Production of synthetic exosomes for delivery of therapeutic agents to the central nervous system and non-central nervous system

Abstract

The present invention provides improved synthetic exosomes for delivering one or more therapeutic agents to the central nervous system. In certain embodiments, the synthetic exosomes comprise liposomes formed from a lipid bilayer, the lipid bilayer comprising one or more phospholipids selected from the group consisting of phosphate lipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids, wherein the lipid carbon chain has a length ranging from 3 to 24 carbon atoms; cholesterol, a cholesterol derivative (e.g., cholesterol hemisuccinate), or a phytosterol; and a non-ionic surfactant, the lipid bilayer does not contain alcohol, and the liposomes have a diameter ranging from about 50 nm to about 200 nm. Typically, the synthetic exosomes can cross the blood-brain barrier without substantially leaking the therapeutic agent.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and benefit of USSN 63 / 006,593, filed April 7, 2020, which is incorporated herein by reference in its entirety for all purposes. [Background technology]

[0002] Exosomes are nano-sized vesicles (e.g., less than 200 nm) that function as mediators of intercellular communication by delivering various endogenous cargoes, including proteins, lipids, nucleic acids, or other cellular components, to adjacent or distant cells. Exosome cargo can change depending on various physiological or pathological conditions. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] WO2019 / 094679A1 Summary of the Invention [Problem to be solved by the invention]

[0004] Due to the important role of exosomes in intercellular communication in delivering cargo to recipient cells, exosomes have been investigated as vectors for delivering endogenous or exogenous cargo for therapeutic purposes. However, the limited number of exosomes produced by cells hinders their application. Furthermore, the production of exosomes from cells is often a laborious, low-yield process that is poorly controlled. Furthermore, the essential components of active exosomes have not been fully established. Finally, the underlying mechanism of exosome delivery is currently unknown. These issues pose challenges for the development of exosomes for the delivery of therapeutic drugs. [Means for solving the problem]

[0005] Various embodiments provided herein may include, but need not be limited to, one or more of the following. Embodiment 1: A synthetic exosome capable of delivering a therapeutic moiety across the blood-brain barrier to the central nervous system (CNS), said synthetic exosome comprising: A liposome formed from a lipid bilayer, the lipid bilayer comprising: one or more phospholipids selected from the group consisting of phosphate lipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids, wherein the lipid carbon chain is in the range of 3 to 24 carbon atoms; Cholesterol, a cholesterol derivative or a phytosterol; a non-ionic surfactant, wherein the lipid bilayer does not contain alcohol, and the size of the liposomes ranges up to about 500 nm in diameter; and the synthetic exosomes.

[0006] Embodiment 2: The synthetic exosome of embodiment 1, wherein said exosome is less than about 200 nm in diameter or less than about 150 nm in diameter.

[0007] Embodiment 3: The synthetic exosome of embodiment 1, wherein the exosome has a diameter of about 50 nm to about 200 nm, or a diameter of about 50 nm to about 150 nm.

[0008] Embodiment 4: The synthetic exosome of any one of embodiments 1 to 3, wherein the synthetic exosome is capable of crossing the blood-brain barrier without substantially leaking the therapeutic moiety.

[0009] Embodiment 5: The synthetic exosome of any one of embodiments 1 to 4, wherein the lipid bilayer consists of the one or more phospholipids, the cholesterol or cholesterol derivative or phytosterol, and the non-ionic surfactant.

[0010] Embodiment 6: The synthetic exosome of any one of embodiments 1 to 5, wherein the exosome is capable of crossing the blood-brain barrier (BBB) ​​and delivering a therapeutic moiety contained within the exosome to the central nervous system without substantial loss of the therapeutic moiety.

[0011] Embodiment 7: The synthetic exosome of embodiment 6, wherein said exosomes are capable of crossing the blood-brain barrier (BBB) ​​and delivering a therapeutic moiety contained within said exosomes to the central nervous system without loss of more than about 40%, or without loss of more than 30%, or without loss of more than 20%, or without loss of more than 10%, or without loss of more than 5%, or without loss of more than 3%, or without loss of more than 1% of the therapeutic moiety contained within said exosomes.

[0012] Embodiment 8: The synthetic exosome of any one of embodiments 1 to 7, wherein the lipid bilayer does not contain alcohol.

[0013] Embodiment 9: The synthetic exosome of embodiment 8, wherein said lipid bilayer does not contain ethanol.

[0014] Embodiment 10: The synthetic exosome of any one of embodiments 1 to 9, wherein the bilayer does not contain glutathione-maleimide-PEG2000-distearoylphosphatidylethanolamine.

[0015] Embodiment 11: The synthetic exosome of any one of embodiments 1 to 10, wherein the exosome is not a transferosome.

[0016] Embodiment 12: The synthetic exosome of any one of embodiments 1 to 11, wherein the exosome is not an ethosome.

[0017] Embodiment 13: The synthetic exosome of any one of embodiments 1-12, wherein the molar ratio of total phospholipids to cholesterol, cholesterol or phytosterol ranges from about 6-10 moles total phospholipids to about 1-3 moles cholesterol.

[0018] Embodiment 14: The synthetic exosome of any one of embodiments 1 to 13, wherein the amount of surfactant ranges from about 1%, or about 3%, or about 5%, or about 8%, to about 18%, or about 15%, or about 13%, or about 10% (wt / wt).

[0019] Embodiment 15: The synthetic exosomes of any one of embodiments 1 to 14, wherein the surfactant comprises one or more surfactants selected from the group consisting of Span 80, Tween 20, BRIJ® 76 (stearyl poly(10) oxyethylene ether), BRIJ® 78 (stearyl poly(20) oxyethylene ether), BRIJ® 96 (oleyl poly(10) oxyethylene ether), and BRIJ® 721 (stearyl poly(21) oxyethylene ether).

[0020] Embodiment 16: The synthetic exosome of embodiment 15, wherein said surfactant comprises or consists of Span80.

[0021] Embodiment 17: The synthetic exosome of embodiment 16, wherein the lipid bilayer comprises about 10% to about 20% by weight, or about 15% by weight, of Span 80.

[0022] Embodiment 18: The synthetic exosome of any one of embodiments 1 to 17, wherein the cholesterol, cholesterol derivative, or phytosterol comprises or consists of cholesterol.

[0023] Embodiment 19: The synthetic exosome of any one of embodiments 1 to 17, wherein the cholesterol, cholesterol derivative, or phytosterol comprises or consists of a cholesterol derivative selected from the group consisting of cholesterol hemisuccinate, lysine-series cholesterol (CHLYS), 20-hydroxycholesterol, 22-hydroxycholesterol, 24-hydroxycholesterol, 25-hydroxycholesterol, 27-hydroxycholesterol, cholesteryl succinate, colesuccinate, coltrisuccinate, lithocholesterol succinate, chenodesoxycholesterol bissuccinate, and hederosides.

[0024] Embodiment 20: The synthetic exosome of any one of embodiments 1 to 17, wherein the cholesterol, cholesterol derivative comprises or consists of cholesterol hemisuccinate.

[0025] Embodiment 21: The synthetic exosome of any one of embodiments 1 to 17, wherein the cholesterol, cholesterol derivative, or phytosterol comprises or consists of a phytosterol.

[0026] Embodiment 22: The synthetic exosome of embodiment 21, wherein the phytosterol comprises a 9,10-secosteroid.

[0027] Embodiment 23: The synthetic exosome of embodiment 22, wherein the 9,10 secosteroid comprises a compound selected from the group consisting of vitamin D3, vitamin D2, and calcipotriol.

[0028] Embodiment 24: The synthetic exosome of embodiment 21, wherein the phytosterol comprises a C-24 alkyl steroid.

[0029] Embodiment 25: The synthetic exosome of embodiment 24, wherein said C-24 alkyl steroid comprises a compound selected from the group consisting of stigmasterol and β-sitosterol.

[0030] Embodiment 26: The synthetic exosome of embodiment 21, wherein the phytosterol comprises a pentacyclic steroid.

[0031] Embodiment 27: The synthetic exosome of embodiment 26, wherein the pentacyclic steroid comprises a compound selected from the group consisting of betulin, lupeol, ursolic acid, and oleanolic acid.

[0032] Embodiment 28: The synthetic exosome of any one of embodiments 1 to 27, wherein the cholesterol, cholesterol derivative, or phytosterol is PEGylated.

[0033] Embodiment 29: The synthetic exosome of any one of embodiments 1 to 28, wherein the one or more phospholipids comprise one or more phospholipids selected from the group consisting of dihexanoyl-sn-glycero-3-phosphate (DHPA), didecanoyl-sn-glycero-3-phosphate (DDPA), distearoyl-sn-glycero-3-phosphate (DTPA), and dihexadecyl phosphate (DHP).

[0034] Embodiment 30: The synthetic exosome of any one of embodiments 1 to 29, wherein the one or more phospholipids comprise one or more phosphoglycerol lipids selected from the group consisting of dihexanoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DHPG), dilauroyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DLPG), and distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DTPG).

[0035] Embodiment 31: The synthetic exosome of any one of embodiments 1 to 30, wherein the one or more phospholipids comprise one or more phosphocholine lipids selected from the group consisting of dipropionyl-sn-glycero-3-phosphocholine (PC), diheptanoyl-sn-glycero-3-phosphocholine (DHPC), dimyristoyl-sn-glycero-3-phosphocholine (DMPC), and dilignoceroyl-sn-glycero-3-phosphocholine (DGPC).

[0036] Embodiment 32: The synthetic exosome of any one of embodiments 1 to 30, wherein the one or more phospholipids comprise one or more phosphoethanolamine lipids selected from the group consisting of cyhexanoyl-sn-glycero-3-phosphoethanolamine (DHPE) and distearoyl-sn-glycero-3-phosphoethanolamine (DTPE).

[0037] Embodiment 33: The synthetic exosome of any one of embodiments 1 to 30, wherein the one or more phospholipids comprise one or more phosphoethanolamine-PEG lipids selected from the group consisting of dipalmitoyl-sn-glycero-3-phospho(ethylene glycol) (DPPEG1), dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350 (DMPEG350), distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350] (DTPEG350), dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-550] (DMPEG550), and dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-1000] (DMPEG1000).

[0038] Embodiment 34: The synthetic exosome of any one of embodiments 1 to 30, wherein the one or more phospholipids comprise one or more phospholipids selected from the group consisting of dioleoyl-sn-glycero-3-phosphocholine(N-aminoethyl) (PC-NH), diphytanoyl-sn-glycero-3-phosphoethanolamine, dioleoyl-3-trimethylammonium-propane (DOTAP), distearoyl-3-trimethylammonium-propane (DSTAP), dimyristoyl-3-trimethylammonium-propane (DMTAP), and di-O-octadecyl-sn-glycero-3-phosphocholine (DOPC).

[0039] Embodiment 35: The synthetic exosome of any one of embodiments 1 to 34, wherein the one or more phospholipids are functionalized with a targeting moiety selected from the group consisting of transferrin, an amino acid, a blood-brain barrier targeting antibody, insulin, folate, and low-density lipoprotein receptor-related protein 1.

[0040] Embodiment 36: The lipid bilayer comprises: the surfactant, and 36. The synthetic exosome of any one of embodiments 1-35, wherein the synthetic exosome comprises or consists of a 3:2:1 molar ratio (DHPA:DHP:CH), a 1:5:1 molar ratio (DHPG:DHPA:CH), a 2:5:1:2 molar ratio (DHPG:DHPA:PC-NH2:CH) or a 2:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH2:DMPEG350:CH), and has a zeta potential of about -20 mV or less.

[0041] Embodiment 37: The synthetic exosome of embodiment 36, wherein said lipid bilayer comprises or consists of said surfactant and a 3:2:1 molar ratio of (DHPA:DHP:CH).

[0042] Embodiment 38: The synthetic exosome of embodiment 36, wherein said lipid bilayer comprises or consists of said surfactant and a 1:5:1 molar ratio of (DHPG:DHPA:CH).

[0043] Embodiment 39: The synthetic exosome of embodiment 36, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 2:5:1:2 (DHPG:DHPA:PC-NH2:CH).

[0044] Embodiment 40: The synthetic exosome of embodiment 36, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 2:4:1:1:2 (DHPG:DHPA:PC-NH2:DMPEG350:CH).

[0045] Embodiment 41: The lipid bilayer is selected from the group consisting of: the surfactant, and 36. The synthetic exosome of any one of embodiments 1 to 35, comprising or consisting of a 2:2:1 molar ratio (DHPG:DHPC:CH), a 4:4:1:2 molar ratio (DHPG:DHPA:PC-NH2:CH), a 2:2:1 molar ratio (DHPG:DHPA:CH), a 4:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH2:DMPEG550:CH), a 2:2:1 molar ratio (DHPG:DTPE:CH), a 2:2:1 molar ratio (DHPG:DMTAP:CH), a 4:4:1:2 molar ratio (DHPG:DMTAP:PC-NH2:CH) or a 4:4:1:1:2 molar ratio (DHPG:DMTAP:PC-NH2:DMPEG550:CH).

[0046] Embodiment 42: The synthetic exosome of embodiment 41, wherein said lipid bilayer comprises or consists of said surfactant and a 2:2:1 molar ratio of (DHPG:DHPC:CH).

[0047] Embodiment 43: The synthetic exosome of embodiment 41, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:2 (DHPG:DHPA:PC-NH2:CH).

[0048] Embodiment 44: The synthetic exosome of embodiment 41, wherein said lipid bilayer comprises or consists of said surfactant and a 2:2:1 molar ratio of (DHPG:DHPA:CH).

[0049] Embodiment 45: The synthetic exosome of embodiment 41, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:1:2 (DHPG:DHPA:PC-NH2:DMPEG550:CH).

[0050] Embodiment 46: The synthetic exosome of embodiment 41, wherein said lipid bilayer comprises or consists of said surfactant and a 2:2:1 molar ratio of (DHPG:DTPE:CH).

[0051] Embodiment 47: The synthetic exosome of embodiment 41, wherein said lipid bilayer comprises or consists of said surfactant and a 2:2:1 molar ratio of (DHPG:DMTAP:CH).

[0052] Embodiment 48: The synthetic exosome of embodiment 41, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:2 (DHPG:DMTAP:PC-NH2:CH).

[0053] Embodiment 49: The synthetic exosome of embodiment 41, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:1:2 (DHPG:DMTAP:PC-NH2:DMPEG550:CH).

[0054] Embodiment 50: The lipid bilayer is selected from the group consisting of: the surfactant, and 36. The synthetic exosome of any one of embodiments 1 to 35, comprising or consisting of a 2:4:1 molar ratio (DHPC:DTPE:CH), a 2:4:1 molar ratio (DHPC:DOTAP:CH), a 2:4:1:2 molar ratio (DHPC:DMTAP:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DHPC:DMTAP:PC-NH2:DMPEG350:CH).

[0055] Embodiment 51: The synthetic exosome of embodiment 50, wherein said lipid bilayer comprises or consists of said surfactant and a 2:4:1 molar ratio of (DHPC:DTPE:CH).

[0056] Embodiment 52: The synthetic exosome of embodiment 50, wherein said lipid bilayer comprises or consists of said surfactant and a 2:4:1 molar ratio of (DHPC:DOTAP:CH).

[0057] Embodiment 53: The synthetic exosome of embodiment 50, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 2:4:1:2 (DHPC:DMTAP:PC-NH2:CH).

[0058] Embodiment 54: The synthetic exosome of embodiment 50, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 2:4:1:1:2 (DHPC:DMTAP:PC-NH2:DMPEG350:CH).

[0059] Embodiment 55: The synthetic exosome of any one of embodiments 1 to 35, wherein the lipid bilayer comprises or consists of the surfactant and a 4:2:1 molar ratio (DTPA:DHP:CH), a 1:5:1 molar ratio (DTPG:DTPA:CH), a 1:5:1:2 molar ratio (DTPG:DTPA:PC-NH2:CH), or a 1:4:1:1:2 molar ratio (DTPG:DTPA:PC-NH2:DMPEG350:CH) to provide a synthetic exosome with a zeta potential of about -20 mV or less.

[0060] Embodiment 56: The synthetic exosome of embodiment 55, wherein said lipid bilayer comprises or consists of said surfactant and a 4:2:1 molar ratio of (DTPA:DHP:CH).

[0061] Embodiment 57: The synthetic exosome of embodiment 55, wherein said lipid bilayer comprises or consists of said surfactant and a 1:5:1 molar ratio of (DTPG:DTPA:CH).

[0062] Embodiment 58: The synthetic exosome of embodiment 55, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 1:5:1:2 (DTPG:DTPA:PC-NH2:CH).

[0063] Embodiment 59: The synthetic exosome of embodiment 55, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 1:4:1:1:2 (DTPG:DTPA:PC-NH2:DMPEG350:CH).

[0064] Embodiment 60: The lipid bilayer is selected from the group consisting of: the surfactant, and 36. The synthetic exosome of any one of embodiments 1 to 35, comprising or consisting of a 2:2:1 molar ratio (DTPG:DGPC:CH), a 4:4:1:2 molar ratio (DTPG:DDPA:PC-NH2:CH), a 2:2:1 molar ratio (DTPG:DDPA:CH), a 4:4:1:1:2 molar ratio (DTPG:DDPA:PC-NH2:DMPEG550:CH), a 2:2:1 molar ratio (DTPG:DTPE:CH), a 2:2:1 molar ratio (DTPG:DMTAP:CH), a 4:4:1:2 molar ratio (DTPG:DMTAP:PC-NH2:CH) or a 4:4:1:1:2 molar ratio (DTPG:DMTAP:PC-NH2:DMPEG550:CH).

[0065] Embodiment 61: The synthetic exosome of embodiment 60, wherein the lipid bilayer comprises or consists of the surfactant and a 2:2:1 molar ratio of (DTPG:DGPC:CH).

[0066] Embodiment 62: The synthetic exosome of embodiment 60, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:2 (DTPG:DDPA:PC-NH2:CH).

[0067] Embodiment 63: The synthetic exosome of embodiment 60, wherein the lipid bilayer comprises or consists of the surfactant and a 2:2:1 molar ratio of (DTPG:DDPA:CH).

[0068] Embodiment 64: The synthetic exosome of embodiment 60, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:1:2 (DTPG:DDPA:PC-NH2:DMPEG550:CH).

[0069] Embodiment 65: The synthetic exosome of embodiment 60, wherein the lipid bilayer comprises or consists of the surfactant and a 2:2:1 molar ratio of (DTPG:DTPE:CH).

[0070] Embodiment 66: The synthetic exosome of embodiment 60, wherein said lipid bilayer comprises or consists of said surfactant and a 2:2:1 molar ratio of (DTPG:DMTAP:CH).

[0071] Embodiment 67: The synthetic exosome of embodiment 60, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:2 (DTPG:DMTAP:PC-NH2:CH).

[0072] Embodiment 68: The synthetic exosome of embodiment 60, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 4:4:1:1:2 (DTPG:DMTAP:PC-NH2:DMPEG550:CH).

[0073] Embodiment 69: The lipid bilayer is selected from the group consisting of: the surfactant, and 36. The synthetic exosome of any one of embodiments 1 to 35, comprising or consisting of a 2:4:1 molar ratio (DMPC:DTPE:CH), a 2:4:1 molar ratio (DMPC:DOTAP:CH), a 2:4:1:2 molar ratio (DMPC:DMTAP:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DMPC:DMTAP:PC-NH2:DMPEG350:CH).

[0074] Embodiment 70: The synthetic exosome of embodiment 69, wherein said lipid bilayer comprises or consists of said surfactant and a 2:4:1 molar ratio of (DMPC:DTPE:CH).

[0075] Embodiment 71: The synthetic exosome of embodiment 69, wherein said lipid bilayer comprises or consists of said surfactant and a 2:4:1 molar ratio of (DMPC:DOTAP:CH).

[0076] Embodiment 72: The synthetic exosome of embodiment 69, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 2:4:1:2 (DMPC:DMTAP:PC-NH2:CH).

[0077] Embodiment 73: The synthetic exosome of embodiment 69, wherein the lipid bilayer comprises or consists of the surfactant and a molar ratio of 2:4:1:1:2 (DMPC:DMTAP:PC-NH2:DMPEG350:CH).

[0078] Embodiment 74: The synthetic exosome of any one of embodiments 36 to 73, wherein CH is a cholesterol derivative.

[0079] Embodiment 75: The synthetic exosome of embodiment 74, wherein said cholesterol derivative is selected from the group consisting of cholesterol hemisuccinate, lysine-based cholesterol (CHLYS), 20-hydroxycholesterol, 22-hydroxycholesterol, 24-hydroxycholesterol, 25-hydroxycholesterol, 27-hydroxycholesterol, cholesteryl succinate, colesuccinate, coltrisuccinate, lithocholesterol succinate, chenodesoxycholesterol bissuccinate, and hederosides.

[0080] Embodiment 76: The synthetic exosome of embodiment 75, wherein the CH is cholesterol hemisuccinate.

[0081] Embodiment 77: The synthetic exosome of any one of embodiments 36 to 73, wherein the CH is a phytosterol.

[0082] Embodiment 78: The synthetic exosome of embodiment 77, wherein CH is a C-24 alkyl steroid.

[0083] Embodiment 79: The synthetic exosome of any one of embodiments 1 to 78, wherein the size of the exosome ranges from about 50 nm, or from about 60 nm, or from about 70 nm, or from about 80 nm, or from about 90 nm, to about 200 nm, or to about 150 nm, or to about 100 nm in average diameter.

[0084] Embodiment 80: The synthetic exosome of embodiment 79, wherein said synthetic exosome has an average diameter of about 50 nm, or an average diameter of about 100 nm, or an average diameter of about 150 nm.

[0085] Embodiment 81: The synthetic exosome of any one of embodiments 1 to 80, wherein a targeting moiety comprising or consisting of transferrin is attached to said exosome.

[0086] Embodiment 82: The synthetic exosome of any one of embodiments 1 to 80, wherein a targeting moiety comprising or consisting of folic acid is attached to said exosome.

[0087] Embodiment 83: The synthetic exosome of any one of embodiments 1 to 80, wherein a targeting moiety comprising or consisting of an amino acid is attached to said exosome.

[0088] Embodiment 84: The synthetic exosome of embodiment 83, wherein said exosome is attached to an amino acid that is transported by an amino acid transporter.

[0089] Embodiment 85: The synthetic exosome of any one of embodiments 1 to 80, wherein a targeting moiety comprising or consisting of insulin is attached to said exosome.

[0090] Embodiment 86: The synthetic exosome of any one of embodiments 1 to 80, wherein a targeting moiety comprising or consisting of low density lipoprotein receptor-related protein 1 is attached to said exosome.

[0091] Embodiment 87: The synthetic exosome of any one of embodiments 1 to 80, wherein a targeting moiety comprising or consisting of a blood-brain barrier targeting antibody is attached to said exosome.

[0092] Embodiment 88: The synthetic exosome of any one of embodiments 1 to 80, wherein the exosome is attached to an antibody or ligand that binds to a moiety selected from the group consisting of transferrin receptor, insulin receptor, insulin growth factor receptor (IGF1R), low density lipoprotein (LDL) receptor, basigin, Glut1, CD98hc, and TMEM30A (cdc50A).

[0093] Embodiment 89: The synthetic exosome of embodiment 88, wherein the exosome is attached to a transferrin receptor peptide comprising a sequence selected from the group consisting of NH2-His-Ala-Ile-Tyr-Pro-Arg-His-Pra-CONH2 (SEQ ID NO: 55) and NH2-Thr-His-Arg-Pro-Pro-Met-Trp-Ser-Pro-Val-Trp-Pro-Pra-CONH2 (SEQ ID NO: 56).

[0094] Embodiment 90: The synthetic exosome of embodiment 89, wherein said transferrin receptor peptide is attached to said synthetic exosome using click chemistry.

[0095] Embodiment 91: The synthetic exosome of any one of embodiments 1 to 80, wherein the exosome is attached to an antibody or ligand that binds to a cell surface marker.

[0096] Embodiment 92: The synthetic exosome of embodiment 91, wherein said cell surface marker is a marker for neuronal or glial cells.

[0097] Embodiment 93: The synthetic exosome of embodiment 91, wherein said cell surface marker is selected from the group consisting of CD63, CD81, CD9 and CD171, and is incorporated into the lipid bilayer of said exosome.

[0098] Embodiment 94: The synthetic exosome of embodiment 93, wherein said cell surface marker is CD63.

[0099] Embodiment 95: The synthetic exosome of any one of embodiments 93 to 94, wherein said cell surface marker is CD81.

[0100] Embodiment 96: The synthetic exosome of any one of embodiments 93 to 95, wherein said cell surface marker is CD9.

[0101] Embodiment 97: The synthetic exosome of any one of embodiments 93 to 96, wherein said cell surface marker is CD171.

[0102] Embodiment 98: The synthetic exosome of any one of embodiments 1 to 97, wherein the exosome comprises one or more therapeutic moieties.

[0103] Embodiment 99: The synthetic exosome of embodiment 98, wherein said therapeutic moiety is selected from the group consisting of a protein, an antibody, an enzyme, DNA encoding an inhibitory RNA, an inhibitory RNA or microRNA (miRNA), a nucleic acid encoding a CRISPR endonuclease and guide RNA, a CRISPR endonuclease and guide RNA, and a small organic molecule.

[0104] Embodiment 100: The synthetic exosome of any one of embodiments 98-99, wherein said synthetic exosome is effective to deliver said therapeutic moiety to the mammalian brain following systemic administration.

[0105] Embodiment 101: The synthetic exosome of any one of embodiments 98 to 100, wherein the therapeutic moiety comprises an sAPPα protein.

[0106] Embodiment 102: The synthetic exosome of embodiment 101, wherein said sAPPα is recombinantly expressed sAPPα.

[0107] Embodiment 103: The synthetic exosome of embodiment 101, wherein said sAPPα is isolated and purified sAPPα.

