Receptor tyrosine kinase agonist, cell culture medium composition, and composition for maintaining undifferentiated state

Abstract

The present invention provides a receptor tyrosine kinase agonist, which is a single-domain antibody having cell growth activity and is at least one selected from the group consisting of human fibroblast growth factor receptor 1 (FGFR1), human fibroblast growth factor receptor 2 (FGFR2), human fibroblast growth factor receptor 3 (FGFR3), and human fibroblast growth factor receptor 4 (FGFR4).

Description

[Technical Field]

[0001] The present invention relates to a receptor tyrosine kinase agonist, a cell culture medium composition, and a composition for maintaining an undifferentiated state. This application claims priority based on Japanese Patent Application No. 2021-102762, filed on June 21, 2021, the contents of which are incorporated herein by reference. [Background technology]

[0002] Many extracellular signaling proteins utilize receptor tyrosine kinases (hereinafter also referred to as "RTKs"). It has been reported that there are approximately 60 types of human RTKs, each with an extracellular domain, a transmembrane domain, and an intracellular domain, and that they are classified into approximately 20 subfamilies based on their structure (Non-Patent Document 1). Signaling protein families that act via RTKs include epidermal growth factor (EGF), which acts to promote responses such as survival, growth, proliferation, and differentiation of various cells; insulin-like growth factor (IGF1), which acts to promote the survival and proliferation of various cells; and fibroblast growth factor (hereinafter also referred to as "FGF"), which acts to promote the proliferation of various cells, inhibit the differentiation of some progenitor cells, and act as developmental induction signals. These receptor families include the EGF receptor, IGF1 receptor, and fibroblast growth factor receptor (FGFR, hereinafter also referred to as "FGFR").

[0003] The FGF family consists of 23 members, of which FGF1 to FGF10 bind to FGFR, and the oldest known are FGF1 (also called acidic FGF or aFGF) and FGF2 (also called basic FGF or bFGF). FGF2 is a protein with a molecular weight of 18,000 and consisting of 154 amino acids.

[0004] Furthermore, as mentioned above, FGF is known to be involved in angiogenesis, wound healing, embryonic development, etc., and to play an important role in processes such as cell proliferation and differentiation. Due to these diverse functions, attempts are being made to utilize FGF in the fields of regenerative medicine and medical care.

[0005] It has been reported that long-term proliferation of undifferentiated human embryonic stem cells (hESCs) requires mouse embryonic fibroblast-derived conditioned medium (MEFCM, hereinafter sometimes referred to as "conditioned medium") and matrix components. hESCs express growth factor receptors (including bFGF, stem cell factor (SCF), and fetal liver tyrosine kinase-3 ligand (Flt3L)), and when cultured in a culture medium containing bFGF alone or in combination with other factors, they exhibit similar characteristics to control MEFCM cultures in terms of morphology, physiological activity, differentiation, etc. (see Non-Patent Document 1, hereinafter referred to as "Prior Art 1").

[0006] It has also been reported that hESCs are often cultured in the presence of FGF2, on a fibroblast feeder layer, or in fibroblast-conditioned medium, and that ES cells can be cultured without conditioned medium if the FGF2 concentration is high. Furthermore, it has been reported that non-conditioned medium supplemented with 4 ng to 250 ng / mL of FGF2 can increase the number of passages of ES cells at low density, but under stringent conditions, medium supplemented with 4 to 40 ng / mL of FGF2 results in a passage number of 3 or less, while medium supplemented with 100 ng / mL of FGF2 has an effect comparable to that of conditioned medium (see Non-Patent Document 2, hereinafter referred to as "Prior Art 2"). It has also been reported that FGF2 decomposes more rapidly in non-conditioned medium than in conditioned medium.

[0007] On the other hand, it has been reported that instead of antibodies, VHH-type single domain antibodies (also called single domain antibodies) produced by pre-immunized llamas have been rapidly isolated, and that substances that specifically bind to human FGFR1 have been obtained. It has also been reported that a large-scale library has been obtained (see Non-Patent Document 3, hereinafter referred to as "Prior Art 3"). [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Xu,Chunhui et al., Basic Fibroblast Growth Factor Supports Undifferentiated Human Embryonic Stem Cell Growth Without Conditioned Medium, 2005, Stem Cells, vol. 23, No. 3, p.315-323 [Non-patent document 2] Levenstein, Mark E. et al., Basic Fibroblast Growth Factor Support of Human Embryonic Stem Cell Self-Renewal, 2006, Stem Cells, vol. 24, p.568-574 [Non-patent document 3] Monegal, Ana et. al., ImMunological applications of single-domain llama recombinant antibodies isolated from a naive library, Protein Engineering, Design & Selection, 2009, vol. 22, No. 4, p.273-280 Summary of the Invention [Problem to be solved by the invention]

[0009] Prior Art 1 is an excellent invention in that it discovered that hESCs can be cultured using a non-conditioned medium without a conditioned medium, in a medium containing only a sufficiently high concentration of bFGF or in a culture medium containing a combination of bFGF and other factors. This is because there is no need to culture fibroblasts. However, there was a problem in that the autocrine and paracrine factors produced by hESCs were not suitable for long-term proliferation of hESCs.

[0010] Prior art 2 is also an excellent invention in that it discovered that hESCs can be cultured in a non-conditioned medium if FGF2 is added, that the amount of FGF2 added increases when the culture conditions are stringent, and that the decomposition rate of FGF2 is faster in a non-conditioned medium than in a conditioned medium. However, because FGF2 has a short half-life in the medium, the effective concentration of FGF2 in the culture medium cannot be maintained by simply adding FGF2. In other words, when using a non-conditioned medium without a conditioned medium, fresh FGF2 must be added to the non-conditioned medium almost daily to maintain the FGF2 concentration in the culture.

[0011] Here, adding FGF2 to the culture medium on a daily basis requires the continuous production of purified FGF2 in a state that can be added. Furthermore, producing and purifying proteins such as FGF2 requires extremely complicated procedures and time. This poses a major concern in terms of production costs when culturing large-scale stem cells, such as those mentioned above, to use as therapeutic agents. Furthermore, adding FGF2 on a daily basis during culture increases the risk of contamination. For this reason, there has been a strong social demand for a peptide that can be obtained without the need for complicated production and purification procedures and that has activity equivalent to that of FGF2.

[0012] Prior Art 3 is an excellent invention in that it allows for the production of VHHs with antibody-like functions through a procedure simpler than conventional antibody purification. However, Prior Art 3 uses a phage display method, ultimately infecting TG1 cells (an E. coli strain used for phage display) to express VHHs and then screening. This means that even if phage particles are formed, constructs containing DNA sequences that specify peptides that cannot be expressed by TG1 will not be expressed. In other words, because the peptides that E. coli can express are limited, there is a problem in that it is not possible to screen for such peptides from libraries. For this reason, there has been a strong social demand for cell-free production of peptides obtained from libraries. [Means for solving the problem]

[0013] The present invention has been completed in order to solve the above-mentioned problems. That is, one aspect of the present invention is a receptor tyrosine kinase agonist, which consists of a single domain antibody having cell proliferation activity and is an agonist of at least one receptor tyrosine kinase selected from the group consisting of human fibroblast growth factor receptor 1 (FGFR1), human fibroblast growth factor receptor 2 (FGFR2), human fibroblast growth factor receptor (FGFR3), and human fibroblast growth factor receptor 4 (FGFR4). Here, the EC 50 Preferably, the value is 10 μg / mL or less. Furthermore, the receptor tyrosine kinase agonist is preferably a dimer in which the single domain antibodies having the same amino acid sequence are linked by a linker.

[0014] The linker is preferably an oligopeptide linker or a chemical linker. The denaturation temperature (Td) is preferably 65°C or higher, more preferably 70°C or higher. The equilibrium dissociation constant (KD) is 5x10 -9 It is preferable that the value is M or less. The amino acid sequence of the complementarity determining region (CDR) of the single domain antibody preferably comprises the amino acid sequence shown in SEQ ID NO:29 or the amino acid sequence shown in SEQ ID NO:30.

[0015] The receptor tyrosine kinase agonist is preferably one in which the amino acid sequence of the single domain antibody is characterized by any one of the following (1) to (5): (1) The 37th amino acid (Kabat numbering) is any amino acid selected from the group consisting of tyrosine (Y), phenylalanine (F), and valine (V). (2) The 41st amino acid is proline (P). (3) The 44th amino acid is any amino acid selected from the group consisting of glutamine (Q), glycine (G), glutamic acid (E), and lysine (K). (4) The 45th amino acid is arginine (R) or leucine (L). (5) The 47th amino acid is any amino acid selected from the group consisting of leucine (L), alanine (A), tryptophan (W), glycine (G), and phenylalanine (F).

[0016] The receptor tyrosine kinase agonist is preferably derived from a gene encoding a heavy chain antibody of a camelid or a cartilaginous fish, and the camelid is preferably an alpaca.

[0017] Another aspect of the present invention is a cell culture medium composition comprising a single domain antibody having cell proliferation activity and containing 0.1 ng / mL to 10 μg / mL of a receptor tyrosine kinase agonist, which is an agonist of at least one receptor tyrosine kinase selected from the group consisting of human fibroblast growth factor receptor 1 (FGFR1), human fibroblast growth factor receptor 2 (FGFR2), human fibroblast growth factor receptor 3 (FGFR3), and human fibroblast growth factor receptor 4 (FGFR4). Here, it is preferable that the cells proliferated by the cell proliferation activity are at least one type selected from the group consisting of fibroblasts, mesenchymal stem cells, and iPS cells.

[0018] Another aspect of the present invention is a method for maintaining the undifferentiated state of stem cells, comprising the step of culturing stem cells at about 36°C to about 38°C in a cell culture medium composition containing 0.1 ng / mL to 10 μg / mL of an agonist of at least one receptor tyrosine kinase selected from the group consisting of human fibroblast growth factor receptor 1 (FGFR1), human fibroblast growth factor receptor 2 (FGFR2), human fibroblast growth factor receptor 3 (FGFR3), and human fibroblast growth factor receptor 4 (FGFR4), which is a single domain antibody having cell proliferation activity. Here, this method is characterized in that the stem cells are mesenchymal stem cells or iPS cells.

[0019] Yet another aspect of the present invention is use of a medium composition for cell culture, the medium composition comprising a single domain antibody having cell proliferation activity and containing 0.1 ng / mL to 10 μg / mL of a receptor tyrosine kinase agonist, the receptor tyrosine kinase agonist being an agonist of at least one receptor tyrosine kinase selected from the group consisting of human fibroblast growth factor receptor 1 (FGFR1), human fibroblast growth factor receptor 2 (FGFR2), human fibroblast growth factor receptor 3 (FGFR3), and human fibroblast growth factor receptor 4 (FGFR4). Here, it is preferable that the cells proliferated by the cell proliferation activity are at least one type selected from the group consisting of fibroblasts, mesenchymal stem cells, and iPS cells. [Effects of the Invention]

[0020] According to the present invention, a receptor tyrosine kinase agonist having excellent stability can be provided. Furthermore, according to the present invention, a medium composition containing the receptor tyrosine kinase agonist can be provided. Furthermore, according to the present invention, a method for maintaining the undifferentiated state of stem cells can be provided, the method comprising the step of culturing stem cells in the cell culture medium composition. [Brief explanation of the drawings]

