New markers for genetic recombination and their use

Abstract

The present invention provides a novel marker for genetic recombination in Starmerella bombicola and a method for using the same. The present invention also provides a Starmerella bombicola mutant strain in which the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated, a uracil-requiring selection marker consisting of the gene, and a method for producing a Starmerella bombicola transformant using the selection marker.

Description

[Technical Field]

[0001] The present invention relates to a novel marker for genetic recombination and its use. [Background technology]

[0002] Sophorolipids are glycolipids produced by microorganisms, primarily yeast, consisting of long-chain hydroxy fatty acids and sophorose. Sophorolipids are amphiphilic lipids with strong surface activity and excellent biodegradability, and in recent years have attracted attention for their use as biosurfactants. Because sophorolipids are produced by microorganisms and primarily comprise nonionic components, they have good skin affinity and are therefore used as penetration enhancers for cosmetics. Furthermore, because sophorolipids are highly biodegradable and effective even with small amounts, they are increasingly being used in cleaning agents such as dishwashing detergents.

[0003] To improve the productivity of sophorolipids using microorganisms, it is necessary to enhance the activity of the microorganisms. Genetic recombination technology is a major method for such activity enhancement. In the genetic recombination of microorganisms, selection markers such as drug resistance genes and auxotrophy-related genes are often used, and the desired genetically modified microorganisms are selected using the drug resistance or auxotrophy traits lost or acquired by these markers as indicators. However, genetically modified microorganisms into which foreign genes not originally present in the microorganism have been introduced carry concerns such as the risk of the introduced foreign genes being horizontally transmitted to other microorganisms, which could have a negative impact on the ecosystem.

[0004] On the other hand, the Enforcement Regulations of the Law Concerning the Sustainable Use of Biological Diversity through Regulations on the Use of Living Modified Organisms (Cartagena Protocol) stipulate that even organisms obtained using genetic engineering techniques are exempt from the scope of the law if they are self-cloning or natural occurrences, and thus self-cloning or natural occurrences are not included in genetically modified organisms. Therefore, even if genetic engineering techniques are used to improve the productivity of sophorolipids using microorganisms, it is desirable that the resulting microorganisms be self-cloning or natural occurrences.

[0005] Starmerella bombicola (formerly Candida bombicola), a nonpathogenic basidiomycete yeast, is a well-known sophorolipid-producing yeast. When modifying Starmerella bombicola, exogenous antibiotic resistance genes, such as hygromycin resistance and nourseothricin resistance, are often used as markers for selecting recombinants. The only known endogenous selectable marker, derived from an endogenous gene necessary for self-cloning, is the ura3 gene, which is involved in uracil auxotrophy (Non-Patent Document 1). Therefore, new endogenous selectable markers are needed.

[0006] Meanwhile, the ura3 gene is also used as a selection marker in the yeast Saccharomyces cerevisiae. In the uracil biosynthetic pathway in Saccharomyces cerevisiae, orotate is converted to orotidine monophosphate by orotate phosphoribosyltransferase, and orotidine monophosphate is converted to uridine monophosphate by orotidine monophosphate decarboxylase. The latter, orotidine monophosphate decarboxylase, is the product of the ura3 gene, while the former, orotate phosphoribosyltransferase, is the product of the ura5 and ura10 genes. It has been reported that there are two genes encoding orotate phosphoribosyltransferase, and introducing a mutation into only one of these genes results in a phenotype known as a leaky phenotype (Non-Patent Document 2). Therefore, using a gene encoding orotate phosphoribosyltransferase as a selection marker for uracil auxotrophy is undesirable in terms of screening efficiency.

[0007] (Non-Patent Document 1) Inge NA Van Bogaert et al., Yeast, 2007, 24: 201-208 (Non-patent document 2) J. de Montigny et al. Current Genetics 17, 105-111, 1990 Summary of the Invention

[0008] The present invention relates to the following 1) to 7). 1) A Starmerella bombicola mutant strain in which the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto is silenced or inactivated. 2) A method for producing a Starmerella bombicola mutant, which comprises suppressing or inactivating the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. 3) A method for producing a Starmerella bombicola transformant, which comprises using a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto as a selection marker. 4) A transformant obtained by the method described in 3). 5) A method for producing glycolipids, which comprises culturing the mutant strain described in 1) or the transformant described in 4). 6) A uracil-requiring selectable marker consisting of a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto. 7) A vector or DNA fragment containing a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto. [Brief explanation of the drawings]

[0009] [Figure 1] Growth of the parent strain of Starmerella bombicola (T1Δseq1::ade strain) and a mutant strain of Starmerella bombicola (T1Δseq1::ade,Δura::ade strain) in which the gene consisting of the nucleotide sequence shown in SEQ ID NO:1 in the parent strain has been disrupted, on potato dextrose agar medium (PDA, control), minimal agar medium (Minimal), minimal agar + uracil medium (Minimal+Uracil), and minimal agar + uracil + 5-fluoroorotic acid medium (Minimal+Uracil+5FOA). [Figure 2] Growth of the parent strain of Starmerella bombicola (NBRC10243 strain), a mutant strain of Starmerella bombicola in which the gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 in the parent strain was disrupted (NBRC10243Δura strain), and a mutant strain of Starmerella bombicola in which the gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 was reintroduced into the NBRC10243Δura strain (NBRC10243ΔuraΔseq1::Ura strain) on potato dextrose agar medium (PDA, control), SD-uracil medium (SD-Uracil), and SD+uracil medium (SD+Uracil). [Figure 3]Electrophoresis of the amplified fragment of the ura3 gene region of a single colony obtained by introducing another gene into the ura3 gene region of the parent strain (T1 strain) of Starmerella bombicola. Transformation experiments were performed three times, and the results of eight single colonies from each experiment are shown. Detailed Description of the Invention

[0010] If we can develop new genetic recombination markers that can be used in Starmerella bombicola and genetic recombination techniques using them, this could become a useful basic technology for producing substances such as glycolipids using Starmerella bombicola.

[0011] The present invention provides a novel marker for genetic recombination in Starmerella bombicola and a method for using the same.

[0012] The present inventors have found that a mutant strain of Starmerella bombicola used for glycolipid production, in which a mutation was introduced into a specific gene, is conferred uracil auxotrophy, and that the mutant strain is also conferred resistance to 5-fluoroorotic acid, which is converted into a toxic substance in the uracil biosynthetic pathway of the type strain. The specific gene can function as a selectable marker for genetic recombination in Starmerella bombicola, and can be used to construct a transformation system for Starmerella bombicola.

[0013] The present invention provides a Starmerella bombicola mutant strain exhibiting uracil auxotrophy, in which a mutation has been introduced into a specific gene. The specific gene can function as a selectable marker for genetic recombination of uracil auxotrophy in Starmerella bombicola, and its use enables efficient transformation of Starmerella bombicola using the presence or absence of uracil auxotrophy as an indicator.

[0014] All patents, non-patent documents, and other publications cited herein are hereby incorporated by reference in their entirety.

[0015] (1.Definition) Herein, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing analysis using the homology analysis (Search homology) program of the genetic information processing software GENETYX Ver. 12, with the unit size to compare (ktup) set to 2.

[0016] As used herein, "at least 90% identity" with respect to an amino acid sequence or a nucleotide sequence means identity of 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0017] As used herein, "an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted" refers to an amino acid sequence in which 1 to 20, preferably 1 to 10, more preferably 1 to 8, even more preferably 1 to 5, and even more preferably 1 to 3 amino acids have been deleted, substituted, added, or inserted. Furthermore, "a nucleotide sequence in which one or several nucleotides have been deleted, substituted, added, or inserted" refers to a nucleotide sequence in which 1 to 60, preferably 1 to 30, more preferably 1 to 24, even more preferably 1 to 15, and even more preferably 1 to 9 nucleotides have been deleted, substituted, added, or inserted. As used herein, "addition" of an amino acid or nucleotide includes addition of an amino acid or nucleotide to one or both ends of a sequence.

[0018] As used herein, "upstream" and "downstream" in relation to a gene refer to upstream and downstream in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter on the DNA sense strand, and "upstream" of a gene means the 5' region of the gene on the DNA sense strand.

[0019] As used herein, the term "operably linked" between a gene and a regulatory region such as a promoter means that the gene and regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. Procedures for "operably linking" a gene to a regulatory region are well known to those skilled in the art.

[0020] As used herein, the term "native" when used with respect to a cellular function, property, or trait is used to indicate that the function, property, or trait is inherently present in the cell. In contrast, the term "exogenous" is used to indicate that the function, property, or trait is not inherently present in the cell but is introduced from outside. For example, an "exogenous" gene or polynucleotide is a gene or polynucleotide that is introduced into a cell from outside. An exogenous gene or polynucleotide may be derived from the same organism as the cell into which it is introduced, or from a different organism (i.e., a heterologous gene or polynucleotide).

[0021] As used herein, a "polynucleotide" may be in the form of single-stranded or double-stranded DNA, RNA, or artificial nucleic acid, or may be cDNA, or chemically synthesized DNA containing no introns.

[0022] As used herein, "uracil auxotrophy" refers to the requirement of uracil supplied from an external source for cell growth. A uracil-auxotrophic microbial strain is substantially unable to grow in a uracil-free medium, but can grow in a uracil-containing medium. For example, under the conditions shown in the Examples below, a uracil-auxotrophic microbial strain cannot grow in a uracil-free minimal solid medium, but can grow in a uracil-containing minimal solid medium.

[0023] As used herein, "5-fluoroorotic acid (5-FOA) resistance" refers to the ability of cells to grow in the presence of 5-FOA, an analog of orotic acid, an intermediate metabolite in the uracil biosynthetic pathway. 5-FOA-resistant microbial strains can grow in both 5-FOA-free and 5-FOA-containing media. However, because the 5-FOA-resistant microbial strains herein are also uracil-auxotrophic microbial strains, the respective media must contain uracil. Furthermore, uridine may be further added to the respective media to improve growth. For example, under the conditions described in the Examples below, 5-FOA-resistant microbial strains can grow in both a minimal solid medium containing uracil but not 5-FOA, and a minimal solid medium containing 5-FOA and uracil. Note that 5-FOA-sensitive microbial strains that are not 5-FOA-resistant are lethal in the presence of 5-FOA because 5-FOA is converted to toxic 5-fluorouracil via the uracil biosynthetic pathway.

[0024] As used herein, "self-cloning" refers to an organism obtained using recombinant DNA technology in which the donor and host of the inserted DNA in the recombinant belong to the same species. Also, as used herein, "natural occurrence" refers to an organism obtained using recombinant DNA technology in which the donor and host of the inserted DNA in the recombinant belong to different species, where genetic exchange between the two has been shown to occur in nature, and the donor and host of the inserted DNA in the recombinant belong to both species. Also, as used herein, "mutation" refers to a change in genetic information, such as a change caused by errors during DNA replication, DNA damage caused by chemicals, replication errors, DNA or chromosomal damage caused by radiation, or gene disruption due to transposon transfer.

