give rise to a progenitor cell that has the ability to generate one or more other cell types, or a precursor that can give rise to a differentiated cell.In certain cases, daughter cells or precursor or precursor cells can give rise to differentiated cells.In certain cases, daughter cells or precursor or precursor cells can themselves proliferate and self-renew and produce progeny that subsequently differentiate into one or more mature cell types.

[0077] Progenitor cells refer to cells that are similar to stem cells in that they can self-renew or differentiate into differentiated cell types, but progenitor cells are already more specialized or defined than stem cells.

[0078] The stem cells of the present disclosure can be derived from any animal, including, but not limited to, human, mouse, rat, rabbit, dog, pig, sheep, goat, and non-human primate.

[0079] Stem cells that can be grown by the organoid culture system of the present disclosure can be normal (e.g., cells derived from a subject's healthy tissue) or diseased cells (e.g., transformed cells, established cells, or cells derived from a diseased tissue sample).

[0080] In some embodiments, the organoid culture of the present disclosure can be derived from pulmonary stem cells.The division of pulmonary stem cells can promote the regeneration of lung structure.Examples of pulmonary stem cells include but are not limited to tracheal basal cells, bronchiolar secretory cells (also known as club cells or Clara cells), club variant cells, alveolar epithelial progenitor (AEP) cells, Clara variant cells, distal lung progenitor, p63+Krt5- airway cells, lineage-negative epithelial progenitor, bronchoalveolar epithelial stem cells (BASC), Sox9+p63+ cells, neuroendocrine progenitor cells, distal airway stem cells, submucosal gland duct cells, induced pluripotent stem cell-derived pulmonary stem cells and alveolar type 2 epithelial cells (referred to herein as AEC2 or AT2) cells.

[0081] In some embodiments, organoid culture contains alveolar type 2 cells. AEC2 cells can self-renew and act as the precursor of alveolar type 1 epithelial cells (AEC1). AEC2 cells can replenish AEC1 cell population under both steady state and injury conditions. In three-dimensional (3D) (organoid) culture, AEC2 cells can form alveolar spheres, which contain cells that express AEC2 cell markers (such as Sftpc, Sftpb, Lamp3, Lpcat7, HTII-280) and cells that express AEC1 cell markers (such as Ager (RAGE), Hopx and Cav1) and / or cells that express transitional status markers.

[0082] In some embodiments, the organoid cultures of the present disclosure can be derived from basal stem cells from organs including skin, mammary gland, esophagus, bladder, prostate, ovary, and salivary gland.

[0083] Accordingly, one aspect of the present disclosure provides a cell culture medium comprising, consisting of, or consisting essentially of serum-free medium and extracellular matrix components, wherein the cell culture medium is chemically defined and stroma-free.

[0084] The cell culture medium of the present disclosure can be used to culture a number of different cells. In some embodiments, the cell culture medium is a stem cell culture medium. In some embodiments, the cell culture medium is a pulmonary stem cell culture medium. In some embodiments, the cell culture medium is an alveolar type 2 cell culture medium. In some embodiments, the cell culture medium is a tumor cell culture medium (e.g., lung tumor cells). In some embodiments, the cell culture medium is a cell culture medium for pathogen-infected cells.

[0085] The term "cell culture medium," as used herein, refers to a nutrient-containing liquid, semi-liquid, or gelatinous substance in which cells or tissues can grow (e.g., proliferate, maintain, or differentiate).

[0086] The term "chemically defined medium," as used herein, refers to a medium in which all of the chemicals used in the medium are known and no yeast, animal, or plant tissue is present in the medium. A chemically defined medium can have all components in known amounts.

[0087] "Stroma-free" cell culture medium, as used herein, refers to a cell culture medium that does not contain stromal cells or interstitial connective tissue. Examples of stromal cells (which may be live or fixed) include, but are not limited to, immune cells, bone marrow-derived cells, endothelial cells, pericytes, smooth muscle cells, and fibroblasts.

[0088] The term "extracellular matrix component" or "ECM" refers to cell culture medium components that provide structure and biochemical support to surrounding cells. Extracellular matrix components can contain an interlocking meshwork of fibrous proteins and glycosaminoglycans. Extracellular matrix components of the present disclosure can include proteoglycans (e.g., heparan sulfate, chondroitin sulfate, keratin sulfate), hyaluronic acid, proteins, collagen (e.g., fibrillar (types I, II, III, V, XI), FACIT collagens (fibril-associated collagens with interrupted triple helices) (types IX, XII, XIV, XIX, XXI collagens and collagen type XXII alpha 1), short chain (collagen types VIII and X), basement membrane (collagen type IV) and collagen types VI, VII, XII), elastin, fibronectin, entactin, or laminin. The extracellular matrix component used in the culture medium described herein may be a gelatinous protein mixture secreted by Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells. Examples of extracellular matrix components include, but are not limited to, Matrigel™, type I collagen, Cultrex growth factor-reduced basement membrane, R-type or human laminin. In some embodiments, the extracellular matrix component is Matrigel. In other embodiments, the extracellular matrix component is Matrigel from BD Biosciences (San Jose, California) #354230.

[0089] The term "serum-free medium" or SFM refers to a medium containing one or more growth nutrients capable of supporting the growth of specific cell types in the absence of serum (e.g., a protein-rich fluid separated from clotted blood). Advantages of using serum-free medium include improved consistency between cell culture batches, elimination of the need for each batch of cell culture medium to be inspected for quality assurance before use, reduced risk of pathogen contamination, improved reproducibility of cell culture studies, and improved isolation and purification of cell culture products.

[0090] The term "growth nutrients" of serum-free medium can include a variety of components, such as small molecule compounds (e.g., SB431542, CHIR99021, BIRB796, DMH-1, or Y-27632), recombinant proteins (e.g., human EGF, mouse FGF10, mouse IL-1β, or mouse noggin), supplements (e.g., heparin, N-2, B-27 supplement, antibiotic-antimycotic, HEPES, GlutaMAX, or N-acetyl-L-cysteine), growth factors, enzyme inhibitors (e.g., trypsin inhibitor), essential vitamins, neuropeptides, neurotransmitters, and trace elements (e.g., copper, manganese, zinc, and selenium).

[0091] In some embodiments, serum-free medium can contain TGF-β inhibitor.Examples of TGF-β inhibitor include but are not limited to LTBP (latent TGF-β binding protein), A 77-01, A 83-01, AZ 12799734, D 4476, Galunisertib, GW 788388, IN 1130, LY 364947, R 268712, SB 505124, SB 525334, SD 208, SM 16, ITD 1, SIS3, N-acetylpuromycin, SB431542, RepSox and LY2109761.

[0092] In some embodiments, the serum-free medium can contain a GSK3 inhibitor. Examples of GSK-3 inhibitors include, but are not limited to, CHIR 99021, LiCl2, AT7519, CHIR-98014, TWS119, tideglusib, SB415286, BIO, SB216763, AZD2858, AZD1080, AR-A014418, TDZD-8, LY2090314, 2-D08, BIO-acetoxime, IM-12, 1-Azakenpaullone, or 6-bromoindirubin-3'-oxime.

[0093] In some embodiments, the serum-free medium can contain a p38 MAP kinase inhibitor. Examples of p38 MAP kinase inhibitors include, but are not limited to, SB202190, BIRB796, PD 169316, and SB203580.

[0094] In some embodiments, the serum-free medium can contain an anticoagulant (antithrombotic drug). Examples of anticoagulants include, but are not limited to, heparin or warfarin.

[0095] In some embodiments, the serum-free medium can contain one or more growth factors, such as epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), fibroblast growth factors (FGF) (e.g., FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22, and FGF23), insulin-like growth factor (IFN-γ), and / or IFN-γ. Growth factors or hormones for use in serum-free media include, but are not limited to, insulin-like growth factors (IGFs) (e.g., IGF-1, IGF-2), platelet-derived growth factor (PDGF), nerve growth factor (NGF), granulocyte-macrophage colony-stimulating factor, transferrin, stem cell factor (SCF), vascular endothelial growth factor (VEGF), transforming growth factor-alpha (TGF-alpha), brain-derived neurotrophic factor (BDNF), and transforming growth factor-beta (TGF-beta). Growth factors or hormones for use in serum-free media may be purified from plants or animals, or produced in bacteria or yeast using recombinant DNA technology.

[0096] In some embodiments, the serum-free medium can contain a ROCK (Rho kinase) inhibitor. Examples of ROCK inhibitors include, but are not limited to, Y27632, ripasudil (K-115), netarsudil (AR-13503), RKI-18, and RKI-11.

[0097] In some embodiments, the serum-free medium can include a basal medium supplement or base medium. Examples of basal medium supplements include, but are not limited to, insulin-transferrin-selenium and improved DMEM / F12 (Dulbecco's Modified Eagle's Medium / Ham's F-12). It will be understood that the culture medium of the present disclosure is scalable, and the volume of the medium can be adjusted according to the culture size.

[0098] In some embodiments, the serum-free medium may contain a substitute for L-glutamine. Examples of L-glutamine substitutes include, but are not limited to, Glutamax, L-alanyl-L-glutamine (AlaGln), and GlutaminePlus.

[0099] In some embodiments, the serum-free medium can include neuronal cell culture components, examples of which include, but are not limited to, B-27.

[0100] In some embodiments, the serum-free medium may contain a buffering agent. A buffering agent is a component of a cell culture medium that can maintain a physiological pH (e.g., about 7.2 to about 7.6). Examples of buffering agents suitable for use in the cell culture medium of the present disclosure include, but are not limited to, HEPES, sodium bicarbonate, and phenol red.

[0101] In some embodiments, the serum-free medium can contain an antioxidant. Examples of antioxidants suitable for use in the cell culture media of the present disclosure include, but are not limited to, N-acetyl-L-cysteine, ascorbic acid, and vitamin C.

[0102] In some embodiments, the serum-free medium can include antibiotics. Examples of antibiotics suitable for use in the cell culture media of the present disclosure include, but are not limited to, antibiotic-antimycotics, pen / strep, and gentamicin.

[0103] In some embodiments, the serum-free medium can comprise at least one growth nutrient selected from the group consisting of SB431542, CHIR 99021, BIRB796, heparin, EGF (e.g., human EGF, mouse EGF), FGF10, Y27632, insulin-transferrin-selenium, Glutamax, B27, N2, HEPES, N-acetylcysteine, antibiotic-antimycotic, and combinations thereof in modified DMEM / F12 (Dulbecco's Modified Eagle's Medium / Ham's F-12).

[0104] In some embodiments, the serum-free medium and extracellular matrix components of the cell culture medium are mixed in a ratio of about 1:1.

[0105] In some embodiments, the pulmonary stem cell (e.g., type 2 alveolar epithelial cell) culture medium comprises, consists of, or consists essentially of a 1:1 mixture of serum-free medium and Matrigel, wherein the serum-free medium contains 5 μM to 20 μM SB431542, 1 μM to 10 μM CHIR The medium contained 9902, 0.5-5 μM BIRB796, 2.5-20 μg / ml heparin, 5-50 ng / ml EGF, 5-10 ng / ml FGF10, 5-20 nM Y27632, insulin-transferrin-selenium (1.7 μM insulin, 0.068 μM transferrin, and 0.038 μM selenium), 0.5-2% Glutamax, 1-3% B27, 0.5-2% N-2, 10-20 mM HEPES, 0.75-2 mM N-acetylcysteine, and 0.5-2% antibiotic-antimycotic, all in a modified DMEM / F12 basal medium, which is stroma-free.

[0106] In some embodiments, the pulmonary stem cell (e.g., type 2 alveolar epithelial cell) culture medium comprises, consists of, or consists essentially of a 1:1 mixture of serum-free medium and Matrigel, wherein the serum-free medium comprises concentrations of approximately 10 μM SB431542, 3 μM CHIR 9902, 1 μM BIRB796, 5 μg / ml heparin, 50 ng / ml EGF, 10 ng / ml FGF10, 10 nM Y27632, insulin-transferrin-selenium (1.7 μM insulin, 0.068 μM transferrin, and 0.038 μM selenium), 1% Glutamax, 2% B27, 1% N-2, 15 mM HEPES, 1.25 mM N-acetylcysteine, and 1% antibiotic-antimycotic in modified DMEM / F12, and the medium is stroma-free.

[0107] Another aspect of the present disclosure provides a pulmonary stem cell (e.g., type 2 alveolar epithelial cell) culture growth medium. The terms "growth medium" or "serum-free, feeder-free" or "SFFF" are used interchangeably herein and refer to a cell culture medium capable of supporting the growth and proliferation of stem cells ex vivo.

[0108] The growth medium of the present disclosure can comprise serum-free medium and extracellular matrix components, wherein the culture medium is chemically defined and stroma-free, and wherein the growth medium further comprises one or more cytokines.