[0021] [Figure 1] FIG. 1 shows a scheme for screening hit compounds by the cDNA display method. [Figure 2] FIG. 2 shows the elution method for each screening round. [Figure 3] FIG. 3 shows the phage display scheme, which is divided into the scheme after panning of the initial library (phage library), when the scheme is performed using an ELISA plate and when the scheme is performed using an immunotube. [Figure 4] FIG. 4 shows CDR regions 1 to 3 of VHH clone #1 and VHH clone #2. [Figure 5] FIG. 5 is an electrophoretic image showing the results of SDS-PAGE performed after purification of VHH. [Figure 6] FIG. 6 is a graph showing the results of measuring the affinity of VHH clone #1 for the target molecule FGFR1. [Figure 7] 7 is a graph showing the results of measuring the affinity of VHH clone #2 for the target molecule FGFR1. The vertical axis represents response, and the horizontal axis represents time (seconds). [Figure 8A] 8A is a graph showing the results of measuring the affinity of VHH clone #1 for the target molecule FGFR2. The vertical and horizontal axes are the same as those in FIG. [Figure 8B] 8B is a graph showing the results of measuring the affinity of VHH clone #1 for the target molecule FGFR3. The vertical and horizontal axes are the same as those in FIG. [Figure 8C] 8C is a graph showing the results of measuring the affinity of VHH clone #1 for the target molecule FGFR4. The vertical and horizontal axes are the same as those in FIG. [Figure 9] 9 is a graph showing the expression level of phospho-p44 / 42 MAPK (Erk1 / 2) upon stimulation with FGF2 or VHH (monomer). The vertical axis shows the relative expression level, where the expression level without stimulation is set to 1. [Figure 10] FIG. 10 is an electrophoretic image showing the results of SDS-PAGE of VHH (homodimer). [Figure 11] 11 is a graph showing the expression level of phospho-p44 / 42 MAPK (Erk1 / 2) upon stimulation with FGF2 or VHH (homodimer). The vertical axis shows the relative expression level, where the expression level without stimulation is set to 1. [Figure 12] FIG. 12 is a graph showing the results of measuring EC50 for the VHH monomer of Clone #2 (indicated as "Clone #2 (mono)" in the figure). [Figure 13A] Figure 13A is a graph showing the EC50 measurement results for the VHH homodimers of Clone #1 (indicated as "#1 5aa" and "#1 L3" in the figure). The vertical axis represents relative luminescence unit (RLU), and the horizontal axis represents peptide concentration. [Figure 13B] Figure 13B is a graph showing the EC50 measurement results for VHH homodimers of Clone #2 (indicated as "#1 5aa" and "#1 L3" in the figure). The vertical axis represents relative luminescence unit (RLU), and the horizontal axis represents peptide concentration. [Figure 14] Figure 14 is a graph showing the results of an experiment in which FGFR antagonists inhibited the growth factor activity of VHH homodimers (when the FGFR inhibitor BGJ398 was not added (indicated as "(-)" in the figure) and when it was added at 20 nm). The vertical axis shows relative luminescence intensity (RLU), and the horizontal axis shows the type and concentration of peptide added. [Figure 15]15 is a graph showing the results of a cell proliferation assay of VHH monomers. The vertical axis shows the relative luminescence intensity when nothing was added (indicated by (-) in the figure) or when Clone #1, Clone #2, or FGF2 was added at the indicated concentrations. [Figure 16] 16 is a graph showing the results of measuring the thermal stability of VHH by protein thermal shift assay (evaluation of the heat resistance of clone #1), where the vertical axis represents fluorescence intensity. [Figure 17] 17 is a graph showing the results of measuring the thermal stability of VHH by protein thermal shift assay (evaluation of the heat resistance of clone #1L4), where the vertical axis represents fluorescence intensity. [Figure 18] Figure 18 shows an alignment of VHH clone #1 (FGFR#1), VHH clone #2 (FGFR#2), humanized VHH, human VH reference, universal VHH, CAMDR, LAMGL, and VICPA. [Figure 19] FIG. 19 shows a gel electrophoresis image of purified VHH clones (coiled-coil bodies, hereinafter sometimes referred to as "VHH-C") expressed in Corynebacterium. [Figure 20] FIG. 20 shows a gel electrophoresis image of purified VHH (Fc form, hereinafter sometimes referred to as "VHH-Fc") expressed using AAVpro293T cells. [Figure 21] FIG. 21 shows a gel electrophoresis image of the FGFR1 extracellular domain (hereinafter sometimes abbreviated as "FGFR1-DIIDIII," "FGFR1-DII," or "FGFR1-DIII") expressed using AAVpro293T cells. [Figure 22] Figure 22 shows sensorgrams showing the results of measuring the binding activity of the FGFR1 extracellular domain to VHH clone #1 by biolayer interferometry. Figure 22(A) shows the binding activity measurement results for FGFR1-DIIDIII, Figure 22(B) shows the binding activity measurement results for FGFR1-DII, and Figure 22(C) shows the binding activity measurement results for FGFR1-DIII. [Figure 23]Figure 23 is a gel electrophoresis image showing the results of examining the agonist activity of VHH-C (indicated as "#1-C" in the figure) and VHH-Fc (indicated as "#1-Fc" in the figure) using NIH3T3 cells. [Figure 24] 24 is a graph showing the results of examining the cell proliferation activity of VHH-C and VHH-Fc on NIH3T3 cells. The horizontal axis shows the concentration of added peptide, and the vertical axis shows the relative luminescence intensity. [Figure 25] FIG. 25 is a graph comparing the proliferation of cultured iPS cells when bFGF or VHH homodimer #1-L4-#1 was used. [Figure 26] FIG. 26 shows optical microscope photographs taken on day 5, at passage 3, of iPS cell culture using bFGF or VHH homodimer #1-L4-#1. [Figure 27] Figure 27 shows photographs visualizing the expression of undifferentiated markers OCT4 and SSEA4 by immunostaining in iPS cells (passage 2, day 6 (20th day of culture)) cultured using bFGF or homodimeric VHH. [Figure 28] FIG. 28 shows optical micrographs showing the morphology of MSCs (4 passages, day 1) when cultured in a medium containing 10% or 20% FBS with the addition of bFGF or homodimeric VHH. [Figure 29] FIG. 29 is a graph comparing the proliferation of cultured MSCs when basic FGF or VHH homodimer #1-L4-#1 was added to a medium containing 10% or 20% FBS. [Figure 30] Figure 30 is a graph comparing the expression of MSC markers, measured by flow cytometry, of MSCs (passage 4) cultured in 10% FBS-containing medium supplemented with bFGF or VHH homodimer #1-L4-#1. [Figure 31] Figure 31 is a graph comparing the expression of MSC markers, as measured by flow cytometry, of MSCs (passage 4) cultured in a 20% FBS-containing medium supplemented with bFGF or VHH homodimer #1-L4-#1. [Figure 32]FIG. 32 shows optical microscope photographs of MSCs (cultured for 3 passages) after 14 days of culture in a proliferation medium or a medium for inducing adipocyte differentiation. [Figure 33] Figure 33 is a graph showing the quantitative evaluation of the absorbance of Oil Red O stained from MSCs induced to differentiate into adipocytes, which were then extracted with isopropyl alcohol. bFGF, VHH, and FBS shown below the graph indicate the MSC culture medium conditions. [Figure 34] FIG. 34 shows optical micrographs of MSCs (cultured for 3 passages) after 14 days of culture in proliferation medium or osteogenic differentiation medium. [Figure 35] Figure 35 shows a graph of the quantitative evaluation of the absorbance of alizarin red extracted from osteogenic MSCs using a calcified nodule lysis solution after staining with alizarin red. bFGF, VHH, and FBS shown below the graph indicate the MSC culture medium conditions. [Figure 36] FIG. 36 is a graph showing the EC50 of the proliferation of cultured fibroblasts when bFGF or VHH homodimer #1-L4-#1 was added to the culture medium. [Figure 37] 37 is a graph showing the results of an investigation into the inhibition of the growth factor activity of bFGF and VHH homodimer #1-L4-#1 by an FGFR kinase inhibitor using fibroblasts. The vertical axis represents relative luminescence intensity compared to background. [Figure 38] Figure 38 is a graph showing the cell proliferation activity of VHH homodimer #1-L4-#1 after incubation in D-PBS at 37°C for one week or bFGF immediately after dissolving the lyophilized product in D-PBS on fibroblasts. DETAILED DESCRIPTION OF THE INVENTION

[0022] One aspect of the present invention is a novel receptor tyrosine kinase agonist, which is (s1) at least one selected from the group consisting of human fibroblast growth factor receptor 1 (FGFR1), human fibroblast growth factor receptor 2 (FGFR2), human fibroblast growth factor receptor 3 (FGFR3) and human fibroblast growth factor receptor 4 (FGFR4), (s2) consists of at least one single domain antibody, and (s3) has cell proliferation activity.

[0023] Here, receptor tyrosine kinases (RTKs) are high-affinity cell surface receptors for many polypeptide growth factors, cytokines, and hormones. 90 tyrosine kinase genes have been identified in the human genome, of which 58 encode receptor tyrosine kinases. Receptor tyrosine kinases are not only important regulators of normal cell function, but have also been shown to play important roles in the development and progression of many types of cancer.

[0024] The receptor tyrosine kinases, along with protein kinases such as tyrosine kinase-associated receptors, receptor-like tyrosine phosphatases, receptor serine / threonine kinases, receptor guanylate cyclases, and histidine kinase-associated receptors, are known as enzyme-linked receptors. Here, the term "enzyme-linked receptor" refers to a receptor that directly activates the enzyme itself or a related enzyme. Enzyme-linked receptors usually have a single-pass transmembrane structure, and the enzyme portion of the receptor is retained intracellularly.

[0025] Fibroblast growth factors (hereinafter sometimes referred to as "FGFs") are a family of 23 members known to be proteins involved in angiogenesis, wound healing, embryonic development, etc. Members of this family bind to heparin and transmit signals through four receptor tyrosine kinases, FGFR1, FGFR2, FGFR3, and FGFR4. FGF receptors (hereinafter sometimes referred to as "FGFR"), which are receptors for FGF, are a family consisting of four members, FGFR1 to FGFR4, which share a common structure. Specifically, all of FGFR1 to FGFR4 have three immunoglobulin loops (I, II, and III) in the extracellular domain and a tyrosine kinase inside the cell.

[0026] The binding partner of the receptor tyrosine kinase agonist of the present invention is any one of the four FGFRs listed above, preferably FGFR1 or FGFR2, and more preferably FGFR2. FGF1, which binds to FGFR1, is also known as FGF-acidic or aFGF. It is a non-glycosylated heparin-binding growth factor expressed in the brain, kidney, retina, smooth muscle cells, bone matrix, osteoblasts, astrocytes, and endothelial cells, and is involved in the proliferation, differentiation, and survival of various tissues and cells. FGF2, which binds to FGFR2, is also known as bFGF or FGF-basic 154, and is an important component for maintaining the undifferentiated state of ES cells in cell culture systems. Here, an "agonist" is a substance that acts on receptor molecules in the body and exhibits the same functions as neurotransmitters or hormones, but is not a substance that actually acts in the body.

[0027] As used herein, the term "antibody" is used in the broadest sense and is not particularly limited as long as it has the desired antigen-binding activity. Specifically, it encompasses both naturally occurring immunoglobulins (Ig) and substances containing artificially synthesized structures as a part of them (hereinafter sometimes referred to as "artificial antibodies"). It also encompasses not only whole immunoglobulins but also fragments thereof as long as they exhibit the desired antigen-binding activity. Bispecific antibodies and other multispecific antibodies are also included in artificial antibodies. The antibody may be produced as a monoclonal antibody or a polyclonal antibody.

[0028] A typical antibody molecule (IgG: immunoglobulin molecule) derived from a human, mouse, or other source is a glycoprotein composed of multiple units, each of which contains four polypeptide chains. These four polypeptide chains consist of two identical heavy chains (hereinafter sometimes referred to as "H chains") and two identical light chains (hereinafter sometimes referred to as "L chains"). The H chain and the L chain are linked by one disulfide bridge to form one unit (heterodimer), and two heterodimers are linked by two disulfide bridges to form a "Y"-shaped IgG.

[0029] The amino-terminus of the polypeptide chain constituting the IgG exhibits significant variation in amino acid sequence, and is therefore called the variable region (hereinafter sometimes referred to as the "V region"), in distinction from the constant region (hereinafter sometimes referred to as the "C region"), which exhibits relatively little variation in amino acid sequence. Each L chain is composed of one variable domain (VL) and one constant domain (CL). The H chain is composed of one variable domain (VH) and three constant domains (CH1, CH2, and CH3). While each L chain has a molecular weight of approximately 25,000, each H chain has approximately twice the number of amino acids, resulting in a molecular weight of approximately 50,000. As a result, the total molecular weight of the immunoglobulin molecule monomer is approximately 150,000.

[0030] The heavy and light chains are held together by a combination of non-covalent interactions and covalent disulfide bridges between the chains, forming a symmetrical structure. The heavy and light chain V regions are sometimes referred to as VH and VL. Each V region contains the antigen-binding site of the immunoglobulin molecule; therefore, an Ig monomer contains two antigen-binding sites and is said to be bivalent. The heavy chain region between the first and second C region domains is called the hinge region, which is held together by disulfide bridges. This hinge region is flexible and can change the distance between the two antigen-binding sites. The hinge region is found in IgG, IgA, and IgD, but not in IgM and IgE.

[0031] Furthermore, in terms of binding properties, the immunoglobulin molecule can be divided into two regions, Fab and Fc. Fab can be obtained by treating the immunoglobulin molecule with the protease papain. The region remaining after excluding Fab from the immunoglobulin molecule is the Fc. The term "Fc region" is used to define the C-terminal region of an immunoglobulin heavy chain, which contains at least a portion of the constant region. The term includes native-sequence Fc regions and variant Fc regions. As used herein, the Fc region of a human IgG heavy chain extends from Cys226 or Pro230 to the carboxyl terminus of the heavy chain. However, the C-terminal lysine (Lys447) of the Fc region may not be present.

[0032] In contrast to the general immunoglobulin molecules mentioned above, antibodies found in camelids and cartilaginous fish lacking light chains and consisting only of heavy chains are called "heavy chain antibodies" or "single-heavy chain antibodies." Here, a single heavy chain refers to a heavy chain alone, not a double chain consisting of a heavy chain and a light chain as in the above-mentioned immunoglobulins. Even if two heavy chains form a dimer via a disulfide bond, the single chain is not a double chain but a single chain. Furthermore, heavy chain antibody monomer variable region antibodies obtained from animals of the Camelidae family are called "single domain antibodies (sdAb)" or "variable domain of a heavy chain" (hereinafter sometimes referred to as "VHH"). These are a type of antibody fragment consisting of a single variable molecule variable domain and lacking the L chain and CH domain of the H chain of the Fab region of conventional antibody molecules. However, they correspond to the antigen-binding domain composed of the H chain and L chain in a conventional antibody. VHHs exhibit the same selectivity and specificity for antigens as conventional antibodies, but because of their low molecular weight, they are highly resistant to high heat, detergents, high concentrations of urea, etc.

[0033] As used herein, VHH refers to the smallest unit (domain) of an antibody structure that has one immunoglobulin fold structure and two or three complementarity-determining regions (hereinafter sometimes referred to as "CDRs") within that structure. The immunoglobulin fold has a sandwich-like structure (a β-barrel structure) in which two β-sheets are sandwiched together, with one β-sheet consisting of three to five antiparallel β-strands and the other β-sheet consisting of four antiparallel β-strands. Each β-strand is arranged so that it alternates between the two sheets.

[0034] Human and mouse VH regions and camel VHHs have three CDRs, whereas shark-derived VNARs (Variable Domain of New Antigen Receptors) have two CDRs (Wang, Yongzhong et al., Nanobody-derived Nanobiotechnology tool kits for diverse biomedical and biotechnology applications, International Journal of Nanomedicine, 2016, Vol. 11, 3287-3303). The method for creating single domain antibodies in the present invention is described below.

[0035] As used herein, the term "cell proliferation activity" refers to the activity of the agonist of the present invention to determine whether or not it can cause specific cells to proliferate. The EC50 concentration of the agonist at which the number of cells reaches 50% of the 100% cell proliferation level is defined as the standard. 50 and EC 50 A lower EC value indicates a higher proliferation activity. 50 The lower limit of the EC value of the agonist is, but is not particularly limited to, 0.1 μg / mL or more. 50A value of 10 μg / mL or less is preferred for reasons such as reducing culture costs and inhibiting aggregation formation, and is more preferably 8 μg / mL or less, and even more preferably 5 μg / mL or less.

[0036] Furthermore, the term "agonist" refers to a substance that acts on receptor molecules in the body and exhibits a function similar to that of neurotransmitters, hormones, etc., but is not a substance that actually acts in the body. The single domain antibody and dimer thereof of this embodiment preferably have agonistic activity against receptor tyrosine kinases, for reasons such as promoting dimerization of receptor tyrosine kinases.

[0037] The single-domain antibodies and dimers thereof of the present invention preferably induce multimerization of receptor tyrosine kinases on the cell surface. This is because receptor tyrosine kinases efficiently transmit signals by forming dimers as described below. Receptor tyrosine kinases are single-pass transmembrane glycoproteins consisting of three domain structures: an extracellular domain that binds to a ligand, a transmembrane domain, and an intracellular domain with kinase activity. Receptor tyrosine kinases generally form dimers upon binding to a ligand. This brings the kinase domains into physical proximity, resulting in mutual phosphorylation of tyrosine residues within the kinase domains, resulting in activation. An effector molecule then binds to the activated kinase domain, and the effector molecule is activated by phosphorylation of its tyrosine residues. In this way, various proteins within the cell are activated one after another.

[0038] In this embodiment, the single-domain antibody and its dimer preferably have one or more VHH domains, and more preferably have two VHH domains, because the more VHH domains that are heavy chain variable regions there are, the more improved affinity with the antigen can be expected.

[0039] When the single-domain antibody and dimer thereof of this embodiment have two VHH domains, they are preferably linked by a linker, such as an oligopeptide linker or a multimerizing peptide linker. Here, the oligopeptide linker is a linker made of an oligopeptide, and is usually composed of 2 to 20 amino acid residues.

[0040] The multimerization peptide linker may be any linker that is mediated by a peptide bond, such as GSGGG, (GSGGG)2, (GSGGG)4, GSAGSAAGSGEF, and GSEGKSSGSGSESKST. Another example of a method that utilizes the self-assembly properties of peptides is a method that utilizes a peptide chain having a coiled-coil structure rich in hydrophobic amino acids. Specifically, peptides can be dimerized using the Luecine Zipper sequence (Vinson, Charles et al., Molecular and Cellular Biology, 2002, Vol. 22, No. 18, pp. 6321-6335). Examples of multimerization domain protein linkers include antibody Fc domains for dimerization.

[0041] One index for evaluating the performance of the receptor tyrosine kinase agonist of this embodiment is its structural stability. High structural stability leads to high practicality in terms of mass production using recombinant microorganisms, storage stability, stability during use, etc. Heat resistance is an index of protein structural stability, which can be expressed as a Td (denaturation midpoint: also called denaturation temperature) value or the like by a thermal shift assay, i.e., by examining the temperature dependence of structural change.