[0025] (2. Starmerella bombicola mutant strain) The present inventors have isolated a mutant strain of Starmerella bombicola, which is used for glycolipid production, by introducing a mutation into the gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2, conferring uracil auxotrophy. The amino acid sequence set forth in SEQ ID NO: 2 is based on a specific ORF discovered by the present inventors as a result of ORF analysis of Starmerella bombicola, a species for which ORF analysis had not previously been fully performed. As shown in the Examples below, a Starmerella bombicola strain without a mutation in the gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 can grow in both uracil-containing and uracil-free media, whereas a Starmerella bombicola mutant strain with a mutation in the gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 can grow in uracil-containing media but not in uracil-free media. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2 is presumed to be a polypeptide involved in the uracil biosynthetic pathway in Starmerella bombicola. Furthermore, based on the similarity of the amino acid sequence, it is highly likely to be a polypeptide with orotate phosphoribosyltransferase activity. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2 was named the Starmerella bombicola orotate phosphoribosyltransferase-like protein. If the expression of the orotate phosphoribosyltransferase-like protein is suppressed or its function is reduced or eliminated, resulting in inactivation of the protein in Starmerella bombicola, which is not auxotrophic for uracil, uracil biosynthesis is impaired or impossible, thereby conferring uracil auxotrophy to the Starmerella bombicola. Conversely, if the expression of an orotate phosphoribosyltransferase-like protein is suppressed or the function of the protein is reduced or eliminated, causing the protein to be inactivated and Starmerella bombicola to become uracil-requiring, then the uracil requirement of Starmerella bombicola can be relieved by normally expressing the protein.In other words, the Starmerella bombicola orotate phosphoribosyltransferase-like protein is a protein that can relieve uracil requirement in uracil-requiring Starmerella bombicola, or in other words, it is a protein that can make uracil-requiring Starmerella bombicola non-requiring. Furthermore, a Starmerella bombicola strain that does not have a mutation in the gene encoding the Starmerella bombicola orotate phosphoribosyltransferase-like protein consisting of the amino acid sequence shown in SEQ ID NO: 2 can grow in 5-FOA-free medium regardless of the presence or absence of uracil, but cannot grow in 5-FOA-containing medium. This is thought to be due to the conversion of 5-FOA to toxic 5-fluorouracil via the uracil biosynthetic pathway. On the other hand, a Starmerella bombicola mutant strain carrying a mutation in the gene encoding the Starmerella bombicola orotate phosphoribosyltransferase-like protein consisting of the amino acid sequence shown in SEQ ID NO:2 can grow in both 5-FOA-containing and 5-FOA-free media in the presence of uracil, but cannot grow in either 5-FOA-containing or 5-FOA-free media in the absence of uracil. This is thought to be because the mutation inhibits the conversion of 5-FOA to 5-fluorouracil in this mutant strain. When the expression of the orotate phosphoribosyltransferase-like protein is suppressed in uracil-nonrequiring Starmerella bombicola or when the protein is inactivated by reducing or eliminating its function, 5-FOA resistance is conferred to the Starmerella bombicola. Conversely, when the expression of an orotate phosphoribosyltransferase-like protein is suppressed or the function of the protein is reduced or eliminated, causing the protein to be inactivated and Starmerella bombicola to become 5-FOA resistant, if the protein is expressed normally in the Starmerella bombicola, the Starmerella bombicola becomes 5-FOA sensitive.As reported in the aforementioned non-patent document 2, Saccharomyces cerevisiae has two genes encoding orotate phosphoribosyltransferase, and mutation in only one of the genes is not sufficient to inhibit the function of orotate phosphoribosyltransferase. However, it is quite surprising that mutation in only one gene in Starmerella bombicola can confer sufficient uracil requirement and 5-FOA resistance.

[0026] The present invention provides a Starmerella bombicola mutant strain (hereinafter referred to as the "mutant strain of the present invention"). In the mutant strain of the present invention, the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated. The mutant strain of the present invention can be produced by suppressing or inactivating the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. The mutant strain of the present invention exhibits uracil auxotrophy due to the suppression or inactivation of the expression of the orotate phosphoribosyltransferase-like protein or a protein equivalent thereto. Furthermore, the mutant strain of the present invention exhibits 5-FOA resistance due to the suppression or inactivation of the expression of the orotate phosphoribosyltransferase-like protein or a protein equivalent thereto.

[0027] Here, the "orotate phosphoribosyltransferase-like protein" refers to an orotate phosphoribosyltransferase-like protein of Starmerella bombicola, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2.

[0028] Furthermore, a "protein equivalent to the orotate phosphoribosyltransferase-like protein" refers to a protein that has the same function as the orotate phosphoribosyltransferase-like protein of Starmerella bombicola, and includes homologs, orthologs, or mutants thereof of the orotate phosphoribosyltransferase-like protein of Starmerella bombicola. A protein equivalent to the orotate phosphoribosyltransferase-like protein is preferably a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2. Examples of amino acid sequences that are at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 2.

[0029] Preferably, the mutant strain of the present invention is a mutant strain in which the expression of an orotate phosphoribosyltransferase-like protein or a protein corresponding thereto is suppressed compared to the strain before mutation (parent strain). In one embodiment, the mutant strain of the present invention can be a mutant strain in which the expression level of an orotate phosphoribosyltransferase-like protein or a protein corresponding thereto is reduced to 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, and even more preferably 5% or less, compared to the parent strain. Even more preferably, the mutant strain of the present invention can be a mutant strain in which the expression level of an orotate phosphoribosyltransferase-like protein or a protein corresponding thereto is reduced to an undetectable level (below the expression level of a negative control or background). The expression level of a protein or polypeptide can be measured by commonly used protein expression quantification methods, such as, but not limited to, colorimetry, fluorometry, Western blotting, ELISA, and radioimmunoassay.

[0030] Methods for suppressing or inactivating the expression of Starmerella bombicola orotate phosphoribosyltransferase-like proteins or proteins equivalent thereto include deleting or inactivating the genes encoding them, inactivating the mRNA transcribed from the genes encoding them, suppressing translation of the mRNA of the genes encoding them by RNA interference using siRNA, mutating the genes encoding them to reduce the activity of the protein, and inactivating the protein with inhibitors such as aptamers or antibodies. In a preferred embodiment, the mutant strain of the present invention is a mutant strain in which the gene encoding the orotate phosphoribosyltransferase-like protein or a gene equivalent thereto has been deleted or inactivated.

[0031] Here, the "gene encoding an orotate phosphoribosyltransferase-like protein" refers to a gene encoding an orotate phosphoribosyltransferase-like protein of Starmerella bombicola, and is preferably a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1.

[0032] Furthermore, a "gene equivalent to the gene encoding the orotate phosphoribosyltransferase-like protein" refers to a gene encoding a protein equivalent to the above-mentioned Starmerella bombicola orotate phosphoribosyltransferase-like protein, preferably a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1, and more preferably a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1, and encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 2. Examples of nucleotide sequences at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1 include nucleotide sequences in which one or more nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence set forth in SEQ ID NO: 1.

[0033] Methods for deleting or inactivating Starmerella bombicola genes include introducing mutations (deletions, insertions, substitutions, or additions) into one or more nucleotides in the nucleotide sequence of the target gene, substituting or inserting another nucleotide sequence into the nucleotide sequence, or deleting part or all of the nucleotide sequence. Alternatively, similar mutations or nucleotide sequence substitutions, insertions, or deletions may be performed in the target gene's regulatory region, such as the promoter region. For example, by introducing mutations into the promoter controlling the expression of the target gene or replacing it with a lower-expressing promoter, promoter activity can be reduced or eliminated, thereby reducing or eliminating mRNA transcription from the target gene, thereby inactivating the target gene.

[0034] Specific techniques for the above-mentioned mutagenesis, or substitution, insertion, or deletion of nucleotide sequences can be any method for genetic modification of microorganisms known in the art, including, but not limited to, ultraviolet irradiation, site-specific mutagenesis, homologous recombination using SOE-PCR (splicing by overlap extension PCR: Gene, 1989, 77:61-68), and genome editing using artificial DNA cleavage enzymes (artificial DNA nucleases or programmable nucleases).

[0035] After the above-mentioned mutagenesis or substitution, insertion, or deletion of a nucleotide sequence, genetic analysis or evaluation of the expression level of mRNA or polypeptide encoded by the target gene can be performed to select cells having the desired mutation, thereby obtaining the mutant strain of the present invention.

[0036] Alternatively, the mutant strain of the present invention in which the gene encoding the orotate phosphoribosyltransferase-like protein or a gene corresponding thereto is deleted or inactivated can be obtained by confirming the uracil requirement and / or 5-FOA resistance of the mutant strain prepared by the above procedures.

[0037] When the gene is deleted or inactivated by homologous recombination using SOE-PCR, cells containing a DNA fragment for gene deletion to replace the target gene DNA can be cultured on a medium containing 5-FOA, and growing colonies can be isolated to obtain a mutant strain in which the target gene has been deleted. Furthermore, the mutation may be confirmed by the above-mentioned genetic analysis or evaluation of the expression level of the polypeptide. By using the above procedures, the mutant strain of the present invention in which the gene encoding the orotate phosphoribosyltransferase-like protein or a gene corresponding thereto has been deleted or inactivated can be obtained.

[0038] (3. Method for producing transformants) A gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto is a gene involved in uracil auxotrophy and 5-FOA resistance in Starmerella bombicola and can function as an auxotrophic (uracil) selection marker (endogenous selection marker) derived from an endogenous gene in Starmerella bombicola. Use of this gene makes it possible to produce Starmerella bombicola transformants. Therefore, the present invention also provides a method for producing a Starmerella bombicola transformant, which comprises using a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto as a selection marker.

[0039] In the method for producing a transformant of the present invention, a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto is used as a selectable marker for selecting transformants. The gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto is preferably an isolated gene. Here, "isolated gene" refers to a gene that exists independently of the genomic DNA of the organism from which it originates, and includes genes separated from the genomic DNA of the organism from which it originates and genes synthesized by genetic engineering or chemical engineering. A gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto can be prepared from Starmerella bombicola harboring the gene by standard methods, either by extracting genomic DNA or by extracting RNA and synthesizing cDNA by reverse transcription. For example, a gene encoding an orotate phosphoribosyltransferase-like protein from Starmerella bombicola can be prepared from the Starmerella bombicola NBRC10243 strain. A gene corresponding to the gene encoding the Starmerella bombicola orotate phosphoribosyltransferase-like protein can be prepared by modifying the gene encoding the Starmerella bombicola orotate phosphoribosyltransferase-like protein using various known mutagenesis techniques. Alternatively, a gene encoding the Starmerella bombicola orotate phosphoribosyltransferase-like protein or a gene equivalent thereto can be prepared by genetic engineering or chemical synthesis of a corresponding nucleotide sequence based on the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 90% identity thereto. Hereinafter, a gene encoding the orotate phosphoribosyltransferase-like protein or a gene equivalent thereto may be referred to as a selectable marker of the present invention.

[0040] In the method for producing a transformant of the present invention, the Starmerella bombicola mutant strain of the present invention can be used as a host. In the mutant strain of the present invention, the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated, and the mutant strain is uracil auxotrophic and 5-FOA resistant. The mutant strain of the present invention can be used as a host in the method for producing a Starmerella bombicola transformant of the present invention, particularly in the method for producing a Starmerella bombicola transformant in which transformants are selected using the presence or absence of uracil auxotrophy as an indicator.

[0041] Alternatively, in the method for producing a transformant of the present invention, a Starmerella bombicola strain that is non-requiring for uracil (hereinafter referred to as a "non-uracil auxotrophic strain") can be used as a host. The non-uracil auxotrophic strain may be a naturally occurring strain or an artificially created mutant strain, as long as it does not require exogenously supplied uracil for growth. The non-uracil auxotrophic strain does not have an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto repressed or inactivated, and is not 5-FOA resistant, i.e., is 5-FOA sensitive. The non-uracil auxotrophic strain can be used as a host in the method for producing a Starmerella bombicola transformant of the present invention, particularly in the method for producing a Starmerella bombicola transformant in which transformants are selected using the presence or absence of 5-FOA resistance as an indicator.

[0042] The method for producing a transformant of the present invention allows for the production of a transformant in which a target polynucleotide has been introduced into a host. The target polynucleotide is not particularly limited and may be any polynucleotide. For example, the above-mentioned selection marker may be both a selection marker and a target polynucleotide to be introduced into the host. The target polynucleotide may be derived from an organism of the same species as the host into which it is introduced, or from an organism of a different species from the host. However, since the resulting transformant may be a self-cloning or natural occurrence, polynucleotides derived from microorganisms of the same species as the host or microorganisms of a different species from the host in which gene exchange between the two has been shown to occur in nature are preferred, and polynucleotides derived from organisms of the same species as the host are more preferred. The target polynucleotide may be isolated from nature, synthesized, or produced using genetic engineering techniques. The target polynucleotide may also be codon-optimized to match the host species. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).