[0108] Embodiment 104: The synthetic exosome of any one of embodiments 101 to 103, wherein said sAPPα is human sAPPα.

[0109] Embodiment 105: The synthetic exosome of any one of embodiments 98 to 100, wherein the therapeutic moiety comprises IDUA (e.g., for MPS1) or acid sphingomyelinase (ASM) for Niemann-Pick disease.

[0110] Embodiment 106: The synthetic exosome of any one of embodiments 98 to 100, wherein the therapeutic moiety comprises an antibody.

[0111] Embodiment 107: The synthetic exosome of embodiment 106, wherein said antibody comprises an antibody selected from the group consisting of a full-length immunoglobulin, a Fab, Fab', Fab'-SH, F(ab')2, Fv, Fv', Fd, Fd', scFv, hsFv fragment, a single chain antibody, and a cameloid antibody.

[0112] Embodiment 108: The synthetic exosome of embodiment 107, wherein said antibody comprises a full-length (intact) human immunoglobulin.

[0113] Embodiment 109: The synthetic exosome of embodiment 108, wherein said antibody comprises IgG or IgA.

[0114] Embodiment 110: The synthetic exosome of any one of embodiments 106 to 109, wherein the antibody comprises an antibody for the treatment of a neurodegenerative condition or the treatment of cancer.

[0115] Embodiment 111: The synthetic exosome of embodiment 110, wherein said antibody comprises an antibody for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease.

[0116] Embodiment 112: The synthetic exosome of embodiment 111, wherein said antibody comprises an antibody for the treatment of Alzheimer's disease.

[0117] Embodiment 113: The synthetic exosome of embodiment 112, wherein said antibody binds to a target selected from the group consisting of Aβ, mutant Aβ, tau, mutant tau, apoE, and alpha-synuclein.

[0118] Embodiment 114: The synthetic exosome of embodiment 113, wherein said antibody comprises an antibody selected from the group consisting of AAB-003, bapineuzumab, ponezumab, RG7345, solanezumab, GSK933776, JNJ-63733657, BIIB076, LY2599666, MEDI1314, SAR228810, BAN2401, BIIB092, C2B8E12, LY3002813, LY3303560, RO7105705, aducanumab, crenezumab, PRX002 (prasinezumab), and gantenerumab, or a combination thereof.

[0119] Embodiment 115: The synthetic exosome of embodiment 113, wherein the antibody comprises an anti-pyroglutamic acid-3Aβ antibody.

[0120] Embodiment 116: The synthetic exosome of embodiment 115, wherein the antibody comprises the 9D5 antibody.

[0121] Embodiment 117: The synthetic exosome of embodiment 115, wherein the antibody comprises an anti-tau antibody.

[0122] Embodiment 118: The synthetic exosome of embodiment 117, wherein said anti-tau antibody is selected from the group consisting of BIIB092, ABBV-8E12, RO7105705, LY3303560, RG7345, RO6926496, JNJ63733657, and UCB0107.

[0123] Embodiment 119: The synthetic exosome of embodiment 113, wherein the antibody comprises an anti-ApoE antibody.

[0124] Embodiment 120: The synthetic exosome of embodiment 111, wherein said antibody comprises an antibody for the treatment of amyotrophic lateral sclerosis (ALS).

[0125] Embodiment 121: The synthetic exosome of embodiment 120, wherein said antibody comprises an antibody that binds to a misfolded SOD1 species.

[0126] Embodiment 122: The synthetic exosome of embodiment 111, wherein said antibody comprises an antibody for the treatment of Huntington's disease.

[0127] Embodiment 123: The synthetic exosome of embodiment 122, wherein the antibody comprises an anti-SEMA4D antibody (e.g., VX15).

[0128] Embodiment 124: The synthetic exosome of embodiment 111, wherein said antibody comprises an antibody for the treatment of Parkinson's disease.

[0129] Embodiment 125: The synthetic exosome of embodiment 122, wherein the antibody comprises an anti-alpha-synuclein antibody (e.g., prasinezumab).

[0130] Embodiment 126: The synthetic exosome of embodiment 106, wherein the antibody comprises an antibody for the treatment of cancer.

[0131] Embodiment 127: The synthetic exosome of embodiment 126, wherein said antibody comprises a checkpoint PD-1 blocker.

[0132] Embodiment 128: The synthetic exosome of embodiment 127, wherein the antibody comprises Keytuda for the treatment of glioma and brain cancer.

[0133] Embodiment 129: The synthetic exosome of embodiments 98 to 100, wherein the synthetic exosome contains an enzyme for enzyme replacement therapy (ERT).

[0134] Embodiment 130: The synthetic exosome of embodiments 98-100, wherein said synthetic exosome contains components of a CRISPR / Cas system for the treatment of Alzheimer's disease, Parkinson's disease, ALS, Fragile X syndrome (FXS), Huntington's disease, autosomal dominant spinocerebellar ataxia (SCA), spinal-bulbar muscular atrophy (SBMA), and correction of autosomal recessive genetic disorders caused by defects in expression or function of ataxia telangiectasia mutated (ATM) protein.

[0135] Embodiment 131: The synthetic exosome of embodiment 130, wherein the synthetic exosome contains a plasmid encoding a class 2 CRISPR / Cas endonuclease and a guide RNA or a nucleic acid encoding a guide RNA, or wherein the synthetic exosome contains a class 2 CRISPR / Cas endonuclease and a guide RNA or a nucleic acid encoding a guide RNA.

[0136] Embodiment 132: The synthetic exosome of embodiment 131, wherein said Class 2 CRISPR / Cas endonuclease is a Type II CRISPR / Cas endonuclease.

[0137] Embodiment 133: The synthetic exosome of any one of embodiments 131 to 132, wherein the Class 2 CRISPR / Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA.

[0138] Embodiment 134: The synthetic exosome of embodiment 133, wherein said Cas9 protein is selected from the group consisting of Streptococcus pyogenes Cas9 protein (spCas9) or a functional portion thereof, Staphylococcus aureus Cas9 protein (saCas9) or a functional portion thereof, Streptococcus thermophilus Cas9 protein (stCas9) or a functional portion thereof, Neisseria meningitides Cas9 protein (nmCas9) or a functional portion thereof, and Treponema denticola Cas9 protein (tdCas9) or a functional portion thereof.

[0139] Embodiment 135: The synthetic exosome of embodiment 134, wherein said Cas9 protein comprises a Streptococcus pyogenes Cas9 protein (spCas9).

[0140] Embodiment 136: The synthetic exosome of embodiment 134, wherein said Cas9 protein comprises Staphylococcus aureus Cas9 protein (saCas9).

[0141] Embodiment 137: The synthetic exosome of embodiment 134, wherein said Cas9 protein comprises a Streptococcus thermophilus Cas9 protein.

[0142] Embodiment 138: The synthetic exosome of embodiment 134, wherein said Cas9 protein comprises a Neisseria meningitides Cas9 protein (nmCas9).

[0143] Embodiment 139: The synthetic exosome of embodiment 134, wherein said Cas9 protein comprises a Treponema denticola Cas9 protein (tdCas9).

[0144] Embodiment 140: The synthetic exosome of embodiment 131, wherein said Class 2 CRISPR / Cas endonuclease is a Type V or Type VI CRISPR / Cas endonuclease.

[0145] Embodiment 141: The synthetic exosome of embodiment 140, wherein said Class 2 CRISPR / Cas endonuclease is selected from the group consisting of a Cpf1 polypeptide or a functional portion thereof, a C2c1 polypeptide or a functional portion thereof, a C2c3 polypeptide or a functional portion thereof, and a C2c2 polypeptide or a functional portion thereof.

[0146] Embodiment 142: The synthetic exosome of embodiment 141, wherein said Class 2 CRISPR / Cas endonuclease comprises a Cpf1 polypeptide.

[0147] Embodiment 143: The synthetic exosome of any one of embodiments 130 to 142, wherein the components of the CRISPR / Cas system are configured to generate an insertion or deletion in ApoE4.

[0148] Embodiment 144: The synthetic exosome of any one of embodiments 130 to 142, wherein the components of the CRISPR / Cas system are configured to replace ApoE4 with ApoE3 or ApoE2.

[0149] Embodiment 145: The synthetic exosome of embodiments 98 to 100, wherein the synthetic exosome contains miRNA.

[0150] Embodiment 146: The synthetic exosome of embodiments 98 to 100, wherein the synthetic exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA.

[0151] Embodiment 147: The synthetic exosome of embodiment 146, wherein said exosome contains DNA encoding shRNA or siRNA.

[0152] Embodiment 148: The synthetic exosome of any one of embodiments 146 to 147, wherein said exosome comprises an inhibitory RNA or a nucleic acid encoding an inhibitory RNA for the treatment of a neurodegenerative condition or cancer.

[0153] Embodiment 149: The synthetic exosome of embodiment 148, wherein said exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease.

[0154] Embodiment 150: The synthetic exosome of embodiment 149, wherein said exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA for the treatment of Alzheimer's disease.

[0155] Embodiment 151: The synthetic exosome of embodiment 150, wherein said inhibitory RNA inhibits expression of a target selected from the group consisting of mutant APP (e.g., APPsw) and mutant tau.

[0156] Embodiment 152: The synthetic exosome of embodiment 150, wherein said inhibitory RNA inhibits expression of a target selected from the group consisting of c-SCR, GGA3 adaptor protein, and acyl-coenzyme A cholesterol acyltransferase (ACAT-1).

[0157] Embodiment 153: A synthetic exosome according to any one of embodiments 1 to 152, and A pharmaceutical formulation comprising a pharmaceutically acceptable carrier.

[0158] Embodiment 154: A container containing the nanoscale synthetic exosomes according to any one of embodiments 1 to 152 and / or the pharmaceutical formulation according to embodiment 153, and A kit comprising instructional materials teaching the use of said synthetic exosomes to alleviate one or more symptoms associated with a disease characterized by amyloid deposits in the brain and / or the use of said composition in delaying or preventing the onset of one or more of said symptoms.

[0159] Embodiment 155: A method of reducing the risk, reducing the severity, or delaying the progression or onset of a disease characterized by beta-amyloid deposits in the brain of a mammal, said method comprising: The method comprises administering to the mammal, or causing to be administered, the synthetic exosome of any one of embodiments 111-119 and 130-152 and / or the pharmaceutical formulation of embodiment 153, in an amount sufficient to reduce the risk, reduce the severity, or delay the progression or onset of the disease.

[0160] Embodiment 156: The method of embodiment 155, wherein the disease is selected from the group consisting of Alzheimer's disease, vascular dementia, Parkinson's disease, Huntington's disease, cerebral amyloid angiopathy, amyotrophic lateral sclerosis (ALS), traumatic brain injury (TBI), and stroke.

[0161] Embodiment 157: A method of preventing or delaying the onset of a pre-Alzheimer's condition and / or cognitive impairment and / or ameliorating one or more symptoms of a pre-Alzheimer's condition and / or cognitive impairment, or preventing or delaying the progression of a pre-Alzheimer's condition or cognitive impairment to Alzheimer's disease in a mammal, said method comprising: The method comprises administering to, or allowing to be administered to, the mammal a synthetic exosome according to any one of embodiments 111-119 and 146-152 and / or a pharmaceutical formulation according to embodiment 153 in an amount sufficient to promote processing of amyloid precursor protein (APP) by a non-amyloidogenic pathway and / or to reduce sAPPβ.

[0162] Embodiment 158: A method for promoting the processing of amyloid precursor protein (APP) by a non-amyloidogenic pathway, characterized by increasing sAPPα and / or the sAPPα / Aβ42 ratio in a mammal, said method comprising: The method comprising administering or causing to be administered to said mammal the synthetic exosome of any one of embodiments 111-119 and 146-152 and / or the pharmaceutical formulation of embodiment 153, wherein said administration is in an amount sufficient to promote processing of amyloid precursor protein (APP) by a non-amyloidogenic pathway and / or to reduce sAPPβ.

[0163] Embodiment 159: A method of delivering one or more therapeutic moieties to the brain of a mammal, said method comprising: The method comprising administering or causing to be administered to the mammal an effective amount of the synthetic exosomes of any one of embodiments 1 to 97, wherein the exosomes contain the one or more therapeutic moieties.

[0164] Embodiment 160: The method of embodiment 159, wherein the synthetic exosome comprises the synthetic exosome of any one of embodiments 98 to 129.

[0165] Embodiment 161: The method of embodiment 159, wherein the one or more therapeutic moieties comprise a component of a CRISPR / Cas system, a component of a TALEN system and / or a component of a zinc finger protein.

[0166] Embodiment 162: The method of embodiment 161, wherein said exosomes contain components of a CRISPR / Cas system for the treatment of Alzheimer's disease, Parkinson's disease, ALS, Fragile X syndrome (FXS), Huntington's disease, autosomal dominant spinocerebellar ataxia (SCA), spinal-bulbar muscular atrophy (SBMA), correction of autosomal recessive disorders caused by defects in expression or function of ataxia telangiectasia mutated (ATM) protein.

[0167] Embodiment 163: The method of embodiment 162, wherein the synthetic exosome comprises the synthetic exosome of any one of embodiments 131 to 144.

[0168] Embodiment 164: The method of any one of embodiments 159 to 163, wherein the mammal is a human.

[0169] Embodiment 165: The method of any one of embodiments 159 to 163, wherein the mammal is a non-human mammal.

[0170] Embodiment 166: A method of treating a condition in a mammal selected from the group consisting of Alzheimer's disease, Parkinson's disease, ALS, Fragile X syndrome (FXS), Huntington's disease, autosomal dominant spinocerebellar ataxia (SCA), spinal-bulbar muscular atrophy (SBMA), an autosomal recessive disorder caused by a defect in expression or function of ataxia telangiectasia mutated (ATM) protein, said method comprising: The method comprising administering to or allowing to be administered to the mammal an effective amount of the synthetic exosome of any one of embodiments 101-144.

[0171] Embodiment 167: The method of embodiment 166, wherein the mammal is a human.

[0172] Embodiment 168: The method of embodiment 166, wherein the mammal is a non-human mammal.

[0173] Embodiment 169: The method of any one of embodiments 166 to 168, wherein the condition is Alzheimer's disease.

[0174] Embodiment 170: The method of embodiment 169, wherein the synthetic exosome is the synthetic exosome of any one of embodiments 130 to 144.

[0175] Embodiment 171: A microfluidic flow reactor for the synthesis of synthetic exosomes, said reactor comprising: 1. The reactor comprising a central channel having two or more branch channels feeding into the central channel, thereby forming a mixing junction, wherein the diameters of the central channel and the branch channels and the angle between the central channel and the branch channels are selected to maintain a back pressure of less than about 100 psi.

[0176] Embodiment 172: A microfluidic flow reactor as described in embodiment 171, wherein the diameters of the central channel and the branch channels and the angle provided between the central channel and the branch channels are selected to minimize turbulence.

[0177] Embodiment 173: A microfluidic flow reactor described in any one of embodiments 171 to 172, wherein the width of the central channel and / or the branch channels independently ranges from about 0.5 μm, or from about 1 μm, or from about 10 μm, or from about 20 μm, or from about 30 μm, to about 100 μm, or to about 80 μm, or to about 60 μm, or to about 50 μm, or to about 40 μm.

[0178] Embodiment 174: A microfluidic flow reactor described in any one of embodiments 171 to 173, wherein the height (depth) of the central channel and / or the branch channels independently ranges from about 0.5 μm, or from about 1 μm, or from about 10 μm, or from about 20 μm, or from about 30 μm, to about 100 μm, or to about 80 μm, or to about 60 μm, or to about 50 μm, or to about 40 μm.

[0179] Embodiment 175: A microfluidic flow reactor described in any one of embodiments 171 to 174, wherein the angle between the central channel and the side channel ranges from about 10 degrees, or from about 15 degrees, or from about 20 degrees, or from about 25 degrees, to about 90 degrees, or to about 80 degrees, or to about 70 degrees, or to about 60 degrees, or to about 50 degrees.

[0180] Embodiment 176: A microfluidic flow reactor described in any one of embodiments 171 to 175, wherein the reactor comprises one or more pumps, the pumps providing a fluid pressure in the range of about 1 bar to about 30 bar.

[0181] Embodiment 177: The microfluidic flow reactor of embodiment 176, wherein the pump provides a flow rate in the range of about 0.05 mL / min to about 10 mL / min.

[0182] Embodiment 178: A microfluidic flow reactor according to any one of embodiments 171 to 177, wherein the reactor utilizes three independently regulated flow streams.

[0183] Embodiment 179: A microfluidic flow reactor according to embodiment 178, wherein two flow streams comprise water and one flow stream comprises isopropyl alcohol.

[0184] Embodiment 180: A microfluidic flow reactor according to any one of embodiments 178 to 179, wherein the aqueous flow rate is in the range of about 0.5 mL / min to about 10 mL / min.

[0185] Embodiment 181: A microfluidic flow reactor according to any one of embodiments 178 to 180, wherein the aqueous flow rate is in the range of about 0.5 mL / min to about 10 mL / min.

[0186] Embodiment 182: A microfluidic flow reactor described in any one of embodiments 171 to 181, wherein the reactor comprises a pressure controller.

[0187] Embodiment 183: A microfluidic flow reactor according to any one of embodiments 171 to 182, wherein the reactor comprises a temperature controller (heater).

[0188] Embodiment 184: A microfluidic flow reactor according to any one of embodiments 171 to 183, wherein the reactor provides 1, 2, 3, 4, 5 or 6 or more mixing junctions.

[0189] Embodiment 185: A microfluidic flow reactor according to embodiment 184, wherein the microfluidic flow reactor comprises a plurality of mixing junctions and contains functionalized lipids, the lipids being functionalized to react with the synthetic exosomes being formed at a second mixing junction.

[0190] Embodiment 186: The functionalized lipid is dioleoyl-sn-glycero-3-phosphocholine(N-aminoethyl), dioleoyl or dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide], dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidophenyl)butyramide], dipalmitoyl-sn-glycero-3-phosphothioethanoyl 186. The microfluidic flow reactor of embodiment 185, comprising one or more lipids selected from the group consisting of dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(succinyl), distearoyl-sn-glycero-3-phosphocholine(N-propynyl), dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-dibenzocyclooctyl, and distearoyl-sn-glycero-3-phosphocholine(N-azidoethyl).

[0191] Embodiment 187: A method of making synthetic exosomes containing a therapeutic moiety, said method comprising combining components of a lipid bilayer according to any one of embodiments 1 to 92 in an organic phase and an aqueous phase with said therapeutic moiety in a microchannel of a microfluidic flow reactor at a controlled flow rate and pressure, and collecting the resulting sample comprising synthetic exosomes comprising said therapeutic moiety.

[0192] Embodiment 188: The method described in embodiment 187, wherein the therapeutic portion comprises a therapeutic portion described in any one of embodiments 98 to 152.

[0193] Embodiment 189: The method according to any one of embodiments 187 to 188, wherein said method produces synthetic exosomes according to any one of embodiments 98 to 152.

[0194] Embodiment 190: The method of any one of embodiments 187 to 189, wherein the sample is dialyzed to produce a dialyzed sample.

[0195] Embodiment 191: The method of any one of embodiments 187 to 190, wherein the dialysis sample is freeze-dried to powder.

[0196] Embodiment 192: The method of any one of embodiments 171 to 191, wherein the microfluidic flow reactor comprises the microfluidic flow reactor of any one of embodiments 171 to 186.

[0197] definition When used in reference to a numerical value, the term "about" means the value ±10% of the value, or ±5% of the value, or ±3% of the value, or ±2% of the value, or ±1% of the value. In certain embodiments, about refers to ±10% of the value. In certain embodiments, about refers to ±5% of the value. In certain embodiments, about refers to ±2% of the value.

[0198] Receptor antagonists are a class of receptor ligands or drugs that do not induce a biological response themselves upon binding to a receptor, but rather block or attenuate agonist-mediated responses. They are sometimes called blockers and include, for example, alpha-blockers, beta-blockers, and calcium channel blockers. In various embodiments, receptor antagonists can include direct receptor antagonists or allosteric receptor antagonists. Direct antagonists typically have affinity but little or no efficacy for their cognate receptors, and binding typically disrupts the interaction and inhibits the function of agonists or inverse agonists at the cognate receptor. Direct antagonists mediate their effects by binding to the active orthosteric (i.e., appropriate) site of the receptor (e.g., the binding site of the receptor's cognate ligand).

[0199] An "allosteric antagonist" may typically bind to other sites on the receptor (other than the natural ligand (e.g., agonist) site) or interact with a unique binding site not normally involved in the biological regulation of the receptor's activity.

[0200] The terms "subject," "individual," and "patient" can be used interchangeably and may typically be a mammal, and in certain embodiments, may be a human or non-human primate. While the compositions and methods are described herein for use in humans, they are also suitable for use in animals, e.g., veterinary medicine. Accordingly, certain exemplary organisms include, but are not limited to, humans, non-human primates, dogs, horses, cats, pigs, ungulates, rabbits, and the like. Accordingly, certain embodiments contemplate the compositions and methods described herein for use with domesticated mammals (e.g., dogs, cats, horses), laboratory mammals (e.g., mice, rats, rabbits, hamsters, guinea pigs), and agricultural mammals (e.g., horses, cattle, pigs, sheep), and the like. The term "subject" does not require the subject to have a particular status (e.g., hospitalized patient, study participant, etc.) with respect to a hospital, clinic, or research facility. Thus, in various embodiments, the subject may be a human (e.g., an adult male, adult female, adolescent male, adolescent female, boy, girl) under the care of a physician or other medical personnel in an outpatient or other clinical setting, in a hospital, psychiatric care facility, etc. In certain embodiments, the subject may not be under the care or supervision of a physician or other medical personnel. In certain embodiments, the subject may not be under the care of a physician or medical personnel, and in certain embodiments, may be able to self-prescribe and / or self-administer the compounds described herein.

[0201] As used herein, the phrase "subject in need thereof" refers to a subject suffering from or at risk of suffering from (e.g., predisposed, such as by a genetic predisposition) a disease or condition listed herein, as described below.

[0202] A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, a prophylactic dose is used in subjects prior to or at an earlier stage of disease. In certain embodiments, a prophylactically effective amount may be less than a therapeutically effective amount.

[0203] As used herein, the terms "treatment," "treating," or "treating" refer to an action that produces a desired effect on the symptoms or pathology of a disease or condition, particularly an action that can be produced using the multi-component formulations described herein, and may include, but is not limited to, a minimal change or even improvement in one or more measurable markers of the disease or condition being treated. Treatment also refers to delaying the onset, slowing or reversing the progression, reducing the severity, or alleviating or preventing the disease or condition to which the term applies, or one or more symptoms of such disease or condition. "Treatment," "treating," or "treating" does not necessarily indicate a complete eradication or cure of the disease or condition or its associated symptoms. In one embodiment, treatment involves an improvement in at least one symptom of the disease being treated. Improvement can be partial or complete. The subject receiving this treatment can be any subject in need thereof. Exemplary markers of clinical improvement will be apparent to those skilled in the art.

[0204] An "effective amount" refers to an amount (dosage and duration required) effective to achieve a desired therapeutic or preventative result. The "therapeutically effective amount" of SEs or formulations thereof containing and / or comprising sAPPα described herein may vary depending on factors such as the disease state, age, sex, and weight of the individual, as well as the ability of the treatment to elicit a desired response in the individual. A therapeutically effective amount is also one in which toxic or detrimental effects of the treatment are substantially absent or outweighed by the therapeutically beneficial effects. The term "therapeutically effective amount" refers to an amount of one or more active agents (e.g., sAPPα-containing synthetic exosomes (SEs)) described herein or a composition comprising the same that is effective to "treat" a disease or disorder in a mammal (e.g., a patient). In one embodiment, a therapeutically effective amount is an amount sufficient to improve at least one symptom associated with a neurological disorder, improve neurological function, improve cognition, or improve one or more markers of a neurological disease, or enhance the effect of one or more pharmaceutical agents administered for the treatment or prevention of a neurodegenerative condition. In certain embodiments, an effective amount is an amount that is sufficient, alone or in combination with other pharmaceutical agents, to prevent, slow the progression of, or cause regression of the disease, or to alleviate symptoms caused by the disease.

[0205] The term "alleviate" refers to the reduction or elimination of one or more symptoms of the condition or disease, and / or the slowing or delaying of the onset or severity of one or more symptoms of the condition or disease, and / or the prevention of the condition or disease.

[0206] As used herein, the phrases "ameliorating at least one symptom" or "ameliorating one or more symptoms," or their equivalents, refer to the reduction, elimination, or prevention of one or more symptoms of a condition or disease. Exemplary symptoms of conditions treated, ameliorated, or prevented by the compositions (active agents) described herein (e.g., SEs containing and / or comprising sAPPα) include, but are not limited to, a reduction, elimination, or prevention of one or more markers characteristic of a condition or disease (e.g., an increase in CSF levels of total tau (tTau), phosphotau (pTau), APPneo, soluble Aβ40, pTau / Aβ42 ratio, and tTau / Aβ42 ratio, and / or one or more components selected from the group consisting of the Aβ42 / Aβ40 ratio, the Aβ42 / Aβ38 ratio, sAPPα, the βAPAα / βAPAβ ratio, the βAPAα / Aβ40 ratio, the βAPAα / Aβ42 ratio, etc.), and / or a reduction, stabilization, or reversal of one or more diagnostic criteria (e.g., the Clinical Dementia Scale (CDR)). Exemplary means for improving neurological function include, but are not limited to, the use of the Mini-Mental State Examination (MMSE) or the Folstein test (a questionnaire test used to screen for cognitive impairment), the General Practitioner Assessment of Cognition (GPCOG), a brief screening test for cognitive impairment described by Brodaty et al., (2002) Geriatrics Society 50(3):530-534, and the like.

[0207] As used herein, the term "antibody" refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. Recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes: IgG, IgM, IgA, IgD, and IgE, respectively.