[0042] The denaturation temperature (Td) of the receptor tyrosine kinase agonist of this embodiment is not particularly limited, but is preferably 65°C or higher, more preferably 70°C or higher. The Td value can be measured, for example, by differential scanning calorimetry (DSC), the SYPRO Orange addition method (Huynh, Kathy, Partch, Carrie L., Analysis of protein stability and ligand interactions by thermal shift assay, Current Protocols in Protein Science, 2015, Vol. 79, pp. 28.9.1-28.9.14), etc. Either method allows monitoring of thermal changes that occur when the protein structure in a cell transitions or denatures when the temperature is increased (decreased) at a constant rate.

[0043] The above Td is evaluated as the Td value when the temperature is increased from 25 to 95°C (heating rate: 1°C / min) in a D-PBS solution (containing 0.2 g of KH2PO4, 1.15 g of Na2HPO4, 0.2 g of KCl, and 8 g of NaCl per 1 L of aqueous solution, pH 7.4) under solution conditions of a protein concentration (0.5 mg / mL).

[0044] The equilibrium dissociation constant (KD) of the receptor tyrosine kinase agonist of this embodiment is not particularly limited, but is preferably 5×10 -9 M or less is preferable, and 1×10 -9 M or less is preferable, 5 × 10 -10 M or less is more preferable. This is because a lower KD value indicates higher affinity. The lower limit of KD is not particularly limited, but for example, 1 × 10 -12 M or more. Here, KD is a value determined by an affinity measurement test using surface plasmon resonance (SPR). The detailed method for measuring KD is as described in the Examples below.

[0045] The amino acid sequence of the CDR (complementarity determining region) of the single domain antibody preferably comprises the amino acid sequence of SEQ ID NO: 29 or the amino acid sequence of SEQ ID NO: 30, more preferably comprises an amino acid sequence having 60% or more homology to the amino acid sequence of SEQ ID NO: 29 or the amino acid sequence of SEQ ID NO: 30, and even more preferably comprises an amino acid sequence having 70% or more homology to the amino acid sequence of SEQ ID NO: 29 or the amino acid sequence of SEQ ID NO: 30.

[0046] The homology (identity) of amino acid sequences is calculated based on an "alignment" in which two sequences are aligned to obtain the highest level of similarity. The homology of two aligned sequences is expressed as the percentage of amino acids that match or have similar physical properties. In other words, it is expressed as the ratio (%) of the "number of amino acids that match or have similar physical properties" in the other amino acid sequence (the reference sequence) to the "total number of amino acid residues" in one amino acid sequence. Amino acids have physical properties such as hydrophilicity, hydrophobicity, acidic, basic, and neutral. Preferred computer program methods for determining alignment and homology include, but are not limited to, the GCS program package (Devereux, John et al., A comprehensive set of sequence analysis programs for the VAX, Nucleic Acid Research, 1984, Vol. 12, No. 1, pp. 387-395), BLAST / FASTA (Altschul, Stephen F. et al., Basic local alignment search tool, Journal of Molecular Biology, 1990, Vol. 215, No. 3, pp. 403-410), and Clustal Omega (Sievers, Fabian, Higgins, Desmond G., Clustal Omega for making accurate alignments of many protein sequences, Protein Science, 2018, Vol. 27, No. 1, pp. 135-145).

[0047] The amino acid sequence of the framework (non-CDR region) of a single-domain antibody is thought to be important for its structural stability, solubility, and immunogenicity and stability in blood when used as a therapeutic agent. An alignment of VHH clone #1 (SEQ ID NO: 17), VHH clone #2 (SEQ ID NO: 18), humanized VHH (SEQ ID NOs: 31-34; excluding CDRs), human VH reference (SEQ ID NOs: 35-38; excluding CDRs), universal VHH (SEQ ID NOs: 39-42; excluding CDRs), CAMDR (accession number: A0A0F6YEF6; SEQ ID NOs: 43-46; excluding CDRs), LAMGL (accession number: R9VYW2; SEQ ID NOs: 47-50; excluding CDRs), and VICPA (accession number: A0A192B6J6; SEQ ID NOs: 51-54; excluding CDRs) was generated using the computer software GENETYX veR13 (Genetyx) (Figure 18).

[0048] The amino acid numbers in the alignment follow "Kabat numbering" (Dondelinger, Mathieu et al., Understanding the Significance and Implications of Antibody Numbering and Antigen-Binding Surface / Residue Definition, Frontiers in Immunology, 2018, Vol. 9, p. 2278) (hereinafter referred to simply as "Kabat No." or "Kabat number"). In addition, homology between clone #1 and the framework sequences (non-CDR regions) of each of the other single domain antibodies was calculated using homology analysis of GENETYX veR13.

[0049] Humanized VHH (Vincke, Cecile and 5 others, General Strategy to Humanize a Camelid Single-Domain Antibody and Identification of a Universal Humanized Nanobody Scaffold, Journal of Biological Chemistry, 2009, Vol. 284, No. 5, pp. 3273-3284; hereinafter referred to as "Vincke's reference") is a humanized VHH. Human VH reference (Chen, Weizao and 4 others, Construction of a Large Phage-Displayed Human Antibody Domain Library with a Scaffold Based on a Newly Identified Highly Soluble, Stable Heavy Chain Variable Domain, Journal of Molecular Biology, 2008, Vol. 382, ​​No. 3, pp. 779-789) is a representative example of a human VH.

[0050] Universal VHHs (Saerens, Dirk et al., Identification of a Universal VHH Framework to Graft Non-canonical Antigen-binding Loop-so-Fcamel Single-domain Antibodies, Journal of Molecular Biology, 2005, Vol. 352, No. 3, pp. 597-607) have a framework sequence that serves as an acceptor suitable for grafting CDR sequences from other antibodies. CAMDR, LAMGL, and VICPA are representative examples of VHHs from the Llama, Camel, and Vicuña genera, respectively.

[0051] Homology studies revealed that the homologies between VHH clone #1 and clone #2, humanized VHH, human VH reference, universal VHH, CAMDR, LAMGL, and VICPA were 78%, 72%, 72%, 77%, 78%, 75%, and 75%, respectively. Based on these findings, it can be concluded that single domain antibodies of the present invention preferably have framework sequences with a homology of 70% or more to the framework sequence of SEQ ID NO: 17.

[0052] A characteristic of the amino acid sequence of framework 2 (FR2) of human VH (hVH) antibodies (see Figure 18) is that four hydrophobic amino acids, 37V, 44G, 45L, and 47W, which are originally important for binding to the light chain variable region (VL), are highly conserved in hVH (the numbers are Kabat numbers). The amino acids corresponding to these four positions in hVH are 37F / Y (F / Y indicates F or Y; the same applies below), 44E, 45R / C, and 47F / G, respectively (Kishimoto, Satoshi, Ito, Yuji, "Application of antigen-binding domains (VHH) derived from camelid heavy chain antibodies to medical technology," Medchem News, 2017, Vol. 27, No. 1, pp. 35-41). Furthermore, referring to the alignment in Figure 18, clones #1 and #2 of the present invention also contain 44Q / K and 47L / A. As an example of humanizing a VHH antibody, substitution of amino acids at positions 44 and 45 of the VHH with G and L has been proposed (see Vincke et al., supra).

[0053] Another feature of single-domain antibody hVHs and VHHs is that in FR2, the proline at position 41 (FR2) and the cysteines at positions 22 (FR1) and 92 (FR3) are highly conserved, as shown in Figure 18. These cysteines, 22C and 92C, form disulfide bonds and are thought to be important for the stability of single-domain antibody structures (Ban, Bhupal et al., Optimization of Methods for the Production and Refolding of Biologically Active Disulfide Bond-Rich Antibody Fragments in Microbial Hosts, Antibodies, 2020, Vol. 9, p. 39).

[0054] On the other hand, there is also a method of substituting amino acids in FR2, etc. with amino acids used in VHH in order to improve the physical properties of hVH (Liu, Jianbin et al., Construction and characterization of a camelized, human, VH-based peptide vaccine against CD20 antigen, Immunotherapy, 2013, Vol. 5, No. 2, pp. 135-141; Soler, Miguel A. et al., Effect of humanizing mutations on the stability of the Llama single-domain variable region, Biomolecules, 2021, Vol. 11, p. 163). The single domain antibodies of the present invention also include amino acid substitutions made to modify the characteristics and functions of at least the framework amino acid sequences of the above-mentioned VHH and VH.

[0055] The amino acid sequence of the receptor tyrosine kinase agonist preferably comprises a framework sequence having 70% or more homology with the non-CDR amino acid sequence (framework sequence) of SEQ ID NO:17.

[0056] The amino acid sequence of the receptor tyrosine kinase agonist is preferably characterized by any one of the following (1) to (5): (1) The amino acid at position 37 (Kabat numbering) is any one amino acid selected from the group consisting of tyrosine (Y), phenylalanine (F), and valine (V). (2) The 41st amino acid is proline (P). (3) The 44th amino acid is any one amino acid selected from the group consisting of glutamine (Q), glycine (G), glutamic acid (E), and lysine (K). (4) The 45th amino acid is arginine (R) or leucine (L). (5) The 47th amino acid is any one amino acid selected from the group consisting of leucine (L), alanine (A), tryptophan (W), glycine (G), and phenylalanine (F).

[0057] The single domain antibody and polymer thereof of this embodiment are preferably derived from a gene encoding a natural heavy chain antibody. The gene encoding the natural heavy chain antibody is preferably derived from a camelid or a cartilaginous fish, more preferably a camelid. Examples of camelids include animals of the genus Camelus, including dromedaries and Bactrian camels, animals of the genus Vicuña, including vicuñas and alpacas, and animals of the genus Llama, including guanacos and llamas, with alpacas being preferred.

[0058] In another aspect of the present invention, in the cell culture medium composition and use of the medium composition for cell culture of the present embodiment, the medium composition contains the above-mentioned receptor tyrosine kinase agonist at a concentration of 0.1 ng / mL to 10 μg / mL. In the cell culture medium composition of this embodiment and the use of the medium composition for cell culture, the medium composition can contain, as components other than the above-mentioned receptor tyrosine kinase agonist and water, substantially the same components as those of medium compositions used for conventional cell culture.

[0059] Here, the cells proliferated by the cell proliferation activity of the receptor tyrosine kinase agonist are preferably at least one type selected from the group consisting of fibroblasts, mesenchymal stem cells, and iPS cells.

[0060] Mesenchymal stem cells (MSCs) are a type of stem cell found in the adult body and have the ability to differentiate into mesodermal tissues such as bone, cartilage, blood vessels, and cardiac muscle cells. Since the 1980s, they have also been called "mesenchymal stromal cells" (Mizukami, Amanda, Swiech, Kamilla, Stem Cells International, Volume 2018, Article ID 4083921, https: / / doi.org / 10.1155 / 2018 / 4083921). In recent years, it has been reported that they can also differentiate into ectoderm-derived neurons and glial cells (which function to support neurons) and endoderm-derived hepatocytes. In this technical field, "mesenchymal stem cells" are abbreviated as "MSCs."

[0061] Fibroblasts are one of the representative cells that make up connective tissue and are basophilic. Within tissue, they exist along the long axis of collagen fiber bundles and are flattened or spindle-shaped cells with numerous cytoplasmic processes. They have an oval nucleus, are rich in the Golgi apparatus and rough endoplasmic reticulum, and are particularly developed in areas where extracellular matrix synthesis is active (such as wound healing sites). Active cells are sometimes called fibroblasts, while dormant cells are called fibrocytes. Fibroblasts are relatively undifferentiated cells that differentiate from mesenchymal stem cells and are said to have the ability to differentiate into adipocytes, chondroblasts, and osteoblasts. Although they rarely divide in adults, they will divide as needed (such as during wound healing).

[0062] iPS cells are induced pluripotent stem cells. By introducing four types of genes into somatic cells, iPS cells have the pluripotency to differentiate into a large number of cells, like embryonic stem cells (ES cells), and the ability to self-replicate, maintaining these characteristics even after division and proliferation.

[0063] In yet another aspect of the present invention, the method for maintaining the undifferentiated state of stem cells of this embodiment comprises the step of culturing stem cells at about 36° C. to about 38° C. in a cell culture medium composition containing 0.1 ng / mL to 10 μg / mL of the above-mentioned receptor tyrosine kinase agonist. In this method, the above-mentioned cell culture medium composition is used.

[0064] Stem cells are unspecialized cells with the ability to self-renew and differentiate. Self-renewal refers to the ability of stem cells to remain undifferentiated (i.e., produce daughter cells identical to the parent cell) through multiple cell division cycles, while differentiation refers to the ability of stem cells to differentiate into specialized cell types present in the body, such as neurons, liver cells, or muscle cells. Stem cells are broadly divided into two types: adult stem cells and embryonic stem cells. Adult stem cells are considered to be in an undifferentiated state and exist among the differentiated cells of tissues. Their primary role is to maintain and repair the tissue in which they reside. Adult stem cells are multipotent, but their differentiation is limited to differentiating into the various cell types present in the tissue from which they originate. Embryonic stem cells (ESCs) are isolated from early preimplantation embryos. Unlike adult stem cells, ESCs can divide over longer periods in culture and have the potential to differentiate into any cell type present in the human body, hence the name pluripotent stem cells (PSCs). Another type of pluripotent stem cell is an induced pluripotent stem cell (iPSC), which can be generated by reprogramming somatic cells such as fibroblasts.

[0065] The method for maintaining the undifferentiated state of stem cells in this embodiment is substantially the same as conventional methods for maintaining the undifferentiated state of stem cells, except that a medium composition containing the above-mentioned receptor tyrosine kinase agonist is used.

[0066] In the method for maintaining the undifferentiated state of stem cells of this embodiment, the cells proliferated by the cell proliferation activity of the receptor tyrosine kinase agonist are preferably at least one type selected from the group consisting of fibroblasts, mesenchymal stem cells, and iPS cells, as described above.

[0067] The receptor tyrosine kinase agonists of the present invention can be prepared by the cDNA display method, which is outlined below.

[0068] Below, we explain in detail a typical selection cycle using the cDNA display method. As an example, we will describe a method for obtaining peptides that bind to anti-FLAG antibodies. (1) Preparation of mRNA For example, library DNA containing the desired sequence and DNA encoding a FLAG sequence are used. For example, the DNAs are mixed at a molar ratio of 25,000 to 100,000:1 to prepare a DNA mixture. 250 to 1,000 ng of this mixture is then transcribed at a volume of 10 to 20 μL using a kit such as the RiboMAX Large Scale RNA Production Systems-T7.

[0069] The DNA mixture is incubated, for example, at about 37°C for 3 to 5 hours, and then a desired amount of DNase is added. For example, the DNA mixture is incubated at about 37°C for about 4 hours, and about 0.5 μL of the DNase provided with the kit (e.g., RQ1 DNase, manufactured by Promega) is added, followed by further incubation at about 37°C for about 10 minutes to obtain mRNA. The obtained mRNA can be purified, for example, using the After Tri-Reagent RNA Clean-Up Kit (manufactured by Favogen Biotech Corp.).