[0043] In the method for producing a transformant of the present invention, a polynucleotide of interest can be introduced into a host by, for example, using a mutant strain of the present invention as a host and introducing the polynucleotide of interest and the selection marker of the present invention. Alternatively, a non-uracil-requiring strain can be used as a host and introducing the polynucleotide of interest so that the selection marker of the present invention is deleted or inactivated in the host genome.

[0044] Means for introducing a polynucleotide of interest and a selectable marker of the present invention into a mutant strain of the present invention in a host include, for example, introducing a vector or DNA fragment containing the polynucleotide of interest and the selectable marker of the present invention into the host, or introducing a vector or DNA fragment containing the polynucleotide of interest and a vector or DNA fragment containing the selectable marker of the present invention into the host, preferably introducing a vector or DNA fragment containing the polynucleotide of interest and the selectable marker of the present invention into the host. Furthermore, a method for introducing a polynucleotide of interest into a host non-uracil-auxotrophic strain so as to delete or inactivate the selectable marker of the present invention in the genome thereof can be, for example, by introducing a polynucleotide containing the polynucleotide of interest and which deletes or inactivates the selectable marker of the present invention in the host genome. More specifically, a method can be used for introducing into the host a vector or DNA fragment containing a polynucleotide comprising a polynucleotide consisting of the nucleotide sequence of the upstream flanking region of the selectable marker of the present invention in the host genome or a nucleotide sequence having at least 90% identity thereto, and a polynucleotide comprising the nucleotide sequence of the downstream flanking region of the selectable marker of the present invention in the host genome or a nucleotide sequence having at least 90% identity thereto, linked in this order, such that the polynucleotide of interest is introduced into the host genome in place of the selectable marker of the present invention by homologous recombination. The length of the flanking region is not particularly limited, but is preferably 0.5 to 3 kb, more preferably 0.5 to 1 kb, independently of each other, in terms of homologous recombination efficiency and operability.

[0045] The above vector may be a vector capable of autonomous replication and propagation outside of a chromosome, or a vector that is integrated into a chromosome. The type of vector is not particularly limited, and examples include plasmids, cosmids, phages, viruses, YACs, and BACs. Among these, plasmid vectors are preferred. Those skilled in the art can select an appropriate vector depending on the type of host. Plasmid vectors may be prepared according to the host, or commercially available products may be used.

[0046] Examples of the DNA fragment include PCR-amplified DNA fragments and restriction enzyme-cleaved DNA fragments.

[0047] When the above-mentioned vector or DNA fragment contains a selectable marker of the present invention, it preferably further comprises a control region operably linked to the selectable marker. Furthermore, when the target polynucleotide to be introduced into a host contains a gene, it preferably further comprises a control region operably linked to the gene. The control region is a sequence that controls the expression of the selectable marker and / or gene in the host into which the vector or DNA fragment has been introduced. Examples of the control region include expression regulatory regions such as promoters and terminators, origins of replication, and secretory signal regions for extracellular secretion of the expressed protein. The type of control region is not particularly limited, and commonly used promoters and secretory signal sequences can be appropriately selected and used depending on the host into which the vector or DNA fragment is introduced. For example, suitable control sequences include promoters and secretory signal sequences derived from Starmerella bombicola.

[0048] The polynucleotide or the like of interest contained in the vector or DNA fragment to be introduced into the host may be introduced into the host nucleus or into the host genome, for example, by homologous recombination.

[0049] The vector or DNA fragment can be introduced into a host by any commonly used method, such as electroporation, particle gun method, lithium acetate method, or heat treatment.

[0050] Transformants into which a polynucleotide of interest has been introduced can be selected using the selection marker of the present invention. For example, when a mutant strain of the present invention is used as a host, transformants into which a polynucleotide of interest has been introduced can be selected using the presence or absence of uracil auxotrophy as an indicator. Alternatively, introduction of a polynucleotide of interest can be confirmed by examining the DNA sequence of the transformant by PCR or the like. Furthermore, for example, when a non-uracil auxotrophic strain is used as a host, transformants into which a polynucleotide of interest has been introduced can be selected using the presence or absence of 5-FOA resistance as an indicator. In this case, the transformant must be selected in the presence of uracil because it is uracil auxotrophic. Alternatively, introduction of a polynucleotide of interest can be confirmed by examining the DNA sequence of the transformant by PCR or the like.

[0051] Furthermore, the method for producing a transformant of the present invention can produce a transformant in which a target endogenous polynucleotide in the host genome has been deleted or inactivated. The target endogenous polynucleotide is not particularly limited as long as it is a polynucleotide contained in the genome of the host before transformation, and may be any polynucleotide.

[0052] In the method for producing a transformant of the present invention, to delete or inactivate a target endogenous polynucleotide in a host genome, for example, a mutant strain of the present invention may be used as a host and a selection marker of the present invention may be introduced so that the target endogenous polynucleotide in the host genome is deleted or inactivated.

[0053] A method for introducing a selectable marker of the present invention into a host so as to delete or inactivate a target endogenous polynucleotide in the genome of a mutant strain of the present invention includes, for example, introducing a polynucleotide that contains the selectable marker of the present invention and that deletes or inactivates the target endogenous polynucleotide in the host genome. More specifically, a method for introducing into the host a vector or DNA fragment containing a polynucleotide comprising a polynucleotide consisting of the nucleotide sequence of the upstream flanking region of the target endogenous polynucleotide in the host genome or a nucleotide sequence at least 90% identical thereto, linked in this order to the selectable marker of the present invention and a polynucleotide consisting of the nucleotide sequence of the downstream flanking region of the target endogenous polynucleotide in the host genome or a nucleotide sequence at least 90% identical thereto, thereby introducing the selectable marker of the present invention into the host genome by homologous recombination, replacing the target endogenous polynucleotide in the host genome. The length of the flanking region is not particularly limited, but is preferably 0.5 to 3 kb, more preferably 0.5 to 1 kb, independently of each other, in terms of homologous recombination efficiency and operability. Details of the vector or DNA fragment and the method for introducing the vector or DNA fragment into a host are the same as those for introducing a target polynucleotide into a host in the above-mentioned method for producing a transformant of the present invention.

[0054] Transformants in which the endogenous polynucleotide of interest in the host genome has been deleted or inactivated can be selected using the selection marker of the present invention. For example, using the mutant strain of the present invention as a host, transformants in which the endogenous polynucleotide of interest in the host genome has been deleted or inactivated can be selected using the presence or absence of uracil auxotrophy as an indicator. Alternatively, the deletion or inactivation of the endogenous polynucleotide of interest can be confirmed by examining the DNA sequence of the transformant by PCR or the like.

[0055] In a preferred embodiment, the method for producing a transformant of the present invention is carried out by the following steps (A) and (B): By such a method, a polynucleotide of interest is introduced into a host. (A) introducing a polynucleotide of interest and a selectable marker of the present invention into a mutant strain of the present invention; (B) Selecting uracil-non-requiring cells as transformants.

[0056] In step (A), the target mutant strain of the present invention is Polynucleotides and the selection marker of the present invention are introduced. The selection marker of the present invention is a gene involved in uracil auxotrophy and 5-FOA resistance in Starmerella bombicola. The mutant strain of the present invention used as a host is uracil auxotrophic and 5-FOA resistant, but cells into which the selection marker of the present invention has been introduced become uracil non-auxotrophic. Therefore, by selecting cells that are non-uracil auxotrophic in step (B), a transformant in which a polynucleotide of interest has been introduced into the mutant strain of the present invention can be selected. Specifically, by culturing cells in a uracil-free medium and selecting the grown cells, a transformant in which a polynucleotide of interest has been introduced into the mutant strain of the present invention can be selected. In this case, the transformant becomes 5-FOA sensitive, so the uracil-free medium does not contain 5-FOA.

[0057] The method for producing a transformant of the present invention, which comprises the above steps (A) and (B), preferably comprises (A') introducing a polynucleotide of interest and the selection marker of the present invention into the genome of a mutant strain of the present invention, and (B) selecting a cell that is not auxotrophic for uracil as a transformant. The method for producing a transformant of the present invention, which comprises steps (A') and (B), may further comprise, as step (C), removing the selection marker of the present invention introduced in step (A') from the genome of the transformant (first transformant) selected in step (B), and as step (D) selecting a 5-FOA-resistant cell as a transformant (second transformant). The selection marker of the present invention can be removed according to methods known in the art for genetic modification of microorganisms. Cells in which the selection marker of the present invention has been removed from the genome of the first transformant selected in step (B) become 5-FOA-resistant. Therefore, a second transformant in which the selection marker of the present invention has been removed from the genome of the first transformant can be selected by selecting 5-FOA-resistant cells, specifically, by culturing cells in a 5-FOA-containing medium and selecting the grown cells. In this case, the second transformant becomes uracil auxotrophic, so the 5-FOA-containing medium contains uracil. The second transformant selected in step (D) corresponds to the mutant strain of the present invention, so it is now possible to carry out the above steps (A) and (B), steps (A') and (B), or steps (A') and (B) to (D) using the second transformant as a host.

[0058] Alternatively, the method for producing a transformant of the present invention, which comprises the above steps (A') and (B), may further comprise, as step (E), introducing a new polynucleotide of interest (a second polynucleotide of interest) into the genome of the transformant selected in step (B) (a first transformant into which a first polynucleotide of interest has been introduced) so that the selectable marker of the present invention in the genome of the first transformant is deleted or inactivated, and as step (F), selecting a 5-FOA-resistant cell as a transformant (a second transformant). Steps (E) and (F) are similar to steps (K) and (L), respectively, described below, and the first transformant in step (E) corresponds to the uracil-non-auxotrophic strain in step (K). Since the second transformant selected in step (F) corresponds to the mutant strain of the present invention, it is possible to newly perform the above steps (A) and (B), steps (A') and (B), or steps (A'), (B), (E) and (F) using the second transformant as a host.

[0059] By repeating the above steps (A') and (B) to (D) or steps (A'), (B), (E), and (F) multiple times, Starmerella bombicola transformants into which multiple target polynucleotides have been introduced can be obtained. When repeating, the transformant obtained in step (D) or step (F) can be used as the host in step (A') of the next cycle. The number of repetitions is not particularly limited and can be any number of times, but is preferably 2 to 10 times, and more preferably 2 to 5 times. When repeating the above steps (A') and (B) to (D) or steps (A'), (B), (E), and (F) multiple times, steps (C) and (D) or steps (E) and (F) in the final repetition may be omitted, if necessary.

[0060] In another preferred embodiment, the method for producing a transformant of the present invention is carried out by the following steps (G) and (H): By such a method, a target endogenous polynucleotide in the host genome is deleted or inactivated. (G) introducing a selectable marker of the present invention into the genome of a mutant strain of the present invention such that an endogenous polynucleotide of interest in the genome of said mutant strain of the present invention is deleted or inactivated; (H) Selecting uracil-non-requiring cells as transformants.