[0208] A typical immunoglobulin (antibody) structural unit is known to comprise a tetramer. Each tetramer consists of two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100-110 or more amino acids that is primarily responsible for antigen recognition. The variable light chain (V L ) and variable heavy chain (V H ) refer to these light and heavy chains respectively.

[0209] Antibodies exist as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests antibodies under the disulfide bonds in the hinge region, itself splitting them into V fragments held together by disulfide bonds. H -C HThe resulting product is a dimer of Fab, a light chain of Fab linked to a light chain of Fab. The F(ab)'2 can be reduced under mild conditions to disrupt the disulfide bond in the hinge region, thereby converting the (Fab')2 dimer into a Fab' monomer. The Fab' monomer is essentially Fab with a portion of the hinge region (see Fundamental Immunology, W.E. Paul, ed., Raven Press, NY (1993) for a more detailed description of other antibody fragments). While various antibody fragments are defined in terms of the digestion of intact antibodies, those skilled in the art will understand that such Fab' fragments can be synthesized de novo, either chemically or by utilizing recombinant DNA methodology. Thus, as used herein, the term "antibody" also includes antibody fragments produced either by the modification of whole antibodies or synthesized de novo using recombinant DNA methodology. Certain preferred antibodies are single chain antibodies (antibodies present as a single polypeptide chain), more preferably single chain Fv (sFv or scFv) antibodies in which the variable heavy chain and variable light chain are linked together (directly or via a peptide linker) to form a continuous polypeptide. Single chain Fv antibodies are composed of V chains linked either directly or by a peptide-encoded linker. H and V L A covalently linked V that can be expressed from a nucleic acid containing a coding sequence H -V L It is a heterodimer. Huston, et al. (1988) Proc. Nat. Acad. Sci. USA, 85:5879-5883. V H and V L are connected to each other as single polypeptide chains, while V H Domain and V LThe domains are non-covalently linked. The first functional antibody molecules expressed on the surface of filamentous phage were single-chain Fvs (scFvs), although other expression strategies have also been successful. For example, Fab molecules can be displayed on phage when one of the chains (heavy or light) is fused to the g3 capsid protein and the complementary chain is exported to the periplasm as a soluble molecule. The two chains can be encoded on the same or different replicons. The key is that the two antibody chains of each Fab molecule assemble post-translationally, and the dimer is incorporated into the phage particle via binding of one of the chains to, for example, g3p (see, e.g., U.S. Pat. No. 5,733,743). Those skilled in the art are familiar with scFv antibodies and many other structures in which naturally aggregated, but chemically separated light and heavy chain polypeptides from antibody V regions are converted into molecules that fold into a three-dimensional structure substantially similar to the structure of an antigen-binding site (see, e.g., U.S. Pat. Nos. 5,091,513, 5,132,405, and 4,956,778). In various embodiments, antibodies include those displayed on phage (e.g., scFv, Fv, Fab, and disulfide-linked Fv) (Reiter et al. (1995) Protein Eng. 8:1323-1331). In certain embodiments, antibodies include, but are not limited to, antibodies or antibody fragments selected from the group consisting of Fab, Fab', Fab'-SH, F(ab')2, Fv, Fv', Fd, Fd', scFv, hsFv fragments, single-chain antibodies, camelid antibodies, bispecific antibodies, and other fragments.

[0210] RNA interference (RNAi) therapeutics can prevent proteins involved in CNS disorders from being made. This can be achieved using complementary small interfering RNAs (siRNAs), which are double-stranded molecules 20–25 nucleotides in length. Similarly, microRNAs (miRNAs), small non-coding RNA molecules containing approximately 22 nucleotides, function in RNA silencing and post-transcriptional gene regulation, which may be beneficial in CNS disorders such as Alzheimer's disease.

[0211] As used herein, "administer" or "administering" means to introduce, e.g., introduce a compound or composition into a subject. The term is not limited to any particular mode of delivery and can include, for example, subcutaneous delivery, intravenous delivery, intramuscular delivery, intracisternal delivery, delivery by injection technique, transdermal delivery, oral delivery, nasal delivery, and rectal delivery. Furthermore, depending on the delivery route, administration can be performed by various individuals, including, for example, a medical professional (e.g., a doctor, a nurse, etc.), a pharmacist, or the subject (e.g., self-administration).

[0212] The phrase "causing to be administered" refers to an action taken by a medical professional (e.g., a physician) who manages and / or determines and / or authorizes the administration of the drug(s) / compound(s) under consideration to a subject, or who prescribes and / or manages the medical care of a subject. Causing to be administered may include diagnosing and / or determining an appropriate therapeutic or prophylactic regimen and / or prescribing a particular drug(s) / compound for a subject. Such prescribing may include, for example, drafting a prescription form, annotating a medical chart, etc.

[0213] The term "small organic molecule" refers to a molecule of a size comparable to organic molecules commonly used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da. [Brief explanation of the drawings]

[0214] [Figure 1]Synthesis, characterization, dialysis, and lyophilization of synthetic exosomes are shown. A) Lipids (e.g., DPPC-1,2-dipalmitoyl-sn-glycero-3-phosphocholine, cholesterol, dihexadecyl phosphate (DCP), and (1-myristoyl-2-{P6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl}-sj-glycero-3-phosphocholine)) in IPA flow into the organic microfluidic reactor stream, while the cargo (if hydrophilic) flows into the aqueous stream. The exosomes are collected (B), characterized (C), dialyzed (D), and lyophilized for storage (E). [Figure 2] Figure 1 shows atomic force microscopy (AFM) images demonstrating the deformability of SEs compared to conventional liposomes. Atomic force microscopy (AFM) images demonstrate that conventional liposomes are not deformable. As shown, the SEs described herein are deformable and can penetrate tight junctions compared to LPs. [Figure 3A] Figure 1 shows that sAPPα-SE reduces sAPPβ and Aβ1-42 in vitro. sAPPα-SE significantly reduced sAPPβ (A) and Aβ1-42 (B) in CHO-7W cells, more effectively than recombinant free sAPPα. Statistical analysis was performed using ANOVA with Tukey's post-hoc analysis. [Figure 3B] Figure 1 shows that sAPPα-SE reduces sAPPβ and Aβ1-42 in vitro. sAPPα-SE significantly reduced sAPPβ (A) and Aβ1-42 (B) in CHO-7W cells, more effectively than recombinant free sAPPα. Statistical analysis was performed using ANOVA with Tukey's post-hoc analysis. [Figure 4A] PK and biochemistry for IV sAPPα-SE. Human sAPPα peaked 1 hour after sAPPα-SE IVF delivery to wt mice and declined to vehicle-only levels by 24 hours (statistics: T-test). [Figure 4B]PK and biochemistry for IV sAPPα-SE. Delivery of sAPPα-SE to EFAD huAPP-expressing mice reduces sAPPβ levels (but not significantly). [Figure 5] A 10-fold increase in brain levels of IDUA using SE-IDUA(-) particles compared to free IDUA is shown. [Figure 6] This shows that SE-Cas9(-) has higher brain penetration than SE-Cas9(+) particles. [Figure 7] The microreactor (microfluidic reactor) designs are shown. A 26 μL reactor is shown on top, and a 1000 μL reactor is shown on the bottom. [Figure 8] A custom reactor design is shown, which is based on minimizing turbulence in the mixing region. [Figure 9] 1 illustrates one embodiment of a flow chemistry device (microfluidic reactor system). [Figure 10] One embodiment of a microfluidic flow reactor design for a series of SE-ligand reactions is shown, where the design is based on minimizing turbulence at the mixing junction. [Figure 11] Figure 1 shows the encapsulation of small hydrophobic molecules. Figure 2 shows the relationship between flow rate and size. [Figure 12] Shows encapsulation of a biological drug. Shows encapsulation of a protein with a molecular weight of 80 kDa. [Figure 13]

[0013] Figure 1 shows synthetic exosomes containing cargo that penetrate the blood-brain barrier by compressing tight junctions due to their deformability. Using a microfluidic platform, CNS biotherapeutic candidates are encapsulated in SEs. In certain embodiments, SEs for brain delivery are nanovesicles of 150 nm or less that can deform and cross the blood-brain barrier while maintaining the cargo inside. Due to their deformability, SEs have the potential to cross the blood-brain barrier (BBB) ​​by physically compressing the tight junctions of the BBB. [Figure 14A]1 shows a synthesis scheme, exemplary moieties for decorating synthetic exosomes (SEs), and exemplary strategies for decorating SEs with peptides to enhance brain penetration. A) Exemplary peptides for decorating synthetic exosomes (SEs). [Figure 14B] A) A synthetic scheme, exemplary moieties for decorating synthetic exosomes (SEs), and an exemplary strategy for decorating SEs with peptides to enhance brain penetration. B) Exemplary lipids for decorating synthetic exosomes (SEs). [Figure 14C] Figure 1 shows a synthetic scheme, exemplary moieties for decorating synthetic exosomes (SEs), and an exemplary strategy for decorating SEs with peptides to enhance brain penetration. C) An exemplary synthetic scheme for modifying SEs with peptides using "click" chemistry. DETAILED DESCRIPTION OF THE INVENTION

[0215] The present disclosure relates to the development of a binder-free brain delivery platform for encapsulating candidate CNS therapeutics into synthetic exosomes (SEs). In various embodiments, SEs for brain delivery are liposomes with a mean (or median) diameter of less than about 200 nm that can deform while retaining their internal cargo.

[0216] Without being bound by any particular theory, it is believed that synthetic exosomes are able to cross the blood-brain barrier (BBB) ​​by physically squeezing between the tight junctions of endothelial cells lining brain capillaries and by the protrusions ("feet") of astrocytes that comprise BBB like microcells, while protecting the therapeutic cargo encapsulated in the exosomes.

[0217] In various embodiments, microfluidic flow reactors are used to synthesize therapeutic agent-loaded SEs (see, e.g., Figure 1). SEs produced in this manner can be stored as lyophilized powders for several months without loss of drug cargo. In various embodiments, synthetic exosomes are made from GRAS (Generally Regarded as Safe) materials and can encapsulate a variety of molecules, including small molecules (both lipophilic and hydrophilic), DNA / RNA / siRNA, and peptides, proteins, aptamers, and combinations thereof. Various lipids, such as DPPC (1,2-dipalmitoyl-sn glycero-3-phosphocholine), cholesterol, and DCP (dihexadecyl phosphate), can be used in predetermined ratios to generate SEs with desired properties, including deformability.

[0218] For example, the flow rates of the organic phase (usually containing lipids and lipophilic compounds) and aqueous phase (usually containing potential hydrophilic therapeutic molecules) in IPA (isopropyl alcohol) can be precisely controlled to obtain SEs with specific size (60 < φ < 500 nm), zeta potential (-50 < ξ < 50), and deformability.

[0219] If desired, the surface of synthetic exosomes can be modified to include different surface charges, using various molecules such as PEG to extend circulatory half-life, or to include carrier proteins for targeted therapeutic delivery.

[0220] Having been optimized (as shown herein), the microfluidic synthesis of SEs is easily scalable to obtain larger quantities, allowing for good batch-to-batch reproducibility.

[0221] As a proof-of-principle study, we encapsulated fluorescently labeled zoledronate for transdermal delivery to a localized site (parietal skin above the skull) (see, e.g., U.S. Patent Application No. WO2017087685 (PCT / US2016 / 062552)). In addition to presenting the size, encapsulation efficiency, zeta potential, and tunability of SEs synthesized by this method, we also provided evidence of successful long-term storage of drug-loaded SEs. Using high-resolution fluorescence and confocal image analysis, we demonstrated successful transdermal delivery of the encapsulated payload. Delivery was greater with SEs compared to non-deformable nanovesicles or aqueous drug solutions. While this experiment was not performed for the purpose of brain delivery, it provides proof-of-concept for using SEs for membrane-mediated drug delivery. The tunability of our microfluidic SE synthesis method allows for the adjustment of the size of therapeutic-agent-loaded SEs.

[0222] In our ongoing experiments for successful delivery of potential therapeutic agents to the brain, we have encapsulated a large protein fragment, the neurotrophic factor soluble amyloid precursor protein alpha (sAPPα, 678 amino acids in length), and characterized the size, encapsulation efficiency, and zeta potential of sAPPα-SE (see Table 1). [Table 1]

[0223] Next, we tested sAPPα-SE in vitro in cells to confirm successful delivery and release of the SE payload into cells while maintaining the cargo's biological activity. sAPPα is an endogenous inhibitor of BACE1 (beta-site cleaving enzyme 1), an enzyme involved in the cleavage of full-length (FL) APP, resulting in the production of sAPPβ and β C-terminal fragment (βCTF). βCTF is then cleaved by the γ-secretase complex to generate amyloid-β (Aβ) and the APP intracellular domain. Therefore, successful delivery of sAPPα to cells expressing FL APP should result in a reduction of sAPPβ and βCTF, and the reduction of the latter should result in a reduction of Aβ. As shown in Figure 3A, 48 h after delivery of unencapsulated free recombinant sAPPα or sAPPα-SE to Chinese hamster ovary cells (CHO-7W cells) stably expressing human FL APP, sAPPα-SE was found to significantly reduce sAPPβ compared to the medium-only control, compared to free sAPPα. Figure 3B shows that the reduction of Aβ1-42 was significantly greater with sAPPα-SE than with free sAPPα. The greater effect of sAPPα-SE may be due to protection of sAPPα in the SE from metabolic or other degradation and / or more efficient delivery of sAPPα to its target enzyme, BACE1.

[0224] Next, we determined whether peripheral injection of sAPPα-SE successfully delivered sAPPα to the mouse brain. To distinguish endogenously expressed sAPPα from exogenous SE-encapsulated sAPPα, we used wild-type mice expressing only endogenous mouse APP and injected SE loaded with recombinant human sAPPα. Human sAPPα levels in the brain were then measured using a human sAPPα-specific AlphaLISA (Perkin-Elmer). As shown in Figure 4A, 1 h after IV delivery of sAPPα-SE, the level of human sAPPα in mouse brain tissue was approximately 1500 AU (au), compared with only approximately 300 AU at 24 h (considered background levels because the 1- and 24-h vehicle-only control values ​​were similar). The concentration could be determined by assaying a known concentration of sAPPα, which was found to be a pharmacologically relevant concentration of approximately 12 nM. These results demonstrate successful delivery of potentially effective levels of sAPPα to the brain.

[0225] Finally, to confirm target binding, we injected sAPPα-SE into EFAD Alzheimer's disease (AD) model mice. EFAD transgenic mice express human apolipoprotein E4 (E), human APP with three familial AD mutations, and human presenilin 1 with two familial AD mutations (FAD). These mice exhibited AD-like amyloid pathology at an early age, beginning with increased production of sAPPβ. As shown in Figure 4B, sAPPβ was lower with sAPPα-SE alone than with the vehicle-only control, but not with free sAPPα. This demonstrates target binding and preservation of the biological activity of sAPPα encapsulated in SEs. These data support the efficacy and target binding of sAPPα-SE delivery in the brain.

[0226] In view of the above, an improved microfluidic flow reactor for the production of synthetic exosomes is described herein. Also provided are improved exosome formulations that are believed to provide improved delivery to the central nervous system and that provide a desired specific zeta potential. Furthermore, the improved exosomes are stable in solution (do not substantially aggregate) and effectively retain the loaded therapeutic moiety, thereby providing effective delivery across the blood-brain barrier (BBB).

[0227] Improved synthetic exosome formulations In various embodiments, the synthetic exosomes described herein comprise liposomes formed from a lipid bilayer, said lipid bilayer comprising: A) one or more phospholipids selected from the group consisting of phospholipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids, each having a lipid carbon chain length in the range of 3 to 24 carbon atoms; B) cholesterol, cholesterol hemisuccinate or phytosterol, and C) Containing or consisting of a nonionic surfactant.

[0228] In certain embodiments, synthetic exosomes have a diameter ranging from about 50 nm to about 200 nm. Typically, synthetic exosomes can cross the blood-brain barrier without substantially leaking the therapeutic site. In certain embodiments, exosomes are capable of crossing the blood-brain barrier (BBB) ​​and delivering the therapeutic moiety contained within the exosomes to the central nervous system without losing more than about 40%, or more than 30%, or more than 20%, or more than 10%, or more than 5%, or more than 3%, or more than 1% of the therapeutic moiety contained within the exosomes.

[0229] In certain embodiments, the lipid bilayer comprising the synthetic exosomes is composed of more phospholipids (e.g., 1, 2, 3, 4 or more phospholipids), cholesterol and / or cholesterol hemisuccinate and / or phytosterol, and a non-ionic surfactant.

[0230] In certain embodiments, the lipid bilayer comprising the synthetic exosomes does not contain alcohol (e.g., ethanol). In certain embodiments, the lipid bilayer comprising the synthetic exosomes does not contain glutathione-maleimide-PEG2000-distearoylphosphatidylethanolamine. In various embodiments, the synthetic exosomes are not transferosomes or ethosomes.

[0231] In certain embodiments, the molar ratio of total phospholipids to cholesterol, cholesterol hemisuccinate and / or phytosterols ranges from about 4-8 moles of phospholipids to about 1-2 moles of cholesterol.

[0232] In certain embodiments, the amount of surfactant ranges from about 1%, or about 3%, or about 5%, or about 8% to about 18%, or about 15%, or about 13%, or about 10% (wt / wt). In certain embodiments, the surfactant comprises one or more surfactants selected from the group consisting of Span 80, Tween 20, BRIJ® 76 (stearyl poly(10) oxyethylene ether), BRIJ® 78 (stearyl poly(20) oxyethylene ether), BRIJ® 96 (oleyl poly(10) oxyethylene ether), and BRIJ® 721 (stearyl poly(21) oxyethylene ether). In various embodiments, the surfactant comprises or consists of Span 80.

[0233] In certain embodiments, the synthetic exosome lipid bilayer (LB) comprises about 10% to about 20%, or about 15% by weight of Span 80.

[0234] phospholipids In various embodiments, the lipid bilayers comprising the synthetic exosomes described herein are formed from one, two, three, four, or more phospholipids, cholesterol or functionalized cholesterol (e.g., cholesterol hemisuccinate (CHEMS), lysine-based cholesterol (CHLYS), and PEGylated cholesterol (Chol-PEG)) or phytosterols, and one or more surfactants (e.g., Span-80).

[0235] In certain embodiments, synthetic exosomes carry one or more targeting moieties attached to the lipid bilayer. Exemplary targeting moieties include, but are not limited to, amino acids transported to the central nervous system (CNS) by amino acid transporters (e.g., amino acid-functionalized lipids), transferrin, folate, various antibodies, CD171, and the like.

[0236] In various embodiments, the lipid bilayer comprises one or more phospholipids, including, but not limited to, phosphate, phosphoglycerol and phosphocholine lipids, phosphoethanolamine lipids with or without polyethylene glycol (7-100 monomers), and cholesterol. In various embodiments, the lipid carbon chain ranges from about 3 to about 24 carbon atoms. Phospholipids suitable for use in the synthetic exosomes described herein may include dihexanoyl-sn-glycero-3-phosphate (DHPA), didecanoyl-sn-glycero-3-phosphate (DDPA), distearoyl-sn-glycero-3-phosphate (DTPA), dihexadecyl phosphate (DHP), and the like.

[0237] Phosphoglycerol lipids suitable for use in lipid bilayers comprising the synthetic exosomes described herein can include dihexanoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DHPG), dilauroyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DLPG), distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DTPG), and the like.

[0238] Phosphocholine lipids suitable for use in lipid bilayers comprising the synthetic exosomes described herein can include dipropionyl-sn-glycero-3-phosphocholine (PC), diheptanoyl-sn-glycero-3-phosphocholine (DHPC), dimyristoyl-sn-glycero-3-phosphocholine (DMPC), dilignoceroyl-sn-glycero-3-phosphocholine (DGPC), and the like.

[0239] Phospholipids comprising alkynes, such as phosphoethanolamines, suitable for use in lipid bilayers comprising the synthetic exosomes described herein can include dihexanoyl-sn-glycero-3-phosphoethanolamine (DHPE), distearoyl-sn-glycero-3-phosphoethanolamine (DTPE), and the like.

[0240] Phosphoethanolamine-PEG lipids suitable for use in lipid bilayers comprising the synthetic exosomes described herein may include dipalmitoyl-sn-glycero-3-phospho(ethylene glycol) (DPPEG1), dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350 (DMPEG350), distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350] (DTPEG350), dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-550] (DMPEG550), dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-1000] (DMPEG1000).

[0241] Other lipids suitable for use in lipid bilayers comprising the synthetic exosomes described herein may include dioleoyl-sn-glycero-3-phosphocholine(N-aminoethyl) (PC-NH2), diphytanoyl-sn-glycero-3-phosphoethanolamine, dioleoyl-3-trimethylammonium-propane (DOTAP), distearoyl-3-trimethylammonium-propane (DSTAP), dimyristoyl-3-trimethylammonium-propane (DMTAP), di-O-octadecyl-sn-glycero-3-phosphocholine (DOPC), and the like.

[0242] Cholesterol and cholesterol analogues / derivatives In various embodiments, the lipid bilayer comprising the synthetic exosomes described herein comprises cholesterol, a cholesterol derivative or a cholesterol analog (e.g., a phytosterol).

[0243] Exemplary cholesterol derivatives include, but are not limited to, cholesterol hemisuccinate, lysine-based cholesterol (CHLYS), 20-hydroxycholesterol, 22-hydroxycholesterol, 24-hydroxycholesterol, 25-hydroxycholesterol, 27-hydroxycholesterol, cholesteryl succinate, colosuccinate, coltrisuccinate, lithocholesterol succinate, chenodesoxycholesterol bissuccinate, hederoside, etc. In certain embodiments, the cholesterol derivative is cholesterol hemisuccinate.

[0244] In certain embodiments, phytosterol is used in addition to or instead of cholesterol.Suitable phytosterols include, but are not limited to, 9,10-secosteroids (for example, vitamin D3, vitamin D2, calcipotriol, etc.), C-24 alkyl steroids (for example, stigmasterol, β-sitosterol, etc.), and five-membered ring steroids (for example, betulin, lupeol, ursolic acid, and oleanolic acid).In certain embodiments, phytosterol is a C-24 alkyl steroid.

[0245] Whenever cholesterol (CHOL) is described herein, it will be recognized that the cholesterol, cholesterol derivative, or phytocholesterol is further functionalized. Thus, for example, in certain embodiments, the cholesterol, cholesterol derivative, or phytocholesterol is PEGylated.

[0246] Specific and effective synthetic exosome formulations The specific lipid mixture used for synthetic exosomes is determined by considering the nature of the molecule(s) to be entrapped, the anatomical delivery location, and the desired surface charge. For example, in the case of biological molecules (e.g., proteins, nucleic acids, antibodies, etc.), a mixture of two to four lipids with small carbon chains (e.g., 3 to 14 carbon atoms) is used in combination with cholesterol and / or functionalized cholesterol and / or phytosterols, and a surfactant (e.g., Span-80) is utilized to form the exosomes. In various exemplary but non-limiting embodiments, the concentration of surfactant (e.g., Span-80) can range from about 1%, or about 5%, to about 20%, or to about 15% (w / w), depending on the degree of deformability required. Examples of formulations particularly suitable for delivery of biological payloads are shown in Table 2. [Table 2]

[0247] For delivery of hydrophobic small molecules, a mixture of 2-4 lipids with large carbon chains (e.g., 14-24 carbon atoms) is used in combination with cholesterol and / or functionalized cholesterol and / or phytosterols, and a surfactant (e.g., Span-80) is utilized to form exosomes. Exemplary formulations particularly suitable for delivery of small molecules are shown in Table 3. [Table 3]

[0248] In certain embodiments, the CH in the formulations of Tables 2 and 3 is cholesterol.

[0249] In certain embodiments, CH in the formulations of Tables 2 and 3 is a cholesterol derivative. Thus, in certain embodiments, CH in the formulations of Tables 2 and 3 is cholesterol hemisuccinate. In certain embodiments, CH in the formulations of Tables 2 and 3 is lysine-based cholesterol (CHLYS). In certain embodiments, CH in the formulations of Tables 2 and 3 is 20-hydroxycholesterol. In certain embodiments, CH in the formulations of Tables 2 and 3 is 22-hydroxycholesterol. In certain embodiments, CH in the formulations of Tables 2 and 3 is 24-hydroxycholesterol. In certain embodiments, CH in the formulations of Tables 2 and 3 is 25-hydroxycholesterol. In certain embodiments, CH in the formulations of Tables 2 and 3 is 27-hydroxycholesterol. In certain embodiments, CH in the formulations of Tables 2 and 3 is cholesteryl succinate. In certain embodiments, CH in the formulations of Tables 2 and 3 is colesuccinate. In certain embodiments, CH in the formulations of Tables 2 and 3 is colesuccinate. In certain embodiments, the CH in the formulations of Tables 2 and 3 is lithocol succinate. In certain embodiments, the CH in the formulations of Tables 2 and 3 is chenodesoxycol bissuccinate. In certain embodiments, the CH in the formulations of Tables 2 and 3 is hederoside.

[0250] In certain embodiments, the CH in the formulations of Tables 2 and 3 is a phytosterol. Thus, in certain embodiments, the CH in the formulations of Tables 2 and 3 is a 9,10-secosteroid. In certain embodiments, the CH in the formulations of Tables 2 and 3 is vitamin D3. In certain embodiments, the CH in the formulations of Tables 2 and 3 is vitamin D2. In certain embodiments, the CH in the formulations of Tables 2 and 3 is calcipotriol. In certain embodiments, the CH in the formulations of Tables 2 and 3 is a C-24 alkyl steroid. In certain embodiments, the CH in the formulations of Tables 2 and 3 is stigmasterol. In certain embodiments, the CH in the formulations of Tables 2 and 3 is β-sitosterol. In certain embodiments, the CH in the formulations of Tables 2 and 3 is a pentacyclic steroid. In certain embodiments, the CH in the formulations of Tables 2 and 3 is betulin. In certain embodiments, the CH in the formulations of Tables 2 and 3 is lupeol. In certain embodiments, the CH in the formulations of Tables 2 and 3 is ursolic acid. In certain embodiments, the CH in the formulations of Tables 2 and 3 is oleanolic acid.