[0109] Cytokines are small proteins (e.g., approximately 5-20 kDa) that can play a role in cell signaling. Examples of cytokines include interleukin-1α (IL-1α), interleukin-1β (IL-1β), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), and interleukin-11. These include, but are not limited to, interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-13 (IL-13), interleukin-14 (IL-14), interleukin-15 (IL-15), interleukin-16 (IL-16), interleukin-17 (IL-17), interleukin-17 (IL-18), INF-α, INF-β, INF-γ, and tumor necrosis factor-α (TNF-α).

[0110] In some embodiments, the growth medium comprises a cytokine selected from the group consisting of IL-1β, TNFα, and / or a combination thereof. In some embodiments, the growth medium comprises murine IL-1β. In other embodiments, the growth medium comprises murine TNFα.

[0111] In some embodiments, the growth medium comprises IL-1β at a concentration of about 0.1 ng / mL to about 10 ng / mL, hi some embodiments, the growth medium comprises IL-1β at a concentration of about 10 ng / ml.

[0112] In some embodiments, the growth medium comprises TNFα at a concentration of about 0.1 ng / mL to about 10 ng / mL, hi some embodiments, the growth medium comprises TNFα at a concentration of about 10 ng / ml.

[0113] In some embodiments, the SFFF medium comprises, consists of, or consists essentially of SB431542, CHIR99021, BIRB796, Y-27632, human EGF, mouse FGF10, mouse IL-1β, heparin, B-27 supplement, antibiotic-antimycotic, HEPES, GlutaMAX, N-acetyl-L-cysteine, and modified DMEM / F12 basal medium.

[0114] In some embodiments, the SFFF medium comprises, consists of, or consists essentially of about 10 μM SB431542, about 3 μM CHIR99021, about 1 μM BIRB796, about 10 μM Y-27632, about 50 ng / ml human EGF, about 10 ng / ml mouse FGF10, about 10 ng / ml mouse IL-1B, about 5 μg / ml heparin, about 1× B-27 supplement, about 1× antibiotic-antimycotic, about 15 mM HEPES, about 1× GlutaMAX, and about 1.25 mM N-acetyl-L-cysteine ​​in modified DMEM / F12 basal medium.

[0115] In other embodiments, the SFFF medium comprises, consists of, or consists essentially of SB431542, CHIR99021, BIRB796, Y-27632, human EGF, human FGF10, heparin, B-27 supplement, antibiotic-antimycotic, HEPES, GlutaMAX, and N-acetyl-L-cysteine ​​in a modified DMEM / F12 basal medium.

[0116] In other embodiments, the SFFF medium comprises, consists of, or consists essentially of about 10 μM SB431542, about 3 μM CHIR99021, about 1 μM BIRB796, about 10 μM Y-27632, about 50 ng / ml human EGF, about 10 ng / ml human FGF10, about 5 μg / ml heparin, about 1× B-27 supplement, about 1× antibiotic-antimycotic, about 15 mM HEPES, about 1× GlutaMAX, and about 1.25 mM N-acetyl-L-cysteine ​​in a modified DMEM / F12 basal medium.

[0117] In some embodiments, the growth medium is formulated for human pulmonary stem cell (eg, human AEC2 cell) self-renewal.

[0118] It will be understood that some growth nutrients can be added to the culture medium of the present disclosure at different times and for different durations during the treatment period, which refers to the period during which the stem cells are in contact with the culture medium.

[0119] In some embodiments, one or more growth nutrients are present in the growth medium at all times throughout the treatment period. Examples of growth nutrients that may be present at all times in the growth medium include SB431542, CHIR99021, BIRB796, EGF, FGF10, heparin, B-27 supplement, antibiotic-antimycotic, HEPES, GlutaMAX and / or N-acetyl-L-cysteine.

[0120] In some embodiments, one or more growth nutrients are present in the growth medium for a limited duration of the treatment period (e.g., from days 0 to 4 of culture or only for the first 4 days). In some embodiments, a ROCK inhibitor (e.g., Y-27632) is present in the growth medium from days 0 to 4 of the treatment period. In some embodiments, a cytokine (e.g., IL-1β) is present only for the first 4 days of the treatment period.

[0121] The terms "proliferation," "proliferate," or "increase," when used in the context of pulmonary stem cell proliferation, refer to an increase in the number of pulmonary stem cells (e.g., AEC2 cells) by a statistically significant amount. The terms "proliferation," "proliferate," or "increase" refer to an increase of at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or up to and including 100% compared to a control or reference level, or at least about a 2-fold increase, or at least about 3-fold increase, or at least about 4-fold increase, or at least about 5-fold increase, or at least about 6-fold increase, or at least about 7-fold increase, or at least about 8-fold increase, or at least about 9-fold increase, or at least about 10-fold increase. A control / reference sample refers to a population of cells obtained from the same biological source that has not been expanded, e.g., using the growth medium or methods described herein, e.g., at the initiation of the growth medium culture or the initial number of cells added to the growth medium culture.

[0122] Another aspect of the present disclosure provides pulmonary stem cell (for example, type 2 alveolar epithelial cell) culture maintenance medium.Terms " maintenance medium " or " AMM " are used interchangeably herein and refer to the cell culture medium that can maintain the specific cellular status of cell in cell culture.For example, the maintenance medium of the present disclosure can be used to suppress the induction of AEC1 cell in such organoid, while maintaining AEC2 cell identity.

[0123] In some embodiments, the maintenance medium of the present disclosure comprises, consists of, or consists essentially of a growth medium of the present disclosure and a bone morphogenetic protein (BMP) inhibitor.

[0124] Examples of BMP inhibitors include, but are not limited to, noggin, DMH-1, chordin, gremlin, cross-veinless, USAG-1, LDN193189, follistatin, follistatin-like, DMH-2, LDN 212854, LDN 214117, dorsomorphin dihydrochloride, and combinations thereof. In some embodiments, the maintenance medium comprises a BMP inhibitor, and the BMP inhibitor is noggin or DMH-1. In some embodiments, the noggin is mouse noggin.

[0125] In some embodiments, the maintenance medium of the present disclosure comprises Noggin at a concentration of about 1 ng / ml to about 10 ng / ml. In some embodiments, the maintenance medium of the present disclosure comprises Noggin at a concentration of about 10 ng / ml.

[0126] In some embodiments, the maintenance medium of the present disclosure comprises DMH-1 at a concentration of about 0.1 μM to about 5 μM, hi some embodiments, the maintenance medium comprises DMH-1 at a concentration of about 1 μM.

[0127] In some embodiments, the BMP inhibitor is present in the maintenance medium for the entire duration of the treatment period.

[0128] In some embodiments, AMM medium comprises SB431542, CHIR99021, BIRB796, DMH-1, Y-27632, human EGF, mouse FGF10, mouse IL-1β, mouse noggin, heparin, B-27 supplement, antibiotic-antimycotic, HEPES, GlutaMAX, and N-acetyl-L-cysteine ​​in a modified DMEM / F12 basal medium.

[0129] In some embodiments, the AMM medium comprises, consists of, or consists essentially of about 10 μM SB431542, about 3 μM CHIR99021, about 1 μM BIRB796, about 1 μM DMH-1, about 10 μM Y-27632, about 50 ng / ml human EGF, about 10 ng / ml mouse FGF10, about 10 ng / ml mouse IL-1β, about 10 ng / ml mouse Noggin, about 5 μg / ml heparin, about 1× B-27 supplement, about 1× antibiotic-antimycotic, about 15 mM HEPES, about 1× GlutaMAX, and about 1.25 mM N-acetyl-L-cysteine ​​in modified DMEM / F12 basal medium.

[0130] In some embodiments, the maintenance medium is formulated for the maintenance of human pulmonary stem cells (eg, human AEC2 cells).

[0131] Another aspect of the present disclosure provides a differentiation medium for pulmonary stem cells (e.g., type 2 alveolar epithelial cells). The terms "differentiation medium" or "ADM" are used interchangeably herein and refer to a cell culture medium that can promote the differentiation of cells into different cellular contexts in cell culture. For example, the differentiation medium of the present disclosure can be used to convert AEC2 cells into AEC1 cells.

[0132] The differentiation medium of the present disclosure can include one or more growth factors and supplements. Additionally, the differentiation medium of the present disclosure can contain serum (e.g., fetal bovine serum, human serum).

[0133] The differentiation medium of the present disclosure can include a 1:1 mixture of differentiation medium and extracellular components (eg, Matrigel).

[0134] In some embodiments, the differentiation medium comprises, consists of, or consists essentially of at least one of ITS, Glutamax, heparin, EFG, FGF10, serum (e.g., fetal bovine serum or human serum) and antibiotic-antimycotic, and / or combinations thereof in a modified DMEM / F12 basal medium.

[0135] In some embodiments, the differentiation medium comprises concentrations of about ITS, insulin 1.7 μM, transferrin 0.068 μM, and selenite 0.038 μM, about 1% Glutamax, about 5 μg / ml heparin, about 5 ng / ml human EFG, about 1 ng / ml mouse FGF10, about 10% fetal bovine serum, and about 1% anti-anti (antibacterial and antifungal agents) in modified DMEM / F12 basal medium.

[0136] In some embodiments, the differentiation medium comprises human EGF, mouse FGF10, heparin, B-27 supplement, antibiotic-antimycotic, GlutaMAX, N-acetyl-L-cysteine, and fetal bovine serum in a modified DMEM / F12 basal medium.

[0137] In some embodiments, the differentiation medium comprises about 5 ng / ml human EGF, about 1 ng / ml mouse FGF10, about 5 μg / ml heparin, about 1× B-27 supplement, about 1× antibiotic-antimycotic, about 1× GlutaMAX, about 1.25 mM N-acetyl-L-cysteine, and about 10% FBS in a modified DMEM / F12 basal medium.

[0138] In some embodiments, the differentiation medium comprises human EGF, human FGF10, heparin, B-27 supplement, antibiotic-antimycotic, GlutaMAX, N-acetyl-L-cysteine, N-acetyl-L-cysteine, and human serum in a modified DMEM / F12 basal medium.

[0139] In some embodiments, the differentiation medium comprises about 5 ng / ml human EGF, about 1 ng / ml human FGF10, about 5 μg / ml heparin, about 1× B-27 supplement, about 1× antibiotic-antimycotic, about 1× GlutaMAX, about 1.25 mM, and about 10% human serum in modified DMEM / F12 basal medium.

[0140] In some embodiments, the growth nutrients of the differentiation medium are present in the differentiation medium for the entire duration of the treatment period.

[0141] In some embodiments, the differentiation medium does not contain inhibitors of TGFβ and p38 kinase.

[0142] In some embodiments, the differentiation medium is formulated for human pulmonary stem cell (eg, human AEC2 cell) differentiation.

[0143] In some embodiments, the differentiation medium of the present disclosure does not contain serum (fetal bovine serum or human serum) and is therefore considered a serum-free medium.

[0144] The serum-free differentiation medium of the present disclosure may contain cytokines instead of serum. In some embodiments, the serum-free differentiation medium of the present disclosure may contain IL-6 at a concentration of about 10 ng / ml to about 50 ng / ml. In some embodiments, the serum-free differentiation medium of the present disclosure contains IL-6 at a concentration of about 20 ng / ml.

[0145] In some embodiments, the serum-free differentiation medium of the present disclosure can be used to culture pulmonary stem cells (e.g., AEC2 cells) after the pulmonary stem cells have been cultured in maintenance medium or after the pulmonary stem cells have been cultured in the SFFF medium of the present disclosure.

[0146] Another aspect of the present disclosure provides a chemically defined, stroma-free organoid culture system for the culture, growth, maintenance and / or differentiation of alveolar epithelial cells, the system comprising isolated alveolar epithelial cells cultured in any of the media of the present disclosure.

[0147] In some embodiments of the system, the alveolar epithelial cells comprise type 2 alveolar epithelial cells. In other embodiments of the system, the alveolar epithelial cells comprise a mixture of AEC2 and AEC1 cells. In other embodiments of the system, the alveolar epithelial cells comprise predominantly AEC2 cells (e.g., greater than 50%, 60%, 70%, 80%, 90%, or 99%) in the culture medium at any given time. In other embodiments of the system, the alveolar epithelial cells comprise predominantly AEC1 cells (e.g., greater than 50%, 60%, 70%, 80%, 90%, or 99%) after treatment of the AEC2 cells with differentiation medium.

[0148] method

[0149] Yet another aspect of the present invention provides a method for expanding, maintaining and / or differentiating pulmonary stem cells in ex vivo organoid culture, comprising, consisting of, or consisting essentially of obtaining pulmonary stem cells and contacting the cells with the culture medium of the present disclosure.