[0061] In step (G), a selectable marker of the present invention is introduced into the genome of a host mutant strain of the present invention so that a target endogenous polynucleotide in the genome of the mutant strain is deleted or inactivated. Step (G) is preferably carried out by introducing into the genome of a mutant strain of the present invention a polynucleotide that contains the selectable marker of the present invention and that deletes or inactivates a target endogenous polynucleotide in the genome of the mutant strain of the present invention. More preferably, step (G) is carried out by introducing into the genome of a mutant strain of the present invention a polynucleotide comprising a polynucleotide consisting of the nucleotide sequence of the upstream flanking region of a target endogenous polynucleotide in the genome of the mutant strain of the present invention or a nucleotide sequence having at least 90% identity thereto, and a polynucleotide comprising the target endogenous polynucleotide and a polynucleotide consisting of the nucleotide sequence of the downstream flanking region of a target endogenous polynucleotide in the genome of the mutant strain of the present invention or a nucleotide sequence having at least 90% identity thereto, linked in this order. In step (G), the target endogenous polynucleotide in the genome of the mutant strain of the present invention is deleted or inactivated by homologous recombination, and the selectable marker of the present invention is introduced. Cells of the mutant strain of the present invention into which the selectable marker of the present invention has been introduced become non-auxotrophic for uracil. Therefore, by selecting cells non-requiring uracil in step (H), it is possible to select a transformant in which the endogenous polynucleotide of interest in the genome of the mutant strain of the present invention has been deleted or inactivated and the selection marker of the present invention has been introduced. Specifically, by culturing cells in a uracil-free medium and selecting the grown cells, it is possible to select a transformant in which the endogenous polynucleotide of interest in the genome of the mutant strain of the present invention has been deleted or inactivated and the selection marker of the present invention has been introduced. In this case, the transformant becomes sensitive to 5-FOA, so the uracil-free medium does not contain 5-FOA.

[0062] The method for producing a transformant of the present invention, which includes the above steps (G) and (H), may further include, as step (I), removing the selection marker of the present invention introduced in step (G) from the genome of the transformant selected in step (H) (first transformant), and as step (J), selecting 5-FOA-resistant cells as transformants (second transformants). Removal of the selection marker of the present invention may be performed according to methods for genetic modification of microorganisms known in the art. Cells from the genome of the first transformant selected in step (H) from which the selection marker of the present invention has been removed become 5-FOA-resistant. Therefore, by selecting 5-FOA-resistant cells, specifically by culturing cells in a 5-FOA-containing medium and selecting the grown cells, a second transformant in which the selection marker of the present invention has been removed from the genome of the first transformant can be selected. Since the second transformant is auxotrophic for uracil, the 5-FOA-containing medium contains uracil. Since the second transformant selected in step (J) corresponds to the mutant strain of the present invention, it is possible to newly carry out the above steps (G) and (H) or steps (G) to (J) using the second transformant as a host.

[0063] By repeating the above steps (G) to (J) multiple times, Starmerella bombicola transformants in which multiple endogenous polynucleotides of interest have been deleted or inactivated can be obtained. When repeating, the transformant obtained in step (J) can be used as the host in step (G) of the next cycle. The number of repetitions is not particularly limited and can be any number of times, but is preferably 2 to 10 times, and more preferably 2 to 5 times. When repeating the above steps (G) to (J) multiple times, steps (I) and (J) in the final repetition may be omitted, if necessary.

[0064] In another preferred embodiment, the method for producing a transformant of the present invention is carried out by the following steps (K) and (L): By such a method, a polynucleotide of interest is introduced into the host genome. (K) introducing a polynucleotide of interest into the genome of a uracil-non-auxotrophic strain so that the selectable marker of the present invention in the genome of the uracil-non-auxotrophic strain is deleted or inactivated; (L) Selecting 5-FOA resistant cells as transformants.

[0065] In step (K), a polynucleotide of interest is introduced into the genome of a host Starmerella bombicola strain that is non-uracil auxotrophic, such that the selection marker of the present invention is deleted or inactivated in the genome of the non-uracil auxotrophic strain. Step (K) is preferably carried out by introducing into the genome of the host non-uracil auxotrophic strain a polynucleotide that contains the polynucleotide of interest and that deletes or inactivates the selection marker of the present invention in the genome of the non-uracil auxotrophic strain, and more preferably by introducing into the genome of the host non-uracil auxotrophic strain a polynucleotide that is formed by linking, in this order, a polynucleotide consisting of the nucleotide sequence of the upstream flanking region of the selection marker of the present invention in the genome of the non-uracil auxotrophic strain or a nucleotide sequence having at least 90% identity thereto, and a polynucleotide of interest and a polynucleotide consisting of the nucleotide sequence of the downstream flanking region of the selection marker of the present invention in the genome of the non-uracil auxotrophic strain or a nucleotide sequence having at least 90% identity thereto. In step (K), the selection marker of the present invention is deleted or inactivated in the genome of the host non-uracil auxotrophic strain by homologous recombination, resulting in the introduction of a polynucleotide of interest. Cells in the host non-uracil auxotrophic strain in which the selection marker of the present invention has been deleted or inactivated become 5-FOA resistant. Therefore, by selecting 5-FOA resistant cells in step (L), a transformant in which the selection marker of the present invention has been deleted or inactivated in the genome of the host non-uracil auxotrophic strain and a polynucleotide of interest has been introduced can be selected. Specifically, by culturing cells in a 5-FOA-containing medium and selecting the grown cells, a transformant in which the selection marker of the present invention has been deleted or inactivated in the genome of the host non-uracil auxotrophic strain and a polynucleotide of interest has been introduced can be selected. Since the transformant becomes uracil auxotrophic at this time, the 5-FOA-containing medium contains uracil.

[0066] The method for producing a transformant of the present invention, which includes the above steps (K) and (L), may further include step (M), which involves introducing a new polynucleotide of interest (a second polynucleotide of interest) and the marker of the present invention into the genome of the transformant selected in step (L) (a first transformant into which a first polynucleotide of interest has been introduced), and step (N), which involves selecting a cell that is non-auxotrophic for uracil as a transformant (a second transformant). Steps (M) and (N) are similar to the above steps (A') and (B), respectively, and the first transformant in step (M) corresponds to the mutant strain of the present invention in step (A'). Since the second transformant selected in step (N) corresponds to a strain that is non-auxotrophic for uracil, it becomes possible to newly perform the above steps (K) and (L) or steps (K) to (N) using the second transformant as a host.

[0067] By repeating the above steps (K) to (N) multiple times, Starmerella bombicola transformants into which multiple target polynucleotides have been introduced can be obtained. When repeating, the transformant obtained in step (N) can be used as the host in step (K) of the next cycle. The number of repetitions is not particularly limited and can be any number of times, but is preferably 2 to 10 times, and more preferably 2 to 5 times. When repeating the above steps (K) to (N) multiple times, steps (M) and (N) in the final repetition may be omitted, if necessary.

[0068] By appropriately combining the steps of the above-mentioned method for producing a transformant of the present invention, a transformant can be obtained in which one or more target polynucleotides have been introduced and / or one or more target endogenous polynucleotides have been deleted or inactivated.

[0069] (4. Method for producing glycolipids) Starmerella bombicola is known to produce glycolipids using hydrocarbon chains of various chain lengths, fatty acids, and the like as substrates. Therefore, by culturing the mutant strain of the present invention described in 2 above or the transformant obtained by the method for producing a transformant of the present invention described in 3 above (hereinafter referred to as the transformant of the present invention) with a substrate of an appropriate chain length, glycolipids containing constituent hydrocarbon chains, fatty acids, and the like of the desired chain length can be efficiently produced. Therefore, the present invention also provides a method for producing glycolipids, which comprises culturing the mutant strain of the present invention or the transformant of the present invention.

[0070] The glycolipid is not particularly limited as long as it can be produced by the mutant strain or transformant of the present invention, but preferably includes a glycolipid containing glucose or an acetylated form thereof as the sugar constituting the sugar or sugar chain, more preferably includes a glycolipid containing glucose, sophorose, cellobiose or an acetylated form thereof as the sugar or sugar chain, even more preferably includes sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, Bola-type glucoside, acidic glucolipid and / or cellobioselipid, even more preferably includes sophorolipid, Bola-type sophoroside and / or alkyl sophoroside, and even more preferably includes sophorolipid.

[0071] The transformant used in the method for producing glycolipids of the present invention is not particularly limited, as long as it is a transformant obtained by the method for producing a transformant of the present invention. For example, a transformant modified to improve the glycolipid-producing ability of Starmerella bombicola is preferably used. Examples of transformants modified to improve the glycolipid-producing ability of Starmerella bombicola include a transformant in which the expression of a polypeptide involved in suppressing the ability to produce a target glycolipid in Starmerella bombicola is suppressed or inactivated, a transformant in which the expression of a polypeptide involved in improving the ability to produce a target glycolipid in Starmerella bombicola is enhanced, and a transformant in which the expression of various enzymes required to produce a target glycolipid is enhanced in Starmerella bombicola.

[0072] In a preferred embodiment, the transformant used in the method for producing a glycolipid of the present invention is a transformant in which the expression of a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 25 is suppressed or inactivated by the method for producing a transformant of the present invention. The polypeptide comprising the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 25 is a putative transcription factor protein, more preferably a putative transcription factor protein having two zinc finger C2H2-type DNA-binding domains. The presence or absence of zinc finger C2H2-type DNA-binding domains in a certain polypeptide can be confirmed by analyzing the amino acid sequence using, for example, NCBI CD search, although the method for analyzing the presence or absence of such domains is not limited thereto. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 25 has been deleted or inactivated, more preferably a transformant in which a gene encoding the nucleotide sequence shown in SEQ ID NO: 24 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 24 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 24 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 24 and consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 25 has been deleted or inactivated. Here, it has been reported that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 is encoded by the nucleotide sequence shown in SEQ ID NO: 24 in Starmerella bombicola, and that a Starmerella bombicola mutant strain in which the expression of this polypeptide is suppressed or inactivated has improved sophorolipid production ability compared to the parent strain (Patent Publication No. 6725506).A specific example of the transformant is the Starmerella bombicola NBRC10243ΔuraΔseq1::Ura strain, which is described in the Examples below. The NBRC10243ΔuraΔseq1::Ura strain was transformed using an orotate phosphoribosyltransferase-like protein-deficient strain as a host, and a gene consisting of the nucleotide sequence shown in SEQ ID NO: 24, present in the genome of the Starmerella bombicola NBRC10243 strain, was inserted in place of the gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, present in the genome of the NBRC10243 strain, and is therefore considered to be a self-cloning strain.

[0073] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which FAO1 (fatty alcohol oxidase 1) or a protein equivalent thereto has been suppressed or inactivated by the method for producing a transformant of the present invention. Here, "FAO1" refers to Starmerella bombicola FAO1, a polypeptide having fatty alcohol oxidase activity, preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 43. Furthermore, "a protein equivalent to FAO1" refers to a protein having the same function as Starmerella bombicola FAO1, including homologs, orthologs, or variants thereof of Starmerella bombicola FAO1. The protein equivalent to FAO1 is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 43. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 43 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 43. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 43 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 43 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 42 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 42 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 42 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 42 and consisting of the amino acid sequence shown in SEQ ID NO: 43 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 43 has been deleted or inactivated.It has been reported that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 43 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 42, and that a Starmerella bombicola mutant strain in which the expression of this polypeptide is suppressed or inactivated is capable of producing Bola-type sophorosides, alkylsophorosides, alkylglucosides, and Bola-type glucosides (Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528).

[0074] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52M1 (CYP52M1 cytochrome P450 monooxygenase) or a protein corresponding thereto has its expression suppressed or inactivated by the method for producing a transformant of the present invention. Here, "CYP52M1" refers to CYP52M1 from Starmerella bombicola, a polypeptide having hydroxylation activity at the ω- or ω-1-position of fatty acids or fatty alcohols, preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 45. Furthermore, "a protein corresponding to CYP52M1" refers to a protein having the same function as CYP52M1 from Starmerella bombicola, including homologs, orthologs, or variants thereof of CYP52M1 from Starmerella bombicola. The protein corresponding to CYP52M1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 45. An example of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 45 is an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 45. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 45 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 45 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 44 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 44 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 44 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 44 and consisting of the amino acid sequence shown in SEQ ID NO: 45 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 45 has been deleted or inactivated.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 45 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 44. It has been reported that a Starmerella bombicola mutant strain in which the cyp52M1 gene and the fao1 gene are disrupted has good productivity of Bola-type sophoroside and suppresses the by-production of sophorolipid (WO 2020 / 104582).