[0251] The foregoing formulations are exemplary and non-limiting, and many other exosome formulations will be available to those skilled in the art using the teachings provided herein.

[0252] Targeting section In certain embodiments, synthetic exosomes carry one or more targeting moieties attached to the lipid bilayer. Exemplary targeting moieties include, but are not limited to, amino acids transported to the central nervous system (CNS) by amino acid transporters (e.g., amino acid-functionalized lipids), transferrin (e.g., transferrin-functionalized lipids), transferrin receptor-binding peptides (see, e.g., Figure 14A), folic acid, various BBB endothelial cell-binding antibodies, CD171, and the like.

[0253] In certain embodiments, the phospholipids or cholesterol comprising the synthetic exosomes described herein can be functionalized to attach one or more targeting moieties. In certain embodiments, the targeting moiety can include an amino acid to utilize an amino acid transporter for internalization into target cells. Essential amino acids are generally transported across the BBB via specific transporters to participate in brain amino acid metabolism, such as neurotransmitter synthesis. Based on differences in substrates, amino acid transporters are divided into cationic, anionic, and neutral amino acid transporters. The large neutral amino acid transporter (LAT1) is the most abundant carrier of amino acids and is expressed on both the luminal and abluminal membranes of BCECs. LAT1 transports large neutral amino acids, such as leucine, tryptophan, tyrosine, and phenylalanine, across the BBB via an ion-independent pathway. Thus, in certain embodiments, the targeting moiety can include carrying large neutral amino acids, such as leucine, tryptophan, tyrosine, and phenylalanine.

[0254] Other exemplary targeting moieties include, but are not limited to, antibodies, lectins, transferrin, folate, CD171, and the like.

[0255] Synthetic exosome (SE) synthesis using a microfluidic flow reactor In one exemplary embodiment, a microfluidic reactor is used to synthesize synthetic exosomes. In a specific embodiment, the microfluidic reactor uses three pumps to flow three fluids into a microfluidic chip. In a specific embodiment, two of the flows are water, and the remaining flow is isopropyl alcohol (IPA).

[0256] In certain embodiments, the flow rate of the aqueous stream can range from 0.5 mL / min to 10 mL / min depending on particle size requirements, including any biologics as needed. Each flow rate can be independently manipulated.

[0257] In certain embodiments, the flow rate of the organic stream can range from 0.05 mL / min to 5 mL / min depending on particle size requirements, optionally including a lipid mixture and any small hydrophobic molecules.

[0258] In certain embodiments, the microflow fluid flow reactor utilizes one or more organic streams containing lipid bilayer components (e.g., cholesterol, phospholipids, surfactants) and one or more aqueous (e.g., water) streams. In certain embodiments, the organic stream contains an alcohol (e.g., isopropyl alcohol) in addition to the lipid bilayer components.

[0259] In various embodiments, the therapeutic moiety (cargo) is provided in the stream most likely to suspend or dissolve said moiety. Thus, for example, in a typical embodiment, a hydrophobic therapeutic moiety is provided in the organic stream, and a hydrophilic moiety is provided in the aqueous stream. Thus, by way of example, organic small molecules (e.g., hydrophobic organic small molecules) are provided in the organic stream. Hydrophilic moieties such as peptides, enzymes, proteins and antibodies, nucleotides, DNA, etc. can be provided in the aqueous stream. It will be appreciated that in certain embodiments, two, three, or four different therapeutic moieties can be loaded into each synthetic exosome.

[0260] In certain exemplary, non-limiting embodiments, the concentration of the organic stream lipid mixture ranges from about 5 mM to about 20 mM, and any hydrophobic cargo ranges from 0.05 mM to about 2 mM depending on the solubility of the cargo. In certain exemplary, non-limiting embodiments, if the aqueous stream contains hydrophilic molecules, their concentration ranges from about 0.01 mg / mL to about 5 mg / mL depending on their solubility.

[0261] Two commercially available reactors were used for the synthesis of synthetic exosomes: a 26 μL reactor and a 1000 μL reactor, although other reactors are possible. Two exemplary reactor designs are shown in FIG. 7.

[0262] To improve SE synthesis, a custom-made reactor can be used, the design of which is shown in Figure 8. As shown in the exemplary embodiment shown in Figure 8, the microfluidic flow reactor includes a central channel with two or more branch channels that feed into the central channel, thereby forming a mixing junction, where the diameters of the central and branch channels and the angle between the central and branch channels are selected to maintain a backpressure of less than about 100 psi. The design is based on minimizing turbulence within the junction while maintaining a backpressure of less than 100 psi, where the collision angle within the mixing junction can minimize turbulence, and the width and height of the channels can control the pressure.

[0263] In certain embodiments, the width(s) of the central channel and / or branch channels independently range from about 0.5 μm, or from about 1 μm, or from about 10 μm, or from about 20 μm, or from about 30 μm, to about 100 μm, or to about 80 μm, or to about 60 μm, or to about 50 μm, or to about 40 μm. In certain embodiments, the height(s) (depth(s)) of the central channel and / or branch channels independently range from about 0.5 μm, or from about 1 μm, or from about 10 μm, or from about 20 μm, or from about 30 μm, to about 100 μm, or to about 80 μm, or to about 60 μm, or to about 50 μm, or to about 40 μm. In certain embodiments, the angle (α) between the central channel and the side channels ranges from about 10 degrees, or from about 15 degrees, or from about 20 degrees, or from about 25 degrees, to about 90 degrees, or to about 80 degrees, or to about 70 degrees, or to about 60 degrees, or to about 50 degrees. In certain embodiments, the reactor includes one or more pumps providing a fluid pressure in the range of about 1 bar to about 31 bar.

[0264] One embodiment of a microfluidic reactor system is shown in Figure 9, with its elements highlighted.

[0265] Functionalization of a series of lipids Synthetic exosome synthesis using a microfluidic reactor also allows for the labeling of a series of synthetic exosomes with various ligands using functionalized lipids, such as those listed in Table 4 below. This can be achieved using reactors connected in series or with the novel reactor design shown in FIG. 10. As shown in the exemplary embodiment shown in FIG. 10, the microfluidic flow reactor includes a central channel with two or more branch channels that feed into the central channel, thereby forming a first mixing junction, and a second set of branch channels that feed into the central channel, thereby forming a second mixing junction. It will be appreciated that the reactor may include additional mixing junctions. Thus, reactors containing two, three, four, five, six, or more mixing junctions are contemplated. In certain embodiments, the diameters of the central and branch channels, as well as the angle provided between the central and branch channels, are selected to maintain a backpressure of less than about 100 psi. The design is also based on minimizing turbulence within the junction while maintaining back pressure below 100 psi. The impingement angle within the mixing junction can minimize turbulence, and the channel width and height can control pressure.

[0266] In terms of synthesis, after the SE is formed at the first mixing junction, the ligand can then react with the SE at the second mixing junction. Furthermore, in certain embodiments, more labeled lipids can be formed and reacted with the SE at additional mixing junctions. All reactions can be individually tuned.

[0267] In certain exemplary, non-limiting embodiments, the "labeled" synthesis facilitates the use of certain protein ligands, including, but not limited to, ligands with receptors at the BBB. Exemplary ligands include, but are not limited to, insulin, transferrin, low-density lipoprotein receptor-related protein 1, or any other ligand, such as an amino acid.

[0268] In certain embodiments, one skilled in the art can use lipid NHS esters and then functionalize them with a variety of ligands, such as peptides, proteins, amino acids, and the like. [Table 4-1] [Table 4-2]

[0269] Pharmaceutical preparations In various embodiments, pharmaceutical formulations contemplated herein comprise the synthetic exosomes described herein and a pharmaceutically acceptable carrier. The term "carrier" generally refers to an inert substance used as a diluent or vehicle in pharmaceutical formulations. The term can also encompass a typically inert substance that imparts viscosity to a composition. Physiologically acceptable carriers are typically present in liquid form. Examples of liquid carriers include, but are not limited to, saline, phosphate buffer, normal buffered saline (135-150 mM NaCl), water, buffered water, 0.4% saline, 0.3% glycine, 0.3 M sucrose (and other carbohydrates), glycoproteins (e.g., albumin, lipoproteins, globulins, etc.) to enhance stability, and the like. Because physiologically acceptable carriers are determined in part by the particular composition being administered, as well as the particular method used to administer the composition, there are a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, Maak Publishing Company, Philadelphia, Pa., 17th ed. (1985)).

[0270] In various embodiments, pharmaceutical preparations can be sterilized by conventional, well-known sterilization techniques or prepared under sterile conditions. Aqueous solutions can be packaged for use or filtered under aseptic conditions and lyophilized, and the lyophilized preparation is combined with a sterile aqueous solution before administration. In certain embodiments, the composition can contain pharmaceutically acceptable auxiliary substances, such as pH adjusting agents and buffers, osmotic pressure adjusting agents, wetting agents, etc., as needed to approximate physiological conditions, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate. Sugars can also be included to stabilize the composition, such as stabilizers for lyophilized compositions.

[0271] Pharmaceutical compositions suitable for parenteral administration, such as by intraarticular, intravenous, intramuscular, intratumoral, intradermal, intraperitoneal, and subcutaneous routes, can include aqueous and non-aqueous isotonic sterile injection solutions. In certain embodiments, injection solutions can contain aqueous and non-aqueous sterile suspensions, which can include antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, as well as suspending agents, solubilizers, thickeners, stabilizers, and preservatives. Injection solutions and suspensions can also be prepared from sterile powders, such as lyophilized synthetic exosomes. In certain embodiments, the compositions can be administered, for example, by intravenous infusion, intraperitoneally, intravesically, or intrathecally. In various embodiments, parenteral and intravenous administration are also contemplated. The formulations of the liposome compositions can be presented in single-use or multi-dose sealed containers, such as ampoules and vials.

[0272] In certain embodiments, the pharmaceutical composition is formulated for systemic administration as an injectable.

[0273] In certain embodiments, the pharmaceutical composition is formulated as a spray, eg, for oral and / or nasal inhalation.

[0274] In certain embodiments, the pharmaceutical composition is formulated for topical, intradermal, subcutaneous and / or transdermal delivery.

[0275] In certain embodiments, the pharmaceutical composition is formulated for application to the oral, vaginal and / or rectal mucosa.

[0276] In certain embodiments, the pharmaceutical composition is in unit dosage form.In this form, the pharmaceutical composition is further divided into unit doses containing appropriate amounts of active ingredients (synthetic exosomes).The unit dosage form can be a packaged composition, and the package contains individual amounts of the pharmaceutical composition.The composition can also contain other compatible therapeutic agents if necessary.

[0277] In certain embodiments, the synthetic exosomes described herein may be delivered through the skin using conventional transdermal drug delivery systems, i.e., transdermal "patches," in which the synthetic exosomes or formulations thereof are typically contained within a laminated structure that functions as a drug delivery device for application to the skin. In such structures, the synthetic exosomes and / or formulations thereof are typically contained in a layer or "reservoir" underlying an upper substrate layer. The term "reservoir" in this context will be understood to refer to a quantity of synthetic exosomes and / or formulations thereof that is ultimately available for delivery to the surface of the skin. Thus, for example, a "reservoir" may comprise the active ingredient(s) in an adhesive on the substrate layer of the patch, or in any of a variety of different matrix formulations known in the art. A patch may contain a single reservoir, or may contain multiple reservoirs.

[0278] In one exemplary embodiment, the reservoir comprises a polymer matrix of a pharmaceutically acceptable contact adhesive material that functions to affix the system to the skin during drug delivery. Examples of suitable skin contact adhesive materials include, but are not limited to, polyethylene, polysiloxane, polyisobutylene, polyacrylate, polyurethane, etc. Alternatively, the synthetic exosome and / or synthetic exosome formulation reservoir and the skin contact adhesive are present as separate, distinct layers, with the adhesive underlying the reservoir, in which case the reservoir may be a polymer matrix as described above, a liquid or hydrogel reservoir, or may take other forms. The backing layer of these laminates, which serves as the top surface of the device, preferably serves as the primary structural element of the "patch" and provides the device with high flexibility. The material selected for the backing layer is preferably substantially impermeable to the synthetic exosomes and / or their formulations and to any other materials present.

[0279] Alternatively, other pharmaceutical delivery systems can be used. For example, emulsions and microemulsions / nanoemulsions are well-known examples of delivery vehicles that can be used to protect and deliver pharmaceutically active compounds. Certain organic solvents, such as dimethyl sulfoxide, can also be used, but are usually more toxic.

[0280] Therapeutic moieties delivered using synthetic exosomes The synthetic exosomes described herein can be readily used to transport any of a number of therapeutic moieties across the blood-brain barrier and effectively deliver those therapeutic moieties to the central nervous system (e.g., the brain). Exemplary therapeutic moieties include, but are not limited to, proteins, antibodies, enzymes, DNA encoding inhibitory RNA, inhibitory RNA or microRNA (miRNA), and / or small organic molecules. It will be appreciated that in certain embodiments, a single therapeutic moiety is delivered using the synthetic exosomes described herein, while in other embodiments, multiple therapeutic moieties are delivered using the synthetic exosomes described herein. Thus, for example, in certain embodiments, two, three, four, or more therapeutic moieties can be encapsulated in a single synthetic exosome.

[0281] organic small molecules Exemplary organic small molecules include hydantoins described in PCT Publication No. WO2014 / 127042 (PCT / US2014 / 016100), disulfiram and / or analogs thereof, honokiol and / or analogs thereof, tropisetron and / or analogs thereof, nimetazepam and / or analogs thereof (see, e.g., PCT / US2011 / 048472 (WO2012 / 024616)), tropinol esters and / or related esters and / or analogs thereof (see, e.g., PCT / US2012 / 049223 (WO2013 / 019901)), TrkA kinase inhibitors (e.g., , ADDN-1351) and / or analogs thereof (e.g., PCT / US2012 / 051426 (see WO2013 / 026021A2), D2 receptor agonists and alpha-1 adrenergic receptor antagonists, and APP-specific BACE inhibitors (ASBIs) described in PCT / US2013 / 032481 (WO2013 / 142370), including, but not limited to, galangin, galangin prodrugs, rutin, rutin prodrugs, and other flavonoids and flavonoid prodrugs described or claimed herein.

[0282] Non-limiting examples of additional therapeutic agents include a drug selected from the group consisting of: (a) a drug useful for treating Alzheimer's disease and / or one or more symptoms of Alzheimer's disease, (b) a drug useful for inhibiting synthetic Aβ, and (c) a drug useful for treating a neurodegenerative disease.

[0283] Other organic small molecules include various chemotherapeutic compounds, including, but not limited to, mitoxantrone, retinoic acid derivatives, doxorubicin, vinblastine, vincristine, cyclophosphamide, ifosfamide, cisplatin, 5-fluorouracil, camptothecin derivatives, interferons, tamoxifen, and taxol, abraxane, doxorubicin, pamidronate disodium, anastrozole, exemestane, cyclophosphamide, epirubicin, toremifene, letrozole, trastuzumab, megestrol tamoxifen, paclitaxel, docetaxel, capecitabine, goserelin acetate, zoledronic acid, and the like.

[0284] SE-mediated delivery of sAPPα (or other proteins) to the brain and CNS Delivery of sAPPα to the brain is thought to be clinically beneficial for the treatment of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), cerebral amyloid angiopathy, Huntington's disease, as well as traumatic brain injury (TBI), and stroke.

[0285] sAPPα is a protein fragment of approximately 100 kDa generated by normal processing of amyloid precursor protein (APP) by α-secretase. Because sAPPα is a large protein and prone to proteolysis, we encapsulated sAPPα into deformable synthetic exosomes (SE-hsAPPα) to enhance its potential for delivery to the brain.

[0286] SE containing sAPPα (SE-hsAPPα) was synthesized using flow chemistry in a microfluidic reactor, supporting efficient and reproducible production of SE. SE-hsAPPα was tested in CHO-7W cells and confirmed the release of sAPPα and inhibition of BACE1, as determined by the reduction of the intracellular BACE1 APP-derived cleavage product sAPPβ (see Figure 3). SE-hsAPPα significantly reduced sAPPβ.

[0287] We also assessed the ability of SE-hsAPPα to penetrate the blood-brain barrier (BBB) ​​by measuring sAPPα levels in mouse brains after intravenous (IV) injection (Figure 4). Brain sAPPα was approximately 13 nM 1 hour after injection.

[0288] Encapsulation of sAPPα in SEs allows for efficient delivery of this large protein across the blood-brain barrier to the brain, and given the surprising finding that delivered sAPPα appears to retain its activity in allosterically inhibiting BACE, SEs (SE-hsAPPα) may find utility as therapeutic and / or prophylactic agents in many settings.

[0289] In particular, sAPPα-containing SEs containing sAPPα may find utility in the treatment or prevention of Alzheimer's disease and / or mild cognitive impairment (MCI) associated with amyloidogenic pathology, and may be used prophylactically to slow or prevent the progression of an asymptomatic state to MCI and / or from an asymptomatic state to pre-Alzheimer's disease or early stage Alzheimer's disease, and / or to slow or halt the progression of Alzheimer's disease.

[0290] Furthermore, synthetic exosomes containing sAPPα may be clinically beneficial for treating not only Alzheimer's disease, but also amyotrophic lateral sclerosis (ALS), cerebral amyloid angiopathy, and traumatic brain injury (TBI) and stroke. In Alzheimer's disease, sAPPα levels are reduced in the brain, particularly in patients with the ApoE4 allele. sAPPα levels are also regulated in several CNS disorders, including amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD). Traumatic brain injury and stroke result in a short-term increase in Aβ levels in the brain, which can be regulated by short-term delivery of the allosteric BACE inhibitor sAPPα.

[0291] Thus, in certain embodiments, synthetic exosomes (SEs) containing sAPPα and pharmaceutical formulations containing these SEs are provided. Prophylactic and / or therapeutic methods using SEs are also provided. Additionally, methods of producing (manufacturing) SEs are provided. Other proteins are contemplated, including, but not limited to, the IDUA gene product (α-L-iduronidase) in mucopolysaccharidosis type I (MPS I) or acid sphingomyelinase (ASM) (also known as SMPD1) in Niemann-Pick disease (NPD).

[0292] SE-mediated antibody delivery to the brain and CNS It was a surprising discovery that the synthetic exosomes (also known as SEs) described herein can be used to effectively facilitate passage of "SE-encapsulated" antibodies across the blood-brain barrier. Exemplary antibodies include, but are not limited to, antibodies useful for treating brain cancer and / or neurodegenerative diseases (e.g., Alzheimer's disease, amyloid-associated mild cognitive impairment (MCI), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Parkinson's disease (PD), etc.).

[0293] Alzheimer's disease Alzheimer's disease (AD) is a progressive neurodegenerative disorder clinically characterized by memory and cognitive impairment. It is generally classified into two types: sporadic AD (SAD) and familial AD (FAD). Three genes—amyloid precursor protein (APP), presenilin 1 (PS1), and presenilin 2 (PS2)—cause familial AD (FAD), while the ε4 allele of the apolipoprotein E gene has been identified as a major risk factor for sporadic AD (SAD). The neuropathology of AD is characterized by two types of pathology: extracellular senile plaques and intracellular neurofibrillary tangles (NFTs), which consist of β-amyloid (Aβ) (a cleavage product of APP) 4 and abnormally phosphorylated tau (a microtubule-associated protein), respectively.

[0294] Research has demonstrated that most neurodegenerative diseases, including Alzheimer's disease, Lewy body and other dementias, Parkinson's disease, and prion diseases, develop and progress along a similar pathway. In each disease, certain proteins change shape from soluble proteins that function physiologically to proteins that lose the ability to perform necessary tasks in the brain, initiating a chain reaction in which they bind together in an almost uncontrolled manner. These aggregates become toxic to brain cells.

[0295] It is thought that attacking the early forms of these proteins as they change shape could either prevent them from forming into aggregates that lead to plaques and tangles, or neutralize their ability to spread throughout the brain, halting the progression of certain neurological diseases.

[0296] In certain embodiments, this can be achieved through the use of antibodies (e.g., monoclonal antibodies) reactive with intermediate or "oligomeric" states of amyloid and tau proteins found in Alzheimer's disease, as well as prion disease proteins.

[0297] Researchers have shown that a number of antibodies directed against proteins comprising amyloid deposits and / or proteins involved in the amyloidogenic process can slow, halt, or reverse amyloid plaque formation and possibly the associated cognitive decline.

[0298] Exemplary targets for the treatment of Alzheimer's disease include, but are not limited to, Aβ, mutant Aβ, tau, mutant tau, apoE, and the like (see, e.g., Table 5). [Table 5]

[0299] In certain embodiments, the antibody targets mutant Aβ, including but not limited to APPsw, APP A713T, pyroglutamate-3Aβ, and the like.

[0300] Without being bound by any particular theory, it is believed that the synthetic exosomes described herein can effectively deliver these and other antibodies across the blood-brain barrier and deliver effective amounts to the brain.

[0301] Amyotrophic lateral sclerosis (ALS) Antibodies against HERV-K envelope protein or SOD1 are believed to be effective candidates for the treatment of amyotrophic lateral sclerosis (ALS). Thus, in certain embodiments, synthetic exosomes containing anti-HERV-K or anti-SOD1 antibodies are contemplated.

[0302] Huntington's disease The antibody VX15 is a monoclonal antibody that blocks the activity of semaphorin 4D (SEMA4D), a molecule thought to promote chronic inflammatory responses in the brain, and is believed to be effective in treating Huntington's disease (HD). VX15 is the company's new clinical-stage monoclonal antibody that blocks the activity of semaphorin 4D (SEMA4D), a molecule thought to promote chronic inflammatory responses in the brain. Accordingly, in certain embodiments, synthetic exosomes containing VX15 or other anti-SEMA4D antibodies are contemplated.

[0303] Parkinson's disease The monoclonal antibody PRX002 (prasinezumab) targets alpha-synuclein, inhibits the intercellular transmission of alpha-synuclein, and is believed to alter the disease progression of Parkinson's disease (PD). Accordingly, in certain embodiments, synthetic exosomes comprising prasinezumab or other anti-alpha-synuclein antibodies are contemplated.

[0304] brain cancer The synthetic exosomes described herein can also be used to transport antibodies (or chemotherapeutic drugs) useful in treating brain tumors (CNS tumors) across the blood-brain barrier. Cancer cells can find ways to use checkpoints (molecules on specific immune cells that must be activated (or inactivated) to initiate an immune response) to avoid attack by the immune system. Drugs (e.g., antibodies) that target these checkpoints can provide effective therapies for treating cancer.

[0305] PD-1 is a checkpoint protein on immune cells called T cells. It normally acts as a kind of "off switch" that helps prevent T cells from attacking other cells in the body. This occurs when it binds to PD-L1, a protein on some normal (and cancer) cells. When PD-1 binds to PD-L1, it essentially tells the T cell not to interfere with other cells. Some cancer cells have high amounts of PD-L1, which helps them evade immune attack. Monoclonal antibodies that target PD-1 or PD-L1 can block this binding and enhance the immune response against cancer cells. Exemplary PD-1 inhibitors include, but are not limited to, pembrolizumab (KEYTRUDA®), nivolumab (OPDIVO®), and cemiplimab (LIBTAYO®).

[0306] Other checkpoint inhibitors include, but are not limited to, PD-L1 inhibitors. Exemplary PD-L1 inhibitors include, but are not limited to, atezolizumab (TECENTRIQ®), avelumab (BAVENCIO®), durvalumab (IMFINZI®), and the like.

[0307] CTLA-4 is another protein on some T cells that acts as a kind of "off switch" to suppress the immune system. Ipilimumab (YERVOY®) is a monoclonal antibody that attaches to CTLA-4 and turns it off, allowing the body's immune response to cancer cells to be boosted.

[0308] Other antibodies useful in treating cancer include, but are not limited to, anti-CD52 antibodies, anti-CD47 antibodies, anti-VEGF antibodies (e.g., bevacizumab), anti-CD20 (e.g., rituximab), anti-HER2 (e.g., trastuzumab), etc. Without being bound by any particular theory, SEs comprising anti-cancer antibodies may be effective in treating brain cancers, including, but not limited to, acoustic neuroma, astrocytoma (e.g., Grade I—pilocytic astrocytoma, Grade II—low-grade astrocytoma, Grade III—anaplastic astrocytoma, Grade IV—glioblastoma (GBM)), chordoma, CNS lymphoma, craniopharyngioma, other gliomas (including, but not limited to, brain stem glioma, ependymoma, mixed glioma, optic glioma, ependymoma), medulloblastoma, meningioma, metastatic brain tumor, oligodendroglioma, pituitary tumor, primitive neuroectodermal tumor (PNET), and schwannoma.

[0309] The antibodies described above are exemplary and non-limiting. Using the teachings provided herein, synthetic exosomes can readily be used to deliver any number of antibodies across the blood-brain barrier (BBB).

[0310] SE-mediated delivery of defective enzymes In certain embodiments, SE technology is used to deliver enzymes deficient in the brain of rare diseases, including, but not limited to, β-N-acetylhexosaminidase A in Tay-Sachs disease, phenylalanine hydroxylase in PKU, iduronidase (IDUA) in MPS-1, iduronate-2-sulfatase (IDS) in MPS-II, heparan N-sulfatase or α-N-acetylglucosaminidase or heparan-α-glucosaminide N-acetyltransferase or N-acetylglucosamine 6-sulfatase in MPS-III, N-acetyl-galactosamine-6-sulfatase or β-galactosidase in MPS-IV, acid sphingomyelinase (ASM1) in Niemann-Pick disease, aminoacylase 2 in Canavan disease, carnitine palmitoyltransferase II, kynurenine-3-monooxygenase, etc.