[0150] The term "obtaining pulmonary stem cells" refers to a process of removing a cell or population of cells from a subject or lung sample in which it originally resides. Pulmonary stem cells can be obtained from healthy or diseased lung tissue in living or deceased subjects. Pulmonary stem cells can be obtained from subjects with a disease (pulmonary or otherwise) or at risk for developing a lung disease. Before the pulmonary stem cells are placed in contact with the culture medium of the present disclosure, the cells or population of cells can be separated and purified from other types of cells or tissues from the sample.

[0151] In some embodiments of the above-described methods, the pulmonary stem cells include tracheal basal cells, bronchiolar secretory cells (also known as club cells or Clara cells), club-variant cells, alveolar epithelial progenitor (AEP) cells, Clara cells, Clara-variant cells, distal lung progenitors, p63+Krt5- airway cells, lineage-negative epithelial progenitors, bronchoalveolar epithelial stem cells (BASC), Sox9+p63+ cells, neuroendocrine progenitor cells, distal airway stem cells, submucosal gland duct cells, induced pluripotent stem cell-derived pulmonary stem cells, and alveolar type 2 epithelial (AEC2) cells. In some embodiments, the pulmonary stem cells include alveolar type 2 epithelial (AEC2) cells.

[0152] In some embodiments of the above-described methods, the culture medium is a proliferation medium, a maintenance medium, or a differentiation medium of the present disclosure.

[0153] In some embodiments of the above-described methods, cytokines are added to the culture medium for about the first four days of culture.

[0154] In some embodiments, the growth, maintenance, or differentiation medium is formulated for use with human stem cells.

[0155] In some embodiments of the above-described methods, pulmonary stem cells are administered to the subject. In some embodiments of the above-described methods, pulmonary stem cells are administered to the subject in a therapeutically effective amount.

[0156] The terms "administration" or "administering," as applied to a human, primate, mammal, mammalian subject, animal, veterinary subject, placebo subject, research subject, experimental subject, cell, tissue, organ, or bodily fluid, refer to, without limitation, the contact of an exogenous ligand, reagent, placebo, small molecule, pharmaceutical agent, therapeutic agent, diagnostic agent, or composition with a subject, cell, tissue, organ, or bodily fluid, and the like. Administration can refer, for example, to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. "Administration" also encompasses in vitro and ex vivo treatments, for example, of a cell with a reagent, diagnostic, binding composition, or another cell.

[0157] Pulmonary stem cells (e.g., AEC2 cells) cultured by the systems and methods of the present disclosure can be administered to a subject (e.g., a human, mouse, monkey, or any mammal having lungs) by any route known in the art, including, but not limited to, intracerebroventricular, intracranial, intraocular, intracerebral, intraventricular, intratracheal, and intravenous.

[0158] In some embodiments of the above-described methods, the desired pulmonary stem cells can be expanded in vitro using the growth medium of the present disclosure to obtain sufficient numbers of cells required for therapy, research, or storage (e.g., by cryopreservation). In some embodiments, the desired pulmonary stem cells can be expanded in sufficient quantities for collection, injection, and / or engraftment in a subject (e.g., a human, a mouse, or any mammal having lungs).

[0159] In some embodiments of the above-described methods, the organoid cultures can be grown in sufficient quantities for use in gene editing or lung disease modeling.

[0160] Another aspect of the present disclosure provides a method for culturing lung tumor cells in the absence of fibroblasts, comprising isolating tumor cells from a subject and contacting the tumor cells with a growth medium described in any one of claims 7 to 12. The cell culture medium of the present disclosure can be used to grow tumor cells for use in generating tumor-based organoid models for research purposes (e.g., to understand cancer pathology or to test the efficacy of therapeutic agents).

[0161] Lung tumor cells can be isolated from a subject suffering from lung cancer. The isolated tumor cells can be primary lung tumors or secondary lung tumors (e.g., cancer that starts in another tissue and metastasizes to the lung). Examples of lung tumor cells include, but are not limited to, small cell lung cancer cells or non-small cell lung cancer cells, including, but not limited to, small cell carcinoma, combined small cell carcinoma, adenocarcinoma, squamous cell carcinoma, large cell carcinoma, Pancoast tumor cells, neuroendocrine tumor, or lung carcinoid tumor cells. Established lung cancer cell lines can also be used with the culture medium of the present disclosure. Lung cancer cell lines that can be used with the cell culture medium of the present disclosure can be found on the ATCC website.Examples of lung cancer cell lines include the EML4-ALK fusion-A549 isogenic cell line, NCI-H838 [H838], HCC827, SK-LU-1, HCC2935, HCC4006, NCI-H1819 [H1819], NCI-H676B [H676B], and Hs 618.T, HBE4-E6 / E7[NBE4-E6 / E7], NCI-H1666[H1666, H1666], NCI-H23[H23], NCI-H1435[H1435], NCI-H1563[H1563], 703D4 and NCI-H1688[H1688], NCI-H187[H187], NCI-H661[H661], NCI-H460[H460], NCI-H1299, NCI-H1155[H1155], DMS 114, NCI-H69[H69], DMS 79, DMS 53, SW 1271[SW1271, SW1271], SHP-77, NCI-H209[H209], NCI-H146[H146], NCI-H345[H345], NCI-H1341[H1341], DMS 153, NCI-H82[H82], NCI-H1048[H1048], NCI-H128[H128], NCI-H446[H446], NCI-H128[H128], NCI-H510A[H510A, NCI-H510], H69AR. HLF-a, Hs 913T, GCT [giant cell tumor], SW 900 [SW-900, SW900], LL / 2 (LLC1), HBE135-E6E7, Tera-2, NCI-H292 [H292], sNF02.2, NCI-H1703 [H1703], NCI-H2172 [H2172], NCI-H2444 [H2444], NCI-H2110 [H2110], NCI-H2135 [H2135], NCI-H2347 [H2347], NCI-H810 [H810], NCI-H1993 [H1993] and NCI-H1792 [H1792].

[0162] Another aspect of the present disclosure provides a method for culturing pathogen-infected pneumocytes, comprising, consisting of, or consisting essentially of culturing lung cells with a culture medium of the present disclosure and inoculating the lung cells with the pathogen in an amount effective to infect the lung cells.

[0163] Yet another aspect of the present disclosure provides a method for identifying an agent capable of treating or preventing pathogen infection in an organoid culture, comprising, or consisting essentially of: i) culturing cells in a medium of the present disclosure; ii) inoculating the cells with a pathogen in an amount effective to infect the cells; iii) contacting the cells with the agent; and iv) determining whether the agent causes a reduction in the amount of the pathogen in the cells compared to cells that have not been treated with the agent.

[0164] In some embodiments, before inoculating cells with pathogen, cell or organoid culture is contacted with drug.Before pathogen infection, contacting cell with drug can determine whether drug can act as prophylactic agent (for example, can prevent pathogen infection or reduce the severity).

[0165] In other embodiments, after inoculating the cells with a pathogen, the cell or organoid culture is contacted with a drug.Contacting the cells with a drug after infection by a pathogen can determine whether the drug can treat the pathogen infection.

[0166] In some embodiments, the reduction in the amount of pathogen in the cells compared to control cells not treated with the agent can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% reduction or up to and including 100% reduction, or about a half-fold or a third-fold or a quarter-fold or a fifth-fold or a sixth-fold or a seventh-fold or eighth-fold or a ninth-fold or tenth-fold reduction or any tenth-fold or less reduction compared to control cells or a reference level.

[0167] As used herein, the term "infect" or "infection" refers to the infection of a human, organoid, or cell with a disease-causing pathogen.

[0168] The pathogen may be a bacterium, a virus or a fungus.

[0169] In some embodiments, the pathogen is a bacterium, virus, or fungus that infects the lungs of humans or any animal that has lungs.

[0170] Bacteria that can infect the lungs include, but are not limited to, Bordetella pertussis, Streptococcus pneumonia, Haemophilus influenza, Staphylococcus aureus, Moraxella catarrhalis, Streptococcus pyogenes, Pseudomonas aeruginosa, Neisseria meningitidis, or Klebsiellapneumoniae.

[0171] Viruses that can infect the lungs include, but are not limited to, 229E (alphacoronavirus), NL63 (alphacoronavirus), OC43 (betacoronavirus), HKU1 (betacoronavirus), MERS-CoV (betacoronavirus that causes Middle East Respiratory Syndrome or MERS), SARS-CoV (betacoronavirus that causes Severe Acute Respiratory Syndrome or SARS), or SARS-CoV-2 (novel coronavirus that causes coronavirus disease 2019 or COVID-19), influenza-A virus (e.g., H1N1, H7N9, low pathogenic avian influenza, highly pathogenic avian influenza, or H5N1), influenza-B virus, respiratory syncytial virus (RSV), or enterovirus (e.g., enterovirus 71). In some embodiments, the virus is SARS-CoV-2.

[0172] Fungi that can infect the lungs include, but are not limited to, Aspergillus (Aspergillosis).

[0173] In some embodiments, the cells that can be infected by pathogens are tracheal basal cells, bronchiolar secretory cells, club variant cells, alveolar epithelial progenitor cells, Clara variant cells, distal lung progenitors, p63+Krt5- airway cells, lineage-negative epithelial progenitors, bronchoalveolar epithelial stem cells, Sox9+p63+ cells, neuroendocrine progenitor cells, distal airway stem cells, submucosal gland duct cells, induced pluripotent stem cell-derived lung stem cells, or alveolar type 2 epithelial cells. In some embodiments, the cells that can be infected by pathogens are alveolar type 2 epithelial cells (AEC or AT2).

[0174] In some embodiments, the culture medium used with the above-described methods is a proliferation medium of the present disclosure, a maintenance medium of the present disclosure, or a differentiation medium of the present disclosure.

[0175] "Drug" as used herein refers to a small molecule, protein, peptide, gene, compound or other pharmaceutically active ingredient that can be used in the treatment, prevention or amelioration of disease.

[0176] Another aspect of the present disclosure provides a method of reducing viral titer in pneumospheres infected with SARS-CoV-2, comprising, consisting of, or consisting essentially of contacting the pneumospheres with an agent before the pneumospheres are exposed to SARS-CoV-2, wherein the pneumospheres exhibit a reduced viral titer compared to pneumospheres that have not been contacted with the agent.

[0177] In some embodiments of the above-described method, the agent is an interferon. Interferons are a group of signaling proteins produced and released by host cells in response to the presence of some viruses. The interferon can be type I, type II, or type III interferon. Examples of interferons include, but are not limited to, INF-α, INF-β, INF-ε, INF-k, INF-w, INF-γ, IL10R2, and INFR1. In some embodiments, the interferon is IFNα and IFNγ.

[0178] kit

[0179] Another aspect of the present disclosure provides a kit comprising, consisting of, or consisting essentially of a chemically defined, stroma-free organoid culture system for the culture, growth, maintenance and / or differentiation of alveolar epithelial cells, the kit comprising, consisting of, or consisting essentially of the medium of the present disclosure and instructions for use.

[0180] Another aspect of the present disclosure provides a kit comprising a chemically defined, stroma-free organoid culture system for determining agents that treat or prevent bacterial, viral, and fungal infections in organoid cultures, the kit consisting of, or consisting essentially of, the medium of the present disclosure and instructions for use.

[0181] Another aspect of the present disclosure provides a kit comprising a chemically defined, stroma-free organoid culture system for determining agents that treat or prevent bacterial, viral, and fungal infections ex vivo and in vivo in organoid cultures or derivatives thereof, the kit consisting of, or consisting essentially of, the medium of the present disclosure and instructions for use.

[0182] The following examples are offered by way of illustration and not by way of limitation. [Example]

[0183] Materials and Methods

[0184] mouse

[0185] Sftp ctm1(cre / ERT2)Blh (Sftpc-CreER), Rosa26R-CAG-lsl-tdTomato were maintained on a C57BL / 6 background. NU / J (nude), B6J.129(Cg)-Igs2 tm1.1(CAG-cas9*)Mmw / J(H11-Cas9) and B6.129S4-Krastm4Tyj / J(Kras-lsl-G12D) were obtained from the Jackson Laboratory. Ctgf-GFP was a generous gift from the University of California, Los Angeles. Sftpc-GFP mice were previously described (Blanpain et al., 2014, Science 344, 1242281). For lineage tracing, mice were given 0.2 mg / g tamoxifen (Sigma-Aldrich, St. Louis, MO) by oral gavage. For bleomycin injury, 2.5 U / kg bleomycin was administered intranasally 2 weeks after the final dose of tamoxifen, and mice were monitored daily. Animal experiments were approved by the Duke University Institutional Animal Care and Use Committee.