[0070] (2) Photocrosslinking Next, the mRNA and the linker obtained as described above are ligated by irradiation with long-wavelength UV (e.g., about 350 to about 370 nm) for 0.5 to 5 minutes. The resulting linker-mRNA conjugate is subjected to cell-free translation at the desired scale, as described above. For example, using a cell-free translation system such as rabbit reticulocyte lysate, 10 to 20 pmol of the mRNA-linker conjugate is translated at a scale of 100 to 150 μL at about 30°C for about 15 minutes. Thereafter, MgCl2 and KCl are added to, for example, about 70 to 80 mM and about 850 to 950 mM, respectively, and the mixture is incubated at about 37°C for about 1 hour to obtain a translation reaction solution containing an mRNA-peptide conjugate. This translation reaction solution contains an IVV in which a peptide is further linked to the mRNA-linker.

[0071] (3) Preparation of cDNA display To the translation reaction solution obtained as described above, about 0.25 to about 0.75 M EDTA (pH about 7.8 to about 8.2) is added to a final concentration of about 80 to 85 mM, and the mixture is incubated at room temperature for about 3 to 7 minutes. Subsequently, an equal volume of, for example, 2x SA binding buffer (containing about 20 mM Tris-HCl (pH about 7.5), about 2 M NaCl, about 2 mM EDTA, and about 0.2% Tween-20) is added, and mixed with 100 to 200 μL of magnetic beads (e.g., Dynabeads MyOne C1 streptavidin) that have been washed with 1x SA binding buffer. The mixture is stirred at about 20 to 30°C for about 20 to 40 minutes.

[0072] Next, the magnetic beads are washed 2 to 4 times with, for example, about 200 μL of 1x binding buffer for SA, and about 100 μL of reverse transcription reaction solution is added, for example, according to the protocol attached to ReverTra Ase (registered trademark), and reverse transcription is performed by stirring at about 42°C for about 15 minutes to prepare an mRNA / cDNA-peptide conjugate (hereinafter sometimes referred to as "cDNA display").

[0073] (3-1-4) Purification of mRNA / cDNA-peptide conjugates Next, for example, Dynabeads MyOne C1 streptavidin is washed with about 150 μL of 1×NE buffer 4, after which about 75 μL of 1×NE buffer 4 containing about 200 U of RNase T1 is added and stirred for about 1 hour at about 37° C. Next, about 75 μL of 2×His-tag washing buffer (about 40 mM sodium phosphate (pH about 7.4) containing about 1 M NaCl and about 0.1% Tween-20) is added, and then the supernatant is recovered.

[0074] Next, for example, approximately 150 μL of the recovered supernatant is mixed with approximately 20 μL of His Mag Sepharose Ni (manufactured by GE Healthcare, washed with 1x His-tag wash buffer) and stirred at room temperature for approximately 1 hour using a mixer such as an Intellimixer RM-2M (manufactured by Toho Corporation).

[0075] The mixture is then washed 1 to 3 times with approximately 100 μL of 1xHis-tag washing buffer, and then approximately 30 μL of selection buffer with an increased EDTA concentration (approximately 50 mM Tris-HCl buffer (pH approximately 7.4) containing approximately 1 M NaCl, approximately 10 mM imidazole, approximately 5 mM EDTA, and approximately 0.1% Tween-20) is added. The mixture is stirred at room temperature for approximately 10 minutes using the mixer described above, and the supernatant is then recovered.

[0076] Next, approximately 25-100 μL of anti-FLAG M2 affinity gel (approximately 40-60% suspension) is loaded into a suitable column, such as MicroSpin Empty Columns (GE Healthcare), and washed two to four times with approximately 150-250 μL of selection buffer. Approximately 50-150 μL of the supernatant is then loaded onto the column and stirred for approximately 1 hour at room temperature using a rotator. The column is washed three to five times with approximately 150-250 μL of selection buffer, and then approximately 50-150 μL of approximately 50-150 ng / μL 3xFLAG peptide (Sigma-Aldrich Japan, LLC) is added. Stirring is performed for approximately 15 minutes at room temperature using the rotator. This allows for competitive elution of the mRNA / cDNA-peptide conjugates bound to the anti-FLAG M2 affinity gel.

[0077] (3-1-5) PCR The eluate in the column is collected by centrifugation, and after ethanol precipitation, the product is dissolved in a desired amount of nuclease-free water. The ethanol-precipitated product is added to approximately 150 to 250 μL of PCR reaction solution, and PCR is performed. For example, the eluate in the column collected by centrifugation is ethanol-precipitated using Quick-Precip Plus Solution or the like, and then dissolved in approximately 15 μL of nuclease-free water. The ethanol-precipitated product is added to approximately 150 to 250 μL of PCR reaction solution (approximately 0.2 mM dNTPs, approximately 0.4 μM T7Ωnew, approximately 4 μM cnvK NewYtag, approximately 0.02 U / μL PrimeSTAR HS DNA polymerase in 1x PrimeSTAR buffer (Mg 2+ In addition to the primers (containing the primers), PCR is performed as follows. Primers that can be used here include, for example, T7Ωnew and cnvK NewYtag (SEQ ID NOs: 3 and 4 in the Sequence Listing). The sequences of these primers are shown below.

[0078] [SEQ ID NO: 3] 5'-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACA-3'

[0079] [SEQ ID NO: 4] 5'‐TTTCCACGCCGCCCCCCGTCCTGCTTCCGCCGTGATGAT‐3'

[0080] Next, PCR can be performed, for example, as follows: (a1) 1 minute at 98°C, (b1) 15 seconds at 98°C, (c1) 30 seconds at 68°C, (d1) 1 minute at 68°C, and 25 cycles of (b1) and (c1). The resulting PCR product is subjected to SDS gel electrophoresis, and the full construct DNA is excised and purified according to standard methods. The purified full construct DNA is added to a desired amount of PCR reaction solution, dispensed in desired amounts, and PCR is performed again to obtain double-stranded DNA.

[0081] More specifically, the PCR product obtained by carrying out PCR as described above is electrophoresed, for example, on 8M urea-denaturing 6% PAGE, and the full construct DNA (260-300 mer) is excised and purified according to a standard method. The purified full construct DNA is dissolved in approximately 150-250 μL of PCR reaction solution (approximately 0.2 mM dNTPs, approximately 0.4 μM Newleft, approximately 0.4 μM NewYtag for cnvK, and approximately 0.02 U / μL PrimeSTAR HS DNA polymerase in 1x PrimeSTAR buffer (Mg 2+ Add the primer to the PCR mixture (containing 1000 kJ / mL of the 1000 kJ / mL nucleotides), dispense approximately 25-75 μL of the 1000 kJ / mL nucleotides, and perform approximately 5 cycles of PCR to obtain double-stranded DNA. The sequence of Newleft (SEQ ID NO: 5 in the Sequence Listing), an example of the primer used here, is shown below.

[0082] [SEQ ID NO: 5] GATCCCGCGAAAATTAATACGACTCACTATAGGG

[0083] PCR can be performed, for example, by repeating five cycles of steps (b2) and (c2) at 98°C for 1 minute, (b2) at 98°C for 10 seconds, (c2) at 68°C for 30 seconds, and (d2) at 68°C for 1 minute. The PCR reaction mixtures obtained after PCR as described above are combined and purified using a column for use in the next round. The above procedure can be repeated for desired rounds, from transcription of the library DNA to affinity selection, to obtain a complex molecule (display molecule) in which the DNA sequence encoding the target-binding peptide (in this case, a FLAG peptide) is combined with the peptide. This completes the selection cycle using the cDNA display method used in the present invention. In this manner, a peptide that binds to a desired antigen, for example, FGF1 or FGF2, can be obtained. [Example]

[0084] The present invention will be described in more detail below using examples, but the present invention is not limited to the examples described below, and various modifications are possible without departing from the gist of the present invention. The VHH (monomer) produced in Example 4 and the VHH homodimer clone #2 produced in Example 8 are reference examples.

[0085] Example 1 [Method] Screening of hit compounds Using the cDNA display method, we screened for hit compounds from a VHH-presenting cDNA display molecule library. Figure 1 shows an overview of the hit compound screening scheme using the cDNA display method.

[0086] 1. Immobilization of target molecules The target molecule used in the screening was human fibroblast growth factor receptor 1 (FGFR1). The proteins used in the screening test were protein A and protein B, which consist of the extracellular domain of FGFR1, and protein C, which was used as a negative control for protein B. Protein A: Recombinant human FGFR1 protein (Active), purchased from Abcam (Cat. no. ab168696; hereinafter referred to as "FGFR-His"). Protein B: FGFReceptor1β(IIIc) / Fc Chimera Human Recombinant Carrier-free was purchased from R&D System (Cat. no. 661-FR; hereinafter referred to as "FGFR-Fc"). Protein C: IgG1 (Fc) Human Recombinant Carrier-free was purchased from R&D System (Cat. no. 110-HG; hereinafter referred to as "hFc"). Target molecules were biotinylated using the following procedure. 20 equivalents of biotinylation reagent (EZ-link sulfo NHSSS Biotin; Thermo Fisher Scientific) was added to each of FGFR1-Fc (Protein B) and hFc (Protein C), and the mixture was allowed to react at 25°C for 30 minutes. Subsequently, unreacted biotinylation reagent was removed using a desalting column (Zeba Spin Desalting Columns; Thermo Fisher Scientific).

[0087] 2. Synthesis of Display cDNA (1) Construction of a DNA library encoding the variable region fragments of full-length alpaca-derived antibodies (single variable domains of the heavy chain of a heavy-chain antibody: VHH) Using the S-hinge and L-hinge genes from two types of alpaca-derived naive VHH library provided by RePHAGEN as templates, the genes were amplified by PCR using S-hinge VHH-specific primers (sequence numbers 1 and 2) and L-hinge VHH-specific primers (sequence numbers 1 and 3). The amplified genes were then extended by extension PCR using overlapping PCR primers (sequence numbers 4 and 5) to prepare DNA fragments consisting of a T7 promoter, omega (ω) enhancer, Kozak consensus sequence, VHH gene, His tag, and linker hybridization region (Y tag) (Table 1 below), and a full-length VHH-encoding DNA library was prepared.

[0088] [Table 1]

[0089] (2) cnv Preparation of KrG Linker cnv The KrG Linker has a main chain and a side chain, and the base sequence of the biotin fragment that forms the main chain is 5'-AAgAATTTCCAKGCCGCCCCCCGVCCT-3' (SEQ ID NO: 55). BioTEG is bound to the 5' end of the main chain. In the base sequence, g represents guanosine, V represents Amino C6-dT, and K represents 3-cyanovinylcarbazole. Also, cnv The puromycin segment that forms the side chain of the KrG Linker has the structure 5'-(5S)TCTFZZCCP. The free end P in the side chain sequence represents puromycin as a protein binding site. (5S) represents 5' Thiol C6, F represents FITC-dT, and Z represents SpaceR18. The chemical synthesis of the main chain and side chains was outsourced to Tsukuba Oligo Service Co., Ltd. (Ushiku City, Ibaraki Prefecture). First, 15 nmol of biotin fragment (final concentration 150 μM) and EMCS (Dojindo Laboratories, final concentration 16.7 mM) were added to 0.2 M sodium phosphate buffer (pH 7.2) and incubated at 37°C for 30 minutes, followed by ethanol precipitation using Quick-Precip Plus Solution (Edge BioSystems). Next, 37.5 nmol of the puromycin segment was dissolved in 1 M aqueous disodium hydrogen phosphate solution containing 50 mM DTT to a final concentration of 417 μM, and the solution was stirred at room temperature for 1 hour. The buffer was then exchanged with 0.02 M sodium phosphate buffer (pH 7.0) containing 0.03 M NaCl using a NAP5 column (GE Healthcare Biosciences). The buffer-exchanged reduced puromycin segment solution was mixed with the ethanol precipitate of the EMCS-modified biotin fragment and left overnight at 4°C. Next, DTT was added to the reaction solution to a final concentration of 50 mM, and the mixture was stirred at room temperature for 30 minutes. Ethanol precipitation was then performed using Quick-Precip Plus Solution (Edge BioSystems). The ethanol precipitate was dissolved in 100 μL of nuclease-free water (Nacalai Tesque). The lysates were separated by 12% polyacrylamide gel electrophoresis. cnv The KrG Linker fraction was excised. The excised gel was crushed using a BioMasher II set (Nippi), 500 μL of nuclease-free water was added, and the mixture was stirred overnight at 4°C. cnv The KrG Linker was extracted. The stirred solution was transferred to a Costar® Spin-X® centrifuge tube filter with 0.22 μm cellulose acetate (corning), and then centrifuged at 16,000 × g for 15 minutes to separate the gel from the extracted solution. Then, ethanol precipitation was performed using Quick-Precip Plus Solution to obtain the desired product. cnv K poly A Linker was obtained. cnvK poly A Linker was dissolved in nuclease-free water and stored at -20°C.

[0090] (Example 2) Preparation of cDNA display Each cDNA display was prepared as follows: The buffers used are listed in Table 2 below.

[0091] [Table 2]

[0092] (1) Transcription The DNA used to synthesize the VHH-encoding cDNA display prepared in "2. Synthesis of cDNA Display" in Example 1 above was transcribed using the T7 RiboMAX ExpreSS Large Scale RNA Production System (Promega) according to the attached manual. 6.6 μg of DNA was used in the first round, and 0.1 to 1 μg in the second round and thereafter. The resulting transcription product was purified using RNaClean XP (Beckman Coulter) according to the attached manual. The concentration of the purified product was quantified using NanoPad DS-11FX (DeNovix).

[0093] (2) Ligation 20 pmol of purified mRNA and 20 pmol of the cDNA prepared in "2. Synthesis of cDNA display" in Example 1 above were used. cnv NaCl (final concentration 0.2 M) and Tris-HCl buffer (pH 7.5, final concentration 0.05 M) were added to KrG Linker, and the mixture was incubated at 90°C for 1 minute. The mixture was then cooled to 70°C at a rate of 0.1°C / sec and incubated at 70°C for 1 minute. The mixture was then cooled to 25°C at a rate of 0.1°C / sec, and then cooled to 10°C at a rate of 2°C / sec. cnv KrG Linker was hybridized to the 3' end of the mRNA. Then, the specimen was irradiated with 365 nm UV light for 5 minutes using a Handheld UV Lamp, 6 W, UVGL-56, 254 / 365 nm, 100 V (Analytik Jena US, An EndreSS+Hauser Company). cnv The KrG Linker was photocrosslinked to mRNA to obtain an mRNA-linker.

[0094] (3) Preparation of mRNA display Six pmol of mRNA-linker was incubated at 30°C for 30 minutes in a 50-µL cell-free translation system (Rabbit reticulocyte lysate (nuclease-treated), Promega). MgCl and KCl were then added to final concentrations of 75 mM and 900 mM, respectively, and the mixture was incubated at 37°C for 1 hour to display the peptide corresponding to the mRNA on the puromycin residue on the mRNA-linker. EDTA (pH 8.0) was then added to a final concentration of 70 mM, and the mixture was incubated at 4°C for 5 minutes to remove ribosomes bound to the mRNA-linker and allow the formation of mRNA display.

[0095] (4) Preparation of cDNA display 60 μL of Dynabeads Myone streptavidin C1 (Thermo Fisher Scientific) was placed in a Protein Lobind tube and washed with 200 μL of binding buffer. The mRNA display prepared by methods (1) to (3) above was then added and stirred at 25°C for 30 minutes. After washing with 200 μL of binding buffer, the tube was incubated at 42°C for 30 minutes in a reaction solution with the composition shown in Table 3 for reverse transcription to prepare mRNA / cDNA-VHH conjugates. After washing with 200 μL of binding buffer, 39 μL of His tag binding / washing buffer and 1 μL of 1,000 U / μL RNase T1 were added and stirred at 37°C for 15 minutes to elute the mRNA / cDNA-VHH conjugates (cDNA display) from the Dynabeads Myone streptavidin C1.