[0075] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52N1 (CYP52N1 cytochrome P450 monooxygenase) or a protein equivalent thereto has its expression suppressed or inactivated by the method for producing a transformant of the present invention. Here, "CYP52N1" refers to CYP52N1 from Starmerella bombicola, which, like the above-mentioned CYP52M1, is a polypeptide having hydroxylation activity at the ω- or ω-1-position of fatty acids or fatty alcohols (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), and is preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 47. Furthermore, "a protein equivalent to CYP52N1" refers to a protein having the same function as CYP52N1 from Starmerella bombicola, and includes homologs, orthologs, and mutants of CYP52N1 from Starmerella bombicola. A protein corresponding to CYP52N1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 47.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 47 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 46 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 46 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 46 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 46 and consisting of the amino acid sequence shown in SEQ ID NO: 47 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 47 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47 is encoded by the nucleotide sequence shown in SEQ ID NO: 46 in Starmerella bombicola.

[0076] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52E3 (CYP52E3 cytochrome P450 monooxygenase) or a protein equivalent thereto has its expression suppressed or inactivated by the method for producing a transformant of the present invention. Here, "CYP52E3" refers to CYP52E3 from Starmerella bombicola, which, like the above-mentioned CYP52M1, is a polypeptide having hydroxylation activity at the ω- or ω-1-position of fatty acids or fatty alcohols (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), and is preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 49. Furthermore, "a protein equivalent to CYP52E3" refers to a protein having the same function as CYP52E3 from Starmerella bombicola, and includes homologs, orthologs, and mutants thereof of CYP52E3 from Starmerella bombicola. A protein corresponding to CYP52E3 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 49.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 49 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 48 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 48 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 48 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 48 and consisting of the amino acid sequence shown in SEQ ID NO: 49 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 49 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49 is encoded by the nucleotide sequence shown in SEQ ID NO: 48 in Starmerella bombicola.

[0077] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which UGTB1 (UDP-glucosyltransferase B1) or a protein equivalent thereto has its expression suppressed or inactivated by the method for producing a transformant of the present invention. Here, "UGTB1" refers to UGTB1 from Starmerella bombicola, a polypeptide having glycosyltransferase activity on hydroxylated fatty acids using UDP-glucose as a donor, and preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 51. Furthermore, "a protein equivalent to UGTB1" refers to a protein having the same function as UGTB1 from Starmerella bombicola, including homologs, orthologs, or variants thereof of UGTB1 from Starmerella bombicola. The protein equivalent to UGTB1 is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 51. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 51 include amino acid sequences in which one or more amino acids are deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 51. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 51 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 51 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 50 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 50 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 50 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 50 and consisting of the amino acid sequence shown in SEQ ID NO: 51 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 51 has been deleted or inactivated.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 51 is encoded by the nucleotide sequence shown in SEQ ID NO: 50 in Starmerella bombicola. It has been reported that a Starmerella bombicola mutant strain in which the ugtB1 gene has been disrupted is capable of producing glucolipids (Sofie Lodens et al., Biotechnol Bioeng., 2020, 117(2): 453-465). It has also been reported that a Starmerella bombicola mutant strain in which the ugtB1 gene, fao1 gene, and cyp52M1 gene have been disrupted is capable of producing alkylglucosides and alkylsophorosides (WO 2021 / 229017).

[0078] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which UGTA1 (UDP-glucosyltransferase A1) or a protein equivalent thereto has been suppressed or inactivated by the method for producing a transformant of the present invention. Here, "UGTA1" refers to UGTA1 from Starmerella bombicola, which, like the above-mentioned UGTB1, is a polypeptide that has the activity of transglycosylating hydroxylated fatty acids using UDP-glucose as a donor (Karen MJ Saerens et al., FEMS Yeast Res., 2015, 15(7): fov075), and is preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 53. Furthermore, "a protein equivalent to UGTA1" refers to a protein that has the same function as UGTA1 from Starmerella bombicola, and includes homologs, orthologs, or mutants thereof of UGTA1 from Starmerella bombicola. The protein equivalent to UGTA1 is preferably a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 53. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 53 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 53.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 53 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 53 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 52 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 52 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 52 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 52 and consisting of the amino acid sequence shown in SEQ ID NO: 53 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 53 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 53 is encoded by the nucleotide sequence shown in SEQ ID NO: 52 in Starmerella bombicola.

[0079] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which the expression of AT (acetyl transferase) or a protein equivalent thereto has been suppressed or inactivated by the method for producing a transformant of the present invention. Here, "AT" refers to the AT of Starmerella bombicola, a polypeptide having the activity of acetylating the OH moiety of sugars, preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 55. Furthermore, "a protein equivalent to AT" refers to a protein having the same function as the AT of Starmerella bombicola, including a homolog, ortholog, or variant thereof of the AT of Starmerella bombicola. The protein equivalent to AT is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 55. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 55 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 55. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 55 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 55 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 54 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 54 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 54 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 54 and consisting of the amino acid sequence shown in SEQ ID NO: 55 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 55 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 55 is encoded by the nucleotide sequence shown in SEQ ID NO: 54 in Starmerella bombicola.It has been reported that a mutant of Starmerella bombicola in which the at gene is disrupted produces non-acetylated sophorolipids (Karen MJ Saerens et al., Biotechnol Bioeng., 2011, 108(12): 2923-2931).

[0080] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which the expression of SBLE (Starmerella bombicola lactone esterase) or a protein equivalent thereto is suppressed or inactivated by the method for producing a transformant of the present invention. Here, "SBLE" refers to SBLE of Starmerella bombicola, a polypeptide having the lactonization activity of sophorolipids, preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 57. Furthermore, "a protein equivalent to SBLE" refers to a protein having the same function as SBLE of Starmerella bombicola, including homologs, orthologs, or variants thereof of SBLE of Starmerella bombicola. The protein equivalent to SBLE is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 57. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 57 include amino acid sequences in which one or more amino acids are deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 57. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 57 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 57 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 56 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 56 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 56 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 56 and consisting of the amino acid sequence shown in SEQ ID NO: 57 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 57 has been deleted or inactivated.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 57 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 56. It has been reported that the ratio of acid-type sophorolipids is increased in a Starmerella bombicola mutant strain in which the sble gene is disrupted (Katarzyna Ciesielska et al., Appl Microbiol Biotechnol., 2016, 100(22): 9529-9541). It has also been reported that a Starmerella bombicola mutant strain in which the sble gene and at gene are disrupted is capable of producing non-acetylated Bola-type sophorolipids (WO 2015 / 028278).

[0081] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which expression of MDR1 (multidrug resistance protein 1) or a protein equivalent thereto is enhanced by the method for producing a transformant of the present invention. Here, "MDR1" refers to MDR1 of Starmerella bombicola, a transporter polypeptide responsible for intracellular and extracellular transport of sophorolipids, and is preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 59. Furthermore, "a protein equivalent to MDR1" refers to a protein having the same function as MDR1 of Starmerella bombicola and includes homologs, orthologs, or variants thereof of MDR1 of Starmerella bombicola. The protein equivalent to MDR1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 59. Examples of amino acid sequences having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 59 include amino acid sequences in which one or more amino acids are deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 59. The transformant is preferably a transformant in which expression has been enhanced of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 59 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 59, more preferably a transformant in which expression has been enhanced of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 58 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 58, and even more preferably a transformant in which expression has been enhanced of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 58 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 58, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 59 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 59. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 59 is encoded by the nucleotide sequence shown in SEQ ID NO: 58 in Starmerella bombicola.It has been reported that the productivity of sophorolipids and Bola-type sophorolipids is significantly reduced in Starmerella bombicola mutants in which the mdr1 gene is disrupted (Silke Claus et al., BMC Genomics, 2022, 23(1): 22).

[0082] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which the expression of MFE-2 (multifunctional enzyme type 2) or a protein equivalent thereto is suppressed or inactivated by the method for producing a transformant of the present invention. Here, "MFE-2" refers to Starmerella bombicola MFE-2, a polypeptide involved in the beta-oxidation degradation of fatty acids. Furthermore, "proteins equivalent to MFE-2" refer to proteins that have the same function as Starmerella bombicola MFE2 and include homologs, orthologs, or mutants of Starmerella bombicola MFE2. It has been reported that a Starmerella bombicola mutant strain in which the mfe-2 gene is disrupted produces sophorolipids with a medium-chain fatty acid backbone (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(4): 610-617).

[0083] In the method for producing glycolipids of the present invention, the mutant strain of the present invention or the transformant of the present invention is cultured in a medium containing substrates such as fatty acids, fatty acid alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, fats and oils, alkanes, alkenes, alkynes, alcohols, etc. Glycolipids can be produced by recovering them from the medium after the culture and purifying them as necessary.

[0084] The medium used for the above-mentioned culture can be a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic trace nutrients such as amino acids and vitamins. The medium may be either a synthetic medium or a natural medium.

[0085] The carbon and nitrogen sources contained in the medium may be of any type that can be utilized by the mutant or transformant being cultured. Examples of carbon sources include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysates, and molasses; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used alone or in combination of two or more. Examples of nitrogen sources include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates; and urea.

[0086] Examples of the inorganic salts include phosphates, magnesium salts, calcium salts, iron salts, manganese salts, etc. Examples of the organic trace nutrients include amino acids, vitamins, fatty acids, nucleic acids, and peptones containing these, casamino acids, yeast extract, soy protein hydrolysates, etc. When using an auxotrophic mutant or transformant that requires amino acids or the like for growth, the required nutrients may be supplemented.

[0087] Preferred examples of substrates that can be contained in the medium include C12-22 fatty acids and their alkyl esters, triacylglycerols containing C12-22 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-22 fatty acids or their alkyl esters, C12-22 alkanes, C12-22 alkenes, C12-22 alkynes, and C12-22 alcohols. More preferred examples include C12-18 fatty acids and their alkyl esters, triacylglycerols containing C12-18 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-18 fatty acids or their alkyl esters, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, and C12-18 alcohols. More preferred examples include C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, and C12 to C18 alcohols.

[0088] More specific examples of the substrate include, but are not limited to, the C12-22 fatty acids, which may be saturated or unsaturated, and may be straight-chain or branched, such as lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, behenic acid, palmitoleic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid; the alkyl esters of the C12-22 fatty acids include alkyl esters of the above-listed fatty acids having 1 to 4 carbon atoms, preferably methyl esters and ethyl esters; and the fats and oils containing the C12-22 fatty acids or alkyl esters thereof include coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.

[0089] The C12-22 alkanes may be straight-chain or branched, and examples thereof include dodecane, tridecane, tetradecane, pentadecane, hexadecane, heptadecane, octadecane, nonadecane, icosane, henicosane, and docosane; the C12-22 alkenes may be straight-chain or branched, and examples thereof include 1-dodecene, 1-tridecene, 1-tetradecene, 1-pentadecene, and 1-hexadecene. , 1-heptadecene, 1-octadecene, 1-nonadecene, 1-icosene, 1-heneicosene, 1-docosene, etc.; the C12-22 alkynes may be linear or branched, and examples thereof include 1-dodecyne, 1-tridecyne, 1-tetradecyne, 1-pentadecyne, 1-hexadecyne, 1-heptadecyne, 1-octadecyne, 1-nonadecyne, 1-icosine, 1-heneicosine, 1-docosine, etc.

[0090] The C12-22 alcohol may be a saturated or unsaturated alcohol, and may be a straight-chain or branched-chain alcohol, and examples thereof include lauryl alcohol, tridecyl alcohol, myristyl alcohol, pentadecyl alcohol, cetyl alcohol, heptadecyl alcohol, stearyl alcohol, isostearyl alcohol, nonadecyl alcohol, arachidyl alcohol, behenyl alcohol, palmitoleyl alcohol, oleyl alcohol, linoleyl alcohol, and linolenyl alcohol.