[0186] Mouse lung tissue dissociation and FACS sorting

[0187] Lung dissociation and FACS were performed as previously described (Chung et al., 2018, Development, 145(9):1-10). Briefly, lungs were inflated intratracheally with 1 ml of enzyme solution containing dispase (5 U / ml), DNase I (0.33 U / ml), and collagenase type I (450 U / ml) in DMEM / F12. Isolated lung lobes were diced and incubated with 3 ml of enzyme solution for 30 minutes at 37°C with rotation. The reaction was quenched with an equal volume of DMEM / F12 + 10% FBS medium and filtered through a 100 μm filter. The cell pellet was resuspended in red blood cell lysis buffer (100 μM EDTA, 10 mM KHCO3, 155 mM NH4Cl) for 5 minutes, washed with DMEM / F12 containing 10% FBS, and filtered through a 40 μm filter. Total cells were centrifuged at 450 g for 5 minutes at 4° C. and the cell pellet was processed for AT2 isolation by FACS.

[0188] Human Lung Tissue Dissociation

[0189] Human lung dissociation was performed as previously described (Zacharias et al., 2018, Nature 555, 251-255). Briefly, the pleura was removed, and the remaining human lung tissue (approximately 2 g) was washed with PBS containing 1% antibiotic-antimycotic and cut into small pieces. Visible small airways and blood vessels were carefully removed to avoid clogging. The sample was then digested with 30 ml of an enzyme mixture (collagenase type I: 1.68 mg / ml, dispase: 5 U / ml, DNase: 10 U / ml) at 37°C for 1 hour with rotation. Cells were filtered through a 100 μm filter and rinsed with 15 ml of DMEM / F12 + 10% FBS medium that had been passed through the filter. After centrifugation at 450 g for 10 min, the supernatant was removed and the cell pellet was resuspended in red blood cell lysis buffer for 10 min, washed with DMEM / F12 containing 10% FBS, and filtered through a 40 μm filter. Total cells were centrifuged at 450 g for 5 min at 4°C, and the cell pellet was processed for AT2 isolation.

[0190] Isolation of human and mouse AT2 cells

[0191] AT2 cells were isolated using magnetic-activated cell sorting (MACS) or fluorescence-activated cell sorting (FACS) protocols. For mouse AT2 isolation, total lung cell pellets were resuspended in MACS buffer (1x PBS, pH 7.2, 1% BSA, and 2 mM EDTA). CD31 / CD45-positive cells were depleted using MACS beads according to the manufacturer's instructions. After CD31 / CD45 depletion, AT2 cells were sorted based on the TdTomato reporter. For reporter-free AT2 cells, cells were stained using the following antibodies: EpCAM / CD326, PDGFRα / CD140a, and Lysotracker, as previously described (Katsura et al., 2019, Stem Cell Reports, 12(4):657-666). For the isolation of human AT2 cells, approximately 2 to 10 million total lung cells were resuspended in MACS buffer and incubated with human TruStain FcX for 15 minutes at 4°C, followed by HTII-280 (1:60 dilution) antibody for 1 hour at 4°C. Cells were washed twice with MACS buffer and then incubated with anti-mouse IgM microbeads for 15 minutes at 4°C. Cells were loaded onto an LS column, and labeled cells were collected magnetically. For FACS-based purification of human AT2 cells, the total lung cell pellet was resuspended in MACS buffer. Cells were positively selected for the EpCAM population using CD326 (EpCAM) microbeads according to the manufacturer's instructions. CD326-selected cells were stained with HTII-280 and LysoTracker for 25 minutes at 37°C, followed by secondary Alexa anti-mouse IgM-488 for 10 minutes at 37°C. Sorting was performed using a FACS Vantage SE and a Sony SH800S.

[0192] Alveolar sphere (organoid) culture

[0193] Conventional murine alveolar sphere culture (using MTEC medium) was performed as previously described (Barkauskas et al., 2013, J. Clin. Invest. 123, 3025-3036). Briefly, FACS-sorted lineage-tagged AT2 (1–3 × 10) cells derived from Sftpc-CreER;R26R-lsl-tdTomato mice were cultured in MTEC medium. 3 ) cells, and PDGFRα + (5×10 4 ) Cells were resuspended in MTEC / Plus or serum-free medium and mixed with an equal volume of growth factor-reduced Matrigel (BD Biosciences, San Jose, CA, #354230).

[0194] For feeder-free culture, AT2 (1–3 × 10 3 Cells (800 cells / well) were resuspended in serum-free medium and mixed with an equal volume of Matrigel. For Transwell culture, 24-well 0.4 μm Transwell inserts (Falcon) were seeded with 100 μl of the medium / Matrigel mixture. For drop culture, three 50 μl droplets of the cell-medium / Matrigel mixture were plated in each well of a 6-well plate. The medium was changed every other day.

[0195] Serum-free medium was prepared in modified DMEM / F12 (Thermo, Waltham, MA) containing 10 μM SB431542 (Abcam, Cambridge, UK), 3 μM CHIR99021 (Tocris, Bristol, UK), 1 μM BIRB796 (Tocris, Bristol, UK), 5 μg / ml heparin (Sigma-Aldrich, St. Louis, MO), 50 ng / ml human EGF (Gibco), 10 ng / ml mouse FGF10 (R&D systems, Minneapolis, MN), and 10 μM The serum-free medium contained Y27632 (Selleckchem, Houston, TX), insulin-transferrin-selenium (Thermo, Waltham, MA), 1% Glutamax (Thermo, Waltham, MA), 2% B27 (Thermo, Waltham, MA), 1% N2 (Thermo, Waltham, MA), 15 mM HEPES (Thermo, Waltham, MA), 1.25 mM N-acetylcysteine ​​(Sigma-Aldrich, St. Louis, MO), and 1% antibiotic-antimycotic (Anti-Anti) (Thermo, Waltham, MA). For alveolar growth medium, 10 ng / ml mouse IL-1b (BioLegend, San Diego, CA) and 10 ng / ml mouse TNFα (BioLegend, San Diego, CA) were added. For alveolar maintenance medium, 10 ng / ml mouse noggin (Peprotech, Rocky Hill, NJ) and 1 μM DMH-1 (Tocris, Bristol, UK) were added to alveolar growth medium. Alveolar differentiation medium contained ITS, Glutamax, 5 μg / ml heparin, 5 ng / ml human EGF, 1 ng / ml mouse FGF10, 10% fetal bovine serum, and 1% antibiotic-antimycotic (anti-anti) in modified DMEM / F12.

[0196] See Table 1 for detailed SFFF and AMM medium compositions.

[0197] [Table 1]

[0198] HTII-280 for human alveolar sphere culture + Human AT2 (1–3 × 10 3 The cells were resuspended in serum-free medium, mixed with an equal volume of Matrigel, and plated in a 6-well plate. For detailed mouse and human serum-free, feeder-free (SFFF) medium compositions, see Tables 1 and 2.

[0199] [Table 2]

[0200] Alveolar sphere subculture

[0201] Mouse alveolar sphere subculture experiments were performed in AMM medium with the composition described above. Briefly, FACS-sorted mouse AT2 cells (2 × 10 3 The cells (3 × 10 cells) were resuspended in AMM medium and mixed with an equal volume of Matrigel. Three droplets of 50 μl of the cell-medium / Matrigel mixture were plated into each well of a 6-well plate for each biological replicate (n=3). For each passage, mouse IL-1β (10 ng / ml) was added for the first 4 days, after which the medium was replaced with AMM without IL-1β. The medium was changed every 3 days. Mouse alveolar spheres were passaged every 10 days. For human alveolar sphere passage, AT2 cells (3 × 10 cells) were used. 3 Cells (800 cells / 1000 cells) were resuspended in SFFF medium and mixed with an equal volume of Matrigel. Three 50 μl droplets of the cell-medium / Matrigel mixture were plated into each well of a 6-well plate per donor (n=3). Alveolar spheres were passaged every 10–14 days.

[0202] AT2 differentiation

[0203] For detailed mouse and human AT2 differentiation medium (ADM) compositions, see the table. For differentiation, unless otherwise noted, mouse alveolar spheres were cultured in AMM medium for 10 days, then switched to AT2 differentiation medium and cultured for an additional 7 days. For differentiation, unless otherwise noted, human alveolar spheres cultured in SFFF medium for 10 days were switched to ADM and cultured for an additional 12–15 days. The medium was changed every 3 days. Human AT2 differentiation medium contains human serum instead of FBS. The differentiation medium can also contain IL-6 (20 ng / mL) instead of serum.

[0204] Alveolar sphere infection experiments for bulk RNAseq and qPCR studies

[0205] To infect the pneumosphere cultures, cells were washed with 1 ml of PBS, and then virus was added to the cells at an MOI of 1. Virus and cells were incubated for 3.5 hours at 37°C, after which the virus was removed and cell culture medium was added. Infection was allowed to proceed for 48 or 120 hours, after which the pneumospheres were washed with PBS and dissociated as described above. Finally, pneumosphere-derived cells were stored in Trizol and stored at -80°C.

[0206] Infection of AT2 pneumocytes with SARS-CoV-2

[0207] Human alveolar sphere cultures were briefly washed twice with 500 μl 1x PBS. SARS-CoV-2-GFP (icSARS-CoV-2-GFP) virus was previously described (Hou et al., 2020). Briefly, seven cDNA fragments covering the entire SARS-CoV-2 WA1 genome were amplified by RT-PCR using PrimeSTAR GXL HiFi DNA polymerase. The junction between each fragment contains a non-palindromic BsaI (GGTCTCN) or BsmBI (CGTCTCN) site, each with a unique four-nucleotide overhang. Fragments E and F contain two BsmBI sites at both ends, while the other fragments have a BsaI site at the junction. Each fragment was cloned into the high-copy vector pUC57 and verified by Sanger sequencing. A silent mutation, T15102A, was introduced into a conserved region in nsp12 of plasmid D as a genetic marker. GFP was inserted by replacing the ORF7 gene. The culture was then diluted with 200 μl of 1 × 10 7 Cultures were inoculated with 200 μl of 1x PBS for either PFU / ml of icSARS-CoV-2-GFP virus (Hou et al., 2020) or mock cultures. The pneumocytes were incubated at 37°C for 2 hours under 5% CO2 supplemented conditions. After incubation, the inoculum was removed, and the pneumocyte cultures were washed three times with 500 μl of 1x PBS. 1 mL of SFFF medium was added to each culture. The pneumocytes were incubated at 37°C for 72 hours, with samples taken every 24 hours during infection. For sampling, 100 μl of medium was removed. An equal volume of fresh medium was then added to the culture to replace the sampled volume. The virus titer was finally determined after 72 hours by plaque assay in Vero E6 cells (USAMRIID). Viral plaques were visualized after 3 days by neutral red staining (Hou et al., 2020). For histological analysis, alveolar spheres were fixed in 10% formalin solution for 7 days and then washed three times in PBS.

[0208] Interferon treatment

[0209] For interferon and cytokine treatment experiments, human AT2 cells (2.5 × 10 ) from passages P2 or P3 were used. 4 AT2 cells were cultured on a matrigel surface. Prior to cell plating, 12-well plates were pre-coated with matrigel (1:1 mix of matrigel and SFFFM) for 30 minutes. AT2 cells were grown in SFFFM without IL-1β for 7–10 days to form alveolar spheres. For RNA isolation and quantitative PCR, alveolar spheres were treated with 20 ng / ml interferon (IFNα, IFNβ, IFNγ) for 12 or 72 hours. For histological analysis, alveolar spheres were treated with the indicated interferon for 72 hours. Prior to viral infection, human alveolar sphere cultures were pretreated with 10 ng IFNα or 10 ng IFNγ for 18 hours. For IFN inhibition studies, alveolar spheres were treated with 1 μM ruxolitinib throughout the culture period.

[0210] RNA isolation and qRT-PCR

[0211] For RNA isolation, alveolar spheres were dissociated into a single-cell suspension using TrypLE™ Select enzyme at 37°C for 10 minutes. The cell pellet was resuspended in 300 μl of TRIzol™ LS Reagent. Total RNA was extracted using the Direct-zol RNA MicroPrep Kit according to the manufacturer's instructions with DNase I treatment. Reverse transcription was performed from 600 ng of isolated total RNA from each sample using SuperScript III and random hexamers or minus-strand-specific primers. Quantitative RTPCR assays were performed using the StepOnePlus system (Applied Biosystems) with PowerUp™ SYBR™ Green master mix. The relative mRNA content of all target genes was determined using the standard curve method. Target gene transcripts in each sample were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primers used are listed in Table 3.

[0212] [Table 3-1] [Table 3-2]

[0213] Bulk RNA sequencing and differential gene expression analysis

[0214] Purified RNA (1 μg) from each sample was enriched for poly(A) RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs, Ipswich, MA, #E7490). Libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs, Ipswich, MA, #E7770). Paired-end sequencing (150 bp per read) was performed using a HiSeq X with at least 15 million reads per sample. The quality of the sequenced reads was assessed using FastQC (www.bioinformatics.babraham.ac.uk / projects / fastqc / ). Poly(A / T) tails were trimmed using Cutadapt (Martin, 2011). Adapter sequences were trimmed, and reads shorter than 24 bp were trimmed using Trimmomatic (Bolger et al., 2014). Reads were mapped to the human (hg38) and SARS-CoV2 (wuhCor1) reference genomes obtained from UCSC using Hisat2 (Kim et al., 2019) with default settings. Duplicate reads were removed using SAMtools (Li et al., 2009). Fragment counts were calculated using the featureCounts option in SUBREAD (Liao et al., 2014). Normalization and extraction of differentially expressed genes (DEGs) between control and treatment were performed using the R package, DESeq2 (Love et al., 2014).