[0096] [Table 3]

[0097] (5) Purification of cDNA-displayed molecules 30 μL of His Mag Sepharose Ni Beads (GE Health Care) were placed in a 1.5 mL / mL microtube and washed with 200 μL of His tag binding / washing buffer. The cDNA display molecules prepared by methods (1) to (4) above were then added and stirred at 25°C for 30 minutes. After washing with 200 μL of His tag binding / washing buffer, 30 μL of His tag elution buffer was added and the cDNA display molecules were eluted by stirring at 37°C for 15 minutes.

[0098] (Example 3) Selection of VHH 1. Selection of target VHHs that bind to the ligand (1) to (5) in Example 2 above constitute one round, with the library obtained at the end of the first round referred to as R1 and the library obtained at the end of the second round referred to as R2. The libraries used in the selection performed in this example and their synthesis scales are shown in Table 4. In this example, the cDNA display molecules obtained in each round of Example 2 were immobilized on beads, and for Initial and R1, they were eluted with TCEP, followed by alkali elution. For R2 to R4, the resulting eluates were divided equally, and one was subjected to competitive elution and the other to TCEP elution. Figure 2 shows a screening test flowchart illustrating the case-by-case elution methods described above. For the R4 eluate, the TCEP-eluted fraction was analyzed by FACS.

[0099] [Table 4]

[0100] 1-1. Screening procedure for selection cycle 1 (Round 1 (R1)) The biotinylated FGFR1-Fc prepared in "1. Immobilization of target molecule" in Example 1 was added to a protein low-binding tube containing 1 mg of Dynabeads Myone streptavidin C1, and the mixture was mixed by inversion at 25°C for 30 minutes. 100 pmol of the FGFR-Fc-immobilized beads were transferred to a new tube containing the FGFR-Fc-immobilized beads. The cDNA display prepared in (1) to (5) in Example 2 was added to the tube and mixed by inversion at 25°C for 30 minutes. The mixture was then washed four times with selection buffer, followed by TCEP elution. Specifically, 40 μL of 10 mM TCEP (Tris(2-carboxyethyl)phosphine) was added to the tube and allowed to stand at 25°C for 15 minutes, resulting in cleavage of the disulfide bonds in the biotinylation reagent and elution. An additional 10 μL of 10 mM NaOH was added to the tube and allowed to stand at 25°C for 10 minutes for additional alkaline elution. This alkaline extraction procedure was performed twice consecutively. After alkaline elution, 4 μL of 1 M Tris-HCl buffer (pH 8.0) was added to the tube containing the resulting extract to neutralize the extract. After alkaline elution, 16 μL of Selection Buffer was added to the tube containing Dynabeads Myone Streptavidin C1 and allowed to stand at room temperature for 1 minute. The supernatant was then removed and mixed with the alkaline eluate. The cDNA contained in the R1 cDNA display molecule obtained as described above was amplified by PCR as follows. cnv Using K NewYtag for poly A (SEQ ID NO: 6) and T7 omeganew (SEQ ID NO: 7), PCR was performed under the following conditions: (a2) 98°C for 1 minute, (b2) 98°C for 10 seconds, (c2) 68°C for 30 seconds, and (d2) 68°C for 1 minute. 25 cycles of steps (b2) and (c2) were repeated to obtain a PCR product. The PCR product was subjected to 4% denaturing PAGE at 200V for 25 minutes to confirm that the cDNA contained in the cDNA display molecule had been amplified. The PCR products obtained as described above were purified using Agencourt AMpure XP (Beckman Coulter) according to the attached manual, and the resulting purified product R1 was used as a library in the second round of selection (R2).

[0101] [Table 5]

[0102] 1-2. Screening procedure for selection cycle 2 (R2) (1) Preparation of hFc-immobilized beads hFc-immobilized beads were prepared in the same manner as in 1-1 above, except that biotinylated FGFR1-Fc was replaced with biotinylated protein C (hFc).

[0103] (2) Preparation of R2 library Beads bearing 10 pmol of immobilized hFc and the cDNA display library prepared from the DNA obtained in Example 2(1) above were added to 100 μL of selection buffer and mixed by inversion at 25°C for 60 minutes, after which the supernatant was collected. The supernatant was aliquoted and added to a tube containing 10 pmol of FGFR1-Fc-immobilized beads or the same amount of hFc-immobilized beads, and 100 pmol of hFc was added to the mixture and mixed by inversion at 25°C for 60 minutes. 200 μL of selection buffer was added to each tube containing the beads, and the tubes were washed four times. After washing, 40 μL of 10 mM TCEP was added to each tube, and the tubes were left to stand at room temperature for 15 minutes for elution. After removing the eluate, 10 μL of 10 mM NaOH was added to each tube, and the elution was repeated twice for 10 minutes at 25°C. Then, 16 μL of selection buffer was added to each tube, and the eluate was allowed to stand at room temperature for 1 minute. After elution, 4 μL of 1 M Tris-HCl buffer (pH 8.0) was immediately added to each tube to neutralize the buffer containing the eluate obtained (hereinafter, sometimes simply referred to as "eluate"). Each of the above eluates was separately tested as a primer. cnv Using K NewYtag for poly A (SEQ ID NO: 6) and T7 omeganew (SEQ ID NO: 7), PCR amplification was performed under the following conditions: (a2) 98°C for 1 minute, (b2) 98°C for 10 seconds, (c2) 68°C for 30 seconds, (d2) 68°C for 1 minute, with 25 cycles of steps (b2) and (c2). The two PCR products obtained were then purified using Agencourt AMpure XP according to the attached manual, and then equal amounts of the products were mixed to create the R2 library.

[0104] 1-3. Screening procedure for selection cycle 3 (R3) For R3, screening was performed by dividing the TCEP elution fraction into two fractions: the TCEP elution fraction and the competitive elution fraction. 10 pmol of hFc-immobilized beads and the cDNA display library shown in Table 4 were placed in a tube, to which 100 μL of selection buffer was added and mixed by end-over-end mixing at 25°C for 60 minutes. The resulting supernatant was then collected and divided into two halves. 10 pmol of FGFR1-Fc or hFc-immobilized beads were added, followed by 50 pmol of hFc, 14 pmol of streptavidin, and 100 ng / μL of salmon sperm DNA, and mixed by end-over-end mixing at 25°C for 60 minutes.

[0105] (1) Competitive elution After the above mixing procedure was completed, competitive elution was performed as follows. 200 μL of selection buffer was added to each tube containing beads and washed three times. Then, 40 μL of selection buffer was added to each tube and washed by end-over-end mixing at 4°C for 30 minutes. 100 pmol of FGFR1-His was then added to each tube and mixed by end-over-end mixing at 25°C for 30 minutes to perform competitive elution of the bound cDNA display molecules, and an eluate was obtained. The above eluate was subjected to PCR, and the eluate was used as a primer. cnv Using K NewYtag for poly A (sequence number 6) and T7 omeganew (sequence number 7), amplification was carried out under the following conditions: (a2) 98°C for 1 minute, (b2) 98°C for 10 seconds, (c2) 68°C for 30 seconds, (d2) 68°C for 1 minute, with 25 cycles of steps (b2) and (c2). The resulting PCR products were purified using Agencourt AMpure XP according to the attached manual to create the R3-1 library.

[0106] (2)TCEP elution The TCEP elution was carried out in the same manner as in 1-2 above. Each eluate was subjected to PCR reaction separately, and purified using Agencourt AMpure XP according to the attached manual to create the R3-2 library.

[0107] 1-4. Screening procedure for selection cycle 4 (R4) For competitive elution of R4, cDNA display libraries prepared separately from the DNA libraries obtained in steps 1-3 above were placed in separate tubes. To each tube, 1 pmol of FGFR1-Fc-immobilized beads, 1,000 μL of selection buffer, 50 pmol of hFc, 140 pmol of streptavidin, and 100 ng / μL of salmon sperm DNA were added and mixed by end-over-end mixing at 4°C for 3 hours. The beads in each tube were washed three times with 200 μL of selection buffer, then divided into two portions. 20 μL of phosphate-buffered saline containing Tween®-20 (hereinafter sometimes referred to as "PBS-T") was added, and competitive elution was performed by end-over-end mixing at 4°C for 16 hours with or without the addition of 10 pmol of FGFR1-His. Then, 40 μL of 10 mM TCEP was added to each tube and the tube was left to stand at room temperature for 15 minutes to perform TCEP elution. Of the above elution procedures, the eluate obtained by competitive elution was subjected to PCR, and the primers were cnv Using K NewYtag for poly A (sequence number 6) and T7 omeganew (sequence number 7), amplification was performed under the following conditions: (a2) 98°C for 1 minute, (b2) 98°C for 10 seconds, (c2) 68°C for 30 seconds, (d2) 68°C for 1 minute, with steps (b2) and (c2) repeated 25 times to produce the R4-1-1 and R4-2-1 DNA libraries. TCEP elution was carried out in the same manner as in 1-2 above, and the resulting competitive eluate was designated as library R4-1-2, and the TCEP eluate was designated as library R4-2-2.

[0108] 1-5. Screening procedure for selection cycle 5 (R5) In the competitive elution of R5, FGFR1-Fc-immobilized beads or hFc-immobilized beads and cDNA display libraries prepared separately from the DNA libraries obtained in 1-3 above were used. 1 pmol of beads bearing immobilized FGFR1-Fc or beads bearing immobilized hFc was placed in separate tubes, and cDNA display libraries prepared separately from the DNA libraries obtained in 1-3 above were added and allowed to bind under the same conditions as in 1-3 above. 20 μL of PBS-T and 10 pmol of FGFR1-His were added to each tube and incubated at room temperature. After 20 hours, the supernatant was collected from each tube (E1). Subsequently, the same amount of PBS-T and FGFR1-His were added, and the mixture was incubated at room temperature. After 40 hours, the solution was again collected (E2). TCEP was then added to each tube to elute the cDNA display molecules (E3). The resulting competitive elution solutions were separately subjected to PCR, and the primers were cnv Using K NewYtag for poly A (SEQ ID NO: 6) and T7 omeganew (SEQ ID NO: 7), amplification was performed under the following conditions: (a2) 98°C for 1 minute, (b2) 98°C for 10 seconds, (c2) 68°C for 30 seconds, (d2) 68°C for 1 minute. 25 cycles of steps (b2) and (c2) were repeated. The R5-1-1-1, R5-2-1-1, R5-1-2-1, and R5-2-2-1 DNA libraries were prepared by mixing equal amounts. TCEP elution was performed as in 1-2 above to prepare the R5-1-1-2, R5-2-1-2, R5-1-2-2, and R5-2-2-2 DNA libraries. In selection cycle 5 (R5), selection was carried out separately using FACS (Fluorescence-Activated Cell Sorting). First, 100 μL of 10 μg / mL biotin-fluorescein dissolved in PBST was added to beads containing 70 pmol of hFc. The mixture was stirred at room temperature for 60 minutes, then placed on a magnetic plate for 1 minute and the supernatant was removed. 200 μL of PBST was added, pipetted, and the mixture was placed on a magnetic plate for 1 minute and the supernatant was removed. This procedure was repeated three times, and then 70 μL of PBST was added to produce hFc-immobilized fluorescent beads. 2 pmol of hFc-immobilized fluorescent beads and 0.5 pmol of FGFR1-Fc-immobilized beads were mixed in a protein low-binding tube. Then, 1 pmol of mRNA-linker complex cDNA display library prepared separately from the DNA obtained in 1-3 above, 50 μL of selection buffer, 50 pmol of streptavidin, and 500 ng / μL of salmon sperm DNA were added to the tube and reacted at 4 °C for 1 hour. The supernatant was removed from the tube, and the beads in the tube were washed three times with 200 μL of selection buffer. Then, 500 μL of selection buffer was added to prepare a sorting solution. The resulting sorting solution was placed in a FACS (Cell Sorter SH800, Sony Corporation). The sample flow path and droplet formation conditions during sorting were automatically set according to the system, and sorting was performed.

[0109] In the FACS analysis described above, the area where magnetic beads were present was identified based on particle size, and the fluorescence intensity was measured when irradiated with a 488 nm laser. From this rapid result, the areas where hFc-immobilized fluorescent beads and FGFR1-Fc-immobilized beads were present were identified and sorted, and 500,000 particles of each were collected in separate protein low-binding tubes. The beads were then centrifuged at 13,000 x g for 10 minutes. After centrifugation, the beads were left to stand on a magnetic plate for 10 minutes, and the supernatant was removed and suspended in 20 μL of RNase-free water. The suspension was subjected to PCR, using 100 μL of RNase-free water as a primer. cnv Using K NewYtag for poly A (SEQ ID NO: 6) and T7 omeganew (SEQ ID NO: 7), amplification was performed under the following conditions: (a2) 98°C for 1 minute, (b2) 98°C for 10 seconds, (c2) 68°C for 30 seconds, (d2) 68°C for 1 minute, with 30 cycles of steps (b2) and (c2) to produce the R5-1-1-FACS, R5-2-1-FACS, R5-1-2-FACS, and R5-2-2-FACS DNA libraries.

[0110] 2.NGS analysis To confirm the degree of convergence of the DNA library after the in vitro selection cycle, we performed sequencing analysis using a next-generation sequencer (NGS, MiSeq System, catalog number SY-410-1003, manufactured by Illumina). Sequencing samples were prepared according to the 2-step PCR Amplicon Library Preparation method provided by Illumina. First, amplicon PCR was performed using the PCR products obtained from each selection as templates and the NGS Fw 1st PCR primer (SEQ ID NO: 8) and NGS Rv 1st PCR primer (SEQ ID NO: 9). The PCR conditions were (s1) 98°C for 1 minute, (s2) 98°C for 10 seconds, 62°C for 5 seconds, 72°C for 35 seconds, and (s3) 72°C for 1 minute, with 15 cycles of (s2). The resulting PCR product was purified using Agencourt AMpure XP (Beckman Coulter, Inc.) according to the kit's instructions. The resulting purified PCR product was then subjected to index PCR according to Illumina's instructions to prepare a library for NGS analysis. The resulting index PCR product was purified using Agencourt AMpure XP according to the kit's instructions, and the concentration of the purified product was quantified using a NanoPad DS-11FX (DeNovix). Next, sequence analysis was performed using MiSeq (Illumina) and MiSeq Reagent Nano kit v2 (500 cycles) according to the instructions of Illumina, Inc. The obtained DNA sequences were translated into VHH amino acid sequences and ranked by frequency of occurrence. The obtained elution fractions were confirmed to contain enriched candidate compounds compared to the library used.

[0111] [Table 6]

[0112] 3. Screening for hit compounds using phage display As described above, the DNA library enriched by the cDNA display method was subjected to phage display to further increase the enrichment rate and obtain the target compound (hereinafter referred to as "hit compound"). Figure 3 shows the difference caused by panning in the phage display scheme.