[0091] The substrates listed above can be used alone or in combination of two or more. Preferably, fatty acids with a chain length of C12 to C18 or their alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, or fats and oils containing them, or alkanes, alkenes, alkynes, or alcohols with a chain length of C12 to C18 are used. More preferably, fatty acids with a chain length of C12 to C18 or their alkyl esters, or alcohols with a chain length of C12 to C18 are used. Even more preferably, fatty acids with a chain length of C16 to C18 or their alkyl esters, or alcohols with a chain length of C16 to C18 are used. Even more preferably, C18 fatty acids or their alkyl esters, or C18 alcohols are used. Even more preferably, oleic acid or its alkyl esters, or oleyl alcohol are used. Rapeseed oil, whose main component is triacylglycerols containing a large amount of oleic acid as a constituent fatty acid, is also preferably used.

[0092] The content of the above-mentioned substrate that can be contained in the medium (at the time of adding the substrate) is preferably 0.1 mass / volume% or more, more preferably 0.5 mass / volume% or more, even more preferably 1 mass / volume% or more, even more preferably 2 mass / volume% or more, even more preferably 3 mass / volume% or more, and even more preferably 5 mass / volume% or more in terms of the amount of glycolipid produced, and is preferably 40 mass / volume% or less, more preferably 30 mass / volume% or less, even more preferably 25 mass / volume% or less, even more preferably 20 mass / volume% or less, even more preferably 15 mass / volume% or less, and even more preferably 10 mass / volume% or less in terms of glycolipid production efficiency. Alternatively, preferably, the amount is 0.1 to 40 mass / volume%, 0.1 to 30 mass / volume%, 0.1 to 25 mass / volume%, 0.1 to 20 mass / volume%, 0.1 to 15 mass / volume%, 0.1 to 10 mass / volume%, 0.5 to 40 mass / volume%, 0.5 to 30 mass / volume%, 0.5 to 25 mass / volume%, 0.5 to 20 mass / volume%, 0.5 to 15 mass / volume%, 0.5 to 10 mass / volume%, 1 to 40 mass / volume%, 1 to 30 mass / volume%, 1 to 25 mass / volume%, 1 to 20 mass / volume%, 1 to 15 mass / volume%. %, 1 to 10 mass / volume%, 2 to 40 mass / volume%, 2 to 30 mass / volume%, 2 to 25 mass / volume%, 2 to 20 mass / volume%, 2 to 15 mass / volume%, 2 to 10 mass / volume%, 3 to 40 mass / volume%, 3 to 30 mass / volume%, 3 to 25 mass / volume%, 3 to 20 mass / volume%, 3 to 15 mass / volume%, 3 to 10 mass / volume%, 5 to 40 mass / volume%, 5 to 30 mass / volume%, 5 to 25 mass / volume%, 5 to 20 mass / volume%, 5 to 15 mass / volume%, or 5 to 10 mass / volume%. In this specification, volume refers to the volume at 25°C and 1 atmosphere.

[0093] The culture conditions may be any conditions that allow the mutant strain or transformant of the present invention to produce glycolipids by fermentation. Culturing is preferably carried out under aerobic conditions, and common methods such as aeration and agitation culture or shaking culture can be used. The culture temperature is preferably 20 to 33°C, more preferably 25 to 30°C, and even more preferably 28 to 30°C. The initial pH of the medium (at 30°C) is preferably 2 to 7, more preferably 3 to 6. The culture time is preferably about 24 to 200 hours, and more preferably 50 to 200 hours.

[0094] In the above-mentioned culture, the mutant strain of the present invention or the transformant of the present invention may be cultured under conditions in which the cells grow, thereby producing glycolipids by fermentation, or the mutant strain of the present invention or the transformant of the present invention may be cultured in a resting cell state, i.e., in a state in which growth and proliferation have stopped, thereby producing glycolipids by fermentation.

[0095] The method for recovering glycolipids from the culture medium after cultivation is not particularly limited, and may be performed according to a known recovery method. For example, glycolipids in the culture medium can be recovered or purified by solvent extraction using ethyl acetate, butanol, etc., fractional precipitation, liquid-liquid partitioning, column chromatography, high-performance liquid chromatography, etc., either alone or in combination as appropriate.

[0096] The following compositions, manufacturing methods, uses, and methods are further disclosed herein as exemplary embodiments of the present invention, but the present invention is not limited to these embodiments.

[0097] [1] A Starmerella bombicola mutant strain in which the expression of an orotate phosphoribosyltransferase-like protein or a protein corresponding thereto is suppressed or inactivated. [2] The mutant strain described in [1], wherein the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2. [3] The mutant strain according to [1] or [2], in which a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto is deleted or inactivated. [4] The mutant strain described in [3], wherein the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1. [5] The mutant strain according to any one of [1] to [4], which is uracil auxotrophic.

[0098] [6] A method for producing a Starmerella bombicola mutant, which comprises suppressing or inactivating the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. [7] The method described in [6], wherein the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2. [8] The method described in [6] or [7], wherein a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto is deleted or inactivated. [9] The method described in [8], wherein the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.

[10] The method according to any one of [6] to [9], which is a method for producing a uracil-requiring Starmerella bombicola mutant.

[0099]

[11] A method for producing a Starmerella bombicola transformant, which comprises using a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto as a selection marker.

[12] The method according to

[11] , which comprises using the mutant strain according to any one of [1] to [5] as a host.

[13] The method described in

[11] or

[12] , which comprises selecting a transformant using the presence or absence of uracil auxotrophy as an indicator.

[14] The method described in

[11] or

[12] , which comprises selecting a transformant using a combination of the presence or absence of uracil auxotrophy and the presence or absence of 5-FOA resistance as indicators.

[0100]

[15] The method according to any one of

[11] to

[13] , comprising the following steps (A) and (B): (A) introducing a target polynucleotide and a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto into the mutant strain according to any one of [1] to [5]; (B) Selecting uracil-non-requiring cells as transformants.

[16] The method according to any one of

[11] to

[14] , comprising the following steps (A') and (B) to (D): (A') introducing a target polynucleotide and a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto into the genome of the mutant strain described in any one of [1] to [5]; (B) selecting cells that are non-requiring for uracil as first transformants; (C) removing the gene encoding the orotate phosphoribosyltransferase-like protein or a gene corresponding thereto, which was introduced in step (A), from the genome of the first transformant selected in step (B); (D) Selecting 5-FOA resistant cells as secondary transformants.

[17] The method according to

[16] , wherein steps (A') and (B) to (D) are repeated multiple times.

[18] The method according to any one of

[11] to

[14] , comprising the following steps (A'), (B), (E), and (F): (A') introducing a first target polynucleotide and a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto into the genome of the mutant strain described in any one of [1] to [5]; (B) selecting cells that are non-requiring for uracil as first transformants; (E) introducing a second polynucleotide of interest into the genome of the first transformant selected in step (B) so that the selectable marker of the present invention introduced in step (A') in the genome of the first transformant is deleted or inactivated; (F) Selecting 5-FOA resistant cells as secondary transformants.

[19] The method described in

[18] , wherein steps (A'), (B), (E) and (F) are repeated multiple times.

[0101]

[20] The method according to any one of

[11] to

[13] , comprising the following steps (G) and (H): (G) introducing a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto into the genome of the mutant strain described in any one of [1] to [5] so that a target endogenous polynucleotide in the genome of the mutant strain is deleted or inactivated; (H) Selecting uracil-non-requiring cells as transformants.

[21] The method according to any one of

[11] to

[14] , comprising the following steps (G) to (J): (G) introducing a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto into the genome of the mutant strain described in any one of [1] to [5] so that a target endogenous polynucleotide in the genome of the mutant strain is deleted or inactivated; (H) selecting cells that are not auxotrophic for uracil as first transformants; (I) removing the gene encoding the orotate phosphoribosyltransferase-like protein or a gene corresponding thereto, which was introduced in step (G), from the genome of the first transformant selected in step (H); (J) Selecting 5-FOA resistant cells as secondary transformants.

[22] The method described in

[21] , wherein steps (G) to (J) are repeated multiple times.

[0102]

[23] The method according to any one of

[11] ,

[12] and

[14] , comprising the following steps (K) and (L): (K) introducing a polynucleotide of interest into the genome of a non-uracil-requiring Starmerella bombicola strain so that a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto in the genome of the non-uracil-requiring Starmerella bombicola strain is deleted or inactivated; (L) Selecting 5-FOA resistant cells as transformants.

[24] The method according to any one of

[11] to

[14] , comprising the following steps (K) to (N): (K) introducing a first polynucleotide of interest into the genome of a non-uracil-requiring Starmerella bombicola strain so that a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto in the genome of the non-uracil-requiring Starmerella bombicola strain is deleted or inactivated; (L) Selecting 5-FOA resistant cells as primary transformants. (M) introducing a second polynucleotide of interest and a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto into the genome of the first transformant selected in step (L); (N) Selecting cells that are not uracil-requiring as second transformants.

[25] The method described in

[24] , wherein steps (K) to (N) are repeated multiple times.

[0103]

[26] The method described in any one of

[11] to

[25] , wherein the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.

[27] The method described in any one of

[11] to

[26] , wherein the mutant strain does not contain an exogenous gene.

[28] The method according to any one of

[15] to

[19] and

[23] to

[27] , wherein the target polynucleotide is derived from an organism of the same species as the mutant strain.

[0104]

[29] A transformant obtained by the method described in any one of

[11] to

[28] .

[30] A transformant according to

[29] , in which expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 25 is suppressed or inactivated.

[31] A transformant described in

[29] or

[30] , in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 24 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 24 is deleted or inactivated.

[0105]

[32] A method for producing a glycolipid, comprising culturing the mutant strain according to any one of [1] to [5] or the transformant according to any one of

[29] to

[31] .

[33] The method described in

[32] , wherein the glycolipid is selected from sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, Bola-type glucoside, acidic glucolipid, and cellobioselipid, preferably sophorolipid, Bola-type sophoroside, and alkyl sophoroside, and more preferably sophorolipid.

[34] The method according to

[32] or

[33] , wherein the culture medium contains the following substrates: at least one substrate selected from the group consisting of C12 to C22 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C22 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, oils and fats containing C12 to C22 fatty acids or alkyl esters thereof, C12 to C22 alkanes, C12 to C22 alkenes, C12 to C22 alkynes, and C12 to C22 alcohols; At least one substrate selected from the group consisting of C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, oils and fats containing C12 to C18 fatty acids or alkyl esters thereof, C12 to C18 alkanes, C12 to C18 alkenes, C12 to C18 alkynes, and C12 to C18 alcohols; or At least one substrate selected from the group consisting of C12-C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12-C18 fatty acids or alkyl esters thereof, and C12-C18 alcohols.

[35] The content of the substrate in the medium is preferably 0.1% by mass / volume or more, more preferably 0.5% by mass / volume or more, even more preferably 1% by mass / volume or more, still more preferably 2% by mass / volume or more, still more preferably 3% by mass / volume or more, still more preferably 5% by mass / volume or more, and preferably 40% by mass / volume or less, more preferably 30% by mass / volume or less, even more preferably 25% by mass / volume or less, still more preferably 20% by mass / volume or less, still more preferably 15% by mass / volume or less, still more preferably 10% by mass / volume or less, or preferably 0.1 to 40% by mass / volume, 0.1 to 30% by mass / volume, 0.1 to 25% by mass / volume, 0.1 to 20% by mass / volume, 0.1 to 15% by mass / volume, 0.1 to 10% by mass / volume, 0.5 to 40% by mass / volume, Volume%, 0.5-30 mass / volume%, 0.5-25 mass / volume%, 0.5-20 mass / volume%, 0.5-15 mass / volume%, 0.5-10 mass / volume%, 1-40 mass / volume%, 1-30 mass / volume%, 1-25 mass / volume%, 1-20 mass / volume%, 1-15 mass / volume%, 1-10 mass / volume%, 2-40 mass / volume%, 2-30 mass / volume%, 2-25 mass / volume%, 2-20 mass / vol%, 2 to 15 mass / vol%, 2 to 10 mass / vol%, 3 to 40 mass / vol%, 3 to 30 mass / vol%, 3 to 25 mass / vol%, 3 to 20 mass / vol%, 3 to 15 mass / vol%, 3 to 10 mass / vol%, 5 to 40 mass / vol%, 5 to 30 mass / vol%, 5 to 25 mass / vol%, 5 to 20 mass / vol%, 5 to 15 mass / vol%, or 5 to 10 mass / vol%.