[0311] SE-mediated ASO delivery to the brain and CNS In certain embodiments, SEs can be used to deliver antisense oligonucleotides (ASOs) for CNS disorders, including, but not limited to, spinal muscular atrophy (SMA), ALS, Huntington's disease, Parkinson's disease, and Alzheimer's disease.

[0312] SE-mediated CRISPR / Cas9 delivery to the brain and CNS In certain embodiments, the synthetic exosomes described herein contain components of the CRISPR / cas system and effectively deliver these components across the blood-brain barrier, including pathogenic mutations in monogenic diseases such as AD, PD, ALS, FXS, SCA, and SBMA. Such packaged CRISPR / cas components can include providing the appropriate guide RNA (sgRNA) and Cas enzyme into the synthetic exosome and administering the synthetic exosome, for example, via intravenous infusion.

[0313] In certain embodiments, the components of the CRISPR / cas system include a nucleic acid that encodes and expresses a CRISPR endonuclease and a nucleic acid that is or encodes a desired guide RNA. In certain embodiments, the nucleic acid packaged into the SE encodes both the CRISPR endonuclease and the guide RNA. In certain embodiments, the components of the CRISPR / cas system include a CRISPR endonuclease protein and a nucleic acid that is or encodes a guide RNA.

[0314] Without being bound by any particular theory, it is believed that CRISPR / cas systems packaged into synthetic exosomes may be used in vivo to correct pathogenic mutations in monogenic diseases including, but not limited to, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Fragile X syndrome (FXS), autosomal dominant spinocerebellar ataxia (SCA), and spinal-bulbar muscular atrophy (SBMA), as well as autosomal recessive diseases caused by deficiencies in the expression or function of the ataxia-telangiectasia-mutated (ATM) protein.

[0315] CRISPR / cas SE delivery for Alzheimer's disease The majority of AD cases are sporadic with unknown triggers, making the use of CRISPR / Cas9 unlikely to be a viable treatment. This is supported by the fact that a very small percentage of cases (<1%) are caused by known mutations in the APP protein or gene products involved in APP processing, resulting in the formation of beta-amyloid. What is certain is that, although these mutations account for a small proportion of known AD cases, they all lead to enhanced production of beta-amyloid peptides (Bettens et al. (2013) Lancet. Neurol. 12:92-104). Other known mutations leading to early-onset AD include mutations in presenilin 1 (PSEN1) and presenilin 2 (PSEN2) (Schellenberg et al. (1992) Science, 258:668-671; Levy-Lahad et al. (1995) Science, 269:970-973). The net effect of mutations in these two genes is enhanced production of beta-amyloid (1-42), presumably by shifting the cleavage site of APP (Vetrivel et al. (2006) Mol. Neurodegener. 1:4).

[0316] Clearly, the potential for CRISPR / Cas9 to potentially correct these autosomal dominant gene mutations is real. This is supported by studies that analyzed the feasibility of using this gene editing system to correct similar types of mutations. For example, CRISPR / Cas9 was used to correct a presenilin (PSEN2) autosomal dominant mutation in iPSC-derived neurons. In this study, the authors generated basal forebrain cholinergic iPSC neurons from an individual with the PSEN2 N141I mutation (Ortiz-Virumbrales et al. (2017) Acta Neuropathol. Commun. 5:77). In this study, CRISPR / Cas9 corrected the N141I mutation, which Sanger sequencing showed led to normalization of the Aβ42 / 40 ratio. Functionally, CRISPR / Cas9 correction of the PSEN2 mutation reversed electrophysiological defects. This work was supported by previous studies that also used CRISPR / Cas9 to correct a familial AD mutation in the PSEN gene in patient-derived iPSCs (Pires et al. (2016) Stem Cell Res. 17:285-288; Poon et al. (2016) Stem Cell Res. 17:466-469).

[0317] CRISPR / cas9 was also used to knock out the Swedish APP mutation in patient-derived fibroblasts, resulting in a 60% reduction in secreted beta-amyloid (Gyorgy et al. (2018) Mol. Ther. Nucleic Acids, 11:429-440).

[0318] Furthermore, sgRNAs targeting the extreme C-terminus of APP resulted in potent APP editing (see, e.g., A CRISPR / Cas9-based strategy to manipulate the Alzheimer's amyloid pathway (bioRxiv preprint doi: / / doi.org / 10.1101 / 310193), which is incorporated herein by reference for the CRISPR / cas components, e.g., sgRNAs, described therein). Figure 1a of this reference shows the protospacer adjacent motif-PAM-sites and genomic targets recognized by the sgRNAs. The sgRNAs appeared to have a reciprocal effect on sAPPα and APPβ cleavage, providing confidence that the gene editing strategy favorably manipulated the amyloid pathway.

[0319] Other CRISPR targets for treating AD include, but are not limited to, tau and BACE1. Tau plays an important role not only in AD pathophysiology but also in various other neurodegenerative diseases, including, but not limited to, FTLD, also known as frontotemporal dementia (Spillantini & Goedert M (1998) Trends Neurosci. 21:428-433; Goedert et al. (1998) Neuron, 21:955-958; Grundke-Iqbal et al. (1986) J. Biol. Chem. 261:6084-6089; Grundke-Iqbal et al. (1986) Proc. Natl. Acad. Sci. USA, 83:4913-4917; Ittner et al. (2010) Cell, 142:387-397). To successfully treat AD, it may be desirable to simultaneously target both Aβ and tau, and CRISPR could be readily used to eliminate toxic forms of tau by gene silencing.

[0320] Similarly, the gene encoding β-secretase 1, Bace1, is required for the production of amyloid-β (Aβ) peptides and therefore plays a central role in the accumulation of Aβ that occurs in AD. This gene can be targeted using the CRISPR / cas system (see, e.g., Park, et al. (2019) Nat. Neurosci. 22:524-528).

[0321] Similarly, a risk factor for AD is ApoE4, which can be modified by CRISPR to ApoE3 or ApoE2.

[0322] These and other targets suitable for the treatment of Alzheimer's disease or FTLD can be readily identified by one of skill in the art, and the appropriate CRISPR / cas system components can be readily delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0323] SE delivery of CRISPR / cas for Parkinson's disease Cells and animals overexpressing alpha-synuclein have proven to be useful models of Parkinson's disease. In new studies, the cleavage ability of Cas9' was abolished and the protein was engineered to recruit transcription factors after binding to the target site. A guide RNA strand was identified that had a potent effect on cell survival, far more effectively than any of the individual genes previously discovered to protect the cells used in the study (see, e.g., Chen et al. (2017) Mol. Cell, 68(1):247-257, which is incorporated herein by reference for the CRISPR / cas system components (including the guide RNA) described therein).

[0324] Further genetic screening revealed that many of the genes activated by this guide RNA strand are chaperone proteins, which help other proteins fold into the correct shape. The researchers hypothesize that these chaperone proteins help alpha-synuclein fold properly, which may prevent aggregation.

[0325] These and other CRISPR / cas system components for the treatment of Parkinson's disease or other conditions characterized by alpha-synuclein aggregation can be readily delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0326] SE delivery of CRISPR / cas for Huntington's disease Huntington's disease (HD) is caused by a CAG repeat expansion in exon 1 of the HTT gene, which encodes mutant huntingtin (mHTT), a large protein composed of large polyglutamine repeats in the N-terminal domain of mHTT, most likely exhibiting increased toxic functions. One potential strategy for treating HD would be to selectively suppress mHTT expression using CRISPR / Cas9. The rationale for this approach comes from previous studies showing that application of RNA interference improved motor and neuropathological abnormalities in HD mouse models. Since this study, the CRISPR / Cas9 gene editing system has been successfully applied to HD (Shin et al. (2016) Hum. Mol. Genet. 25:4566-4576; Kolli et al. (2017) Int. J. Mol. Sci. 18(4):754; Monteys et al. (2017) Mol. Ther. 25:12-23).

[0327] Recently, CRISPR / Cas9 was used to selectively silence the entire HTT and mHTT genes (a non-allele-specific approach) in an in vivo mouse model of HD (Yang et al. (2017) J. Clin. Invest. 127:2719-2724). As an example, the guide RNAs used in this study (HTT-gRNAs T1, T2, T3, and T4) were designed to target regions adjacent to the polyQ tract, and their sequence information is incorporated herein by reference.

[0328] These and other CRISPR / cas system components for the treatment of Huntington's disease can be readily delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0329] SE delivery of CRISPR / cas for amyotrophic lateral sclerosis Amyotrophic lateral sclerosis (ALS) is a fatal and incurable neurodegenerative disease characterized by the progressive loss of motor neurons in the spinal cord and brain. In particular, autosomal dominant mutations in the superoxide dismutase 1 (SOD1) gene are responsible for approximately 20% of all familial ALS cases. The clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas9) genome editing system has the potential to treat autosomal dominant diseases by facilitating the introduction of frameshift-inducing mutations that can abolish mutant gene function.

[0330] It has been demonstrated that CRISPR-Cas9 can be used to disrupt the expression of mutant SOD1. Such genome editing can significantly reduce or eliminate mutant SOD1 protein, resulting in improved motor function and reduced muscle atrophy (e.g., Gaj et al. (2017) Sci. Adv., 3:eaar3952).

[0331] These and other CRISPR / cas system components for the treatment of ALS can be readily delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0332] SE delivery of CRISPR / cas for fragile X syndrome Fragile X syndrome (FXS) is a common cause of intellectual disability, most commonly due to a CGG repeat expansion mutation in the FMR1 gene, which triggers epigenetic gene silencing. Epigenetic modifiers can only transiently and modestly induce FMR1 reactivation in the presence of the expanded CGG repeat. As a proof-of-principle study, the expanded CGG repeat was excised in both somatic cell hybrids containing the human fragile X chromosome and human FXS iPSCs using CRISPR / Cas9 genome editing (see, e.g., Xie et al. (2016) PLOS ONE 11(10):e0165499). Transcription was reactivated in approximately 67% of CRISPR-cut hybrid colonies and 20% of isolated human FXS iPSC colonies. The reactivated cells produced FMRP and showed reduced DNA methylation at the FMR1 locus. These data demonstrate that excision of the expanded CGG repeat from the fragile X chromosome results in FMR1 reactivation.

[0333] These and other CRISPR / cas system components for the treatment of fragile X syndrome can be readily delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0334] SE delivery of CRISPR / cas for autosomal dominant spinocerebellar degeneration (SCA) and spinal-bulbar muscular atrophy (SBMA) Repeat expansion disorders are a class of genetic diseases caused by the expansion of DNA repeats. DNA repeats vary in size, from a single nucleotide to 12-mers or larger. The threshold at which repeat expansions become symptomatic varies depending on the specific disease. There are currently over 40 different diseases known to be caused by the expansion of these DNA sequences. Remarkable progress over the past 30 years has defined the causative mutations for many of these diseases. Expansion of CAG, GCG, CTG, CGG, and CAAA repeats in both coding and non-coding sequences of different genes leads to a diverse group of diseases, with mechanisms related to protein level or toxicity, RNA, and / or both.

[0335] Spinal and bulbar muscular atrophy / Kennedy disease Kennedy's disease has been shown to be caused by a CAG expansion in the androgen receptor (AR) gene (La Spada et al. (1991) Nature, 352(6330):77-79). Spinal and bulbar muscular atrophy (SBMA) is a slowly progressive neuromuscular disorder in which lower motor neurons and muscles degenerate. SBMA is X-linked, so it primarily affects men, with some exceptions discussed in a review by Arnold and Merry (Arnold & Merry Molecular Mechanisms and Therapeutics for SBMA / Kennedy's Disease. Neurotherapeutics. 2019). Symptoms include gynecomastia, testicular atrophy, and reduced fertility, all of which correlate with the known function of AR as a transcription factor that binds androgen hormones. AR is involved in the male reproductive and skeletal systems and female fertility. Given the known functions of AR, the average lifespan of SBMA patients, and the rapid progress in this field, it is surprising that after nearly 30 years of research, there is no cure for this disease. Merry outlines the complexity of the underlying pathogenesis of this disorder and highlights steps that may lead to a cure for SBMA / Kennedy disease (ibid.).

[0336] SCA1 The genetic cause of spinocerebellar ataxia type 1 (SCA1) was reported in 1993 (Orr et al. (1993) Nat. Genet. 4(3):221-226; Srinivasan & Shakkottai (2019) Neurotherapeutics, DOI:10.1007 / s13311-019-00763-y). SCA1 is an autosomal dominant disorder characterized by neurodegeneration of the cerebellum, spinal cord, and brainstem, and is due to a polyQ expansion in the ataxin-1 protein.

[0337] SCA3 Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease (MJD), is caused by a polyQ expansion in the ataxin-3 protein (Takiyama et al. (1993) Nat. Genet. 4(3):300-304). Ataxin-3 is a ubiquitin ligase, and Da Silva et al. have proposed a unifying molecular mechanism for disease pathogenesis that focuses on disruption of protein homeostasis (Da Silva et al. (2019) Neurotherapeutics, 16(4):1009-1031). This molecular mechanism is common to all polyQ disorders, and key networks may be shared across diseases.

[0338] SCA2 In 1996, a CAG expansion in the ataxin 2 gene was discovered to cause spinocerebellar ataxia type 2 (SCA2). Egorova and Bezprozvanny described the epidemiology, the function of ataxin 2 in RNA metabolism and stress granules, the molecular changes underlying Purkinje cell loss, dysregulation of cerebellar-thalamocortical circuits and ataxia, and molecular mechanisms that could be therapeutically targeted, for example, using the CRISPR / cas system (Egorova & Bezprozvanny et al. (2019) 16(4):1050-1073).

[0339] SCA7 Spinocerebellar ataxia type 7 (SCA7) is caused by a CAG expansion in the ataxin-7 gene and is characterized by neuronal loss in the cerebellum, brainstem, and retina. The primary symptoms are cerebellar ataxia and blindness. The ataxin-7 protein is a subunit of the multiprotein SAGA complex, which is involved in chromatin remodeling. There is now a detailed molecular understanding of how polyQ expansions in ataxin-7 disrupt neuronal function (Niewiadomska-Cimicka & Trottier (2019) Neurotherapeutics, 16(4):1074-1096).

[0340] SCA17 SCA17 is caused by a CAG / CAA repeat expansion in the gene encoding TATA box-binding protein (TBP) (Koide et al. (1999) Hum. Mol. Genet. 8(11):2047-2053). TBP is a well-characterized transcription factor. Liu et al. discuss the use of CRISPR-Cas9 for the treatment of SCA17 (Liu et al. (2019) Neurotherapeutics, 6(4):1097-1105).

[0341] SCA31 SCA31 is an adult-onset neurological disorder associated with progressive cerebellar ataxia caused by Purkinje cell degeneration in the Japanese population. The genetics of SCA31 were elucidated in 2009 (Sato et al. (2009) Am. J. Hum. Genet. 85(5):544-557). There is a 2.5-3.8 kb insertion of a pentanucleotide repeat (TGGAA) expansion in the introns of thymidine kinase 2 (TK) and BEAN (brain-expressed, Nedd4-related). A novel mechanism of RNA toxicity has been identified in this disease (Ishikawa & Nagai (2019) Neurotherapeutics, 6(4):1106-1114).

[0342] C9orf72 ALS / FTD Hexanucleotide repeat expansions in the first intron of the C9orf72 gene have been identified in cases of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Relatively recent discoveries have rapidly advanced the identification of key pathogenic events, including the acquisition of toxicity from bidirectionally transcribed repeat-containing RNA, defects in nucleocytoplasmic transport common to many expansion disorders, and how the expansions cause two distinct diseases. These advances have led to phase I clinical trials using antisense oligonucleotide therapy, and it is believed that CRISPR / cas methods may be even more effective.

[0343] The use of CRISPR-Cas9 in the treatment of the above diseases offers a promising area of ​​neurotherapeutics.

[0344] With this in mind, these and other CRISPR / cas system components for treating the above-identified conditions can be readily delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0345] SE delivery of CRISPR / cas for ataxia telangiectasia (AT) Ataxia-telangiectasia (AT) is a disease characterized by cerebellar wasting or atrophy and eventual lymphoma, and is caused by mutations in the ataxia-telangiectasia mutated gene, or ATM. Disease-causing mutations are usually located in the kinase domain or near regulatory regions of the protein.

[0346] Mutations in the ATM gene affect the production or activity of the ATM protein, resulting in AT-related symptoms. By permanently correcting the defective gene, cells have the opportunity to produce the correct protein. In recent years, CRISPR has revolutionized the field of genome editing, demonstrating remarkable success in advancing the treatment of many genetic diseases that also rely on correcting defective genes.

[0347] CRISPR / cas system components for the treatment of ataxia-telangiectasia can be readily delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0348] CRISPR / Cas system--Class 2 CRISPR / Cas endonucleases As noted above, the synthetic exosomes described herein are particularly well suited for in vivo delivery of CRISPR / cas system components.

[0349] Recently, compelling evidence has emerged for the existence of RNA-mediated genome defense pathways in archaea and many bacteria that are hypothesized to be comparable to the eukaryotic RNAi pathway (for reviews, see Godde and Bickerton (2006) J. Mol. Evol. 62:718-729; Lillestol et al. (2006) Archaea 2:59-72; Makarova et al. (2006) Biol. Direct 1:7; Sorek et al. (2008) Nat. Rev. Microbiol. 6:181-186). Known as the CRISPR-Cas system or prokaryotic RNAi (pRNAi), this pathway is thought to arise from two evolutionarily and often physically related loci: the CRISPR (clustered regularly interspaced short palindromic repeats) locus, which encodes the RNA component of the system, and the protein-coding cas (CRISPR-associated) locus (see, e.g., Jansen et al. (2002) Mol. Microbiol. 43:1565-1575; Makarova et al., (2002) Nucl. Acids Res. 30:482-496; Makarova et al. (2006) Biol. Direct 1:7; Haft et al. (2005) PLoS Comput. Biol. 1:e60). CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes and non-coding RNA elements that can program the specificity of CRISPR-mediated nucleic acid cleavage. Although individual Cas proteins do not share significant sequence similarity with protein components of the eukaryotic RNAi machinery, they have similar predicted functions (e.g., RNA binding, nuclease, helicase, etc.) (see, for example, Makarova et al. (2006) Biol. Direct 1:7). CRISPR-associated (cas) genes are often associated with CRISPR repeat-spacer arrays. More than 40 different Cas protein families have been described. Of these protein families, Cas1 appears to be ubiquitous among different CRISPR / Cas systems.Specific combinations of cas genes and repeat structures have been used to define eight CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube), some of which are associated with additional gene modules encoding repeat-associated mysterious proteins (RAMPs). Multiple CRISPR subtypes can exist within a single genome. The sporadic distribution of CRISPR / Cas subtypes suggests that the system is subject to horizontal gene transfer during microbial evolution.

[0350] In class 2 CRISPR systems, the function of the effector complex (e.g., cleaving target DNA) can be performed by a single endonuclease (see, for example, Zetsche et al. (2015) Cell, 163(3):759-771; Makarova et al. (2015) Nat. Rev. Microbiol. 13(11):722-736; Shmakov et al. (2015) Mol. Cell. 60(3):385-397, etc.). Therefore, the term "class 2 CRISPR / Cas protein" is used herein to encompass endonucleases (target nucleic acid cleavage proteins) from class 2 CRISPR systems. Thus, as used herein, "Class 2 CRISPR / Cas endonuclease" encompasses Type II CRISPR / Cas proteins (e.g., Cas9), Type V CRISPR / Cas proteins (e.g., Cpfl, C2cl, C2C3), and Type VI CRISPR / Cas proteins (e.g., C2c2). To date, Class 2 CRISPR / Cas proteins include Type II, Type V, and Type VI CRISPR / Cas proteins, but the term is also meant to encompass any Class 2 CRISPR / Cas protein suitable for binding to a corresponding guide RNA and forming an RNP complex (e.g., further cleaving target DNA).

[0351] Type II CRISPR / Cas endonucleases (e.g., Cas9) In the native type II CRISPR / Cas system, Cas9 functions as an RNA-guided endonuclease using dual guide RNAs (crRNA and transactivating crRNA) for target recognition and cleavage through a mechanism involving the two nuclease active sites of Cas9, which together generate double-stranded DNA breaks (DSBs), or can individually generate single-stranded DNA breaks (SSBs). The type II CRISPR endonuclease Cas9 and an engineered dual (dgRNA) or single-guide RNA (sgRNA) form a ribonucleoprotein (RNP) complex that can target desired DNA sequences. Guided by the dual RNA complex or chimeric single guide RNA, Cas9 generates site-specific DSBs or SSBs within the double-stranded DNA (dsDNA) of the target nucleic acid, which are then repaired by either nonhomologous end joining (NHEJ) or homology-directed recombination (HDR).

[0352] In some embodiments, a nucleic acid encoding a CRISPR endonuclease, or an endonuclease protein and a guide RNA or nucleic acid guide RNA, is provided as cargo(s) within the synthetic exosomes described herein.

[0353] The Cas9 protein forms a complex with the Cas9 guide RNA. The guide RNA provides target specificity to the Cas9-guide RNA complex by having a nucleotide sequence (guide sequence) complementary to a sequence (target site) of the target nucleic acid (described elsewhere herein). The Cas9 protein of the complex provides site-specific activity. In other words, the Cas9 protein is directed to (e.g., stabilized at) a target site within a target nucleic acid sequence (e.g., genomic DNA) by associating with the protein-binding segment of the Cas9 guide RNA.

[0354] In some cases, the CRISPR / Cas endonuclease (e.g., a Cas9 protein) is a naturally occurring protein (e.g., naturally occurring in bacteria and / or archaea). In other cases, the CRISPR / Cas endonuclease (e.g., a Cas9 protein) is not a naturally occurring polypeptide (e.g., the CRISPR / Cas endonuclease is a variant CRISPR / Cas endonuclease, a chimeric protein, etc., e.g., in some cases, the CRISPR / Cas endonuclease includes one or more NLSs).

[0355] Examples of suitable Cas9 proteins include, but are not limited to, those set forth in SEQ ID NOS: 5-816 of PCT Application No. PCT / US2017 / 017255 (WO2017 / 139505), which are incorporated herein by reference for their sequences. Naturally occurring Cas9 proteins bind to Cas9 guide RNAs, which guide them to specific sequences (target sites) within a target nucleic acid and cleave the target nucleic acid (e.g., cleave dsDNA to generate double-stranded breaks). Chimeric Cas9 proteins are fusion proteins that contain a Cas9 polypeptide fused to a heterologous protein (referred to as a fusion partner), where the heterologous protein provides an activity (e.g., one not provided by the Cas9 protein). The fusion partner may provide an activity, such as an enzymatic activity (e.g., nuclease activity, DNA and / or RNA methylation activity, DNA and / or RNA cleavage activity, histone acetylation activity, histone methylation activity, RNA modification activity, RNA binding activity, RNA splicing activity, etc.). In some cases, a portion of the Cas9 protein (e.g., the RuvC domain and / or the HNH domain) exhibits reduced nuclease activity compared to the corresponding portion of a wild-type Cas9 protein (e.g., in some cases, the Cas9 protein is a nickase). In some cases, the Cas9 protein is enzymatically inactive or has reduced enzymatic activity compared to a wild-type Cas9 protein (e.g., compared to Streptococcus pyogenes Cas9). In some cases, the Cas9 protein is enzymatically enhanced or has enhanced enzymatic activity and / or specificity compared to a wild-type Cas9 protein (e.g., compared to Streptococcus pyogenes Cas9).

[0356] The assay for determining whether a given protein interacts with a Cas9 guide RNA can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Suitable binding assays (e.g., gel shift assays) are known to those skilled in the art (e.g., assays involving the addition of a Cas9 guide RNA and a protein to a target nucleic acid).

[0357] The assay to determine whether a protein has activity (e.g., to determine whether the protein has nuclease activity and / or some heterologous activity that cleaves a target nucleic acid) can be any convenient assay (e.g., any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage). Suitable assays (e.g., cleavage assays) are known to those of skill in the art and can include adding a Cas9 guide RNA and a protein to a target nucleic acid.

[0358] In some cases, the chimeric Cas9 protein comprises a heterologous polypeptide having an enzymatic activity that modifies a target nucleic acid (e.g., nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damaging activity, deaminating activity, dismutase activity, alkylating activity, depurinating activity, oxidizing activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity).

[0359] In some cases, the chimeric Cas9 protein comprises a heterologous polypeptide having an enzymatic activity (e.g., methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylating activity, deadenylating activity, sumoylating activity, desumoylating activity, ribosylation activity, deribosylation activity, myristoylating activity, or demyristoylating activity) that modifies a polypeptide (e.g., a histone) associated with a target nucleic acid.

[0360] In some cases, the CRISPR / Cas endonuclease (e.g., Cas9 protein) includes a heterologous polypeptide that provides localization within a cell. For example, in some cases, the subject CRISPR / Cas endonuclease (e.g., Cas9 protein) includes one or more (e.g., two or more, three or more, four or more, five or more, etc.) nuclear localization sequences (NLSs). The one or more (e.g., two or more, three or more, four or more, five or more, etc.) NLSs can be present in any convenient location within the CRISPR / Cas endonuclease (e.g., Cas9 protein), such as at the N-terminus, C-terminus, internally, etc. In some cases, a CRISPR / Cas endonuclease (e.g., a Cas9 protein) comprises one or more (e.g., two or more, three or more, four or more, five or more, etc.) NLSs at the N-terminus and one or more (e.g., two or more, three or more, four or more, five or more, etc.) NLSs at the C-terminus.