[0113] 3-1. Restriction enzyme treatment of phagemids and each DNA library A mixture of the DNA libraries obtained in 1-3 or 1-5 above was used as a template. The primers used were Alp-to-pPK4-Nco-Sfi-VHH-F (SEQ ID NO: 10) and Alp-GGGS-HisTag-to-pPK4-R (SEQ ID NO: 11). PCR was performed under conditions of annealing temperature 55°C and extension reaction time 60 seconds. Restriction enzyme recognition sequences for ligation with the phagemid vector were added to the resulting PCR product, which was then purified with Agencourt AMpure XP (Beckman Coulter). The phagemid and each DNA library were sequentially digested with two restriction enzymes. First, FastDigest BamHI (Thermo Fisher Scientific) was added and the mixture was treated at 37°C for 1 hour, followed by FastDigest SfiI (Thermo Fisher Scientific) and treatment at 50°C for 1 hour. Each DNA library was then purified using Agencourt AMpure XP according to the attached manual.

[0114] [Table 7]

[0115] The phagemid vector digested with the restriction enzymes described above was subjected to gel electrophoresis at 100 V for 30 minutes using a 1% agarose gel containing 1x Gel Green (Fujifilm Wako Pure Chemical Industries, Ltd.). It was then extracted and purified using a FastGene Gel / PCR Extraction Kit (Nippon Genetics Co., Ltd.) according to the accompanying manual. The purified phagemid vector was dephosphorylated by adding FastAP Thermosensitive Alkaline Phosphatase (Thermo Fisher Scientific) and reacting at 37°C for 60 minutes. The enzyme was then inactivated by heating at 75°C for 5 minutes. The phagemid vector obtained as described above was mixed with the VHH antibody gene fragment prepared in 3-1 above at a molar ratio of 1:5-10, and Ligation high Ver2 (Toyobo Co., Ltd.) was added and the mixture was incubated overnight at 16°C. The resulting phagemid vector was concentrated by ethanol precipitation, and then the phagemid vector was electroporated to transform E. coli TG-1 (phage display competent cells, Lucigen). The transformed TG-1 was treated according to standard procedures, plated on LB agar medium, and cultured overnight at 30°C. All colonies that appeared on the agar medium were collected in a tube containing 2YTAG liquid medium and cultured in this tube at 30°C until the OD600 reached 0.5-1. A 20-fold volume of helper phage was then added to the E. coli cells in the tube, and the cells were infected with the phage and cultured overnight at 30°C. After the culture, the tube containing the culture medium containing the E. coli cells was centrifuged at 4,000 × g for 30 minutes at 4°C, and the supernatant was collected in a separate tube. A 20% polyethylene glycol (PEG) solution containing 2.5 M NaCl was added to the tube containing the collected supernatant, and the mixture was mixed by inversion and then cooled on ice for 1 hour. The tube was then centrifuged and the supernatant was removed. The precipitate in the tube was dissolved in PBS containing 10% glycerol, and phages displaying VHH were obtained.

[0116] 3-2. Biopanning using ELISA plates FGFR1-Fc or FGFR1-His was diluted with PBS to 10 μg / mL to prepare an FGFR1 immobilization solution. 100 μL of the FGFR1 immobilization solution was added to each well of a 96-well ELISA plate (Immuno Clear Standard Modules_C8_MaxiSorp: cat# 445101, Thermo Fisher Scientific) and immobilized overnight at 4°C. The same procedure was repeated using PBS as a negative control. After immobilization, each well of the 96-well plate was washed three times with PBS, and then 200 μL of 3% skim milk-containing PBS (hereinafter sometimes referred to as "blocking solution") was added and the plate was left to stand at room temperature for 1 hour for blocking. Each well was then washed three times with PBS. 1 mL of PBS containing 3% skim milk and 5% BSA (bovine serum albumin) was mixed with 50 μL of the phage display solution prepared in 3-1 above, and then 100 μL was added to each well and allowed to react at room temperature for 1 hour. After the reaction was complete, 200 μL of PBS-T was added to each well and washed four times. Another 200 μL of PBS-T was added in the same way, and the wells were shaken for 5 minutes to wash each well. This washing procedure was then repeated. 100 μL of 100 mM trimethylamine solution was added to each well and collected. The same volume of 100 mM trimethylamine solution was added to each well and allowed to stand at room temperature for 10 minutes to elute the bound phage. The eluate was collected and immediately neutralized with 100 μL of 0.5 M Tris-HCl buffer (pH 6.8). The neutralized eluate was collected in a tube, mixed with 1,200 μL of E. coli TG-1, and allowed to stand at 30°C for 1 hour. 10 μL of the mixture was plated on a 2YTAG agar plate (10 cm dish). The remaining mixture was centrifuged at 1,450 xg for 10 minutes at 4°C, and the resulting precipitate (Escherichia coli TG-1) was plated on a 2YTAG agar plate (15 cm dish). Each agar plate was cultured overnight at 30°C. All colonies that appeared on each agar plate were collected in a 500µL Erlenmeyer flask containing 2YTAG liquid medium. The flask was cultured at 30°C until the OD600 reached 0.5-1. The E. coli was then infected with 20 times the amount of helper phage compared to the E. coli and cultured overnight at 30°C. The culture containing E. coli was centrifuged at 4,000 x g for 30 minutes at 4°C, and the supernatant was collected in a separate tube. A 20% PEG solution containing 2.5 M NaCl was added to the tube containing the supernatant and mixed by inversion. After cooling on ice for 1 hour, the tube was centrifuged at 4,000 x g for 30 minutes at 4°C and the supernatant was removed. The resulting precipitate was dissolved in PBS containing 10% glycerol to prepare phage display vectors, and biopanning was performed again.

[0117] 3-3. Biopanning using immunotubes FGFR1-Fc was diluted with PBS to 10 μg / mL to prepare an FGFR1 immobilization solution. 1 mL of this solution was added to an immunotube (MAXISORP NUNC-IMMUNO TUBE 5.0 mL: cat#444202, Thermo Fisher Scientific) and allowed to immobilize overnight at 4°C. The tube was washed three times with PBS, and then 5 mL of the blocking solution was added to the tube. The tube was then left to stand at room temperature for 1 hour for blocking. The tube was then washed five times with PBS. 100 μL of the phage display solution prepared in 3-1 above was mixed with PBS containing 3 mL of PBS, 3% skim milk, 5% BSA, and 5% HSA (Human Serum Albumin). The mixture was then added to the immunotube and incubated at room temperature for 1 hour.

[0118] The tubes were washed 10 times with 5 mL of PBS-T, then 5 mL of PBS-T was added and shaken for 30 minutes at room temperature. Then, 5 mL of PBS-T was added again and washed 10 times. 1 mL of 100 mM trimethylamine solution was added to the immunotube and collected. Another 1 mL of 100 mM trimethylamine solution was added to the immunotube and left to stand at room temperature for 10 minutes to elute and collect the bound phage. The collected eluate was immediately neutralized with 1 mL of 0.5 M Tris-HCl buffer (pH 6.8). The neutralized eluate was mixed with 10 mL of E. coli TG-1 and left to stand at 30°C for 1 hour. The mixture was then centrifuged at 1,450 × g for 10 minutes at 4°C, and the precipitate (E. coli TG-1) was plated on a 2YTAG agar plate (15 cm dish). Each agar plate was incubated overnight at 30°C.

[0119] All colonies that appeared on the agar plate were collected in liquid medium and cultured at 30°C until the OD600 reached 0.5–1. Then, helper phage was added in an amount 20 times the amount of E. coli, and the E. coli was infected and cultured overnight at 30°C. The culture containing the cultured E. coli was centrifuged at 4,000 × g for 30 minutes at 4°C, and the supernatant was collected in a new tube. A 20% PEG solution containing 2.5 M NaCl was added to the collected supernatant, mixed by inversion, and chilled on ice for 1 hour. The tube was then centrifuged at 4,000 × g for 30 minutes at 4°C, and the supernatant was removed. The resulting precipitate was dissolved in PBS containing 10% glycerol to prepare a phage display solution, and biopanning was performed again. The second panning was performed identically to the first panning, except that FGFR1-His was immobilized on the immunotube instead of FGFR1-Fc.

[0120] 3-4. Phage ELISA To confirm whether VHHs that bind to FGFR1 were enriched in the library, phage ELISA was performed in a polyclonal state. FGFR1-Fc and FGFR1-His were diluted with PBS to 10 μg / mL to prepare an FGFR1 immobilization solution. 100 μL of the FGFR1 immobilization solution was added to each well of a 96-well ELISA plate and immobilized overnight at 4°C. Each well was washed three times with PBS, then 200 μL of the above-mentioned blocking solution was added and allowed to stand at room temperature for 1 hour for blocking. Each well of the plate was then washed three times with PBS. 160 μL of each round of phage display was mixed with 160 μL of 10% BSA-containing PBS, and 50 μL of this mixture was added to each well and incubated at room temperature for 1 hour. Each well was then washed five times with 200 μL of PBS-T. Anti-M13-mAb-HRP (Sinobiological) was diluted 3,000-fold with PBS-T, and 50 μL of this diluted solution was added to each well and incubated at room temperature for 1 hour. Each well was then washed five times with 200 μL of PBS-T. OPD tablets (cat# 155-02161, Fujifilm Wako Pure Chemical Industries, Ltd.) were then dissolved in 10 mL of 0.1 M NaH2PO4 aqueous solution to prepare an OPD solution. 100 μL of this solution was added to each well and incubated for 15 minutes in the dark. 1 Next, 100 μL of 1 M sulfuric acid was added, and the absorbance of each well was immediately measured at 490 nm using a Microplate Reader Infinite 200Pro M PLEX (Tecan). The VHH-displaying phages biopanned in 3-2 above were transferred to a new tube, mixed with E. coli TG-1, and incubated at 30°C for 1 hour. The tube containing the mixture was centrifuged at 4,000 × g for 10 minutes at 4°C. The precipitate (E. coli TG-1) was dissolved in 2YTAG liquid medium and then plated on a 2YTAG agar plate (15 cm dish). The agar plate was cultured overnight at 30°C, and the resulting colonies were single-picked and cloned according to standard methods. Each phage display was recovered. Phage ELISA was performed in the same manner, except that FGFR1-His was diluted to 2 μg / mL in PBS and used for the ELISA plate. Phagemids were extracted from the E. coli cells for clones that showed responses, and the DNA sequences corresponding to the displayed VHHs were analyzed using the Sanger method. DNA sequence analysis was outsourced to Eurofins Genomics.

[0121] Example 4: Production of VHH (monomer) For VHH clone #1 and VHH clone #2 identified in 3-4 of Example 3 above, VHH (monomer) expression and purification were carried out using Corynebacterium glutamicum. The experimental procedures were as follows.

[0122] 1. Construction of plasmids for expression of hit VHH (monomer) Using the phagemids of VHH clone #1 and VHH clone #2 as templates, PCR was performed using primers specific to each VHH at an annealing temperature of 55°C and an extension reaction time of 5 seconds. The resulting DNA was purified using a Gel / PCR Extraction Kit (manufactured by Nippon Genetics) according to the instructions provided with the kit. The purified DNA, C. glutamicum expression plasmid, and Escherichia coli-extracted SLiCE reaction solution were added to a tube containing SLiCE buffer (50 mM Tris-HCl buffer (pH 7.5), 10 mM MgCl2, 1 mM ATP, 1 mM DTT (1,4-dithiothreitol)), and in vitro homologous recombination was carried out at 37°C for 15 minutes to transform competent cells JM109 (Takara Bio Inc.) to obtain transformants. Plasmids were extracted from the resulting transformants, and DNA sequence analysis confirmed that the genes of VHH clone #1 or VHH clone #2 had been incorporated, respectively. FIG. 4 shows the amino acid sequences of the CDR regions of VHH clone #1 (Clone #1) and VHH clone #2 (Clone #2).

[0123] 2. Expression of VHH (monomer) in C. glutamicum Each plasmid obtained in 1 above was introduced into C. glutamicum by electroporation, and transformation was performed to obtain transformants. The resulting transformants were inoculated into CM2G medium and pre-cultured overnight at 30°C. The pre-culture solution was then subcultured in PM1S medium in a 96-deep-well plate and cultured at 25°C for 72 hours, allowing VHH (monomer) to be secreted into the culture supernatant. After culture, the 96-deep-well plate was centrifuged at 4,000 × g for 30 minutes at 20°C. After centrifugation, the supernatant was collected and passed through a 0.22 μm filter to remove the bacterial cells. The culture supernatant after bacterial cell removal was frozen and stored at -80°C, and thawed as needed for purification.

[0124] 3. Purification of VHH (monomer) Imidazole was added to the thawed culture supernatant to a final concentration of 10 mM, followed by mixing with 100 μL of Ni Sepharose 6 Fast Flow (Cytiva, hereafter referred to as "carrier") and mixing by inversion at 4°C for 1 hour. The carrier was precipitated by centrifugation at 500 × g for 1 minute at 4°C, and the supernatant was removed to a final volume of approximately 700 μL to obtain a suspension. This suspension was transferred to a spin column (EconoSpin; Ajinomoto Bio-Pharma) and centrifuged at 100 × g for 30 seconds at 4°C. 600 μL of wash buffer (50 mM Tris-HCl buffer (pH 7.5) containing 300 mM NaCl and 30 mM imidazole) was added, and the column was centrifuged twice under the same conditions as above. Subsequently, 700 μL of elution buffer (50 mM Tris-HCl buffer (pH 7.5) containing 300 mM NaCl and 500 mM imidazole) was added to elute the VHH. The purity of the eluted clone VHH (monomer) #1 and #2 was confirmed by SDS-PAGE (Figure 5). In Figure 5, the markers indicate molecular weights. Each of clone VHH (monomer) #1 and #2 was detected at around 15 kDa. To remove high concentrations of imidazole, the buffer was exchanged with PBS using a desalting column (Zeba Spin Desalting Columns; Thermo Fisher Scientific). The concentration of VHH (monomer) was quantified by the BCA method using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) with bovine serum albumin (Fujifilm Wako Pure Chemical Industries, Ltd.) as the standard protein.

[0125] (Example 5) Affinity measurement of VHH (monomer) The affinity of VHH (monomer) was measured by surface plasmon resonance (SPR) analysis. The binding activity of VHH clone #1 or VHH clone #2 immobilized on a Series S Sensor Chip CAP (Cytiva) to FGFR1-Fc was measured using a Biacore® T200 (Cytiva). Measurements were performed using CAP Single-cycle Kinetics. The temperature was set at 25°C. The running buffer used was HBS-EP+ (10 mM HEPES (pH 7.4) containing 150 mM NaCl, 0.5 mM EDTA, and 0.05% surfactant P20) (Cytiva). The measurement order for each run was as follows: 1) Immobilization of biotinylated FGFR1-Fc: The flow rate was set to 2 μL / mL, and Biotin CAPture Reagent (Cytiva) was added for 300 seconds. Then, the flow rate was set to 10 μL / mL, and FGFR1-Fc solution diluted with running buffer was added for 120 seconds, resulting in immobilization of 140 RU. Here, "resonance unit (RU)" is the unit used in Biacore, where a change in SPR angle of 0.1° is defined as 1,000 RU. 2) Measurement of binding activity: The flow rate was set to 30 μL / mL, and VHH clone #1 or VHH clone #2 diluted to 1.85 nM, 5.56 nM, 16.67 nM, and 50 nM using running buffer was allowed to bind with an association time of 120 seconds, and allowed to interact with each other with a dissociation time of 600 seconds. 3) Regeneration of the sensor chip surface: The flow rate was set to 10 μL / mL, and a 3:1 mixture of Regeneration stock 1 and Regeneration stock 2 (both manufactured by Cytiva) was added for 120 seconds to elute the immobilized VHH. Analysis was then performed using a 1:1 binding model using Biacore T200 Evaluation (software version 2.0, manufactured by Cytiva) to calculate binding activity. The results are shown in Figures 6 and 7. As a result, the equilibrium dissociation constant (KD) of VHH clone #1 for FGFR1-Fc was 1.74 x 10 -9 M(ka=8.19x10 6 (1 / Ms), kd=1.42x10 -3 The equilibrium dissociation constant (KD) of VHH clone #2 for FGFR1 was 1.02 x 10 -9 M(ka=1.11x10 6 (1 / Ms), kd=1.14x10 -3 (1 / s)).