[36] The method according to any one of

[32] to

[35] , further comprising recovering glycolipids from the culture medium after the culture.

[0106]

[37] A uracil-requiring selectable marker consisting of a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto, preferably an isolated gene encoding an orotate phosphoribosyltransferase-like protein or an isolated gene equivalent thereto.

[38] A uracil-requiring selectable marker described in

[37] , wherein the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.

[39] Use of a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto, preferably an isolated gene encoding an orotate phosphoribosyltransferase-like protein or an isolated gene corresponding thereto, as a uracil-requiring selection marker.

[40] The use described in

[39] , wherein the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.

[41] A vector or DNA fragment containing a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto.

[42] A vector or DNA fragment described in

[41] , wherein the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1. [Example]

[0107] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0108] Example 1 (1) Genomic DNA extraction from the NBRC10243 strain Genomic DNA was extracted and purified from the Starmerella bombicola type strain NBRC10243 (ATCC22214) using GenTorukun (for yeast) High Recovery (Takara Bio) according to the attached protocol.

[0109] (2) Preparation of the template plasmid pbJK13 for the introduced DNA fragment Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio) was used for all PCR reactions performed hereinafter. Genomic DNA fragment 1 was amplified using the genomic DNA of the NBRC10243 strain as a template with the primers of SEQ ID NO: 3 (GCCAAGCTTGCATGCGTTGAGCTCGTAACTCAGTGGAAGATTGAG) and SEQ ID NO: 4 (CAAACTGAAAATGTCTACCGCGGCCTAG). Similarly, genomic DNA fragment 2 was amplified with the primers of SEQ ID NO: 5 (GACATTTTCAGTTTGACTATGGAAATTAATGAAGAATTGGGCTGGCCGGCAG) and SEQ ID NO: 6 (TCTGCAGACATAGCCGAAATTCTACTGTGAG). Genomic DNA fragment 3 was amplified with the primers of SEQ ID NO: 7 (GGCTATGTCTGCAGAAGCGGGACAAGTATAGGACTGAGTTCAGCAAATAG) and SEQ ID NO: 8 (AGAGTCGACCTGCAGCAGTGCAAGTTCTGCCGCTGTAAATTTCGGTTCCAC). Furthermore, a vector DNA fragment was amplified using pHSG298 (Takara Bio) as a template with the primers SEQ ID NO: 9 (GCATGCAAGCTTGGCACTGGCCGTC) and 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). Each DNA fragment was purified from the four PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio) and then ligated using the In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene), and the cell suspension was plated on LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio) as the enzyme. Introduction of the target DNA fragment was confirmed using the primers SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG).Transformants carrying the plasmids in which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. Plasmids were purified from this culture using NucleoSpin Plasmid EasyPure (Takara Bio Inc.) to obtain plasmid pbJK13, which contains a DNA fragment in which genomic DNA fragment 2 was inserted between 887 bp upstream and 902 bp downstream of the gene shown in SEQ ID NO: 1. For convenience, genomic DNA fragment 2 is inserted upstream and downstream, but any sequence may be used, or it may be absent.

[0110] (3) Preparation of DNA fragment for introduction Using the plasmid pbJK13 as a template, a DNA fragment containing 887 bp upstream of the gene shown in SEQ ID NO: 1 (hereinafter also referred to as the ura gene), genomic DNA fragment 2, and 902 bp downstream was amplified using the primers SEQ ID NO: 13 (GTTGAGCTCGTAACTCAGTGGAAG) and SEQ ID NO: 14 (CAGTGCAAGTTCTGCCGCTG). The resulting PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The resulting DNA fragments were sequenced, confirming that all of the DNA fragments were composed of gene sequences present in the genome of the NBRC10243 strain.

[0111] (4) Insertion of DNA fragments into the T1Δseq1::ade strain and generation of the T1Δseq1::ade,Δura::ade strain The DNA fragment obtained in (3) was used to transform the Starmerella bombicola T1Δseq1::ade strain (uracil non-requiring) described in Example 2 of PCT / JP2024 / 037995 by electroporation (Nepa Gene). The transformed cell lysate was spread onto minimal agar + uracil + 5-fluoroorotic acid (5-FOA) medium (0.7% w / v yeast nitrogen base (amino acid-free), 2% w / v glucose, 0.03% w / v uracil, 0.1% w / v 5-FOA, 1.5% w / v agar) and cultured statically at 30°C. PCR was performed using the resulting colonies as templates with primers CTCTTGGTAGCAAAGAGGCCAC (SEQ ID NO: 15) and CACCTTTTCTATCGAGGATG (SEQ ID NO: 16), and the amplified fragments were sequenced. After confirming that the introduced DNA fragment was integrated into the genome, this strain was designated the T1Δseq1::ade,Δura::ade strain. In this mutant strain, genomic DNA fragment 2 has been inserted in place of the DNA sequence containing SEQ ID NO:1 on the genome.

[0112] (5) Phenotype confirmation of T1Δseq1::ade, Δura::ade strains The three T1Δseq1::ade and Δura::ade strains isolated from the different colonies obtained in (4) and the host strain T1Δseq1::ade were inoculated into potato dextrose agar (PDA) medium (0.4% by mass / volume potato extract, 2% by mass / volume glucose, 1.5% by mass / volume agar), minimal agar medium (0.7% by mass / volume yeast nitrogen base (amino acid-free), 2% by mass / volume glucose, 1.5% by mass / volume agar), minimal agar + uracil medium (0.7% by mass / volume yeast nitrogen base (amino acid-free), 2% by mass / volume glucose, 0.03% by mass / volume uracil, 1.5% by mass / volume agar), and minimal agar + uracil + 5-FOA medium, and subjected to static culture at 30°C. As a result, growth of the host strain was observed on minimal agar medium, whereas growth of the obtained T1Δseq1::ade,Δura::ade strain was not observed, confirming that uracil auxotrophy was conferred by the deletion of the DNA sequence of SEQ ID NO: 1 (Figure 1). Furthermore, growth of the host strain was not observed on minimal agar + uracil + 5-FOA medium, whereas growth of the T1Δseq1::ade,Δura::ade strain was observed, confirming that 5-FOA resistance was conferred by the deletion of the DNA sequence of SEQ ID NO: 1 (Figure 1).

[0113] Example 2 (1) Genomic DNA extraction from the NBRC10243 strain Genomic DNA was extracted and purified from the Starmerella bombicola type strain NBRC10243 (ATCC22214) using GenTorukun (for yeast) High Recovery (Takara Bio) according to the attached protocol.

[0114] (2) Preparation of the template plasmid pbJK19 for the introduced DNA fragment Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio) was used for all PCR enzymes used hereafter. Genomic DNA fragment 1 was amplified using the genomic DNA of the NBRC10243 strain as a template with the primers SEQ ID NO: 3 (GCCAAGCTTGCATGCGTTGAGCTCGTAACTCAGTGGAAGATTGAG) and SEQ ID NO: 4 (CAAACTGAAAATGTCTACCGCGGCCTAG). Similarly, genomic DNA fragment 4 was amplified using the primers SEQ ID NO: 17 (GACATTTTCAGTTTGAGCGGGACAAGTATAGGACTGAGTTCAGCAAATAG) and SEQ ID NO: 8 (AGAGTCGACCTGCAGCAGTGCAAGTTCTGCCGCTGTAAATTTCGGTTCCAC). Furthermore, a vector DNA fragment was amplified using pHSG298 (Takara Bio) as a template with the primers SEQ ID NO: 9 (GCATGCAAGCTTGGCACTGGCCGTC) and SEQ ID NO: 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). The three PCR products were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio) to separate DNA fragments, which were then ligated using an In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene). The cell suspension was then plated onto LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio) as the enzyme. Introduction of the target DNA fragment was confirmed using the primers SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG). Transformants carrying the plasmids for which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C.The plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.) to obtain plasmid pbJK19 containing a DNA fragment in which the upstream 887 bp and downstream 902 bp of the gene shown in SEQ ID NO:1 were linked.

[0115] (3) Preparation of DNA fragment for introduction Using the plasmid pbJK19 as a template, a DNA fragment containing 887 bp upstream and 902 bp downstream of the gene shown in SEQ ID NO: 1 (hereinafter also referred to as the ura gene) was amplified using the primers SEQ ID NO: 13 (GTTGAGCTCGTAACTCAGTGGAAG) and SEQ ID NO: 14 (CAGTGCAAGTTCTGCCGCTG). The resulting PCR product was treated with DpnI (Takara Bio), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The resulting DNA fragment was sequenced, confirming that the entire DNA fragment consisted of the gene sequence present in the genome of the NBRC10243 strain.

[0116] (4) Insertion of DNA fragment into NBRC10243 strain and generation of NBRC10243Δura strain The DNA fragment obtained in (3) was used to transform Starmerella bombicola strain NBRC10243 (non-uracil auxotroph) by electroporation (Nepa Gene). The transformed cell lysate was spread onto 5-fluoroorotic acid (5-FOA)-containing SD medium (4.7% w / v Minimal SD Agar Base (Clontech), 0.08% w / v Ura DO Supplement (Clontech), 0.05% w / v uracil, 0.1% w / v uridine, 0.1% w / v 5-FOA, pH adjusted to 6.8 with NaOH solution) and cultured at 30°C. PCR was performed using the resulting colonies as templates with primers CTCTTGGTAGCAAAGAGGCCAC (SEQ ID NO: 15) and CACCTTTTCTATCGAGGATG (SEQ ID NO: 16). The amplified fragments were sequenced (analyzed by electrophoresis). It was confirmed that the introduced DNA fragment was introduced into the genome and that the DNA sequence shown in SEQ ID NO: 1 was deleted, and this strain was designated as the NBRC10243Δura strain.

[0117] Example 3 (1) Preparation of the template plasmid pbJK68 for the introduced DNA fragment Using the genomic DNA of the NBRC10243 strain as a template, the primers shown in SEQ ID NO: 18 (GCCAAGCTTGCATGCTCCAATTTCTAAGGCGCAAGCGACGCTTCTAG) and 19 (TCAATTGGTAAGAGGGAACGCGTAGCGAAG) were used to amplify genomic DNA fragment 5. Similarly, the primers shown in SEQ ID NO: 20 (CCTCTTACCAATTGAGTTGAGCTCGTAACTCAGTGGAAGATTGAG) and 21 (CATTCGGACAACAATCAGTGCAAGTTCTGCCGCTGTAAATTTCG) were used to amplify genomic DNA fragment 6, and the primers shown in SEQ ID NO: 22 (ATTGTTGTCCGAATGCTCTGCGACGGCTC) and 23 (AGAGTCGACCTGCAGCCCAACGCCTTGACAAGCTTTCCAAATAGAG) were used to amplify genomic DNA fragment 7. Furthermore, a vector DNA fragment was amplified using pHSG298 (Takara Bio) as a template with the primers SEQ ID NO: 9 (GCATGCAAGCTTGGCACTGGCCGTC) and 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). Each DNA fragment was purified from the four PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio) and then ligated using the In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene), and the cell suspension was plated on LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio) as the enzyme. Introduction of the target DNA fragment was confirmed using the primers SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG). The transformant carrying the plasmid in which the introduction of the gene was confirmed was inoculated into 2 mL of LB liquid medium containing kanamycin and cultured at 37°C overnight.The plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), and plasmid pbJK68 was obtained, which contains a DNA fragment in which 887 bp upstream of the gene shown in SEQ ID NO: 1, the gene shown in SEQ ID NO: 1, and 902 bp downstream have been inserted between 1 kbp upstream and 1 kbp downstream of the gene shown in SEQ ID NO: 24 (hereinafter also referred to as the seq1 gene).