[0361] Many Cas9 orthologs from a wide variety of species have been identified, and in some cases, the proteins share only a few identical amino acids. The identified Cas9 orthologs have a similar domain structure, with a central HNH endonuclease domain and separate RuvC / RNaseH domains (e.g., RuvCI, RuvCII, and RuvCIII) (see, e.g., Table 6). For example, the Cas9 protein may have three distinct regions (sometimes referred to as RuvC-I, RuvC-11, and RuvC-III) that are not contiguous in the primary amino acid sequence of the Cas9 protein but fold together to form the RuvC domain as the protein is synthesized and folded. Thus, Cas9 proteins can be said to share at least four key motifs with conserved structures. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. While the motifs set forth in Table 6 may not represent the entire RuvC-like and / or HNH domains, as recognized in the art, Table 6 provides motifs that may be used to help determine whether a given protein is a Cas9 protein. [Table 6]

[0362] In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, wherein each of motifs 1-4 has 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to motifs 1-4 set forth in SEQ ID NOS: 1-4, respectively (see, e.g., Table 6), or to the corresponding portion of any of the amino acid sequences set forth in SEQ ID NOS: 5-816 of PCT / US2017 / 017255.

[0363] In other words, in some cases, a suitable Cas9 polypeptide comprises an amino acid sequence having four motifs, wherein each of motifs 1-4 has 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to motifs 1-4 (e.g., the sequences set forth in SEQ ID NOS: 1-4, see e.g., Table 6) of the Cas9 amino acid sequence set forth in SEQ ID NO: 26 (see also SEQ ID NO: 5 of PCT / US2017 / 017255), or to the corresponding portions of any of the amino acid sequences set forth in SEQ ID NOS: 6-816 of PCT / US2017 / 017255.

[0364] In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 60% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 70% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 75% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 80% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 85% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and set forth in SEQ ID NOs:1-4, respectively), or to the corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255.In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 90% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 95% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 99% or greater amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having four motifs, each of which has 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (the motifs are in Table 6 and are set forth in SEQ ID NOs:1-4, respectively), or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. Any of the Cas9 proteins defined above can be used as a Cas9 polypeptide or as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), any of which can be used in the RNPs of the present disclosure.

[0365] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255.

[0366] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 70% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 75% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 80% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs: 6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 85% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs: 6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 90% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255.In some cases, a suitable Cas9 protein comprises an amino acid sequence having 95% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 99% or greater amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 26, or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOs: 6-816 of PCT / US2017 / 017255. Any of the Cas9 proteins defined above can be used as a Cas9 polypeptide or as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), either of which can be used in the RNPs of the present disclosure.

[0367] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255.

[0368] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 70% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 75% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 80% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 85% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 90% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 95% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 99% or greater amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26 or to any of the amino acid sequences set forth in SEQ ID NOs:6-816 of PCT / US2017 / 017255.In some cases, a suitable Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 26 or to any of the amino acid sequences set forth in SEQ ID NOs: 6-816 of PCT / US2017 / 017255. Any of the Cas9 proteins defined above can be used as a Cas9 polypeptide, as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), either of which can be used in the RNPs of the present disclosure.

[0369] In some cases, the Cas9 protein comprises four motifs (listed in Table 1), with at least one (or each) comprising an amino acid sequence having 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to each of the four motifs listed in Table 1 (SEQ ID NOS: 1-4) or to a corresponding portion of any of the amino acid sequences set forth in SEQ ID NOS: 6-816 of PCT / US2017 / 017255.

[0370] In some cases, the Cas9 protein is a high-fidelity Cas9 protein (see, e.g., Kleinstiver et al. (2016) Nature, 529(7587):490-495).

[0371] In some cases, a suitable Cas9 protein is the Cas9 protein described in Slaymaker et al. (2016) Science 351:84. For example, a suitable Cas9 protein can include Streptococcus pyogenes Cas9 with one or more substitutions of K810, K848, K855, K1003, and R1060 (amino acid numbering is based on the numbering described in SEQ ID NO:26 (SEQ ID NO:5 of PCT / US2017 / 017255)). For example, a suitable Cas9 protein can include Streptococcus pyogenes Cas9 with substitutions of K810A, K1003A, and R1060A (amino acid numbering is based on the numbering described in SEQ ID NO:26 (SEQ ID NO:5 of PCT / US2017 / 017255)). As another example, a suitable Cas9 protein includes Streptococcus pyogenes Cas9 with K848A, K1003A, and R1060A substitutions (amino acid numbering is based on that set forth in SEQ ID NO: 5). As another example, a suitable Cas9 protein includes Streptococcus pyogenes Cas9 with K855A substitution (amino acid numbering is based on that set forth in SEQ ID NO: 26 (SEQ ID NO: 5 of PCT / US2017 / 017255)).

[0372] Type V and Type VI CRISPR / Cas endonucleases In certain embodiments, the plasmid(s) complexed with the PRX carrier described herein encode a Type V or Type VI CRISPR / Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3) and associated guide RNA(s). Type V and Type VI CRISPR / Cas endonucleases are a type of Class 2 CRISPR / Cas endonucleases. Examples of Type V CRISPR / Cas endonucleases include, but are not limited to, Cpf1, C2c1, and C2c3. An example of a Type VI CRISPR / Cas endonuclease is C2c2. In some instances, the plasmid encodes a Type V CRISPR / Cas endonuclease (e.g., Cpf1, C2c1, C2c3). In some instances, the Type V CRISPR / Cas endonuclease is a Cpf1 protein. In some cases, the plasmid encodes a Type VI CRISPR / Cas endonuclease (e.g., C2c2).

[0373] Like Type II CRISPR / Cas endonucleases, Type V and Type VI CRISPR / Cas endonucleases form a complex with a corresponding guide RNA. The guide RNA provides target specificity to the endonuclease-guide RNA RNP complex by having a nucleotide sequence (guide sequence) complementary to a sequence (target site) of the target nucleic acid (as described elsewhere herein). The endonuclease in the complex provides site-specific activity. In other words, the endonuclease is guided to (e.g., stabilized at) a target site within a target nucleic acid sequence (e.g., genomic DNA) by associating with the protein-binding segment of the guide RNA.

[0374] Examples and guidance relating to Type V and Type VI CRISPR / Cas proteins (e.g., cpf1, C2c1, C2c2, and C2c3 guide RNAs) can be found in the art (see, e.g., Zetsche et al. (2015) Cell, 163(3):759-771; Makarova et al. (2015) Nat. Rev. Microbiol. 13(11):722-736; Shmakov et al. (2015) Mol. Cell, 60(3):385-397, etc.).

[0375] In some cases, the Type V or Type VI CRISPR / Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3) is enzymatically active, e.g., the Type V or Type VI CRISPR / Cas polypeptide cleaves the target nucleic acid upon binding to the guide RNA. In some cases, the Type V or Type VI CRISPR / Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3) exhibits reduced enzymatic activity compared to a corresponding wild-type Type V or Type VI CRISPR / Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3) and retains DNA binding activity (e.g., in some cases, the endonuclease is a nickase).

[0376] In some cases, the Type V CRISPR / Cas endonuclease is a Cpf1 protein. In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOS: 27-31 (SEQ ID NOS: 1088-1092 of PCT / US2017 / 017255). In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to a contiguous sequence of 100 amino acids to 200 amino acids (aa), 200 aa to 400 aa, 400 aa to 600 aa, 600 aa to 800 aa, 800 aa to 1000 aa, 1000 aa to 1100 aa, 1100 aa to 1200 aa, or 1200 aa to 1300 aa of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27-31.

[0377] In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvC1 domain of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27 to 31. In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCII domain of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27 to 31. In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90% or 100% amino acid sequence identity to the RuvCIII domain of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27-31. In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90% or 100% amino acid sequence identity to the RuvCI, RuvCII and RuvCIII domains of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27-31.

[0378] In some cases, the Cpf1 protein exhibits reduced enzymatic activity compared to a wild-type Cpf1 protein (e.g., compared to a Cpf1 protein comprising the amino acid sequence set forth in any of SEQ ID NOS: 27-31) and retains DNA binding activity. In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOS: 27-31, and includes an amino acid substitution (e.g., a D-to-A substitution) of the amino acid residue corresponding to amino acid 917 of the Cpf1 amino acid sequence set forth in SEQ ID NOS: 27. In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27-31, and comprises an amino acid substitution (e.g., an E→A substitution) of the amino acid residue corresponding to amino acid 1006 of the Cpf1 amino acid sequence set forth in SEQ ID NO: 27. In some cases, the Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27-31, and comprises an amino acid substitution (e.g., a D→A substitution) of the amino acid residue corresponding to amino acid 1255 of the Cpf1 amino acid sequence set forth in SEQ ID NO: 27.

[0379] In some cases, a suitable Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90% or 100% amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs: 27-31.

[0380] In some instances, the Type V CRISPR / Cas endonuclease is a C2c1 protein (e.g., those set forth in SEQ ID NOS: 32-39 (SEQ ID NOS: 1112-1119 of PCT / US2017 / 017255)). In some instances, the C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the C2c1 amino acid sequence set forth in any of SEQ ID NOS: 32-39. In some cases, the C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to a contiguous sequence of 100 to 200 amino acids (aa), 200 to 400 aa, 400 to 600 aa, 600 to 800 aa, 800 to 1000 aa, 1000 to 1100 aa, 1100 to 1200 aa, or 1200 to 1300 aa of the C2c1 amino acid sequence set forth in any of SEQ ID NOs: 32 to 39.

[0381] In some cases, the C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCI domain of the C2c1 amino acid sequence set forth in any of SEQ ID NOs: 32 to 39. In some cases, the C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCII domain of the C2c1 amino acid sequence set forth in any of SEQ ID NOs: 32 to 39. In some cases, the C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90% or 100% amino acid sequence identity to the RuvCIII domain of the C2c1 amino acid sequence set forth in any of SEQ ID NOs: 32-39. In some cases, the C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90% or 100% amino acid sequence identity to the RuvCI, RuvCII and RuvCIII domains of the C2c1 amino acid sequence set forth in any of SEQ ID NOs: 32-39.

[0382] In some cases, the C2c1 protein exhibits reduced enzymatic activity compared to a wild-type C2c1 protein (e.g., compared to a C2c1 protein comprising the amino acid sequence set forth in any of SEQ ID NOs: 32-39) and retains DNA-binding activity. In some cases, a suitable C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the C2c1 amino acid sequence set forth in any of SEQ ID NOs: 32-39.

[0383] In some instances, the Type V CRISPR / Cas endonuclease is a C2c3 protein (e.g., as set forth in SEQ ID NOS: 40-43 (SEQ ID NOS: 1120-1123 of pCT / US2017 / 017255)). In some instances, the C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOS: 40-43. In some cases, the C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to a contiguous sequence of 100 to 200 amino acids (aa), 200 to 400 aa, 400 to 600 aa, 600 to 800 aa, 800 to 1000 aa, 1000 to 1100 aa, 1100 to 1200 aa, or 1200 to 1300 aa of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 40 to 43.

[0384] In some cases, the C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCI domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 40 to 43. In some cases, the C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCII domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 40 to 43. In some cases, the C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCIII domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43. In some cases, the C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 40-43.

[0385] In some cases, the C2c3 protein exhibits reduced enzymatic activity compared to a wild-type C2c3 protein (e.g., compared to a C2c3 protein comprising the amino acid sequence set forth in any of SEQ ID NOS: 40-43) and retains DNA-binding activity. In some cases, a suitable C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOS: 40-43.

[0386] In some instances, the Type VI CRISPR / Cas endonuclease is a C2c2 protein (e.g., those set forth in SEQ ID NOS: 44-55 (SEQ ID NOS: 1124-1135 of PCT / US2017 / 017255)). In some instances, the C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOS: 44-55. In some cases, the C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to a contiguous sequence of 100 to 200 amino acids (aa), 200 to 400 aa, 400 to 600 aa, 600 to 800 aa, 800 to 1000 aa, 1000 to 1100 aa, 1100 to 1200 aa, or 1200 to 1300 aa of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 44 to 55.

[0387] In some cases, the C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCI domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 44 to 55. In some cases, the C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCII domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 44 to 55. In some cases, the C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90% or 100% amino acid sequence identity to the RuvCIII domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 1124-1135. In some cases, the C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 44-55.

[0388] In some cases, the C2c2 protein exhibits reduced enzymatic activity compared to a wild-type C2c2 protein (e.g., compared to a C2c2 protein comprising the amino acid sequence set forth in any of SEQ ID NOs: 44-55) and retains DNA-binding activity. In some cases, a suitable C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100% amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 44-55.

[0389] PAM sequence Wild-type Class 2 CRISPR / Cas endonucleases (e.g., Cas9 proteins) typically possess nuclease activity that cleaves a target nucleic acid (e.g., double-stranded DNA (dsDNA)) at a target site defined by complementarity between the guide sequence of a CRISPR / Cas guide RNA and the target nucleic acid. In some cases, site-specific cleavage of the target nucleic acid occurs at a location determined by both (i) base pair complementarity between the CRISPR / Cas guide RNA and the target nucleic acid and (ii) a short motif within the target nucleic acid called a protospacer adjacent motif (PAM). For example, when the Class 2 CRISPR / Cas endonuclease is a wild-type Cas9 protein, the PAM sequence recognized (e.g., bound) by the Cas9 protein is present on the non-complementary strand of the target DNA (the strand that does not hybridize with the guide sequence of the Cas9 guide RNA) and is adjacent to the target site.

[0390] In some cases (e.g., when the Class 2 CRISPR / Cas endonuclease is an S. pyogenes Cas9 protein), the PAM sequence of the non-complementary strand is 5'-XGG-3', where X is any DNA nucleotide, and X is immediately 3' to the target sequence on the non-complementary strand of the target DNA. Thus, the sequence of the complementary strand that hybridizes to the PAM sequence is 5'-CCY-3', where Y is any DNA nucleotide, and Y is immediately 5' to the target sequence on the complementary strand of the target DNA. In some such embodiments, X and Y are complementary, and the XY base pair can be any base pair (e.g., X=C and Y=G, X=G and Y=C, X=A and Y=T, or X=T and Y=A).

[0391] In some cases, it may be advantageous to use plasmids encoding different Class 2 CRISPR / Cas endonucleases (e.g., Cas9 proteins from various species, Type V or Type VI CRISPR / Cas endonucleases, etc.) for the method of interest to take advantage of various properties (e.g., enzymatic properties) of the different endonucleases (e.g., for different PAM sequence preferences, for increased or decreased enzymatic activity, for increased or decreased levels of cytotoxicity, to alter the balance between NHEJ, homology-guided repair, single-strand breaks, double-strand breaks, etc.).

[0392] Class 2 CRISPR / Cas endonucleases (e.g., Cas9 proteins) from various species may require different PAM sequences in the target DNA, and different types of Class 2 CRISPR / Cas endonucleases (e.g., Type II proteins, such as Cas9 proteins, Type V proteins, Type VI proteins, etc.) may have different requirements for the location of the PAM sequence relative to the target sequence in the target DNA (e.g., 5', 3', complementary strand, non-complementary strand, distance from the target sequence). Thus, for a particular selection of Class 2 CRISPR / Cas endonuclease, the PAM sequence requirement may differ from the 5'-XGG-3' sequence described above for the S. pyogenes Cas9 protein.

[0393] In some embodiments (e.g., when the Cas9 protein is derived from S. pyogenes or a closely related Cas9 is used), the PAM sequence can be 5'-NGG-3', where N is any nucleotide (see, e.g., Chylinski et al. (2013) RNA Biol. 10(5):726-737; Jinek et al. (2012) Science, 337(6096):816-821, etc.). In some embodiments (e.g., when the Cas9 protein is derived from the Cas9 protein of Neisseria meningitidis or a closely related Cas9 is used), the PAM sequence can be 5'-NNNNGANN-3', 5'-NNNNGTTN-3', 5'-NNNNGNNT-3', 5'-NNNNGTNN-3', 5'-NNNGNTN-3', or 5'-NNNNGATT-3', where N is any nucleotide. In some embodiments (e.g., when the Cas9 protein is derived from Streptococcus thermophilus #1 or a closely related Cas9 is used), the PAM sequence can be 5'-NNAGAA-3', 5'-NNAGGA-3', 5'-NNGGAA-3', 5'-NNANAA-3', or 5'-NNGGGA-3', where N is any nucleotide. In some embodiments (e.g., when the Cas9 protein is derived from Treponema denticola (TD) or a closely related Cas9 is used), the PAM sequence can be 5'-NAAAAN-3', 5'-NAAAAC-3', 5'-NAAANC-3', 5'-NANAAC-3', or 5'-NNAAAC-3', where N is any nucleotide.

[0394] The PAM requirements for any particular Class 2 CRISPR / Cas endonuclease can be determined using standard, routine, and conventional methods, which may include experimental methods and / or silica analysis of naturally occurring sequences from the species of interest. For example, as known to those skilled in the art, additional PAM sequences for other Class 2 CRISPR / Cas endonucleases (e.g., Cas9 proteins from different species, Type IV CRISPR / Cas endonucleases, Type V CRISPR / Cas endonucleases, etc.) can be readily determined using bioinformatics analysis (e.g., analysis of genome sequencing data) (see, e.g., Mojica et al. (2009) Microbiology, 155(Pt3):733-740; Esvelt et al. (2013) Nat. Meth. 10(11):1116-11121, etc.).

[0395] Furthermore, as is known in the art, the PAM-interacting domain of a Class 2 CRISPR / Cas endonuclease (e.g., a Cas9 protein) can be derived from, and the PAM sequence can correspond to, an endonuclease (e.g., a Cas9 protein) from a first species. Thus, in some cases, a Class 2 CRISPR / Cas endonuclease has a PAM-interacting domain derived from (e.g., obtained from) a Class 2 CRISPR / Cas endonuclease (e.g., a Cas9 protein) of a first species, and another portion of the Class 2 CRISPR / Cas endonuclease (e.g., a Cas9 protein) can be derived from (e.g., obtained from) a second species.

[0396] Guide RNA (for CRISPR / Cas endonucleases) A nucleic acid molecule that binds to a Class 2 CRISPR / Cas endonuclease (e.g., a Cas9 protein, a Type V or Type VI CRISPR / Cas protein, a Cpf1 protein, etc.) and targets the complex to a specific location within a target nucleic acid is referred to as a "guide RNA" or "CRISPR / Cas guide nucleic acid" or "CRISPR / Cas guide RNA."

[0397] The guide RNA provides target specificity to the complex (RNP complex) by containing a targeting segment that includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence complementary to the sequence of the target nucleic acid.

[0398] The guide RNA may be represented by a corresponding protein. For example, if the class 2 CRISPR / Cas endonuclease is a Cas9 protein, the corresponding guide RNA may be referred to as a "Cas9 guide RNA." Similarly, as another example, if the class 2 CRISPR / Cas endonuclease is a Cpf1 protein, the corresponding guide RNA may be referred to as a "Cpf1 guide RNA."

[0399] In some embodiments, the guide RNA comprises two separate nucleic acid molecules, an "activator" and a "targeter," and is referred to as a "dual guide RNA," "dual-molecule guide RNA," "binomolecular guide RNA," or "dgRNA." In some embodiments, the guide RNA is one molecule (e.g., in some Class 2 CRISPR / Cas proteins, the corresponding guide RNA is a single molecule, and in some cases, the activator and targeter are covalently linked to each other, e.g., via an intervening nucleotide), and the guide RNA is referred to as a "single guide RNA," "single-molecule guide RNA," "single-molecule guide RNA," or simply "sgRNA."

[0400] Cas9 guide RNA A nucleic acid molecule that binds to a Cas9 protein and targets the complex to a specific location within a target nucleic acid is referred to herein as a "Cas9 guide RNA." A Cas9 guide RNA can be said to contain two segments: a first segment (referred to herein as a "targeting segment") and a second segment (referred to herein as a "protein-binding segment"). A "segment" refers to a segment / section / region of a molecule, e.g., a continuous sequence of nucleotides in a nucleic acid molecule. A segment can also refer to a region / section of a complex, and one segment can contain regions of two or more molecules.

[0401] The first segment (targeting segment) of the Cas9 guide RNA comprises a nucleotide sequence (guide sequence) that is complementary to (and therefore hybridizes with) a specific sequence (target site) within a target nucleic acid (e.g., target genomic DNA). The protein-binding segment (or "protein-binding sequence") interacts with (binds to) a Cas9 polypeptide. The protein-binding segment of a subject Cas9 guide RNA comprises two complementary stretches of nucleotides that hybridize to each other to form a double-stranded RNA duplex (dsRNA duplex). Site-specific binding and / or cleavage of a target nucleic acid (e.g., genomic DNA) can occur at a location (e.g., a target sequence at a target locus) determined by base-pair complementarity between the Cas9 guide RNA (the guide sequence of the Cas9 guide RNA) and the target nucleic acid.

[0402] The Cas9 guide RNA and the Cas9 protein form a complex (e.g., bind via non-covalent interactions). The Cas9 guide RNA contains a targeting segment that includes a guide sequence (a nucleotide sequence complementary to the sequence of a target nucleic acid), providing target specificity to the complex. The Cas9 protein of the complex provides site-specific activity (e.g., cleavage activity). In other words, the Cas9 protein is guided to a target nucleic acid sequence (e.g., genomic DNA) by associating with the Cas9 guide RNA.

[0403] The "guide sequence," also referred to as the "targeting sequence" of a Cas9 guide RNA, can be modified to enable the Cas9 guide RNA to target the Cas9 protein to any desired sequence in any desired target nucleic acid, except that a protospacer adjacent motif (PAM) sequence may be considered. Thus, for example, a Cas9 guide RNA can have a targeting segment comprising a sequence (guide sequence) that is complementary to (e.g., can hybridize with) a sequence in a nucleic acid (e.g., genomic DNA) within a eukaryotic cell.

[0404] In some embodiments, the Cas9 guide RNA comprises two separate nucleic acid molecules, an "activator" and a "targeter," and is referred to as a "dual Cas9 guide RNA," "double-molecule Cas9 guide RNA," "binomolecular Cas9 guide RNA," or "dual guide RNA" or "dgRNA." In some embodiments, the activator and targeter are covalently linked to each other (e.g., via an intervening nucleotide), and the guide RNA is referred to as a "single guide RNA," "Cas9 single guide RNA," "single-molecule Cas9 guide RNA," or "single-molecule Cas9 guide RNA," or simply "sgRNA."

[0405] Cas9 guide RNAs include crRNA-like ("CRISPR RNA" / "targeter" / "crRNA" / "crRNA repeat") molecules and corresponding tracrRNA-like ("trans-acting CRISPR RNA" / "activator" / "tracrRNA") molecules. The crRNA-like molecule (targeter) contains both the targeting segment (single strand) of the Cas9 guide RNA and a stretch of nucleotides ("duplex-forming segment") that forms one half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. The corresponding tracrRNA-like molecule (activator / tracrRNA) contains a stretch of nucleotides (duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the guide nucleic acid. In other words, the stretch of nucleotides in the crRNA-like molecule is complementary to and hybridizes with the stretch of nucleotides in the tracrRNA-like molecule to form the dsRNA duplex of the protein-binding domain of the Cas9 guide RNA. Thus, each targeter molecule can be said to have a corresponding activator molecule (having a region that hybridizes with the targeter). The targeter molecule further provides a targeting segment. Thus, the targeter molecule and the activator molecule (as a corresponding pair) hybridize to form a Cas9 guide RNA. The exact sequence of a particular crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecule is found. A subject dual Cas9 guide RNA can comprise any corresponding activator and targeter pair.

[0406] The terms "activator" or "activator RNA" are used herein to refer to a tracrRNA-like molecule (tracrRNA: "trans-acting CRISPR RNA") of a Cas9 dual guide RNA (and thus a Cas9 single guide RNA when the "activator" and "targeter" are linked together, e.g., by an intervening nucleotide). Thus, for example, a Cas9 guide RNA (dgRNA or sgRNA) comprises an activator sequence (e.g., a tracrRNA sequence). A tracr molecule (tracrRNA) is a naturally occurring molecule that hybridizes with a CRISPR RNA molecule (crRNA) to form a Cas9 dual guide RNA. The term "activator" is used herein to encompass naturally occurring tracrRNAs, but also to encompass tracrRNAs that have been modified (e.g., truncated, sequence mutated, base modified, backbone modified, linkage modified, etc.) such that the activator retains at least one function of the tracrRNA (e.g., contributes to the dsRNA duplex to which the Cas9 protein binds). In some cases, the activator provides one or more stem loops that can interact with the Cas9 protein. The activator can be said to have a tracr sequence (tracrRNA sequence), and in some cases is a tracrRNA, although the term "activator" is not limited to naturally occurring tracrRNA.

[0407] The terms "targeter" or "targeter RNA" are used herein to refer to the crRNA-like molecule (crRNA: "CRISPR RNA") of a Cas9 dual guide RNA (and thus a Cas9 single guide RNA when the "activator" and "targeter" are linked together, e.g., by intervening nucleotides). Thus, for example, a Cas9 guide RNA (dgRNA or sgRNA) comprises a targeting segment (comprising nucleotides that hybridize (are complementary to) the target nucleic acid) and a duplex-forming segment (e.g., the duplex-forming segment of the crRNA, which may also be referred to as a crRNA repeat). The sequence of the targeter's targeting segment (the segment that hybridizes with the target sequence of the target nucleic acid) is modified by the user to hybridize with the desired target nucleic acid, and therefore the sequence of the targeter is often a sequence that does not occur in nature. However, the duplex-forming segment of the targeter (described in more detail below) that hybridizes with the duplex-forming segment of the activator can comprise a naturally occurring sequence (e.g., can comprise the sequence of the duplex-forming segment of a naturally occurring crRNA, which may also be referred to as a crRNA repeat). Thus, the term "targeter" is used herein to distinguish it from a naturally occurring crRNA, despite the fact that a portion of the targeter (e.g., the duplex-forming segment) often comprises a naturally occurring sequence derived from the crRNA. However, the term "targeter" encompasses naturally occurring crRNAs.

[0408] A Cas9 guide RNA can also be said to comprise three portions: (i) a targeting sequence (a nucleotide sequence that hybridizes with a sequence in a target nucleic acid), (ii) an activator sequence (as described above) (sometimes referred to as a tracr sequence), and (iii) a sequence that hybridizes to at least a portion of the activator sequence to form a double-stranded duplex. The targeter comprises (i) and (iii), and the activator comprises (ii).