[0215] Tumor organoid cultures

[0216] Tumors were induced in K-raslsl-G12D;Rosa26R-CAG-lsl-tdTomato mice using an adenovirus carrying Cre recombinase and GFP (SignaGen Laboratories, SL100706). At approximately 6–8 weeks of age, mice were cultured with approximately 2.5 × 10 cells in 100 μl of PBS. 7 The mice were infected intranasally with plaque-forming units of virus. Lungs were isolated at least 8 months after tumor induction. Visible tumor nodules were manually dissected under a microscope and dissociated as described above. Cells were stained with anti-EPCAM / CD326 antibody and Lysotracker, and tumor cells were sorted into tdTomato+, EPCAM+, and Lysotracker+ populations using a SONY SH800S. FACS-sorted cells were resuspended in medium and mixed with an equal volume of Matrigel. 2 × 10 cells were collected in 50 μl. 3 Three droplets containing 100 cells were plated in a 6-well plate. The medium was changed every other day.

[0217] Organoid-derived cell grafting

[0218] On days 10–12, organoids were dissociated into single cells using Accutase (Sigma-Aldrich) followed by 0.25% trypsin-EDTA treatment and resuspended in serum-free medium containing 1% Matrigel and 10 mM EDTA. Ten days after intranasal administration of bleomycin, nude mice were treated with 5–7 × 10 5 80 μl of medium containing 10 cells was injected intratracheally. At least 2 months after grafting, lungs were fixed and analyzed.

[0219] Tissue preparation and sectioning

[0220] Transwell-derived lungs and alveolar spheres were fixed with 4% paraformaldehyde (PFA) for 4 hours at 4°C and 30 minutes at room temperature, respectively. Droplet-derived organoid cultures were first immersed in 1% low-melting-point agarose (Sigma) and fixed with 4% PFA for 30 minutes at room temperature. For OCT frozen blocks, samples were washed with PBS and incubated with 30% sucrose overnight at 4°C. Samples were then incubated with a 1:1 mixture of 30% sucrose / OCT for 4 hours at 4°C, embedded in OCT, and cryosectioned (10 μm). For paraffin blocks, samples were dehydrated, embedded in paraffin, and sectioned at 7 μm.

[0221] immunostaining

[0222] Paraffin sections were first dewaxed and rehydrated before antigen retrieval. Antigen retrieval was performed using 10 mM sodium citrate buffer in an antigen retrieval system (Electron Microscopy Sciences, Hatfield, PA) or a water bath (90°C for 15 minutes) or 0.05% trypsin (Sigma-Aldrich, St. Louis, MO) treatment for 5 minutes at room temperature. Sections were washed with PBS, permeabilized, and blocked with 3% BSA and 0.1% Triton X-100 in PBS for 30 minutes at room temperature, followed by overnight incubation with primary antibodies at 4°C. Next, sections were washed three times with 0.05% Tween®-20 in PBS (PBST), incubated with secondary antibodies in blocking buffer for 1 hour at room temperature, washed three times with PBST, and mounted using Fluor G reagent with DAPI. Primary antibodies were as follows: prosurfactant protein C (Millipore, Burlington, MA ab3786, 1:500), RAGE / AGER (R&D systems, Minneapolis, MN, MAB1179, 1:250), HOPX (Santa Cruz Biotechnology, Dallas, TX, sc-30216, 1:250, sc-398703, 1:250), T1a / PODOPLANIN (DSHB, clone 8.1.1, 1:1000), KRT8 (DSHB, TROMA-I, 1:50), tdTomato (ORIGENE, AB8181-200, 1:500), CLDN4 (Invitrogen, Carlsbad, CA 95660, 1:200), GFP (Novus Biologicals, Littleton, CO, NB100-1770, 1:500).

[0223] To quantify staining in near-single cell suspensions, alveolar sphere bubbles were dissociated using TrypLE™ Select Enzyme for 15 minutes at 37°C. Matrigel was disrupted by vigorous pipetting. Alveolar sphere-derived cells were then plated onto coverslips or chamber slides pre-coated with Matrigel (5-10% Matrigel for 30 minutes) for 2-3 hours. Cells were then fixed in 4% paraformaldehyde.

[0224] electron microscope

[0225] Organoids were fixed in 2.5% glutaraldehyde (Electron Microscopy Sciences, EMS, Hatfield, PA) in 0.1 M cacodylate buffer, pH 7.4 (Electron Microscopy Sciences, EMS, Hatfield, PA) for 3 hours at room temperature. Next, the samples were washed three times in 0.1 M cacodylate for 10 minutes each, post-fixed in 1% tannic acid (Sigma) in 0.1 M cacodylate buffer for 5 minutes at room temperature, and washed three times again in 0.1 M cacodylate buffer. Organoids were post-fixed overnight in 1% osmium tetroxide (Electron Microscopy Sciences, EMS) in 0.1 M cacodylate buffer at 4°C in the dark. The samples were washed three times in 0.1 N acetate buffer for 10 minutes each and block-stained in 1% uranyl acetate (Electron Microscopy Sciences, EMS, Hatfield, PA) for 1 hour at room temperature. The samples were then dehydrated in ice-cold acetone (70%, 80%, 90%, and 100%) for 10 minutes each, followed by incubation with propylene oxide for 15 minutes at room temperature. The samples were then transferred to EMbed 812 (EMS) and left at room temperature for 3 hours. The samples were then transferred to fresh EMbed 812 and left at room temperature overnight. They were then embedded in freshly prepared EMbed 812 and polymerized overnight at 60°C. The embedded samples were sectioned at 70 nm, and the grids were stained with 1% uranyl acetate in water for 5 minutes at room temperature, followed by lead citrate for 2.5 minutes at room temperature. The sections on the grids were imaged on an FEI Tecnai G2 Twin at 2200x and 14500x magnifications.

[0226] Whole mount imaging

[0227] For lung whole-mount imaging, lungs were fixed with 4% PFA and cleared with CUBIC-15. Images were obtained using a fluorescence stereoscope (Zeiss Lumar.V12). For organoids, AEC2 cells isolated from Sftpc-CreER;Rosa26R-lsl-tdTomato were grown in alveolar growth medium on 35 mm glass-bottom culture dishes. Organoids were fixed in 4% PFA for 30 minutes at room temperature on days 7 and 10 of culture. Next, samples were washed four times in PBST (1x PBS + 0.1% Triton X-100) for 30 minutes each, blocked in blocking solution (1.5% BSA in 1x PBS + 0.3% Triton X-100) for 1 hour at room temperature, and then incubated overnight at 37°C with anti-SFTPC (1:500, Millipore, Burlington, MA) and anti-AGER (1:500 R&D) in blocking solution. The organoids were then washed in PBST (4x30 min), incubated with secondary antibody in PBST for 1 hour at 37°C, washed once in PBST + DAPI for 30 min, and twice in PBST for 30 min each at room temperature. Images were captured using an Olympus FV3000 confocal microscope with a 20x or 40x objective.

[0228] Live imaging

[0229] AEC2 cells isolated from Sftpc-GFP mice were grown on 35 mm glass-bottom culture dishes in alveolar growth medium for 3 days. DIC images were acquired at 20-minute intervals using a microscope (VivaView-Olympus). After 3 days of imaging (day 6 of culture), the medium was replaced, and imaging was resumed (day 8 of culture) and continued for another 2 days.

[0230] Plasmid construction, AAV6 production and HITI-based gene editing in organoids

[0231] An Sftpc-specific gRNA vector was prepared using AAV:ITR-U6-sgRNA-hSyn-Cre-2AEGFP-KASH-WPRE-shortPA-ITR (Addgene plasmid #60231) as a backbone. First, the hSyn-Cre-2A-EGFP-KASH-WPRE cassette was removed by XbaI and RsrII digestion, and the EGFP gene flanked by gRNA binding sequences was cloned into the plasmid. Using the web tool "CHOPCHOP" for selecting CRISPR / Cas9 target sites, an Sftpc-specific gRNA was designed near the end of the coding region and inserted into the SapI site downstream of the U6 promoter. The CRISPR / Cas9 target sequence (20 bp target and 3 bp PAM sequence (underlined)) used in this study was GGATGCTAGATATAGTAGAGTGG (SEQ ID NO: 01). Small-scale AAV production followed a recently published method. Briefly, HEK293T cells were plated in 12-well plates and then transfected with 0.4 μg AAV plasmid, 0.8 μg helper plasmid pAd-DeltaF6, and 0.4 μg serotype 2 / 6 plasmid per well using PEI Max (Polysciences, Warrington, PA; 24765) when the cells reached 60-80% confluency. After 12 hours, the cells were then incubated for 2 days in glutamine-free DMEM (ThermoFisher, Waltham, MA; 11960044) supplemented with 1% Glutamax (ThermoFisher, Waltham, MA; 35050061) and 10% FBS. The AAV-containing supernatant medium was collected, filtered through a 0.45 μm filter tube, and stored at 4°C until use. For gene editing, AEC2 (EPCAM+Lysotracker+ cells) were isolated from H11-Cas9 mice. AEC2 (5 × 10 4The organoids were resuspended in alveolar growth medium and incubated with 100 μl of AAV-containing supernatant for 1 hour at 37°C with rotation. The cells were washed with PBS, resuspended in alveolar growth medium, mixed with an equal volume of Matrigel, and plated in a 6-well plate. The alveolar growth medium was changed every other day. Once the organoids were grown, they were dissociated into single cells as described above, and GFP+ cells were purified by FACS.

[0232] Droplet-based single-cell RNA sequencing (Drop-seq)

[0233] Matrigel-embedded organoids were incubated with Actase for 20 minutes at 37°C, followed by 0.25% trypsin-EDTA for 10 minutes at 37°C. Trypsin was inactivated using DMEM / F-12 Ham supplemented with 10% FBS, and the cells were then resuspended in PBS supplemented with 0.01% BSA. Cells filtered through a 40-μm filter were used at 100 cells / μl to pass through the microfluidic channel at flow rates of 3,000 μl / h for cells, 3,000 μl / h for mRNA capture beads, and 13,000 μl / h for droplet-generating oil. The DNA polymerase for the pre-amplification step (one cycle of 95°C for 3 minutes, 15–17 cycles of 98°C for 15 seconds, 65°C for 30 seconds, 68°C for 4 minutes, and one cycle of 72°C for 10 minutes, adapted from ) was replaced with Terra PCR Direct polymerase (#639271, Takara). The other processes were performed as described in the original Drop-seq protocol. The library was sequenced using HiSeq X and 150-bp paired-end sequencing.

[0234] Computational analysis for Drop-seq

[0235] FASTQ files were processed using dropSeqPipe v0.3 (hoohm.github.io / dropSeqPipe) and mapped to the GRCm38 genome with annotation version 91. The unique molecular identifier (UMI) counts were then further analyzed using the R package Seurat v3.0.6 (Stuart et al., 2019). UMI counts were normalized using SCTransform v0.2 (Hafemeister and Satija, 2019). Principle components that were significant based on the Jackstraw plot were used to generate t-SNE plots. After removing duplicates, specific cell clusters were identified based on the enrichment of Sftpc, Sftpa1, Sftpa2, Sftpb, Lamp3, Abca3, Hopx, Ager, Akap5, Epcam, Vim, Pdgfra, Ptprc, Pecam1, and Mki67 in the tSNE plot.

[0236] Computational analysis for single-cell RNA sequencing of COVID-19 patient lungs

[0237] Publicly available single-cell RNA-seq datasets for six severe COVID-19 patient lungs (GSE145926 (Bost et al., 2020, Cell, 181(7):1475-1488)) and control lungs (GSE135893 (Habermann et al., 2019)) were obtained from Gene Expression Omnibus (GEO). EpCAM-positive epithelial cell clusters in severe COVID-19 patient lungs were further clustered based on LAMP3, ABCA3, KRT5, KRT15, ​​DNAH1, FOXJ1, SCGB3A1, and SCGB1A1. AT2 cells with UMI counts of ≥1 for LAMP3, NKX2-1, and ABCA3 were used for comparison between severe COVID-19 patient lungs and control lungs. UMI counts were normalized and regressed against the percentage of mitochondrial genes using SCTransform. Genes enriched in severe COVID-19 patient and control lungs were extracted using FindMarkers and displayed in a Volcano plot guided by the R package Enhanced Volcano v1.5.4. Genes with ≥2 log2 fold changes were used as input for Enrichr (Kuleshov et al., 2016) queries to obtain enriched signaling pathways from the database - BioPlanet.