[0118] (2) Preparation of the introduced DNA fragment A DNA fragment was amplified using the plasmid pbJK68 as a template with the primers SEQ ID NO: 26 (TCCAATTTCTAAGGCGCAAGCGAC) and 27 (CCCAACGCCTTGACAAGCTTTCC). The resulting PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The resulting DNA fragment was sequenced, confirming that it was composed entirely of gene sequences present in the genome of the NBRC10243 strain.

[0119] (3) Insertion of the DNA fragment into the NBRC10243Δura strain and generation of the NBRC10243ΔuraΔseq1::Ura strain The DNA fragment obtained in (2) was used to transform Starmerella bombicola NBRC10243Δura (uracil auxotroph) by electroporation (Nepa Gene). The transformed cell lysate was plated onto uracil-free SD-uracil medium (4.7% w / v Minimal SD Agar Base (Clontech), 0.08% w / v Ura DO Supplement (Clontech), pH adjusted to 6.8 with NaOH solution) and cultured statically at 30°C. PCR was performed using the resulting colonies as templates with primers CTAACCAACCTCGAGCCCTAACAC (SEQ ID NO: 28) and CATGATTGAGTGACGTACGATG (SEQ ID NO: 29). The amplified fragments were sequenced (analyzed by electrophoresis). The gene shown in SEQ ID NO: 1 was confirmed to have been introduced in place of the gene shown in SEQ ID NO: 24, and this strain was designated NBRC10243ΔuraΔseq1::Ura.

[0120] Example 4 (1) Phenotype confirmation of the NBRC10243Δura strain and the NBRC10243ΔuraΔseq1::Ura strain The NBRC10243Δura strain, NBRC10243ΔuraΔseq1::Ura strain, and the host strain NBRC10243 obtained in Examples 2 and 3 were cultured in YPD liquid medium for 24 hours, and then bacterial cell dilutions were prepared using a 1 M sorbitol solution to give an OD600 of 1. Five microliters of each of these dilutions were inoculated into potato dextrose agar (PDA) medium, SD-uracil medium, and SD+uracil medium (4.7 wt / vol% Minimal SD Agar Base (Clontech), 0.08 wt / vol% Ura DO Supplement (Clontech), 0.1 wt / vol% uracil, adjusted to pH 6.8 with NaOH aqueous solution), and static culture was performed at 30°C. As a result, the NBRC10243Δura strain did not grow on SD-uracil medium, but did grow on SD+uracil medium, confirming that disruption of the gene shown in SEQ ID NO: 1 renders the strain uracil auxotrophic. Furthermore, growth on SD-uracil medium was observed in the NBRC10243ΔuraΔseq1::Ura strain, into which the gene shown in SEQ ID NO: 1 was reintroduced, confirming that uracil auxotrophy had been relieved (Figure 2). These results demonstrate that repeated genetic recombination procedures can be performed using the gene shown in SEQ ID NO: 1 without the use of an exogenous gene.

[0121] Example 5 (1) Confirmation of glycolipid productivity in the NBRC10243Δura and NBRC10243ΔuraΔseq1::Ura strains The NBRC10243Δura strain and the NBRC10243ΔuraΔseq1::Ura strain obtained in Examples 2 and 3 were inoculated into glycolipid production medium 2 (0.1% wt / vol urea, 2% wt / vol yeast extract, 5% wt / vol oleic acid, and 12.5% ​​wt / vol glucose) and cultured with shaking at 30°C. After 96 hours of culture, 5 mL of culture medium was collected, 5 mL of hexane was added, and the mixture was stirred and mixed for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the hexane fraction in the supernatant was removed. Next, 5 mL of ethyl acetate was added to the remaining solution, and the mixture was stirred and mixed for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the entire ethyl acetate fraction was collected. The collected ethyl acetate fraction was volatilized by blowing nitrogen gas, and the dissolved glycolipids, including sophorolipids, were precipitated. The weight of the precipitated glycolipids was measured, and the glycolipid concentration in the culture medium was calculated. The results are shown in Table 1. It was confirmed that glycolipids including glycolipids were produced in each strain.

[0122] [Table 1]

[0123] Comparative example: Genetic recombination using the ura3 marker (1) Preparation of the template plasmid pbJK6 for the introduced DNA fragment Using the genomic DNA of the NBRC10243 strain as a template, the primers shown in SEQ ID NO: 30 (GCCAAGCTTGCATGCAACAAGGCCGAGTATGTCGACGTTTCCAG) and 31 (ATTATTTCTCTACAGTAGTGCCCGTGCCCTC) were used to amplify genomic DNA fragment 8. Similarly, the primers shown in SEQ ID NO: 32 (CTGTAGAGAAATAATATGGCTGCGATGGCTGCGTGTGCCTTG) and 33 (AACTGTTTGAGAAAACTAGATGCCCTTGTGAATGCGTGATGCAAG) were used to amplify genomic DNA fragment 9, and the primers shown in SEQ ID NO: 34 (TTTTCTCAAACAGTTCCTTCAATGCAAC) and 35 (AGAGTCGACCTGCAGGAAGCAGGCGAGTCGGAGCATATAC) were used to amplify genomic DNA fragment 10. Furthermore, a vector DNA fragment was amplified using pHSG298 (Takara Bio) as a template with the primers SEQ ID NO: 9 (GCATGCAAGCTTGGCACTGGCCGTC) and 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). Each DNA fragment was purified from the four PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio) and then ligated using the In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene), and the cell suspension was plated on LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio) as the enzyme. Introduction of the target DNA fragment was confirmed using the primers SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG). The transformant carrying the plasmid in which the introduction of the gene was confirmed was inoculated into 2 mL of LB liquid medium containing kanamycin and cultured at 37°C overnight.The plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), and the gene shown in SEQ ID NO: 36 (hereinafter also referred to as ura3 gene) was inserted between 1 kbp upstream and 1 kbp downstream of the gene shown in SEQ ID NO: 36. 37 A plasmid pbJK6 was obtained, which contains a DNA fragment into which a genomic DNA sequence containing the gene shown in TABLE 1 was inserted.

[0124] (2) Preparation of the introduced DNA fragment A DNA fragment was amplified using the plasmid pbJK6 as a template and the primers of SEQ ID NO: 38 (AACAAGGCCGAGTATGTCGAC) and SEQ ID NO: 39 (GAAGCAGGCGAGTCGGAGCATATAC). The resulting PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The resulting DNA fragment was sequenced and confirmed to be a DNA fragment in which a genomic DNA sequence containing the gene shown in SEQ ID NO: 37 (a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein) was inserted between 1 kbp upstream and 1 kbp downstream of the gene shown in SEQ ID NO: 36.

[0125] (3) Insertion of DNA fragment into T1 strain The DNA fragment obtained in (2) was used to transform the Starmerella bombicola T1 strain (adenine auxotroph) described in Example 1 of PCT / JP2024 / 037995 by electroporation (Nepa Gene). The transformed cell suspension was plated on minimal agar medium and allowed to stand at 30°C for 5 days. The resulting colonies were plated again on minimal agar medium and cultured at 30°C, yielding multiple single colonies. The T1 strain used as the host is adenine auxotrophic and therefore cannot grow on the minimal agar medium used for selection. Therefore, the resulting colonies are presumed to be strains in which adenine auxotrophy has been relieved by the introduction of the gene shown in SEQ ID NO: 37.

[0126] (4) Confirmation of DNA fragment-transfected strains Using the colonies obtained in (3) as templates, PCR was performed using the primers SEQ ID NO: 40 (CATGCGATATCATGATACCATACTC) and SEQ ID NO: 41 (GAGTGTCAGATTAGCCTCCGACATAG), and the amplified fragments were sequenced (analysis of fragment length by electrophoresis). The transformation described in (3) was performed three times, obtaining eight single colonies from each. A total of 24 colonies were identified. As designed, both a band representing the gene SEQ ID NO: 37 knocked into the ura3 gene region SEQ ID NO: 36 and a native band representing an intact ura3 region were simultaneously observed in each colony (Figure 3). Furthermore, growth tests on medium containing 5-FOA showed no growth in any of the colonies. These results highlight the challenges of using the gene SEQ ID NO: 36 (ura3) as a genetic recombination marker.

Claims

1. A uracil-requiring Starmerella bombicola mutant strain in which the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated, the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

2. Starmerella bombicola mutant.

2. A uracil-requiring Starmerella bombicola mutant strain in which the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated, a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto is deleted or inactivated, the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO:

1. Starmerella bombicola mutant.

3. A method for producing a uracil-requiring Starmerella bombicola mutant, comprising suppressing or inactivating the expression of an orotate phosphoribosyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola, the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the orotate phosphoribosyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

2. Method for producing Starmerella bombicola mutant strains.

4. A method for producing a Starmerella bombicola transformant, comprising using a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto as a selection marker for uracil requirement, the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence set forth in SEQ ID NO: 1; A method for producing a Starmerella bombicola transformant, comprising the following steps (A) and (B): (A) introducing into the mutant strain according to claim 1 or 2 a gene encoding a target polynucleotide and the selection marker orotate phosphoribosyltransferase-like protein or a gene corresponding thereto; (B) Selecting cells that are not uracil-requiring as transformants.

5. A method for producing a Starmerella bombicola transformant, comprising using a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto as a selection marker for uracil requirement, the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence set forth in SEQ ID NO: 1; A method for producing a Starmerella bombicola transformant, comprising the following steps (G) and (H): (G) introducing a gene encoding an orotate phosphoribosyltransferase-like protein, which is the selection marker, or a gene corresponding thereto into the genome of the mutant strain according to claim 1 or 2 so that the endogenous polynucleotide of interest in the genome of the mutant strain is deleted or inactivated; (H) Selecting cells that are not auxotrophic for uracil as transformants.

6. A method for producing a Starmerella bombicola transformant, comprising using a gene encoding an orotate phosphoribosyltransferase-like protein or a gene equivalent thereto as a selection marker for uracil requirement, the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence set forth in SEQ ID NO: 1; A method for producing a Starmerella bombicola transformant, comprising the following steps (K) and (L): (K) introducing a target polynucleotide into the genome of a uracil-non-requiring Starmerella bombicola strain so that the gene encoding the orotate phosphoribosyltransferase-like protein, which is the selection marker, or a gene corresponding thereto is deleted or inactivated in the genome of the uracil-non-requiring Starmerella bombicola strain; (L) Selecting 5-fluoroorotic acid (5-FOA) resistant cells as transformants.

7. A transformant obtained by the method of claim 4 (excluding the case where the gene encoding the orotate phosphoribosyltransferase-like protein, which is the selection marker, or a gene corresponding thereto is inserted into the original position of the genome).

8. A transformant obtained by the method of claim 5 (with the exception of the case where the endogenous polynucleotide of interest is a gene encoding an orotate phosphoribosyltransferase-like protein, which is the selection marker, or a gene corresponding thereto).

9. The transformant described in claim 8, in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 25 is suppressed or inactivated.

10. A method for producing glycolipids, comprising culturing the mutant strain according to claim 1 or 2.

11. A method for producing glycolipids, comprising culturing the transformant according to claim 7.

12. A method for producing glycolipids, comprising culturing the transformant according to claim 8.

13. The method according to claim 10, wherein the glycolipid is selected from the group consisting of sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids and cellobioselipids.

14. The method according to claim 11, wherein the glycolipid is selected from the group consisting of sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids and cellobiose lipids.

15. The method according to claim 12, wherein the glycolipid is selected from the group consisting of sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids and cellobioselipids.

16. Use of a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto as a selection marker for uracil requirement, the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO:

1. use.

17. A vector or DNA fragment containing a gene encoding an orotate phosphoribosyltransferase-like protein or a gene corresponding thereto, the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1, and encoding a protein having the function of making uracil-requiring Starmerella bombicola non-requiring to uracil. Vector or DNA fragment.

Images