[0409] A Cas9 guide RNA (e.g., a dual guide RNA or a single guide RNA) can consist of any corresponding activator and targeter pair. In some cases, the duplex-forming segments can be swapped between the activator and targeter. In other words, in some cases, the targeter comprises a sequence of nucleotides from the duplex-forming segment of the tracrRNA (this sequence is usually part of the activator), and the activator comprises a sequence of nucleotides from the duplex-forming segment of the crRNA (this sequence is usually part of the targeter).

[0410] As described above, a targeter comprises both the targeting segment (single strand) of the Cas9 guide RNA and a stretch of nucleotides ("duplex-forming segment") that forms one half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. The corresponding tracrRNA-like molecule (activator) comprises a stretch of nucleotides (duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. In other words, a stretch of nucleotides in the targeter is complementary to a stretch of nucleotides in the activator and hybridizes with it to form a dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. Thus, each targeter can be said to have a corresponding activator (having a region that hybridizes with the targeter). The targeter molecule also provides a targeting segment. Thus, the targeter and activator (as a corresponding pair) hybridize to form the Cas9 guide RNA. The specific sequence of a particular naturally occurring crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecule is found. Examples of suitable activators and targeters are well known in the art.

[0411] Cas9 guide RNAs (e.g., dual guide RNAs or single guide RNAs) can consist of any corresponding activator and targeter pair. Non-limiting examples of nucleotide sequences that can be included in a Cas9 guide RNA (dgRNA or sgRNA) can include the sequences set forth in SEQ ID NOS: 827-1075 of PCT / US2017 / 017255, or their complements. For example, in some cases, the sequences set forth in SEQ ID NOS: 827-957 of PCT / US2017 / 017255 (derived from tracrRNA) or their complements pair with the sequences set forth in SEQ ID NOS: 964-1075 of PCT / US2017 / 017255 (derived from crRNA) or their complements to form a dsRNA duplex of the protein-binding segment. In some cases, the duplex-forming portion of a guide RNA suitable for use herein comprises the sequence: gttttagagctaGAAAtagcaagttaaaataagg ctagtccgttatcaactt gaaaaagtggcac cgagtcggtgcTTTTTT (SEQ ID NO: 5) (SEQ ID NO: 1366 of PCT / US2017 / 017255), or guuuuagagcuaGAAAuagcaaguuaa aauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggug cUU UUUU (SEQ ID NO: 6) (SEQ ID NO: 1367 of PCT / US2017 / 017255).

[0412] Cas9 guide RNA targeting segment The subject guide RNA comprises a guide sequence (i.e., a targeting sequence) (a nucleotide sequence complementary to a sequence (target site) in the target nucleic acid). In other words, the targeting segment of the subject guide nucleic acid can interact with the target nucleic acid (e.g., double-stranded DNA (dsDNA)) in a sequence-specific manner by hybridization (i.e., base pairing). Thus, the nucleotide sequence of the targeting segment (depending on the target) can vary to determine the position within the target nucleic acid at which the Cas9 guide RNA and the target nucleic acid interact. The targeting segment of the Cas9 guide RNA can be modified (e.g., by genetic engineering) / designed to hybridize to any desired sequence (target site) within the target nucleic acid (e.g., a eukaryotic target nucleic acid such as genomic DNA).

[0413] In various embodiments, the targeting segment can have a length of 7 nucleotides (nt) or more (e.g., 8 nucleotides or more, 9 nucleotides or more, 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 25 nucleotides or more, 30 nucleotides or more, or 40 nucleotides or more). In some cases, the targeting segment may be 7 to 100 nucleotides (nt) (e.g., 7 to 80 nt, 7 to 60 nt, 7 to 40 nt, 7 to 30 nt, 7 to 25 nt, 7 to 22 nt, 7 to 20 nt, 7 to 18 nt, 8 to 80 nt, 8 to 60 nt, 8 to 40 nt, 8 to 30 nt, 8 to 25 nt, 8 to 22 nt, 8 to 20 nt, 8 to 18 nt, 10 to 100 nt, 10 to 80 nt, 10 to 60 nt, 10 to 40 nt, 10 to 30 nt, 10 to 25 nt, 10 to 22 nt, 10 to 20 nt, 10 to 18 nt, 12 to 100 nt, 12 to 80 nt, 12 to 60 nt, 12 to 40 nt, 1 The length may be 2 to 30 nt, 12 to 25 nt, 12 to 22 nt, 12 to 20 nt, 12 to 18 nt, 14 to 100 nt, 14 to 80 nt, 14 to 60 nt, 14 to 40 nt, 14 to 30 nt, 14 to 25 nt, 14 to 22 nt, 14 to 20 nt, 14 to 18 nt, 16 to 100 nt, 16 to 80 nt, 16 to 60 nt, 16 to 40 nt, 16 to 30 nt, 16 to 25 nt, 16 to 22 nt, 16 to 20 nt, 16 to 18 nt, 18 to 100 nt, 18 to 80 nt, 18 to 60 nt, 18 to 40 nt, 18 to 30 nt, 18 to 25 nt, 18 to 22 nt, or 18 to 20 nt).

[0414] In various embodiments, the nucleotide sequence of the targeting segment (targeting sequence, guide sequence) complementary to the nucleotide sequence of the target nucleic acid (target site) can have a length of 10 nt or more. For example, the targeting sequence of the targeting segment complementary to the target site of the target nucleic acid can have a length of 12 nt or more, 15 nt or more, 17 nt or more, 18 nt or more, 19 nt or more, or 20 nt or more. In some cases, the nucleotide sequence of the targeting segment (targeting sequence) complementary to the nucleotide sequence of the target nucleic acid (target site) has a length of 12 nt or more. In some cases, the nucleotide sequence of the targeting segment (targeting sequence) complementary to the nucleotide sequence of the target nucleic acid (target site) has a length of 17 nt or more. In some cases, the nucleotide sequence of the targeting segment (targeting sequence) complementary to the nucleotide sequence of the target nucleic acid (target site) has a length of 18 nt or more.

[0415] For example, in certain embodiments, the targeting sequence (guide sequence) of the targeting segment complementary to the target sequence of the target nucleic acid is 10 to 100 nucleotides (nt) (e.g., 10 to 90 nt, 10 to 75 nt, 10 to 60 nt, 10 to 50 nt, 10 to 35 nt, 10 to 30 nt, 10 to 25 nt, 10 to 22 nt, 10 to 20 nt, 12 to 100 nt, 12 to 90 nt, 12 to 75 nt, 12 to 60 nt, 12 to 50 nt, 12 to 35 nt, 12 to 30 nt, 12 to 25 nt, 12 to 22 nt, 12 to 20 nt, 15 to 100 nt, 1 The targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid may have a length of 5 to 90 nt, 15 to 75 nt, 15 to 60 nt, 15 to 50 nt, 15 to 35 nt, 15 to 30 nt, 15 to 25 nt, 15 to 22 nt, 15 to 20 nt, 17 to 100 nt, 17 to 90 nt, 17 to 75 nt, 17 to 60 nt, 17 to 50 nt, 17 to 35 nt, 17 to 30 nt, 17 to 25 nt, 17 to 22 nt, 17 to 20 nt, 18 to 100 nt, 18 to 90 nt, 18 to 75 nt, 18 to 60 nt, 18 to 50 nt, 18 to 35 nt, 18 to 30 nt, 18 to 25 nt, 18 to 22 nt, or 18 to 20 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 15 nt to 30 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 15 nt to 25 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 17 nt to 30 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 17 nt to 25 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 17 nt to 22 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 18 nt to 30 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 18 nt to 25 nt. In some cases, the targeting sequence of the targeting segment complementary to the target sequence of the target nucleic acid has a length of 18 nt to 22 nt.In some cases, the targeting sequence of the targeting segment that is complementary to the target site of the target nucleic acid is 20 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to the target site of the target nucleic acid is 19 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to the target site of the target nucleic acid is 18 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to the target site of the target nucleic acid is 17 nucleotides in length.

[0416] In various embodiments, the percentage of complementarity between the targeting sequence (guide sequence) of the targeting segment and the target site of the target nucleic acid can be 60% or greater (e.g., 65% or greater, 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, 97% or greater, 98% or greater, 99% or greater, or 100%). In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 7 contiguous nucleotides that are most 5'-most to the target site of the target nucleic acid. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or greater for approximately 20 contiguous nucleotides. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 14 contiguous nucleotides that are most 5'-most to the target site of the target nucleic acid, with the remainder being as low as 0% or greater. In such cases, the targeting sequence can be considered to be 14 nucleotides in length. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 7 contiguous nucleotides most 5'-side of the target site of the target nucleic acid, and the remaining nucleotides are as low as 0% or more.

[0417] In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 7 5'-most contiguous nucleotides of the target site of the target nucleic acid (which may be complementary to the 3'-most nucleotide of the targeting sequence of the Cas9 guide RNA). In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 8 5'-most contiguous nucleotides of the target site of the target nucleic acid (which may be complementary to the 3'-most nucleotide of the targeting sequence of the Cas9 guide RNA). In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 9 5'-most contiguous nucleotides of the target site of the target nucleic acid (which may be complementary to the 3'-most nucleotide of the targeting sequence of the Cas9 guide RNA). In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 10 5'-most contiguous nucleotides of the target site of the target nucleic acid (which may be complementary to the 3'-most nucleotide of the targeting sequence of the Cas9 guide RNA). In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 17 5'-most contiguous nucleotides of the target site of the target nucleic acid (which may be complementary to the 3'-most nucleotide of the targeting sequence of the Cas9 guide RNA). In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 18 5'-most contiguous nucleotides of the target site of the target nucleic acid (which may be complementary to the 3'-most nucleotide of the targeting sequence of the Cas9 guide RNA). In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid can be 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%) for 20 consecutive nucleotides.In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid can be 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%) for 17 consecutive nucleotides.

[0418] In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 7 contiguous nucleotides most 5'-side of the target site of the target nucleic acid, and the remaining is 0% or less. In such cases, the targeting sequence can be considered to be 7 nucleotides long. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 8 contiguous nucleotides most 5'-side of the target site of the target nucleic acid, and the remaining is 0% or less. In such cases, the targeting sequence can be considered to be 8 nucleotides long. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 9 contiguous nucleotides most 5'-side of the target site of the target nucleic acid, and the remaining is 0% or less. In such cases, the targeting sequence can be considered to be 9 nucleotides long. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 10 contiguous nucleotides most 5'-side of the target site of the target nucleic acid, and the remaining is 0% or less. In such cases, the targeting sequence can be considered to be 10 nucleotides long. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 11 contiguous nucleotides most 5'-side of the target site of the target nucleic acid, and the remaining is 0% or less. In such cases, the targeting sequence can be considered to be 11 nucleotides long. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 12 contiguous nucleotides most 5'-side of the target site of the target nucleic acid, and the remaining is 0% or less. In such cases, the targeting sequence can be considered to be 12 nucleotides long. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 13 contiguous nucleotides most 5' to the target site of the target nucleic acid, and is low, 0% or greater, for the remainder.In such cases, the targeting sequence can be considered to be 13 nucleotides in length. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 14 contiguous nucleotides that are most 5'-side of the target site of the target nucleic acid, and the remaining nucleotides are 0% or less. In such cases, the targeting sequence can be considered to be 14 nucleotides in length. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 17 contiguous nucleotides that are most 5'-side of the target site of the target nucleic acid, and the remaining nucleotides are 0% or less. In such cases, the targeting sequence can be considered to be 17 nucleotides in length. In some cases, the percentage of complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% for the 18 contiguous nucleotides that are most 5'-side of the target site of the target nucleic acid, and the remaining nucleotides are 0% or less. In such cases, the targeting sequence can be considered to be 18 nucleotides in length.

[0419] Examples of various Cas9 proteins and Cas9 guide RNAs (as well as information regarding requirements related to the presence of protospacer adjacent motif (PAM) sequences in target nucleic acids) can be found in the art (e.g., Jinek et al., (2012) Science, 337(6096):816-821; Chylinski et al. (2013) RNA Biol. 10(5):726-737; Ma et al., (2013) Biomed Res Int. 2013:270805; Hou et al. (2013) Proc. Natl. Acad. Sci. USA, 110(39):15644-15649; Jinek et al. (2013) Elife, 2:e00471; Pattanayak et al. (2013) Nat. Biotechnol. 31(9):839-843; Qi et al. al.(2013)Cell,152(5):1173-1183;Wang et al.(2013)Cell,153(4):910-918;Chen et al.(2013)Nucleic Acids Res.41(20):e19;Cheng et al.(2013)Cell Res.23(10):1163-1171;Cho et al.(2013)Genetics,195(3):1177-1180;DiCarlo et al.(2013)Nucleic Acids Res.41(7):4336-4343;Dickinson et al. al.(2013)Nat.Meth.10(10):1028-1034;Ebina et al.(2013)Sci Rep.3:2510;Fujii et.al.(2013) Nucleic Acids Res.41(20):e187;Hu et al.(2013)Cell Res.23(11):1322-1325;Jiang et al.(2013)Nucleic Acids Res.41(20):e188;Larson et al. al.(2013)Nat.Protoc.8(11):2180-2196;Mali et al.(2013)Nat.Meth.10(l0):957-963;Nakayama et al.(2013)Genesis,51(12):835-843;Ran et al.(2013)Nat.Protoc.8(11):2281-308;Ran et al.(2013)Cell,154(6):1380-1389;Upadhyay et al.(2013)G3(Bethesda)3(12):2233-2238;Walsh et al.(2013)Proc.Natl.Acad.Sci.USA,110(39):15514-15515;Yang et al.(2013)Cell,154(6):1370-1379;Briner et al.(2014)Mol.Cell, 56(2):333-339 and U.S. Patents and Patent Applications Nos. 8,906,616, 8,895,308, 8,889,418, 8,889,356, 8,871,445, 8,865,406, No. 8,795,965, No. 8,771,945, No. 8,697,359, No. 20140068797, No. 20140170753, No. 20140179006, No. 20140179770, No. 20140186843, No. 20140186919, 20140186958, 20140189896, 20140227787, 20140234972, 20140242664, 20140242699, 2014024 No. 2700, No. 20140242702, No. 20140248702, No. 20140256046, No. 20140273037, No. 20140273226, No. 20140273230, No. 20140273231, No. 2 No. 0140273232, No. 20140273233, No. 20140273234, No. 20140273235, No. 20140287938, No. 20140295556, No. 20140295557, No. 20140298 No. 547, No. 20140304853, No. 20140309487, No. 20140310828, No. 20140310830, No. 20140315985, No. 20140335063, No. 20140335620, No. 20 See Nos. 140342456, 20140342457, 20140342458, 20140349400, 20140349405, 20140356867, 20140356956, 20140356958, 20140356959, 20140357523, 20140357530, 20140364333, and 20140377868, all of which are incorporated herein by reference in their entireties.

[0420] Guide RNAs for Type V and Type VI CRISPR / Cas endonucleases (e.g., Cpf1 guide RNA) A guide RNA that binds to a Type V or Type VI CRISPR / Cas protein (e.g., Cpf1, C2c1, C2c2, C2c3) and targets the complex to a specific location within a target nucleic acid is generally referred to herein as a "Type V or Type VI CRISPR / Cas guide RNA." A more specific example of the term is a "Cpf1 guide RNA."

[0421] Type V or type VI CRISPR / Cas guide RNAs (e.g., cpf1 guide RNA) can range from 30 nucleotides (nt) to 200 nt (e.g., 30 nt to 180 nt, 30 nt to 160 nt, 30 nt to 150 nt, 30 nt to 125 nt, 30 nt to 100 nt, 30 nt to 90 nt, 30 nt to 80 nt, 30 nt to 70 nt, 30 nt to 60 nt, 30 nt to 50 nt, 50 nt to 200 nt, 50 nt to 1 In some cases, a Type V or Type VI CRISPR / Cas guide RNA (e.g., a cpf1 guide RNA) has a total length of at least 30 nt (e.g., at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 80 nt, at least 50 nt, at least 150 nt, at least 125 nt, at least 50 nt, at least 100 nt, or at least 120 nt).

[0422] In some cases, the Cpf1 guide RNA has an overall length of 35 nt, 36 nt, 37 nt, 38 nt, 39 nt, 40 nt, 41 nt, 42 nt, 43 nt, 44 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt or 50 nt.

[0423] Like a Cas9 guide RNA, a Type V or Type VI CRISPR / Cas guide RNA (e.g., a cpf1 guide RNA) may comprise a target nucleic acid binding segment and a duplex-forming region (e.g., in some cases formed from two duplex-forming segments, i.e., two sequences of nucleotides that hybridize to each other to form a duplex).

[0424] The target nucleic acid binding segment of a Type V or Type VI CRISPR / Cas guide RNA (e.g., a cpf1 guide RNA) can have a length of 15 nt to 30 nt, for example, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt. In some cases, the target nucleic acid binding segment is 23 nt in length. In some cases, the target nucleic acid binding segment is 24 nt in length. In some cases, the target nucleic acid binding segment is 25 nt in length.

[0425] The guide sequence of a type V or type VI CRISPR / Cas guide RNA (e.g., cpf1 guide RNA) can be between 15 nt and 30 nt (e.g., 15-25 nt, 15-24 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 17-30 nt, 17-25 nt, 17-24 nt, 17-23 nt, 17-22 nt, 17-21 nt, 17-20 nt, 17-19 nt, 17-18 nt, 18-30 nt, 18-25 nt, 18-24 nt, 18-23 nt). The guide sequence may have a length of 15 nt, 18-22 nt, 18-21 nt, 18-20 nt, 18-19 nt, 19-30 nt, 19-25 nt, 19-24 nt, 19-23 nt, 19-22 nt, 19-21 nt, 19-20 nt, 20-30 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt. In some instances, the guide sequence is 17 nt in length. In some instances, the guide sequence is 18 nt in length. In some instances, the guide sequence is 19 nt in length. In some instances, the guide sequence is 20 nt in length. In some cases, the guide sequence is 21 nt in length. In some cases, the guide sequence is 22 nt in length. In some cases, the guide sequence is 23 nt in length. In some cases, the guide sequence is 24 nt in length.

[0426] The guide sequence of a type V or type VI CRISPR / Cas guide RNA (e.g., a cpf1 guide RNA) may have 100% complementarity to a target nucleic acid sequence of a corresponding length. The guide sequence may have less than 100% complementarity to a target nucleic acid sequence of a corresponding length. For example, the guide sequence of a type V or type VI CRISPR / Cas guide RNA (e.g., a cpf1 guide RNA) may have 1, 2, 3, 4, or 5 nucleotides that are not complementary to the target nucleic acid sequence. For example, in some cases where the guide sequence is 25 nucleotides long and the target nucleic acid sequence is 25 nucleotides long, the target nucleic acid binding segment may have 100% complementarity to the target nucleic acid sequence. As another example, in some cases where the guide sequence is 25 nucleotides long and the target nucleic acid sequence is 25 nucleotides long, the target nucleic acid binding segment may have 1 non-complementary nucleotide and 24 complementary nucleotides to the target nucleic acid sequence. As another example, in some cases where the guide sequence has a length of 25 nucleotides and the target nucleic acid sequence has a length of 25 nucleotides, in some cases the target nucleic acid binding segment has 2 non-complementary nucleotides and 23 complementary nucleotides to the target nucleic acid sequence.

[0427] The duplex-forming segment (e.g., of a targeter RNA or activator RNA) of a Type V or Type VI CRISPR / Cas guide RNA (e.g., a cpf1 guide RNA) can, in some cases, have a length of 15 nt to 25 nt (e.g., 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, or 25 nt).

[0428] In some cases, the RNA duplex of a type V or type VI CRISPR / Cas guide RNA (e.g., cpf1 guide RNA) can be any length between 5 base pairs (bp) and 40 bp (e.g., 5-35 bp, 5-30 bp, 5-25 bp, 5-20 bp, 5-15 bp, 5-12 bp, 5-10 bp, 5-8 bp, 6-40 bp, 6-35 bp, 6-30 bp, 6-25 bp, 6-20 bp, 6-15 bp, 6-12 bp, 6-10 bp, 6-8 bp, 7-40 bp, 7-35 bp, 7-30 bp, The length may be 7 to 25 bp, 7 to 20 bp, 7 to 15 bp, 7 to 12 bp, 7 to 10 bp, 8 to 40 bp, 8 to 35 bp, 8 to 30 bp, 8 to 25 bp, 8 to 20 bp, 8 to 15 bp, 8 to 12 bp, 8 to 10 bp, 9 to 40 bp, 9 to 35 bp, 9 to 30 bp, 9 to 25 bp, 9 to 20 bp, 9 to 15 bp, 9 to 12 bp, 9 to 10 bp, 10 to 40 bp, 10 to 35 bp, 10 to 30 bp, 10 to 25 bp, 10 to 20 bp, 10 to 15 bp, or 10 to 12 bp.

[0429] As an example, the duplex-forming segment of a Cpf1 guide RNA may comprise (5' to 3') a nucleotide sequence selected from AAUUUCUACUGUUGUAGAU (SEQ ID NO: 7), AAUUUCUGCUGUUGCAGAU (SEQ ID NO: 8), AAUUUCCACUGUUGUGGAU (SEQ ID NO: 9), AAUUCCUACUGUUGUAGGU (SEQ ID NO: 10), AAUUUCUACUAUUGUAGAU (SEQ ID NO: 11), AAUUUCUACUGCUGUAGAU (SEQ ID NO: 12), AAUUUCUACUUUGUAGAU (SEQ ID NO: 13), and AAUUUCUACUUGUAGAU (SEQ ID NO: 14). A guide sequence may then follow (5' to 3') the duplex-forming segment.

[0430] A non-limiting example of an activator RNA (e.g., tracrRNA) for a C2c1 guide RNA (dual guide or single guide) is an RNA comprising the nucleotide sequence GAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGA GCUUCUCAAAAAG (SEQ ID NO: 15). In some cases, the C2c1 guide RNA (dual guide or single guide) is an RNA comprising the nucleotide sequence GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGC AAAGCCCGUUGAGCUUCUCAAAAAG (SEQ ID NO: 16). In some cases, the C2c1 guide RNA (dual guide or single guide) is an RNA comprising the nucleotide sequence UCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCA AAGCCCGUUGAGCUUCUCAAAAAG (SEQ ID NO: 17). A non-limiting example of an activator RNA (e.g., tracrRNA) for a C2c1 guide RNA (dual guide or single guide) is an RNA comprising the nucleotide sequence ACUUUCCAGGCAAAGCCCGU UGAGCUUCUCAAAAAG (SEQ ID NO: 18). In some cases, the duplex-forming segment of a C2c1 guide RNA (dual guide or single guide) for an activator RNA (e.g., tracrRNA) comprises the nucleotide sequence AGCUUCUCA (SEQ ID NO: 19) or the nucleotide sequence GCUUCUCA (SEQ ID NO: 20) (duplex-forming segments from naturally occurring tracrRNAs).

[0431] A non-limiting example of a targeter RNA (e.g., crRNA) of a C2c1 guide RNA (dual guide or single guide) is an RNA having the nucleotide sequence CUGAGAAGUGGCACNNNNNNNNNNNNNNNNNNNNNN (SEQ ID NO: 21), where N represents the guide sequence, which varies depending on the target sequence, but the 20 Ns indicate that a range of lengths is allowed. In some cases, the duplex-forming segment of the C2c1 guide RNA (dual guide or single guide) of the targeter RNA (e.g., crRNA) comprises the nucleotide sequence CUGAGAAGUGGCAC (SEQ ID NO: 22), or the nucleotide sequence CUGAGAAGU (SEQ ID NO: 23), or the nucleotide sequence UGAGAAGUGGCAC (SEQ ID NO: 24), or the nucleotide sequence UGAGAAGU (SEQ ID NO: 25).

[0432] Examples and guidance relating to Type V or Type VI CRISPR / Cas endonucleases and guide RNAs (as well as information regarding requirements relating to protospacer adjacent motif (PAM) sequences present in target nucleic acids) can be found in the art (see, e.g., Zetsche et al. (2015) Cell, 163(3):759-771; Makarova et al. (2015) Nat. Rev. Microbiol. 13(11):722-736; Shmakov et al. (2015) Mol. Cell. 60(3):385-397, etc.).

[0433] SE-mediated delivery of inhibitory RNA to the brain and CNS It has also been a surprising discovery that the synthetic exosomes described herein can be used to effectively promote the passage of "SE-encapsulated" inhibitory RNAs (e.g., siRNA, shRNA), typically as DNA encoding the inhibitory RNA; such DNA often includes vectors capable of transcribing the inhibitory RNA, which is an antibody that crosses the blood-brain barrier. Exemplary inhibitory RNAs include, but are not limited to, inhibitory RNAs useful for treating neurodegenerative diseases (e.g., Alzheimer's disease, amyloid-associated mild cognitive impairment (MCI), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Parkinson's disease (PD), etc.).

[0434] Alzheimer's disease Tau and amyloid precursor protein (APP) are key proteins in the pathogenesis of sporadic and hereditary Alzheimer's disease. Therefore, developing methods to inhibit the production of these proteins is a major research and therapeutic goal. Furthermore, selective silencing of mutant alleles is an attractive strategy for treating hereditary dementias and other dominantly inherited disorders.

[0435] Miller et al. (2004) Nucleic Acids Res., 32(2):661-668 described an efficient method for producing small interfering RNA (siRNA) against essentially any targeted region of a gene. This method was then used to develop siRNAs that exhibited optimal allele-specific silencing for a well-characterized tau mutation (V337M) and the most widely studied APP mutation (APPsw). The allele-specific RNA duplexes identified by this method then served as templates for constructing short hairpin RNA (shRNA) plasmids that successfully silenced mutant tau or APP alleles.