[0126] (Example 6) Measurement of affinity of VHH (monomer) to each receptor The binding activity of VHH clone #1 to FGFR2-Fc, FGFR3-Fc, or FGFR4-Fc was measured in the same manner as in Example 5. As a result of the analysis, the equilibrium dissociation constants (KD) of VHH clone #1 for FGFR2-Fc, FGFR3-Fc, and FGFR4-Fc were 1.63 × 10 -6 M(ka=4.84x10 5 (1 / Ms), kd=7.76x10 -1 (1 / s)), 1.01×10 -6 M(ka=2.32x105 (1 / Ms), kd=2.35x10 -1 (1 / s)), 2.22 × 10 -8 M(ka=2.37x10 6 (1 / Ms), kd=5.27x10 -2 (1 / s)). The affinity measurement results of VHH clone #1 for FGFR2-Fc, FGFR3-Fc, and FGFR4-Fc are shown in Figures 8A to 8C in the order of FGFR2-Fc (Figure 8A), FGFR3-Fc (Figure 8B), and FGFR4-Fc (Figure 8C). The vertical axis of the graph represents affinity (response), and the horizontal axis represents time (seconds).

[0127] (Example 7) Measurement of agonist activity of VHH (monomer) 1. Samples, etc. To verify the agonist activity of the purified VHH (monomer), changes in the expression level of phospho-p44 / 42 MAPK (Erk1 / 2) were measured using in-cell ELISA. The VHH (monomer) was applied to cells at a final dilution of 1:100. As a positive control, FGF2 (fibroblast growth factor (basic) (FGF-basic / bFGF / FGF2), human, recombinant, animal-derived-free (154 aa); product code 068-05384; Fujifilm Wako Pure Chemical Industries, Ltd.; final concentration 100 ng / mL) was used. The experimental procedure was as follows:

[0128] 2. Stimulation of NIH3T3 cells with FGF2 or VHH (monomer) D-MEM (D6429, Sigma) medium containing 10% fetal bovine serum (S0400, BWT) and 1% Penicillin-Streptomycin Mixed Solution (26253-84, Nacalai Tesque) was prepared, and NIH3T3 cells (CRL1658, ATCC) were suspended in the medium. 1 × 10 cells were cultured in a 96-well cell culture plate. 4Cells were seeded at 1000 cells / well and cultured overnight in a 5% CO2 incubator at 37°C in the dark. The medium was removed from each well and washed with serum-free medium. Then, serum was removed from the medium to prepare serum-free medium. VHH (monomer) was added to the cells at a final dilution of 1:100. NIH3T3 cells were stimulated by culture in a 5% CO2 incubator at 37°C in the dark for 30 minutes. FGF2 (final concentration: 100 ng / mL) was used as a positive control.

[0129] 3. In Cell ELISA The medium was removed from each well, and the cells stimulated with FGF2 or VHH (monomer) obtained in 2 above were washed twice with PBS. Then, 100 μL / well of 4% paraformaldehyde-PBS solution (hereinafter referred to as "fixative") was added to each well and fixed for 15 minutes at room temperature. After fixation, the fixative was removed from each well, and PBS was added to each well and washed three times. Next, 100 μL / well of 0.1% Triton X-100 in PBS was added to each well and permeabilized for 15 minutes at room temperature. After this treatment, each well was washed again with PBS, and 100 μL / well of 1% HO in PBS was added to each well and allowed to stand at room temperature for 20 minutes for inactivation. Next, the 1% HO in PBS was removed from each well, and each well was washed with PBS. Then, 100 μL / well of 1% BSA in TBS was added to each well and allowed to stand at room temperature for 1 hour for blocking. Anti-phospho-p44 / 42 MAPK (Erk1 / 2) rabbit monoclonal antibody (CST, #4370) was diluted 1,000-fold with 1% BSA-containing TBS to prepare antibody dilution 1, which was added at 100 μL / well to each well of the blocked plate and incubated overnight at 4°C. The solution in the wells was removed, and 100 μL / well of 0.05% Tween 20-containing TBS (hereinafter sometimes referred to as "TBS-T") was added to each well to wash the wells, and this procedure was repeated three times. Anti-rabbit IgG, HRP-linked antibody (CST, #7074) was diluted 1:1,000 with TBS containing 1% BSA to prepare antibody dilution 2, which was added to each well at 100 μL / well and incubated at room temperature for 1 hour in the dark. As with antibody dilution 1, 100 μL / well of TBS-T was added to each well and the plate was washed three times. Then, 100 μL / well of OPD detection reagent mix was added to each well. The OPD detection reagent mix was prepared by dissolving 10 PD tablets (Fujifilm Wako Pure Chemical Industries, #154-06173) in 12 mL of 0.1 M NaHPO (pH 5.5) and adding H2O to a final concentration of 0.025%. The reaction was then carried out at room temperature for 15 minutes in the dark, after which 100 μL / well of 1 M sulfuric acid was added to each well to stop the reaction, and the absorbance of each well was measured using a plate reader (measurement wavelength: 490 nm, ref: 630 nm).

[0130] 4. Janus Green Staining To correct for cell number, cells were stained with Janus Green. After measuring the absorbance in step 3 above, each well of the plate was washed three times with ultrapure water, and Janus Green solution (ab111622, Abcam) was added to each well. 50 The cells were stained by adding 100 μL of 0.1 M HCl to each well and incubating at room temperature for 5 minutes. Each well was then washed 5-6 times with ultrapure water, and 100 μL of 0.1 M HCl was added to each well to lyse the cells. The cells were then incubated at room temperature for 10 minutes. The absorbance at 595 nm was then measured using a plate reader. Figure 9 shows a graph of the expression levels of phospho-p44 / 42 MAPK (Erk1 / 2) upon stimulation with FGF2 or VHH (monomer). The vertical axis in Figure 9 shows the relative expression levels of FGF2, VHH clone #1, and VHH clone #2, when the expression level of the negative control (no stimulation with FGF2 or VHH (monomer)) is set to 1. Figure 9 reveals that none of the above VHH (monomer) has agonist activity.

[0131] Example 8: Production of VHH (homodimer) 1. Plasmid construction for VHH (homodimer) expression In Example 7 above, measurement of the agonistic activity of VHH (monomer) confirmed that the above VHH (monomer) had no agonistic activity. Therefore, in order to confer agonistic activity to VHH clone #1 and VHH clone #2, VHH homodimerization was investigated using various linkers. Details of the amino acid sequences of each linker investigated in this example are shown in Table 8. In Figure 10, the linkers used are listed by the names in Table 8 below.

[0132] [Table 8]

[0133] Using the plasmid obtained in Example 4-1 above as a template and primers specific to each VHH, PCR was performed at an annealing temperature of 55°C and an extension reaction time of 5 seconds to add a linker sequence and a restriction enzyme recognition sequence to the N-terminus of each clone. The resulting PCR product was purified using a Gel / PCR Extraction Kit (Nippon Genetics) according to the attached manual to obtain a purified PCR product. The plasmid obtained in Example 4 above was digested with restriction enzymes FastDigest BamHI and ApaI (Thermo Fisher Scientific) and purified as described above using a Gel / PCR Extraction Kit to obtain purified DNA. FastDigest BglII and ApaI (Thermo Fisher Scientific) were added to this purified DNA and reacted at 37°C for 1 hour. Each DNA was then purified as described above using a Gel / PCR Extraction Kit to obtain restriction enzyme-treated plasmids. The above restriction enzyme-treated plasmid was electrophoresed at 100 V for 30 minutes using a 1% agarose gel containing 1x Gel Green, and then purified using the FastGene Gel / PCR Extraction Kit according to the attached manual to obtain purified DNA. Ligation high Ver2 was added to each purified DNA obtained by the above procedure, and ligation was carried out at 16°C for 30 minutes, followed by transformation of competent cells JM109. Plasmids were extracted from the resulting transformants using the FastGene Plasmid Mini Kit (Nippon Genetics Co., Ltd.) according to the instructions provided with the kit, and purified. DNA sequence analysis of the resulting plasmids confirmed that homodimeric genes using each linker had been incorporated.

[0134] 2. Introduction of vectors into C. glutamicum and purification of VHH (homodimer) Each of the plasmids prepared as described above was introduced into C. glutamicum by electroporation, and the expression of VHH (homodimers) was confirmed and then purified. The experimental procedures were the same as those described in "2. Expression of VHH (monomer) using C. glutamicum" and "3. Purification of VHH (monomer)" in Example 4 above. Figure 10 shows an SDS-PAGE electrophoresis image of VHH (homodimer). In Figure 10, #1 and #2 represent each VHH clone, and 5 aa, 10 aa, and 20 aa, L3, and L4 represent the linkers used here, using the linker names listed in Table 8. Numbers 10 to 75 represent molecular weights and markers.

[0135] (Example 9) Measurement of agonist activity of VHH (homodimer) The agonist activity of purified VHH (homodimer) was examined by measuring changes in the expression level of phospho-p44 / 42 MAPK (Erk1 / 2) using in-cell ELISA. VHH (homodimer) was applied to cells at a uniform final dilution of 100. FGF2 (final concentration 100 ng / mL) was used as a positive control. The experimental procedure was the same as in Example 7, section 3 above. Figure 11 shows the relative expression levels of phospho-p44 / 42 MAPK (Erk1 / 2) upon stimulation with FGF2 or VHH (homodimer), with the expression level when unstimulated cells were used set at 1. In Figure 11, NTC indicates unstimulated cells (negative control). Combinations of linker-linked homodimers and linkers are shown, such as #1-5aa-#1 when the linked clone is VHH clone #1 and the linker is 5aa. Figure 11 also shows the relative expression levels of homodimers formed by linking clone VHH#1 or clone #2 with the linkers shown in Table 8. These results demonstrate that VHH (homodimers) have agonistic activity.

[0136] (Example 10) Measurement of cell proliferation activity of VHH (monomer, homodimer) 1. Measurement of cell proliferation activity using NIH3T3 (mouse fibroblast cell line) NIH3T3 (mouse fibroblast cell line) cells were obtained from ECACC via a domestic distributor for cell proliferation assays. These cells were expanded according to standard procedures and then cryopreserved at -80°C using CellBank®1 plus (Zenoac). For maintenance culture, D-MEM (high glucose: Fujifilm Wako Pure Chemical Industries, Ltd.; hereafter simply referred to as "DMEM") containing 10% bovine serum (New Zealand origin: Thermo Fisher Scientific, hereafter referred to as "CS") and 100 U penicillin-streptomycin (Thermo Fisher Scientific, hereafter referred to as "PS(+)") was used. Passage procedures were performed according to standard procedures using Trypsin-EDTA (Thermo Fisher Scientific) and D-PBS(-) under the conditions provided by the supplier. Cell proliferation assays were performed using cells at passages 3 to 10. The FGF2 cell proliferation assay was performed as follows: On day 1, 2.5 × 10 NIH3T3 cells were cultured in DMEM containing 10% CS and PS(+). 4A suspension containing 100 cells / mL was prepared and seeded at 100 μL per well onto a CulturPlate-96 (White Opaque 96-well Microplate, Perkin Elmer, Cat# 6005680) and cultured at 37°C in a 5% CO2 incubator for 16–24 hours. On day 2, the medium was replaced with serum-free PS(+)DMEM containing FGF2 (PeproTech Cat# AF-100-18B) or various test substances, and the cells were cultured for an additional 2 days. On day 4, the 96-well plate was left at room temperature for 30 minutes, after which 100 μL of room-temperature Cell Titer Glo 2.0 Reagent (Promega) was added to each well and the plate was agitated at 500 rpm for 2 minutes. After leaving the plate to stand for another 8 minutes, the luminescence of each well was measured using a Synergy HTX plate reader (BioTek) with a sensitivity setting (Gain) of 200 and a measurement time of 1 s / well. Measurements were performed at three points for each concentration of the test substance. For measurements at a single concentration, 100 ng / mL FGF2 was used as a positive control, and no FGF2 was used as a negative control. VHH monomers were uniformly diluted 100-fold and measured. 50 For the measurement, a four-fold dilution series starting from 1,000 ng / mL or 100 ng / mL (FGF2) was prepared for eight concentrations and used for the measurement. 50 The measured data was fitted to a 4-parameter fit using the control software provided with the plate reader in the usual manner, and the EC 50 The value was calculated. Figure 12 shows the EC of VHH monomer (Clone #2). 50 The graphs show the measurement results. The RLU shown on the vertical axis of the graphs in Figures 12, 13A, and 13B all indicate relative light units. In Figure 12, this is the concentration of FGF2 or Clone #2 monomer. Compared to when FGF2 was used, the Clone #2 monomer showed a lower relative light unit even at high concentrations. Figure 13A shows the EC of VHH homodimer (Clone #1). 50The graph shows the measurement results. It was confirmed that all of the homodimers of Clone #1 used here had activity comparable to that of FGF2. Figure 13B shows the EC of VHH homodimer (Clone #2). 50 The graphs showing the measurement results show that all of the homodimers of Clone #2 used here were confirmed to have significantly lower activity than FGF2. From the above, VHH homodimer (Clone #1) has the same EC as FGF2. 50 It has been shown that

[0137] 2. Inhibition of growth factor activity of VHH homodimers by FGFR antagonists We investigated the proliferation inhibition of VHH homodimers by FGFR kinase inhibitors to confirm whether they exert cell proliferation activity via FGFR. As a kinase inhibitor, NVP-BGJ398 (IC for FGFR1 / 2 / 3) was used, which shows selective inhibitory activity against FGFR. 50 The same procedures as in the FGF2 cell proliferation assay were performed on two groups: an NVP-BGJ398-free group (indicated by (-) in Figure 14) and a 20 nM NVP-BGJ398-added group (indicated by BGJ398 20 nM in Figure 14). The amounts of FGF2 and VHH#1 dimerized with linker L4 (#1L4, sometimes referred to as "#1-L4-#1") added were both 10 or 100 ng / mL. It was also confirmed separately that 20 nM NVP-BGJ398 itself had almost no effect on cell proliferation. The vertical axis in Figure 14 represents relative luminescence intensity. As shown in Figure 14, the cell proliferation activity of FGF2 and #1L4 was suppressed by the addition of NPV-BGJ398. This confirmed that #1L4, like FGF2, has FGFR-mediated cell proliferation activity.

[0138] 3. Cell proliferation activity of VHH monomers Each VHH monomer stock (Clone #1: 2.65 mg / mL; Clone #2: 0.82 mg / mL in PBS) was diluted 100-fold to confirm the presence or absence of cell proliferation activity. A sample without FGF2 or Clone #1 was used as a negative control, and FGF2 (100 ng / mL) was used as a positive control. VHH monomer 1 was used at concentrations of 26.5 μg / mL and 8.20 μg / mL. The results are shown in Figure 15. The vertical axis of Figure 15 indicates relative luminescence intensity. Luminescence intensity was measured using the same method as described in Example 10. As shown in Figure 15, VHHClone #2 exhibited significant cell proliferation activity as a monomer.