[0238] statistics

[0239] Sample size was not predetermined. Data were presented as means with standard errors (sem) to indicate variation within each experiment. Statistical analysis was performed in Excel, Prism, and R. A two-tailed Student's t-test was used for comparisons between two experimental conditions. For experiments with three or more conditions, statistical significance was calculated by ANOVA followed by the Tukey-HSD method. The Shapiro-Wilk test was used to test whether the data were normally distributed, and the Wilcoxon rank-sum test was used for comparisons between two conditions that showed non-normal distribution. For three or more conditions, we used the Steel-Dwass test. Example 1 Establishing chemically defined conditions for alveolar organoid cultures

[0240] Previous studies have demonstrated that lung-resident PDGFRa+ fibroblasts can support the growth of AEC2 when co-cultured in MTEC medium containing serum and many unknown components (see Methods section for details) (Schwartz et al., 2018, Ann. Am. Thorac. Soc. 15, S192-S197; Barkauskas et al., 2013, J. Clin. Invest. 123, 3025-3036; Frank et al., 2016, Cell Rep. 17, 2312-2325; Katsura et al., 2019, Stem Cell Rep. 12, 657-666; Lee et al., 2014, Cell 156, 440-455; Lee et al., 2013, Am. J. Respir. Cell Mol. Biol. 48, 288-298). Interestingly, AEC2s do not replicate in the absence of PDGFRa+ fibroblasts, implying that either paracrine or contact-mediated signals emanating from fibroblasts are essential for AEC2 proliferation.

[0241] To investigate the nature of the communication (i.e., paracrine or contact-mediated), we set up an AEC2-fibroblast coculture system in three different modes: i) AEC2 cells only (condition A); ii) AEC2 and fibroblasts were physically separated (condition B); and iii) AEC2 mixed with fibroblasts (condition C). We found that condition C produced the highest colony-forming efficiency (CFE) (8.71% ± 0.92%), while condition B produced moderate to low CFE (2.40% ± 0.10%), and no organoids (0% ± 0%) were observed in condition A (Figure 1A-C). These data suggest that short-range paracrine signaling mediates communication between fibroblasts and AEC2 cells, without the need for contact-mediated signaling.

[0242] To identify paracrine signaling between these cells, we performed single-cell transcriptome analysis on cells derived from the coculture system described above. After quality control filtering, k-means clustering and stochastic neighbor embedding (t-SNE) were performed to visualize the cells. Two major clusters were identified: EpCAM+ epithelial cells and Vimentin+ / Pdgfra stromal cells. Notably, two smaller clusters (<10 cells each) were observed: EpCAM+ endothelial cells and Ptprc+ immune cells (Figure 2A, 2B, and 2C). Within the epithelial cell cluster, three subclusters were observed: Sftpc+ AEC2, Ager+ AEC1, and Sftpc+ / Mki67+ proliferating AEC2. Notably, Acta2+ / Pdgfra+ myofibroblasts were found within Pdgfra+ cells. These data indicate that 3D organoid cultures resemble their in vivo counterparts in cellular diversity and gene expression profiles. scRNA-seq analysis pointed to receptor-ligand interactions in developmental pathways between epithelial and stromal cells in alveolar organoid cultures, but these processes occur spontaneously and are likely mediated by the stroma and serum-containing culture conditions.

[0243] To achieve a more defined culture system, we mined the scRNA-seq data described above to identify ligand-receptor pairs expressed in epithelial and fibroblast cells. We found many signaling pathway components differentially enriched in AEC2 and fibroblast cells. In particular, many ligands of the wnt (wnt4, wnt5a), BMP (Bmp4, Bmp5), TGFb (Tgfb1, Tgfb3), and FGF (Fgf2, Fgf7, Fgf10) signaling pathways were found in fibroblasts, while the corresponding receptors were identified in AEC2: wnt (Fzd1, Fzd2), BMP (Bmpr1a, Bmpr2), TGFb (Tgfbr1, Tgfbr2), and FGF (Fgfr1, Fgfr2) (Figures 2D and 2E). Interestingly, inhibitors of BMP (Fst, Fstl1, Grem1) and TGFβ (Ltbp1, Ltbp2, Ltbp3) were also found to be enriched in fibroblasts. These data indicate that fibroblasts can dynamically and spatially regulate both proliferation and differentiation of AEC2.

[0244] To develop a serum-free and chemically defined medium for AEC2 culture, we used small molecule modulators or ligands for specific receptors for pathway modulation. Previous studies have demonstrated that activation of the wnt and EGF pathways and inhibition of the TGFβ pathway are essential for AEC2 replication. Additionally, scRNA-seq-guided interactome analysis further supported the requirement for wnt and EGF and inhibition of the TGFβ pathway for AEC2 maintenance and replication (Figure 2D and Figure 2E). Therefore, we formulated a basal medium containing known concentrations of essential nutrients critical for cell growth and supplemented this medium with CHIR, EGF, and SB431542. When this medium was tested in an AEC2-fibroblast coculture system, we found that AEC2s could grow in this medium without the need for serum or other unknown factors derived from bovine pituitary extract, despite low colony size and colony size. Using this medium as the basal medium, other pathways were examined, including p38 kinase inhibition (known to enhance the EGF pathway), FGF7, FGF9, and FGF10. While a moderate effect of p38 inhibition on AEC2 proliferation was observed, both FGF7 and FGF10, alone or in combination, produced the greatest CFE. When both FGF7 and FGF10 were added to organoid cultures, organoid CFE (10.7% ± 2.6% in SCE vs. 13.5% ± 1.2% in SCE + p38i vs. 15.9% ± 0.6% in SCE + p38i + FGF7 vs. 16.5% ± 0.7% in SCE + p38i + FGF10 vs. 15.4% ± 0.7% in SCE + p38i + FGF7 + 10 [n = 3] day 15; mean ± SEM) was significantly increased. There was no additive effect on the size (629.7 ± 170.7 μm in SCE, vs. 823.8 ± 228.3 μm in SCE + p38i, vs. 967.6 ± 304.8 μm in SCE + p38i + FGF7, vs. 921.1 ± 271.2 μm in SCE + p38i + FGF10, vs. 812.3 ± 256.2 μm in SCE + p38i + FGF7 + 10 [n = 3]; mean ± SEM) of the cells (Figures 3A, 3B, and 3C).Notably, we found a significant increase in CFE (9.8% ± 0.8% [n = 3] in MTEC vs. 22.0% ± 0.5% [n = 3] in serum-free medium at day 10; mean ± SEM) and colony size (505.0 ± 104.7 μm in MTEC vs. 1228.2 ± 363.7 μm in serum-free medium [n = 3]; mean ± SEM) in the freshly formulated medium (Figures 4A, 4B, and 4C).

[0245] Immunofluorescence analysis for the AEC2 (SFTPC) and AEC1 (AGER, also known as RAGE) markers revealed that the organoids were composed of both AEC2 and AEC1 (data not shown). Notably, many cells co-expressing the AEC2 and AEC1 markers were observed.

[0246] These data demonstrated that the new medium described in this example can replace the serum and bovine pituitary extract present in the previously used MTC medium. Example 2 Transient IL1 treatment overcomes fibroblast dependency in organoid cultures

[0247] To test whether the above-mentioned medium could support AEC2 cell growth without fibroblasts, AEC2 organoid cultures were set up in the absence of fibroblasts. Significantly smaller and fewer organoids were observed under these conditions, indicating that AEC2 cells require additional factors for their growth. Previous studies have demonstrated that IL1β / TNFα-mediated NFkB signaling is essential for AEC2 cell replication and regeneration after injury and functions as a component of the AEC2 niche (Katsura et al., 2019, Stem Cell Rep. 12, 657-666). Therefore, IL1s and TNFα were added to the above-mentioned serum-free medium to test whether these conditions could replace fibroblasts in AEC2 organoid cultures. Numerous organoids with significantly larger sizes were observed compared to controls (without IL1β / TNFα). Notably, CFE in IL1β-treated cultures reached a similar efficiency to that in fibroblast-containing conditions. In addition, immunofluorescence analysis suggests that these organoids are composed of both AEC2 and AEC1. Similar organoid size (433.4 ± 77.7 μm without IL1s / TNFa vs. 857.2 ± 339.5 μm with IL1β / TNFa [n=3]; mean ± SEM) and CFE (4.0% ± 0.3% without IL1β / TNFa [n=3] vs. 21.0% ± 1.3% with IL1β / TNFa [n=3], day 15; mean ± SEM) were observed with IL1β alone or TNFa alone or in combination, indicating that either IL1s or TNFa is sufficient to replace fibroblasts while maintaining AEC2 self-renewal and differentiation (Figures 5A, 5B, and 5C, and data not shown). IL1β / TNFα-mediated NFkB signaling is known to have pleiotropic functions in regulating cell proliferation, survival and apoptosis, and is involved in early stages of the tissue injury repair process in vivo.LaCanna et al., 2019, J. Clin. Invest. 129, 2107-2122;Karin et al., 2009, Cold Spring Harb. Perspect. Biol. 1, a000141, DiDonato et al., 2012, Immunol. Rev. 246, 379-400, Cheng et al., 2007, J. Immunol. Baltim. Md 1950 178, 6504-6513.

[0248] Therefore, we asked whether IL1β treatment was necessary at the initial stage or throughout the entire culture period. To examine this, we removed IL1β at different times after organoid culture setup. Compared to continuous supplementation (20.91% ± 1.61%, n = 3; mean ± SEM), no decrease in CFE was observed even when IL1β was removed from the culture medium on day 3 (19.85%, n = 2), day 5 (20.35% ± 0.30%, n = 3), or day 7 (19.33% ± 0.84%, n = 3) (Figures 6A and 6B).

[0249] We also examined the effect of human IL-1β on human alveolar sphere cultures. On day 7, human IL-1β was removed from the medium containing human alveolar spheres from three individual donors and cultured for an additional 7–15 days (Figure 7A). Treatment with IL-1β significantly enhanced the number and size of organoids (which reflect growth rate) (Figure 7B, 7C, and 7D).

[0250] Taken together, these data revealed that transient IL1β stimulation at the early stage of organoid culture is sufficient to replace fibroblasts when AEC2s are cultured in a newly established serum-free, feeder-free condition (hereafter referred to as alveolar growth medium). Example 3 AEC2 derived from defined culture conditions are functional in vivo and ex vivo

[0251] The presence of lamellar bodies is used as a benchmark assay to define the identity and function of AEC2 (Beers, et al., 2017, Am. J. Respir. Cell Mol. Biol. 57, 18-27). Electron microscopy was performed to examine the presence of lamellar bodies in the AEC2 cells derived from our organoid culture. A schematic diagram and representative images of alveolar spheres derived from labeled (tdTomato+) cells cultured in SFFF medium on days 10 and 15 are shown in Figure 8A. Numerous lamellar bodies were observed in the AEC2 cells derived from organoids (Figure 8B).

[0252] To test whether mouse AEC2 cells can be passaged, organoid-derived cells were sub-passaged for 5 passages. Quantification of cell number over 5 passages revealed an exponential increase in the total number of cells over the passages, demonstrating that they can self-renew and maintain marker expression (Figure 9A and Figure 9B).

[0253] To test whether human AEC2s can be passaged, HTII-280+ cells were isolated and purified from a human donor (Figure 10A). Imaging and quantification of cell number in organoids cultured in SFFF medium showed that they maintained AEC2 marker expression and self-renewal over several passages out of 10 (Figures 10B, 10C, 10D, 10E, and 10F). Organoids cultured in IL-1β maintained AEC2 marker expression and self-renewal over several passages (Figures 10G, 10H, 10I, and 10J). Organoid cultures in IL-1β maintained differentiation potential over several passages (Figures 10K and 10L), and organoids cultured in SFFF medium maintained differentiation potential over several passages out of 10 (Figures 10M and 10N).

[0254] Next, we tested the amenability of organoid cultures to Cas9 / Crispr-mediated genome editing. To test this, we used a recently described homology-independent transgene integration (HITI) method to insert T2A-GFP-encoding DNA into the 3' end of the Sftpc gene coding sequence. Successful gene editing was visualized by GFP expression in clonally derived AEC2 organoids (Figure 11A). These data serve as proof-of-concept that our organoid conditions are amenable to gene editing and disease modeling. Recent studies have used organoid-based tumor models to study tumor formation ex vivo. Indeed, recent studies have used MTEC medium to culture lung adenocarcinoma cells in the presence of fibroblasts.