[0436] Other studies suggest that using RNAi to inhibit c-SCR, GGA3 adaptor protein, acyl-coenzyme A cholesterol acyltransferase (ACAT-1), and / or tau could be used to treat Alzheimer's disease (see, e.g., Chen et al. (2013) Drug Design Develop. & Therap., 7:117-115).

[0437] The SEs described herein can be readily utilized to deliver these and other shRNA plasmids across the blood-brain barrier for the treatment of Alzheimer's disease.

[0438] Amyotrophic lateral sclerosis (ALS) Amyotrophic lateral sclerosis (ALS) is a progressive, fatal neurodegenerative disease caused by the degeneration of motor neurons. Although ALS has no clear genetic cause, approximately 20% of familial ALS cases are associated with mutations in the superoxide dismutase (SOD1) gene. Kubodera et al. (2010) Hum. Gene Therap., 22(1):doi.org / 10.1089 / hum.2010.054) developed a therapeutic strategy for ALS that uses intravenous injection of AAV8 vectors to knock down mutant SOD1 alleles using small hairpin RNA (shRNA) while simultaneously expressing functional wild-type SOD1 cDNA.

[0439] Without being bound by any particular theory, it is believed that the SEs described herein can be used to deliver SOD1 inhibitory RNA (or a construct encoding an SOD1 inhibitory RNA) for the treatment of ALS.

[0440] Huntington's disease It has been demonstrated that the injection of cholesterol-conjugated small interfering RNA duplexes (cc-siRNA) targeting the huntingtin (Htt) gene alone into the adult striatum of a viral transgenic mouse model of HD silences mutant Htt, attenuates neuronal pathology, and delays the abnormal behavioral phenotypes observed in the mice. For example, in a study by DiFiglia and colleagues, adeno-associated viruses containing either wild-type (18CAG) or expanded (100CAG) Htt cDNA encoding Htt1-400 and siRNA were injected into the mouse striatum (see, e.g., DiFiglia et al. (2007) Proc. Natl. Acad. Sci. USA, 104(43):17204-17296). Treatment of mice carrying mutant Htt with cc-siRNA-Htt was observed to prolong striatal neuron survival, reduce neuropil aggregates, and decrease inclusion size. The siRNA reduces the production of mutant Htt protein through RNA interference, thereby suppressing its expression.

[0441] Thus, without being bound by any particular theory, it is believed that delivery of an inhibitory RNA (or DNA encoding the inhibitory RNA) that targets the Htt gene can be used to treat Huntington's disease. Thus, in various embodiments, SEs comprising an Htt inhibitory RNA are provided.

[0442] Parkinson's disease Recent findings indicate that IRAK4 is a key regulator of the body's innate immune response, which is the body's first line of defense against foreign pathogen activation that leads to the production of pro-inflammatory cytokines.

[0443] Because abnormal function in innate immune cells is involved in the development of chronic inflammatory and autoimmune diseases, IRAK4 inhibitors are considered next-generation anti-inflammatory therapeutics for autoimmune conditions, including rheumatoid arthritis, inflammatory bowel disease, psoriasis, and lupus. However, transport of IRAK4 inhibitors across the blood-brain and blood-nerve barriers allows them to target neuroinflammatory diseases of the central nervous system, including Parkinson's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis, and diabetic peripheral neuropathy, among others.

[0444] It is believed that inhibitory RNAs targeting IRAK4 (or DNA encoding such inhibitory RNAs) packaged in the SEs described herein can readily cross the blood-brain barrier, and that such compositions can be used to treat Parkinson's disease. Similarly, it is believed that inhibitory RNAs targeting α-synuclein can be used to treat Huntington's disease.

[0445] Thus, in certain embodiments, SEs comprising an inhibitory RNA or a nucleic acid encoding an inhibitory RNA that targets IRAK4 or alpha-synuclein are contemplated.

[0446] Similarly, humanized monoclonal antibodies such as PRX002 directed against α-synuclein aggregates may be more effectively delivered to the brain by SE in PD.

[0447] Niemann-Pick disease Patients with types A and B Niemann-Pick disease (NPD) have a genetic deficiency of acid sphingomyelinase (ASM) activity. The clinical spectrum of this disorder ranges from an infantile neurological form (type A NPD) resulting in death by age 3 to a non-neurological form (type B NPD) that allows survival into adulthood. Intermediate cases have also been reported, and the disease is best considered as a single entity with a range of phenotypes. ASM deficiency is widespread, but appears to be more frequent in people of Middle Eastern and North African descent. Current estimates of the disease incidence range from approximately 0.5 to 1 per 100,000 live births. However, these estimates are based only on cases referred to biochemical laboratories for enzymatic confirmation and may therefore underestimate the true frequency of the disorder.

[0448] The gene encoding ASM (SMPD1) has been extensively studied. It resides within the imprinted region of chromosome 11 and is preferentially expressed from the maternally inherited chromosome. Over 100 SMPD1 mutations causing ASM-deficient NPD have been reported, and several useful genotype-phenotype correlations have been established. Based on these findings, DNA-based carrier screening has been performed in the Ashkenazi Jewish community. ASM "knockout" mouse models have also been constructed and used to study disease pathogenesis and treatment.

[0449] Based on these studies in mouse models, clinical trials of enzyme replacement therapy in adult patients with non-neurological ASM-deficient NPD have recently begun. In light of these findings, in certain embodiments, it is contemplated that acid sphingomyelinase (ASM) is packaged into synthetic exosomes described herein for delivery throughout the body, particularly to the central nervous system.

[0450] Preparation of inhibitory RNA In various embodiments, the composition contained in the SE comprises double-stranded DNA (dsDNA) encoding a promoter region and an siRNA, or a promoter region and a short hairpin RNA (shRNA). In certain embodiments, the SE comprises double-stranded DNA (dsDNA) encoding a promoter region and an siRNA (long or short dsRNA), or a promoter region and a short hairpin RNA (shRNA).

[0451] dsDNA encoding siRNA sequences complementary to the promoter region and the nucleotide sequence of target gene can be prepared using standard methods well known to those skilled in the art.For example, siRNA nucleotide sequences can be obtained from the siRNA selection program (Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, Mass. (http: / / jura.wi.mit.edu)) by entering the accession number or GI number from the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov).Genome Database (www.gdb.org) provides nucleic acid sequence links that can be used as National Center for Biotechnology Information accession numbers.Custom-made dsDNA encoding U6 promoter and siRNA is commercially available (Promega, Madison, Wis.).Appropriate sequences can be easily determined using the USPHS, NIH Gene Sequence Data Bank. Alternatively, dsRNA containing suitable siRNA sequences can be identified using the strategy of Miyagishi and Taira (2003) Nat.Biotechnol.20:497-500. In certain embodiments, dsRNA can be up to 800 base pairs in length (Diallo et al. (2003) Oligonucleotides 13(5):381-392). In certain embodiments, dsRNA can have a hairpin structure (see, for example, US Patent Publication No. 2004 / 0058886). Optionally, siRNA sequence can also be determined using the Promega algorithm (www.promega.com / sirnadesigner). Invitrogen provides another commercially available RNAi designer algorithm (for example, / / maidesigner.invitrogen.com / maiexpress / , etc.).

[0452] The inhibitory RNAs described above are exemplary and non-limiting. Using the teachings provided herein, numerous other inhibitory RNAs, or nucleic acids (e.g., DNA) encoding inhibitory RNAs, can be readily provided and incorporated into the SEs described herein.

[0453] Similarly, in various embodiments, miRNAs (eg, miRNAs that are small non-coding RNA molecules about 22 nucleotides in length) are used to have beneficial effects in CNS disorders such as AD.

[0454] kit In certain embodiments, kits for delivery of a therapeutic moiety (e.g., sAPPα) to the brain are provided. Typically, such kits include a container containing synthetic exosomes (SEs) comprising the therapeutic moiety. In certain embodiments, the synthetic exosomes can be provided in a unit dose formulation (e.g., a vial, tablet, caplet, patch, etc.) and / or can optionally be combined with one or more pharmaceutically acceptable excipients.

[0455] Further, in certain embodiments, the kits optionally include labels and / or instructional materials providing directions (i.e., protocols) for use of the synthetic exosomes described herein. Thus, for example, the kits may contain instructions for use of the synthetic exosomes comprising therapeutic moieties in the treatment of dementia, mild cognitive impairment, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, cerebral amyloid angiopathy, etc., as well as the treatment of traumatic brain injury (TBI) and stroke, the treatment of brain tumors, etc. In various embodiments, the instructional materials may also optionally teach preferred dosages / treatment regimens, contraindications, etc.

[0456] The instructional materials typically include, but are not limited to, handwritten or printed materials. Any medium capable of storing such instructions and communicating them to an end user is contemplated by the present invention. Such media include, but are not limited to, electronic storage media (e.g., magnetic disks, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to internet sites that provide such instructional materials. [Example]

[0457] The following examples are offered to illustrate, but not to limit, the claimed invention.

[0458] Example 1 Encapsulation of hydrophobic small molecules For encapsulation of hydrophobic small molecules, a 2:2:1 (DTPG:DDPA:CH) lipid mixture was used, with a Span-80 concentration of 5% w / w, resulting in a zeta potential of approximately -15 mV. The relationship between particle size and flow rate is shown in Figure 11.

[0459] Generally, the higher the flow rate of the aqueous stream relative to the organic stream, the smaller the particle size of the SE.

[0460] Example 2 Protein encapsulation For encapsulation of an 80 JDa protein, a 2:2:1 (DHPG:DHPC:CH) lipid mixture was used, with a Span-80 concentration of 10% w / w, resulting in a zeta potential of approximately +5 mV. The particle size versus flow rate ratio is shown in Figure 12. Light green indicates FRR=100, dark green indicates FRR=80, red indicates FRR=25, and blue indicates FRR=20. In general, the faster the aqueous flow rate relative to the organic flow rate, the smaller the particle size of the SE.

[0461] Example 3 Cas9 and / or IDUA inclusion Table 7 below shows the synthetic exosome properties of microfluidically synthesized synthetic exosomes encapsulating IDUA or Cas9. [Table 7]

[0462] Without being bound by any particular theory, it is believed that the difference in encapsulation efficiency between IDUA and Cas9 is due to the stability of the enzyme in aqueous solution.

[0463] Figure 5 shows that SE-IDUA(-) particles increase brain levels of IDUA by approximately 10-fold compared to free IDUA, and Table 8 shows the ratio of brain IDUA to plasma IDUA and the percentage of IDUA in the brain. [Table 8]

[0464] Table 9 shows the characterization of SE-Cas-9 and IV brain levels. [Table 9]

[0465] Figure 6 shows that SE-Cas9(-) has higher brain penetration than SE-Cas9(+) particles.

[0466] It is understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes in light thereof will be suggested to those skilled in the art and are to be included within the spirit and scope of this application and the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[0467] Sequence Listing SEQ ID NO: 26 S. pyrogenes Cas9 [ka] SEQ ID NO: 27 (1088 of PCT / US2017 / 017255) Francisella tularensis [ka] SEQ ID NO: 28 (1089 of PCT / US2017 / 017255) [ka] SEQ ID NO: 29 (1090 of PCT / US2017 / 017255) [ka] SEQ ID NO: 30 (1091 of PCT / US2017 / 017255) Porphyromonas macacae [ka] SEQ ID NO: 31 (1092 of PCT / US2017 / 017255) Prevotella disiens [ka] SEQ ID NO: 32 (1112 of PCT / US2017 / 017255) Alicyclobacillus acidoterrestris [ka] SEQ ID NO: 33 (1113 of PCT / US2017 / 017255) Alicyclobacillus contaminans [ka] SEQ ID NO: 34 (1114 of PCT / US2017 / 017255) Desulfovibrio inopinatus [ka] SEQ ID NO: 35 (1115 of PCT / US2017 / 017255) Desulfonatronum thiodismutans [ka] SEQ ID NO: 36 (1116 of PCT / US2017 / 017255) Tuberibacillus calidus [ka] SEQ ID NO: 37 (1117 of PCT / US2017 / 017255) Bacillus thermoamylovorans [ka] SEQ ID NO: 38 (1118 of PCT / US2017 / 017255) [ka] SEQ ID NO: 39 (1119 of PCT / US2017 / 017255) Methylobacterium nodulans [ka] SEQ ID NO: 40 (1120 of PCT / US2017 / 017255) [ka] SEQ ID NO: 41 (1121 of PCT / US2017 / 017255) [ka] SEQ ID NO: 42 (1122 of PCT / US2017 / 017255) [ka] SEQ ID NO: 43 (1123 of PCT / US2017 / 017255) [ka] SEQ ID NO: 44 (1124 of PCT / US2017 / 017255) [ka] SEQ ID NO: 45 (1125 of PCT / US2017 / 017255) [ka] SEQ ID NO: 46 (1126 of PCT / US2017 / 017255) Clostridium aminophilum [ka] SEQ ID NO: 47 (1127 of PCT / US2017 / 017255) [ka] SEQ ID NO: 48 (1128 of PCT / US2017 / 017255) Carnobacterium gallinarum [ka] SEQ ID NO: 49 (1129 of PCT / US2017 / 017255) Paludibacter propionicigenes [ka] SEQ ID NO: 50 (1130 of PCT / US2017 / 017255) Listeria seeligeri [ka] SEQ ID NO: 51 (1131 of PCT / US2017 / 017255) Listeria newyorkensis [ka] SEQ ID NO: 52 (1132 of PCT / US2017 / 017255) Leptotrichia wadei [ka] SEQ ID NO: 53 (1133 of PCT / US2017 / 017255) Rhodobacter capsulatus [ka] SEQ ID NO: 54 (1134 of PCT / US2017 / 017255) Leptotrichia buccalis [ka] SEQ ID NO: 55 (1135 of PCT / US2017 / 017255) Leptotrichia shahii [ka]

Claims

1. 1. A synthetic exosome capable of delivering a therapeutic moiety across the blood-brain barrier to the central nervous system (CNS), said synthetic exosome comprising: A liposome formed from a lipid bilayer, the lipid bilayer comprising a non-ionic surfactant and a 3:2:1 molar ratio (DHPA:DHP:CH), a 1:5:1 molar ratio (DHPG:DHPA:CH), a 2:5:1:2 molar ratio (DHPG:DHPA:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH2:DMPEG350:CH), wherein the synthetic exosomes have a zeta potential of −20 mV or less; or a 2:2:1 molar ratio (DHPG:DHPC:CH), a 4:4:1:2 molar ratio (DHPG:DHPA:PC-NH2:CH), a 2:2:1 molar ratio (DHPG:DHPA:CH), a 4:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH2:DMPEG550:CH), a 2:2:1 molar ratio (DHPG:DTPE:CH), a 2:2:1 molar ratio (DHPG:DMTAP:CH), a 4:4:1:2 molar ratio (DHPG:DMTAP:PC-NH2:CH) or a 4:4:1:1:2 molar ratio (DHPG:DMTAP:PC-NH2:DMPEG550:CH), wherein the synthetic exosomes have a zeta potential in the range of -20mV to 20mV; or a 2:4:1 molar ratio (DHPC:DTPE:CH), a 2:4:1 molar ratio (DHPC:DOTAP:CH), a 2:4:1:2 molar ratio (DHPC:DMTAP:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DHPC:DMTAP:PC-NH2:DMPEG350:CH), wherein the synthetic exosomes have a zeta potential of 20 mV or greater; or a 4:2:1 molar ratio (DTPA:DHP:CH), a 1:5:1 molar ratio (DTPG:DTPA:CH), a 1:5:1:2 molar ratio (DTPG:DTPA:PC-NH2:CH), or a 1:4:1:1:2 molar ratio (DTPG:DTPA:PC-NH2:DMPEG350:CH), wherein the synthetic exosomes have a zeta potential of −20 mV or less; or a 2:2:1 molar ratio (DTPG:DGPC:CH), a 4:4:1:2 molar ratio (DTPG:DDPA:PC-NH2:CH), a 2:2:1 molar ratio (DTPG:DDPA:CH), a 4:4:1:1:2 molar ratio (DTPG:DDPA:PC-NH2:DMPEG550:CH), a 2:2:1 molar ratio (DTPG:DTPE:CH), a 2:2:1 molar ratio (DTPG:DMTAP:CH), a 4:4:1:2 molar ratio (DTPG:DMTAP:PC-NH2:CH) or a 4:4:1:1:2 molar ratio (DTPG:DMTAP:PC-NH2:DMPEG550:CH), wherein the synthetic exosomes have a zeta potential in the range of -20mV to 20mV; or a 2:4:1 molar ratio (DMPC:DTPE:CH), a 2:4:1 molar ratio (DMPC:DOTAP:CH), a 2:4:1:2 molar ratio (DMPC:DMTAP:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DMPC:DMTAP:PC-NH2:DMPEG350:CH), wherein the synthetic exosomes have a zeta potential of 20 mV or greater; CH is a cholesterol derivative selected from the group consisting of cholesterol, cholesterol hemisuccinate, lysine-based cholesterol (CHLYS), 20-hydroxycholesterol, 22-hydroxycholesterol, 24-hydroxycholesterol, 25-hydroxycholesterol, 27-hydroxycholesterol, cholesteryl succinate, colesuccinate, coltrisuccinate, lithocholesterol succinate, chenodesoxycholesterol bissuccinate, and hederosides, or a phytosterol; the lipid bilayer is alcohol-free; The synthetic exosomes, wherein the liposomes do not exceed about 500 nm in diameter.

2. 10. The synthetic exosome of claim 1, wherein said exosome does not exceed about 200 nm in diameter.

3. the synthetic exosomes comprise a therapeutic moiety, the therapeutic moiety being selected from the group consisting of a protein, an antibody, an enzyme, DNA encoding an inhibitory RNA, an inhibitory RNA or microRNA (miRNA), a nucleic acid encoding a CRISPR endonuclease and a guide RNA, a CRISPR endonuclease and a guide RNA; The lipid bilayer is a 3:2:1 molar ratio (DHPA:DHP:CH), a 1:5:1 molar ratio (DHPG:DHPA:CH), a 2:5:1:2 molar ratio (DHPG:DHPA:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH2:DMPEG350:CH), wherein the synthetic exosomes have a zeta potential of −20 mV or less; or a 2:2:1 molar ratio (DHPG:DHPC:CH), a 4:4:1:2 molar ratio (DHPG:DHPA:PC-NH2:CH), a 2:2:1 molar ratio (DHPG:DHPA:CH), a 4:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH2:DMPEG550:CH), a 2:2:1 molar ratio (DHPG:DTPE:CH), a 2:2:1 molar ratio (DHPG:DMTAP:CH), a 4:4:1:2 molar ratio (DHPG:DMTAP:PC-NH2:CH) or a 4:4:1:1:2 molar ratio (DHPG:DMTAP:PC-NH2:DMPEG550:CH), wherein the synthetic exosomes have a zeta potential in the range of -20mV to 20mV; or 2. The synthetic exosome of claim 1, comprising a 2:4:1 molar ratio (DHPC:DTPE:CH), a 2:4:1 molar ratio (DHPC:DOTAP:CH), a 2:4:1:2 molar ratio (DHPC:DMTAP:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DHPC:DMTAP:PC-NH2:DMPEG350:CH), wherein the synthetic exosome has a zeta potential of 20 mV or greater.

4. the synthetic exosome comprises a therapeutic moiety, the therapeutic moiety being a small organic molecule; The lipid bilayer is a 4:2:1 molar ratio (DTPA:DHP:CH), a 1:5:1 molar ratio (DTPG:DTPA:CH), a 1:5:1:2 molar ratio (DTPG:DTPA:PC-NH2:CH), or a 1:4:1:1:2 molar ratio (DTPG:DTPA:PC-NH2:DMPEG350:CH), wherein the synthetic exosomes have a zeta potential of −20 mV or less; or a 2:2:1 molar ratio (DTPG:DGPC:CH), a 4:4:1:2 molar ratio (DTPG:DDPA:PC-NH2:CH), a 2:2:1 molar ratio (DTPG:DDPA:CH), a 4:4:1:1:2 molar ratio (DTPG:DDPA:PC-NH2:DMPEG550:CH), a 2:2:1 molar ratio (DTPG:DTPE:CH), a 2:2:1 molar ratio (DTPG:DMTAP:CH), a 4:4:1:2 molar ratio (DTPG:DMTAP:PC-NH2:CH) or a 4:4:1:1:2 molar ratio (DTPG:DMTAP:PC-NH2:DMPEG550:CH), wherein the synthetic exosomes have a zeta potential in the range of -20mV to 20mV; or 2. The synthetic exosome of claim 1, comprising a 2:4:1 molar ratio (DMPC:DTPE:CH), a 2:4:1 molar ratio (DMPC:DOTAP:CH), a 2:4:1:2 molar ratio (DMPC:DMTAP:PC-NH2:CH), or a 2:4:1:1:2 molar ratio (DMPC:DMTAP:PC-NH2:DMPEG350:CH), wherein the synthetic exosome has a zeta potential of 20 mV or greater.

5. 4. The synthetic exosome of claim 3, wherein the lipid bilayer comprises a 2:2:1 molar ratio (DHPG:DHPC:CH).

6. 6. The synthetic exosome of claim 5, wherein the therapeutic moiety comprises an IDUA.

7. 3. The synthetic exosome of claim 1 or 2, wherein the amount of surfactant is from 1%, 3%, 5%, or 8% to 18%, 15%, 13%, or 10% (wt / wt).

8. 3. The synthetic exosome of claim 1 or 2, wherein the surfactant is selected from the group consisting of Span 80, Tween 20, BRIJ® 76 (stearyl poly(10) oxyethylene ether), BRIJ® 78 (stearyl poly(20) oxyethylene ether), BRIJ® 96 (oleyl poly(10) oxyethylene ether) and BRIJ® 721 (stearyl poly(21) oxyethylene ether).

9. 9. The synthetic exosome of claim 8, wherein the surfactant comprises Span80.

10. 3. The synthetic exosome of claim 1 or 2, comprising cholesterol.

11. 3. The synthetic exosome of claim 1 or 2, comprising a cholesterol derivative selected from the group consisting of cholesterol hemisuccinate, lysine-based cholesterol (CHLYS), 20-hydroxycholesterol, 22-hydroxycholesterol, 24-hydroxycholesterol, 25-hydroxycholesterol, 27-hydroxycholesterol, cholesteryl succinate, colesuccinate, coltrisuccinate, lithocholesterol succinate, chenodesoxycholesterol bissuccinate, and hederoside.

12. 3. The synthetic exosome of claim 1 or 2, comprising a phytosterol.

13. 2. The synthetic exosome of claim 1, wherein the CH is a phytosterol.

14. 2. The synthetic exosome of claim 1, wherein the exosome has an average diameter of from 50 nm, 60 nm, 70 nm, or 80 nm, or 90 nm, to 200 nm, 150 nm, or 100 nm.

15. 4. The synthetic exosome of claim 3, wherein the therapeutic moiety comprises an sAPPα protein.

16. 4. The synthetic exosome of claim 3, wherein the therapeutic moiety comprises IDUA or acid sphingomyelinase.

17. 4. The synthetic exosome of claim 3, wherein the therapeutic moiety comprises an antibody.

18. 18. The synthetic exosome of claim 17, wherein said antibody comprises an antibody for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease.

19. 4. The synthetic exosome of claim 3, wherein the synthetic exosome contains an enzyme for enzyme replacement therapy (ERT).

20. 4. The synthetic exosome of claim 3, wherein the synthetic exosome contains components of a CRISPR / Cas system for the treatment of Alzheimer's disease, Parkinson's disease, ALS, Fragile X syndrome (FXS), Huntington's disease, autosomal dominant spinocerebellar ataxia (SCA), spinal-bulbar muscular atrophy (SBMA), or for the correction of autosomal recessive genetic diseases caused by defects in expression or function of ataxia telangiectasia mutated (ATM) protein.

21. 21. The synthetic exosome of claim 20, wherein the synthetic exosome contains a plasmid encoding a class 2 CRISPR / Cas endonuclease and a guide RNA or a nucleic acid encoding a guide RNA, or wherein the synthetic exosome contains a class 2 CRISPR / Cas endonuclease and a guide RNA or a nucleic acid encoding a guide RNA.

22. 22. The synthetic exosome of Claim 21, wherein the Class 2 CRISPR / Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA.

23. 23. The synthetic exosome of Claim 22, wherein said Cas9 polypeptide comprises a Streptococcus pyogenes Cas9 protein (spCas9).

24. 3. The synthetic exosome of claim 1 or 2; and a pharmaceutically acceptable carrier.

25. 21. A composition for reducing the risk, alleviating the severity, or delaying the progression or onset of a disease characterized by beta-amyloid deposits in the brain of a mammal, said composition comprising the synthetic exosome of claim 18 or 20.

26. 21. Use of the synthetic exosome of claim 18 or 20 in the manufacture of a medicament for reducing the risk, reducing the severity, or delaying the progression or onset of a disease characterized by beta-amyloid deposits in the brain of a mammal.

27. 10. A pharmaceutical composition for delivering one or more therapeutic moieties to the brain of a mammal, said composition comprising the synthetic exosome of claim 3 or 4.

28. 16. A pharmaceutical composition for the treatment of a condition selected from the group consisting of Alzheimer's disease, Parkinson's disease, ALS, Fragile X syndrome (FXS), Huntington's disease, autosomal dominant spinocerebellar ataxia (SCA), spinal-bulbar muscular atrophy (SBMA), and an autosomal recessive disorder caused by defective expression or function of ataxia telangiectasia mutated (ATM) protein, said composition comprising the synthetic exosome of claim 15.

29. 16. Use of the synthetic exosome of claim 15 in the manufacture of a medicament for the treatment of a condition selected from the group consisting of Alzheimer's disease, Parkinson's disease, ALS, Fragile X syndrome (FXS), Huntington's disease, autosomal dominant spinocerebellar ataxia (SCA), spinal-bulbar muscular atrophy (SBMA), and an autosomal recessive disorder caused by defective expression or function of ataxia telangiectasia mutated (ATM) protein.

Images