[0255] To test whether the newly established culture medium was suitable for culturing lung tumor-derived cells in the absence of fibroblasts, we isolated tumor nodules from Kras G12D / tdTomato mice and purified tdTomato tumor cells (Figure 11B). We set up organoid cultures using these tumor cells in our newly established medium in the absence of stromal cells and directly compared them with MTEC medium. Interestingly, tumor cells generated numerous organoids in the new medium but not in MTEC medium (CFE, 0.7% ± 0.2% in MTEC vs. 20.0% ± 1.4% in alveolar growth medium [n = 3], day 5; mean ± SEM) (Figures 11C, 11D, and 11E). These data demonstrated that the newly established medium conditions supported tumor cell growth ex vivo, even in the absence of stromal cells.

[0256] Finally, organoid-derived cells were tested for their ability to engraft in vivo. To test this, a tdTomato-labeled cell suspension was intratracheally injected into the lungs of nude mice that had been administered bleomycin to injure the lungs (Figure 11F). Two months after injection, patches of tdTomato+ cells were observed in the injured lungs (Figure 11G and Figure 11H). Immunofluorescence and histological analysis further revealed that the engrafted cells integrated into the regenerated tissue and expressed markers of AEC2 and AEC1, indicating successful engraftment of organoid-derived cells (Figure 11I). Taken together, organoid-derived cells derived from the newly established culture resembled the in vivo correlate of AEC2, were amenable to gene editing, and were able to functionally integrate into regenerating tissue in the engraftment assay. Example 4 Chemically defined conditions for AEC2 maintenance and differentiation

[0257] Immunofluorescence analysis for AEC2 and AEC1 markers in organoids derived from alveolar growth medium indicated that the majority of cells (nearly 80%) co-expressed AEC2 and AEC1 markers, indicating that these conditions promote both AEC2 and AEC1 identity in the same cells (Figures 12A, 12B, and 12C). Interestingly, scRNA-seq-guided epithelial-stromal cell interactome revealed that BMP signaling ligands (Bmp4) and inhibitors (Fst, Fstl1, and Grem1) were expressed in AEC2 and stromal cells, respectively (Figures 2D and 2E). Furthermore, recent studies have suggested that BMP signaling is involved in the differentiation of AEC2 to AEC1 (Chung et al., 2018, Development 145, dev163014; Lee et al., 2014, Cell 156, 440-455). It was therefore hypothesized that in the absence of stromal cells, BMP ligands produced by AEC2 cells act in an autocrine manner to induce differentiation.

[0258] To test whether inhibition of BMP signaling blocks the emergence of AEC1 cell identity while maintaining AEC2 cell identity, we supplemented alveolar growth medium with inhibitors of BMP signaling (noggin and DMH1). Whole-mount immunostaining and quantification for SFTPC and RAGE revealed a dramatic reduction in the number of RAGE-expressing organoids (down by 30%) and the number of RAGE-expressing cells (>5%) in each organoid (Figures 12D and 12E). Analysis of AEC2 and AEC1 markers further revealed that organoids cultured in alveolar maintenance medium maintained self-renewal properties for six passages (Figures 12F–12J). These data demonstrated that alveolar growth medium containing BMP inhibitors (referred to as alveolar maintenance medium) maintained AEC2 cell identity while suppressing the induction of AEC1 cells in such organoids (Figure 13).

[0259] These data are consistent with previous studies showing that BMP signaling is required for AEC1 differentiation. However, complete differentiation of AEC2 to AEC1 cells was not observed when organoids were treated with BMP4 ligand, suggesting that BMP signaling is necessary but not sufficient to induce differentiation.

[0260] To identify factors that could induce differentiation of AEC2 cells into AEC1 cells, we tested various molecules previously thought to promote differentiation (dexamethasone, T3, BMP4, TGFs, and IBMX (a phosphodiesterase inhibitor)). In the experiments described above using serum-containing MTEC medium, spontaneous differentiation of AEC2 cells was observed. Therefore, we suspected that reducing or completely eliminating factors that promote AEC2 growth, combined with a small amount of serum, might stimulate differentiation. To test this, mouse lung-derived AEC2 cells were cultured in maintenance medium for 10 days. We then removed the inhibitors of TGF and p38 kinase, reduced the amount of EGF and FGF (10-fold), and added 10% fetal bovine serum to the medium (hereafter referred to as alveolar-Diff medium), and cultured the cells for 10 days (Figure 14A). A significant increase in the number of RAGE, HOPX, and T1a+ cells was observed in the alveolar-Diff medium. Single-cell transcriptome analysis of cells derived from alveolar-Diff medium clearly indicates that these organoids are composed of a large number of AEC1 cells.Notably, the number of proliferating AEC2 cells is significantly reduced, indicating that factors present in serum can prevent AEC2 proliferation, further confirming the importance of the developed and described alveolar growth medium (Figure 14B, Figure 14C and Figure 14D).

[0261] In summary, and as described herein, culture conditions for the proliferation, maintenance, and differentiation of AEC2 in organotypic culture were determined. Example 5 Chemically defined (serum-free) conditions for alveolar stem cell differentiation

[0262] To identify factors that could induce AEC2 differentiation into AEC1, we mined scRNA-seq data from organoids co-cultured with fibroblasts. Conclude withWe searched for molecules expressed in fibroblasts that could be associated with IL6. An enrichment of IL6 transcripts was identified in fibroblasts (Figure 15A). Previous studies have shown that AEC2 express the IL6 receptor (Zepp et al., 2017, Cell, 170(6):1134-1148). To test whether IL6 is sufficient to induce AEC2 differentiation, we cultured mouse AEC2 in alveolar maintenance medium for 10 days and expanded AEC2 in organoid culture. Next, the organoids were treated with alveolar differentiation medium lacking serum but supplemented with IL6 (20 ng / mL) and cultured for an additional 10 days. Immunostaining analysis of organoids cultured in this medium revealed strong expression of AEC1 markers, including AGER (Figure 15B). Similarly, human AEC2s were cultured in SFFF medium for 14 days before the medium was replaced with ADM (serum-free) supplemented with IL6 (20 ng / mL) (Figure 15C). These studies further demonstrated that IL6 treatment was sufficient to induce differentiation of both mouse and human AEC2s into AEC1s in culture.

[0263] To test whether SARS-CoV-2 can infect alveolar sphere-derived AT2 cells, we utilized a recently developed reverse-engineered SARS-CoV-2 virus carrying a GFP fusion protein (Hou et al., 2020, Cell, 182(2):429-446). Human alveolar spheres were cultured on Matrigel surfaces in SFFF medium (lacking IL1β) for 10–12 days, incubated with SARS-CoV-2-GFP for 2 hours, washed with PBS to remove residual viral particles, and then harvested for analysis over 72 hours (Figure 16A). GFP was detected as early as 48 hours postinfection in virus-exposed alveolar spheres but not in control alveolar spheres (Figure 16B). Subsequent plaque formation assays using culture supernatants revealed that viral shedding peaked at 24 hours but subsequently declined (Figure 16C). This observation was consistent across cells from three different donors. Notably, despite numerous washes with PBS, significant numbers of viral particles were observed immediately after infection. This result was likely due to viral encapsulation in Matrigel. Nevertheless, viral titers increased at 24 hpi, demonstrating that SARS-CoV-2 productively replicates in AEC cells (Figure 16C). Quantitative RT-PCR further revealed the presence of viral RNA in SARS-CoV-2-infected cells compared to controls (Figure 16D). D To further confirm viral replication, we performed qRT-PCR using primers specifically recognizing the negative strand of the virus. Indeed, viral replication in the alveolar sphere cultures was observed (Figure 16E). Example 7 AT2 activates interferon and inflammatory pathways in response to SARS-CoV-2 infection

[0264] To gain insight into the AT2 response to wild-type SARS-CoV-2, we performed unbiased genome-wide transcriptome profiling of alveolar sphere cultures 48 hours after infection. Of all sequenced reads, viral transcripts accounted for 4.7% and human transcripts for 95.3%, indicating that the virus was propagating in AT2. Previous studies have shown that in response to viral infection, target cells typically produce type I (IFN-I) and type III (IFN-III) interferons (a / b and λ, respectively), which subsequently activate targets of the transcription factors IRF, STAT1 / 2, and NF-κB, including interferon-stimulated genes (ISGs), inflammatory chemokines, and cytokines, which proceed to exert antiviral defense mechanisms (Barrat et al., 2019, Nat. Immunol. 20, 1574-1583). Therefore, differential gene expression analysis of infected versus uninfected alveolar spheres revealed enrichment of transcripts related to general virus response genes, including multiple interferons (IFNs) and their targets. Specifically, SARS-CoV-2-infected AT2 cells were enriched for transcripts of type III IFNs (IFNL1, IFNL2, and IFNL3) along with type I IFNs (IFNA7, IFNB1, and IFNE), but not type II IFN (IFNG) ligands (Figures 17A and 17B). Receptors for type I (IFNAR1 and IFNAR2), type II (IFNGR1 and IFNGR2), and type III (IFNLR1 and IL10RB) IFNs were expressed in control AT2 cells, and a modest increase in IFNAR2 and IFNGR2 was found after SARS-CoV-2 infection (Figures 17A and 17C) (Platanias, 2005; Syedbasha and Egli, 2017).

[0265] These data indicate that in response to SARS-CoV-2 infection, AT2 produces type I and III IFN ligands, which potentially act via either autocrine or paracrine (neighboring AT2) mechanisms to activate their cognate receptors. Indeed, numerous IFN target genes, including IFN-stimulated genes (ISGs), IFN-inducible protein-encoding genes (IFIs), and IFN-inducible protein with tetratricopeptide repeats-encoding genes (IFITs), were upregulated in SARS-CoV-2-infected AT2 cells (Figures 17A and 17D). Furthermore, the key transcription factors STAT1 and STAT2, known to be components of the signaling pathway downstream of the IFN receptor, were also upregulated in infected AT2 cells.

[0266] Pathway analysis revealed that all three classes of IFN targets were upregulated, most notably type I and type II IFN signaling. Despite the absence of type II IFN ligand (IFNG), significant upregulation of canonical targets of IFNγ response mediators was observed in SARS-CoV-2-infected AT2 cells (Figures 17A and 17D). This finding suggests significant overlap in downstream targets and crosstalk between different classes of IFN pathways, as previously described (Barrat et al., 2019; Bartee et al., 2008). Other notable upregulated genes included chemokines (CXCL10, CXCL11, and CXCL17) and programmed cell death-related genes (TNFSF10, CASP1, CASP4, CASP5, and CASP7) (Figure 17A). In contrast, we observed significant downregulation of transcripts related to DNA replication and cell cycle (PCNA, TOP2A, MCM2, and CCNB2) in infected AT2 cells (Figure 17A). Selected targets (IFNA7, IFNB1, IFNL1, IFIT1, IFIT2, IFIT3, IL1A, IL1B, IL6, and CSCL10) were validated using independent quantitative RT-PCR assays at early (48 h) and late (120 h) time points postinfection. Collectively, transcriptome analysis revealed significant upregulation of interferon, inflammatory, and cell death signaling, alongside downregulation of proliferation-related transcripts, in alveolar sphere-derived AT2 cells in response to SARS-CoV-2. Example 8 SARS-CoV-2 infection induces surfactant loss and lung cell death

[0267] To gain further insight into how primary AT2 cells respond early to SARS-CoV-2 infection, we used immunohistochemistry to analyze cellular changes in alveolar spheres 24 to 72 hours after infection. Quantification of infected alveolar spheres revealed that 29.22% were SARS+ (Figure 18A). Immunostaining revealed coexpression of GFP and SARS-CoV-2 spike protein in infected alveolar spheres. Variation in the number of GFP+ cells in each alveolar sphere was observed. Thus, alveolar spheres were broadly categorized as low (1–10 cells) or high (>10 cells) depending on the number of SARS+ cells in each alveolar sphere (Figure 18B). Next, analysis of AT2 cell markers, including SFTPC, SFTPB, and HTII-280, revealed a dramatic loss or reduction in the expression of surfactant proteins SFTPC and SFTPB in infected cells (GFP+ or SARS+), but not in control alveolar spheres (Figure 18C). Notably, HTII-280 expression was unchanged in SARS-CoV-2-infected human alveolar spheres, as visualized by immunostaining. Loss of surfactant protein expression was more evident in highly infected alveolar spheres, as visualized by immunostaining. Although some GFP+ cells exhibited a slightly elongated morphology resembling AT1 cells, immunostaining for AT1 cell markers revealed that infected cells did not differentiate into AT1 cells, as visualized by co-immunostaining to detect SARS-CoV-2 and AGER. These data are consistent with our scRNA-seq data, which showed that AT2 downregulates surfactant expression in response to SARS-CoV-2 infection.

[0268] Histopathological evidence suggests loss of alveolar parenchyma in COVID-19 lungs (Huang et al., 2020, Lancet Lond. Engl. 395, 497-506). To examine whether SARS-CoV-2 infection induces cell death, we performed immunostaining for activated caspase 3, a marker of apoptotic cells. Apoptotic cells were found in virus-exposed pneumocytes but not in controls, suggesting that AT2 cells undergo cell death in response to SARS-CoV-2 infection. Strikingly, cell death was observed in both SARS+ and SARS- cells, suggesting paracrine mechanisms leading to cell death in uninfected neighboring cells (Figure 18D). Furthermore, immunostaining for Ki67, a marker of proliferating cells, revealed no obvious difference in overall cell replication in virus-exposed pneumocytes compared with controls (Figure 18E). Collectively, these data indicate that SARS-CoV-2 infection induces downregulation of surfactant proteins and increased cell death in AT2 cells through both cell-autonomous and non-autonomous mechanisms. Example 9 Transcriptome-wide similarities in AT2 from SARS-CoV-2-infected pneumocytes and COVID-19 lungs

[0269] To directly compare the SARS-CoV-2-induced response in AT2 cells in pneumocytes with the changes seen in COVID-19 lungs, we utilized publicly available scRNA-seq datasets derived from bronchoalveolar lavage fluid (BALF) samples from six severe COVID-19 patients (Bost et al., 2020, Cell, 181(7):1475-1488; Liao et al., 2020, Nature Medicine, 26:842-844). We first compared the gene expression profiles of AT2 cells from COVID-19 patient lungs with those from healthy lungs (Figure 19). We found significant upregulation of chemokine (CXCL10, CXCL14, and IL32), interferon target (IFIT1, ISG15, and IFI6), and cell death (TNFSF10, ANXA5, and CASP4) pathway-related transcripts in COVID-19 patient AT2 cells (Figures 20A and 20B). Interestingly, surfactant genes, including SFTPA1, SFTPA2, SFTPB, SFTPC, and SFTPD, as well as NAPSA, a gene product that catalyzes the processing of pro-forms of surfactant proteins into mature proteins, were significantly downregulated in COVID-19 patient AT2 cells, while other AT2 cell markers showed minimal and negligible changes (Figures 20A and 20B). Pathway analysis revealed significant enrichment of type I and type II IFN signaling, inflammatory programs, and cell death pathways in COVID-19 AT2 cells. Next, we directly compared transcripts between AT2 cells from SARS-CoV-2-infected ex vivo cultures and COVID-19 patient lungs. This revealed striking similarities in upregulated transcripts. These included upregulation of chemokines and cytokines, including IFN ligands and their targets, indicating that AT2 cells derived from alveolar spheres respond similarly to AT2 cells derived from human lungs after SARS-CoV-2 infection. Example 10 AT2 responds to exogenous IFN and recapitulates features associated with SARSCoV-2 infection

[0270] Transcriptome analysis revealed striking similarities in interferon signatures in alveolar spheres and AT2 cells derived from human lungs after SARS-CoV-2 infection. Previous studies have shown that IFN induces cellular changes in a context-dependent manner. For example, IFN Na and IFN b provide protective effects in response to influenza virus infection in the lung, whereas IFN g induces apoptosis in intestinal cells in response to chronic inflammation (Koerner et al., 2007, J. Virol. 81, 2025-2030; Takashima et al., 2019, Sci. Immunol. 4(42)). To examine the direct effects of IFN on AT2 cells, alveolar spheres were treated with purified recombinant IFN Na, IFN b, and IFN g in SFFF medium and cultured for 72 hours. First, we observed detached cells across all treatments, with a maximum effect of nearly threefold increase in IFNg-treated alveolar spheres (Figure 21A). Immunostaining for activated caspase 3 revealed a significant induction of cell death in response to all IFN treatments, with the greatest effect being with IFNg (Figure 21B). In contrast, a significant reduction in cell proliferation was observed with IFNb and IFNg treatments, as revealed by immunostaining for Ki67, a marker of cell proliferation (Figure 21C). Strikingly, immunostaining revealed a reduction in SFTPB expression in alveolar spheres treated with all IFNs compared to controls. A similar trend was observed for SFTPC and SFTPB transcripts, as assessed by qRT-PCR (Figures 21D and 21E). These data are consistent with transcriptome data from AT2 alveolar spheres following SARS-CoV-2 infection. Notably, treatment with IFNa, IFNb, and IFNg significantly enhanced the levels of ACE2 but not TMPRSS2 transcripts, consistent with previous studies in other cell types (Hou et al., 2020; Ziegler et al., 2020) (Figures S21F and S21G). A similar trend was observed in SARS-CoV-2-infected cells, suggesting a positive loop involving IFN and ACE2 that subsequently amplifies SARS-CoV-2 infection (Figure S21H). Example 11 Pretreatment with IFN reduces SARS-CoV-2 replication in alveolar spheroids

[0271] Recent studies have suggested that IFN pretreatment reduced SARS-CoV-2 replication in Calu-3 and Vero-2 cells. Because the above data from IFN treatment alone resulted in increased AT2 cell death, we examined the effect of pretreatment of alveolar spheres with IFN before viral infection. Therefore, alveolar spheres were pretreated with lower doses of IFNα and IFNγ (10 ng) for 18 hours prior to viral infection (Figure 22A). Subsequent plaque formation assays at 24 and 48 hours postinfection revealed that IFN pretreatment significantly reduced viral titers in alveolar spheres (Figure 22B). In addition, we examined the effect of IFN signaling inhibition on viral replication. To do this, alveolar spheres were pretreated with ruxolitinib, an inhibitor of IFN signaling, for 18 hours, and treatment continued after viral infection (Figure 22A). Plaque formation assays revealed increased viral replication (Figure 22B). Taken together, these data suggest that pretreatment with IFN confers a protective effect, whereas IFN inhibition promotes viral replication.

[0272] Consideration

[0273] Using alveolar sphere cultures, we demonstrated that AT2 expresses the SARS-CoV-2 receptor, ACE2, and is susceptible to viral infection. Transcriptome profiling further revealed the emergence of a "proinflammatory landscape" in AT2, activating the expression of numerous IFN, cytokine, chemokine, and cell death-related genes at later time points after infection. These data are consistent with previous studies showing a delayed host innate immune response after SARS-CoV (2003) infection until later time points (Menachery et al., 2014, mBio, 5(3): e01174-14), but also highlight the need for dynamic analysis of the host response at different time points after infection. Both transcriptome and immunohistochemical analyses revealed downregulation of surfactant proteins in SARS-CoV-2-infected alveolar spheres. The finding that the type II IFN pathway is activated in AT2 cells ex vivo is surprising, since it is the type I and type III pathways that are typically activated in cells upon viral infection (Barrat et al., 2019, Nat. Immunol. 20, 1574-1583; Bartee et al., 2008, Curr. Opin. Microbiol. 11, 378-383). Remarkably, these unexpected findings from pneumosphere-derived AT2 mirrored responses in AT2 cells derived from COVID-19 patient lungs, further supporting the relevance of pneumosphere-derived AT2 for SARS-CoV-2 research.

[0274] This study provided further evidence that pretreatment with IFN exhibited preventive efficacy in alveolar globules.

[0275] There are several reasons why AT2 cells grown in organoid cultures are preferred over currently used cell lines such as Calu-3, A549, Vero, and H1299. For example, A549 cells, derived from a human lung adenocarcinoma, have been widely used as a surrogate for alveolar epithelial cells in viral infection studies. However, the A549 cell line lacks core characteristics of lung epithelial cells, including the ability to form epithelial tight junctions; it also possesses numerous genetic alterations (Osada et al., 2014, Genes Genomes 21, 673-683). More importantly, A549 cells do not express the SARS-CoV-2 receptor, ACE2, and viral infection studies rely on ectopic expression of this receptor. Therefore, transformed cell lines do not faithfully recapitulate native lung epithelial cells (Mason and Williams, 1980, Biochim. Biophys. Acta 617:36-50). In contrast, alveolar spheroids, which are based on alveolar stem cells (AT2), are highly polarized epithelial structures that retain their molecular and morphological characteristics and maintain the ability to differentiate into AT1 cells under appropriate conditions.

[0276] Those skilled in the art will readily appreciate that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The disclosure described herein is presently representative of preferred embodiments and is exemplary and not intended as a limitation on the scope of the disclosure. Modifications and other uses will occur to those skilled in the art and are encompassed within the spirit of the disclosure as defined by the scope of the claims.

[0277] No admission is made that any reference, including any non-patent or patent document, cited herein constitutes prior art. In particular, unless otherwise stated, it will be understood that reference to any document herein does not constitute an admission that any of these documents form part of the common general knowledge in the art in the United States or any other country. Any statement of a reference states what its author asserts, and applicants reserve the right to verify the accuracy and pertinence of any of the documents cited herein. Unless expressly indicated otherwise, all references cited herein are incorporated herein by reference in their entirety.

[0278] In the event of any discrepancy between any definitions and / or descriptions found in the cited references, the present disclosure shall control.

Claims

1. 1. A type 2 alveolar epithelial cell culture medium comprising a 1:1 mixture of serum-free medium and extracellular matrix components, the serum-free medium comprising 10 μM SB431542, 3 μM CHIR99021, 1 μM BIRB796, 5 μg / ml heparin, 50 ng / ml human EGF, 10 ng / ml mouse FGF10, 10 μM Y27632, insulin-transferrin-selenium (1.7 μM insulin, 0.068 μM transferrin, and 0.038 μM selenium), 1% Glutamax, 2% B27, 1% N2, 15 mM HEPES, 1.25 mM N-acetylcysteine, and 1% antibiotic-antimycotic in modified DMEM / F12, wherein the medium is stroma-free.

2. 2. The medium of claim 1, wherein the medium further comprises a cytokine selected from the group consisting of IL-1β, TNFα, and a combination thereof, and is a type 2 alveolar epithelial cell culture and growth medium.

3. 3. The growth medium of claim 2, wherein the IL-1β is at a concentration of about 10 ng / ml.

4. 4. The growth medium of claim 3, wherein the TNFα is at a concentration of about 10 ng / ml.

5. 3. The medium of claim 2, wherein the medium further comprises a bone morphogenetic protein (BMP) inhibitor selected from the group consisting of noggin, DMH-1, chordin, gremlin, cross-veinless, LDN193189, USAG-1, and follistatin, and combinations thereof, and is a type 2 alveolar epithelial cell culture and maintenance medium.

6. The maintenance medium of claim 5, wherein the BMP inhibitors are noggin and DMH-1.

7. 6. The maintenance medium of claim 5, wherein the noggin is at a concentration of about 10 ng / ml.

8. 8. The maintenance medium of claim 7, wherein the DMH-1 is at a concentration of about 1 μM.

9. Type 2 alveolar epithelial cell culture differentiation medium containing insulin-transferrin-selenium (1.7 μM insulin, 0.068 μM transferrin, and 0.038 μM selenium), 5 ng / ml human EGF, 1 ng / ml FGF10, 5 μg / ml heparin, 1× B-27, 1% antibiotic-antimycotic, 1% Glutamax, and 1.25 mM N-acetylcysteine ​​in modified DMEM / F12, with serum as needed.

10. The differentiation medium of claim 9 , wherein the medium further comprises serum.

11. The differentiation medium according to claim 9 , wherein the serum is fetal bovine serum.

12. The differentiation medium of claim 11 , wherein the medium comprises about 10% fetal bovine serum.

13. The differentiation medium of claim 12 , wherein the medium does not contain inhibitors of TGFβ and p38 kinase.

14. The differentiation medium according to claim 9, wherein the medium contains IL-6 and is serum-free.

15. The differentiation medium according to claim 14, wherein the medium comprises 10 ng / mL to 50 ng / mL of IL-6.

16. A chemically defined, stroma-free organoid culture system for the cultivation, proliferation, maintenance and / or differentiation of alveolar epithelial cells, comprising isolated alveolar epithelial cells cultured in a medium according to claim 2, claim 5 and / or claim 9.

17. 10. An in vitro method for expanding, maintaining and / or differentiating type 2 alveolar epithelial cells in an ex vivo organoid culture, comprising culturing type 2 alveolar epithelial cells in a medium described in claim 2, claim 5 and / or claim 9.

18. 1. A method for identifying an agent capable of treating or preventing SARS-CoV-2 infection in organoid cultures, comprising: i) culturing alveolar type 2 epithelial cells in the growth medium of claim 4; ii) inoculating said cells with SARS-CoV-2 in an amount effective to infect said cells; iii) contacting the cells with an agent; iv) determining whether the agent causes a reduction in the amount of SARS-CoV-2 in the cells compared to cells that were not treated with the agent; A method comprising:

19. 20. The method of claim 18, wherein step iii is optionally performed before step ii.

20. A kit comprising a chemically defined stroma-free organoid culture system for the culture, proliferation, maintenance and / or differentiation of alveolar epithelial cells, said kit comprising the medium described in claim 2, claim 5 and / or claim 9 and instructions for use.

Images