[0139] (Example 11) Measurement of thermal stability of VHH (monomer) The thermal stability of VHH was measured by protein thermal shift assay. To confirm the thermal stability of VHH monomer Clone #1 and tandem dimer #1L4, the denaturation temperature (Td) was measured by protein thermal shift assay. Experiments were performed according to Huynh et al. (Hynh, Kathy, Partch, Carrie L., Analysis of protein stability and ligand interactions by thermal shift assay, Current Protocols in Protein Science, 2015, Vol. 79, pp. 28.9.1-28.9.14). Specifically, 0.5 mg / mL of VHH monomer Clone #1 or tandem dimer #1L4 was used in a D-PBS solution (Fujifilm Wako Pure Chemical Industries, Ltd.) containing 20 μL of 10x SYPRO Orange (Thermo Fisher Scientific). A protein-free control was also prepared at the same time and dispensed into an 8-strip PCR tube (Nippon Genetics Co., Ltd.) to measure the fluorescence background. The tube was placed in a real-time PCR system (QuantStudio3, Thermo Fisher Scientific) and the change in fluorescence intensity was measured at 1°C / min using a fluorescent filter for ROX measurement in the range of 25°C to 95°C. After the measurement, the background value was subtracted from the measured value to calculate Td. The thermal stability of VHH monomer Clone #1 and tandem dimer #1L4 was measured by protein thermal shift assay. The results are shown in Figures 16 and 17. In Figures 16 and 17, the vertical axis indicates fluorescence intensity, and the horizontal axis indicates the temperature range measured. As shown in Figures 16 and 17, both VHHs exhibited high thermal stability, with Td values ​​of 74.1°C for VHHClone #1 and 75.4°C for #1L4.

[0140] (Example 12) Production of VHH (coiled coil) For the VHH clone #1 obtained in Example 4 above, a VHH (coiled-coil body) (hereinafter sometimes abbreviated as "VHH-C") was expressed using Corynebacterium glutamicum (C. glutamicum) as follows, and this was purified.

[0141] 1. Construction of VHH-C expression plasmid First, a coiled-coil sequence was added to the VHH clone #1 expression plasmid as follows. Coiled-coil DNA was obtained by artificial gene synthesis (Eurofins Genomics). FastDigest BamHI and FastDigest ApaI (both restriction enzymes from Thermo Fisher Scientific) were added to the VHH clone #1 expression plasmid and artificial gene DNA, and the mixture was allowed to react at 37°C for 30 minutes. Next, the enzyme reaction mixture was loaded onto a 1% agarose gel containing 1xGel green (Fujifilm Wako Pure Chemical Industries, Ltd.) and electrophoresed at 100 V for 30 minutes. The product was then extracted from the gel using the FastGene Gel / PCR Extraction Kit (Nippon Genetics Co., Ltd.) according to the attached instructions, and further purified. Next, the above plasmid and coiled-coil DNA were mixed at a molar ratio of 1:3, Ligation High Ver. 2 (TOYOBO) was added, and the mixture was reacted at 16°C for 30 minutes to obtain a VHH-C expression plasmid. Escherichia coli JM-109 (Takara Bio Inc.) was transformed with the obtained VHH-C expression plasmid. The transformed E. coli JM109 was plated on an agar medium plate and cultured overnight at 37°C. Colonies that appeared on the agar medium were picked and cultured overnight at 37°C. The VHH-C expression plasmid was extracted and further purified using the FasteGene Plasmid Mini Kit (Nippon Genetics Co., Ltd.) according to the attached instructions.

[0142] 2. Expression of VHH-C in C. glutamicum Each of the plasmids prepared as described above was introduced into C. glutamicum by electroporation, and the expression of VHH (homodimers) was confirmed and then purified. The experimental procedures were the same as those described in "2. Expression of VHH (monomer) using C. glutamicum" and "3. Purification of VHH (monomer)" in Example 4 above. An electrophoretic image of SDS-PAGE of VHH (homodimer) is shown in Figure 19. In Figure 19, #1-C represents a VHH clone, and the numbers 10 to 75 represent molecular weights and markers.

[0143] Example 13: Production of VHH (Fc form) For the VHH clone #1 obtained in Example 4 above, VHH (Fc form) (hereinafter sometimes referred to as "VHH-Fc") was expressed using AAVpro293T cells as follows, and this was purified.

[0144] 1. Construction of VHH-Fc expression plasmid A restriction enzyme sequence for ligation with the pFUSE vector (InvivoGen) was added to VHH clone #1 from Example 4 above as follows: First, VHH clone #1 was amplified by PCR using the VHH clone #1 expression plasmid as a template and the primers pFc-VHH#1-F (SEQ ID NO: 56) and pFc-VHH#1-R (SEQ ID NO: 57) shown in Table 9 below, under conditions of 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 5 seconds for 30 cycles. The resulting amplified product was purified using a Gel / PCR Extraction Kit (Nippon Genetics) according to the attached instructions.

[0145] [Table 9]

[0146] Subsequently, FastDigest EcoRI and FastDigest NcoI (both restriction enzymes from Thermo Fisher Scientific) were added to the pFUSE vector and PCR amplification product, and the reaction was allowed to proceed at 37°C for 30 minutes. Next, the enzyme reaction mixture was loaded onto a 1% agarose gel containing 1x Gel Green and electrophoresed at 100 V for 30 minutes. The product was then extracted from the gel using the FastGene Gel / PCR Extraction Kit according to the attached instructions, and further purified. Next, the above-mentioned plasmid vector and VHH#1 DNA were mixed at a molar ratio of 1:3, Ligation High Ver. 2 was added, and the mixture was incubated at 16°C for 30 minutes to obtain a VHH-Fc expression plasmid. Escherichia coli JM-109 was transformed with the obtained VHH-Fc expression plasmid. The transformed E. coli JM109 was plated on an agar medium plate and cultured overnight at 37°C. Colonies that appeared on the agar medium were picked and cultured overnight at 37°C, and the VHH-C expression plasmid was extracted and further purified using the FasteGene Plasmid Mini Kit according to the attached instructions.

[0147] 2. Expression of VHH-Fc using AAVpro293T cells AAVpro293T cells (Takara Bio Inc.) were passaged in 10% FBS-containing D-MEM (High-glucose, Fujifilm Wako Pure Chemical Industries, Ltd.). AAVpro293T cells were seeded onto adherent cell culture dishes and cultured at 37°C in a 5% CO2 environment. The VHH-Fc expression plasmid, PEI MAX (Polysciences), was suspended in Opti-MEM (Gibco) and allowed to stand at room temperature for 30 minutes. The suspension was then added to overnight-cultured AAVpro293T cells for transfection, followed by overnight culture at 37°C in a 5% CO2 environment. The medium was replaced with serum-containing D-MEM, and after 72 hours of culture, the culture supernatant was collected. The collected culture supernatant was filtered through a 0.22 μm filter to remove cells from the supernatant.

[0148] 3. Purification of VHH-Fc The culture supernatant was loaded onto a MonoSpin L ProG column (GL Sciences), followed by purification of VHH-Fc using a MonoSpin ProA / G Buffer Kit (GL Sciences) according to the attached instructions. The purity of the eluted VHH-Fc was confirmed by SDS-PAGE (Figure 20). SDS-PAGE was performed using a 4% stacking gel and a 10% resolving gel. 5 μL of sample was applied to each well and electrophoresed at 150 V for 1 hour. Precision Plus Protein Standard was used as a molecular weight marker. The eluate obtained as described above was dialyzed overnight against PBS at 4°C. The eluate was then transferred to an Amicon Ultra 4, 10 kDa (Millipore) column and centrifuged at 3,500 × g for 30 minutes at 4°C to concentrate the VHH-Fc. The concentration of VHH-Fc was quantified by the BCA method using the Pierce BCA Protein Assay Kit with bovine serum albumin as the standard protein.

[0149] (Example 14) Identification of the extracellular domain of FGFR1 that VHH clone #1 binds to The FGFR1 extracellular domain contains DII and DIII domains. Each FGFR1 extracellular domain (hereinafter referred to as "FGFR1-DIIDIII," "FGFR1-DII," and "FGFR1-DIII") was expressed in AAVpro293T cells as follows. These were purified and subjected to affinity measurement tests with VHH clone #1 using biolayer interferometry (BLI).

[0150] 1. Construction of a plasmid for expressing the FGFR1 extracellular domain First, each DNA was obtained by DNA fragment synthesis (Eurofins Genomics). The plasmid purified in Example 14-1 above, the DNA fragment, and the SLiCE reaction solution were added to an 8-tube PCR tube containing SLiCE buffer containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM ATP, and 1 mM DTT, and the mixture was allowed to react at 37°C for 15 minutes to obtain plasmids for expressing FGFR1-DII, FGFR1-DIII, and FGFR1-DIIDIII. E. coli JM-109 was transformed with each of the resulting plasmids. The transformed E. coli JM109 was plated on an agar plate and cultured overnight at 37°C. Colonies that appeared on the agar plate were picked and cultured overnight at 37°C. The VHH-C expression plasmids were extracted and further purified using the FasteGene Plasmid Mini Kit according to the attached instructions.

[0151] 2.Expression of FGFR1 extracellular domain using AAVpro293T cells The same procedure as in Example 14-2 above was carried out to obtain a culture supernatant containing FGFR1-DIIDIII, FGFR1-DII and FGFR1-DIII.

[0152] 3. Purification of FGFR1 extracellular domain The same procedure as in 3 of Example 14 above was carried out to obtain FGFR1-DIIDIII, FGFR1-DII and FGFR1-DIII (FIG. 21).

[0153] 4. Binding Activity Measurement by Bilayer Interferometry Biolayer interferometry (BLI) was used to measure the binding activity of FGFR1-DIIDIII, FGFR1-DII, and FGFR1-DIII to VHH clone #1. BLI was performed using Octet 384 (Fortebio). VHH clone #1 diluted in kinetic buffer (PBS containing 0.05% Tween 20, pH 7.4) was immobilized on an Anti-Penta-HIS (HIS1K, Fortebio) sensor chip. Two-fold serial dilutions of FGFR1-DIIDIII, FGFR1-DII, and FGFR1-DIII were then allowed to bind to the VHH clone. The dissociation rates were then measured. To prepare for the measurement, the tip of the sensor chip was immersed in 200 μL of kinetics buffer for 10 minutes to hydrate the sensor chip. Then, 70 μL of each measurement solution was added to a 384-well black plate (Fortebio), and the measurement was performed according to the following steps 1) to 6). 1) Baseline step: Baseline measurement in kinetic buffer (30 seconds), 2) Loading step: Immobilization of VHH antibodies onto the sensor (120 seconds), 3) Baseline step: Baseline measurement in kinetic buffer (30 seconds), 4) Association step: Association with each FGFR1 protein (120 seconds), 5) Dissociation step: Measurement in kinetic buffer (120 seconds), 6) Regeneration step: Measurement in glycin-HCl (pH 2.2) for 5 seconds, followed by measurement in kinetic buffer for 5 seconds, repeated three times. After the above measurements were completed, the measured values ​​for the reference (kinetic buffer only) were subtracted from the actual values, and global fitting was performed using a 1:1 binding model using Octet software to calculate the binding activity (Figure 22). The equilibrium dissociation constants (KD) of VHH clone #1 for each FGFR1 protein are shown in Table 10.

[0154] [Table 10]

[0155] (Example 15) Measurement of agonist activity of VHH-C and VHH-Fc To verify the agonistic activity of VHH-C (represented as #1_C in the figure), #1-L4-#1, and #1_Fc obtained in the above examples, changes in the expression levels of Phospho-p44 / 42 MAPK (Erk1 / 2) were examined by Western blotting as follows: bFGF (basic fibroblast growth factor; Fujifilm Wako Pure Chemical Industries, Ltd.) was used as a positive control.

[0156] 1.Cell culture The NIH3T3 cells used were those described in Example 7. 2 × 10 cells were cultured in a 6-well cell culture plate. 5 NIH3T3 cells were seeded at 10 cells / well and cultured overnight (37°C, 5% CO2 incubator, protected from light). After washing with serum-free medium, bFGF (final concentration: 10 ng / mL) or VHH (final concentration: 100 nM) diluted in serum-free medium was added and cultured for 30 minutes. The wells were then washed with ice-cold PBS, and the cells were detached using a cell scraper and transferred to a tube. The cells were then collected by centrifugation at 300 x g for 5 minutes at 4°C. The cells were then solubilized in RIPA buffer containing phosphatase inhibitors and allowed to stand on ice for 30 minutes. After solubilization, the cells were centrifuged at 12,000 x g for 15 minutes at 4°C, and the supernatant was collected. The resulting cell lysate was suspended in 6x SDS-PAGE sample buffer (containing a reducing agent) and subjected to SDS-PAGE and Western blotting.

[0157] 2. Western Blotting For Western blotting, the primary antibodies used were anti-p44 / 42 MAPK (Erk1 / 2) (137F5) (#4695, CST), anti-phospho-p44 / 42 MAPK (Erk1 / 2) (Thr202 / Tyr204) (D13.14.4E) (#4370, CST), and anti-β-Actin (13E5) (#4970, CST). The secondary antibody was anti-rabbit IgG, HRP-linked antibody (#7074, CST). In Figure 23, NC indicates a negative control without additives, monomer indicates Clone #1 monomer, and bFGF (FGF) indicates a positive control. Figure 23(A) confirms the expression of p44 / 42 MAPK (Erk1 / 2) alone, and Figure 23(B) confirms the expression of phosphorylated p44 / 42 MAPK (Erk1 / 2). The detection of phosphorylated peptides was confirmed using β-Actin in Figure 23(C). The results confirmed that #1_C, #1-L4-#1, and #1_Fc all exhibited agonistic activity when NIH3T3 cells were used.

[0158] (Example 16) Measurement of cell proliferation activity of VHH-C and VHH-Fc The same procedures as in Example 10 above were carried out to measure the cell proliferation activity of VHH-C and VHH-Fc (FIG. 24).

[0159] (Example 17) Evaluation of iPS cell culturing (proliferation ability and maintenance of undifferentiated state) 1. Evaluation Preparation (Cell sleep) 10 mL of TeSR-E8 medium (Stemcell Technologies, ST05990) was added to a 15 mL PP tube and warmed in a thermostatic water bath (set at 37°C). The required amount of medium was collected in a separate tube, supplemented with Y-27632 at 10 μM, and warmed at room temperature. A stock tube of 253G1 cells (provided by the Kyoto iPS Cell Research and Application (CiRA)) stored in liquid nitrogen vapor was removed from the liquid nitrogen container and thawed in a thermostatic water bath (set at 37°C). The cells were then quickly pipetted into the warmed tube (containing 10 mL of medium) in a clean bench (PHC, C / N: MCV-B131S-PJ). After mixing by pipetting, the mixture was centrifuged (200 × g, 5 minutes), and the supernatant was then removed using an aspirator.

[0160] An appropriate amount of complete TeSR-E8 (prepared according to the TeSR-E8 manual; hereafter referred to as cTeSR-E8) warmed to room temperature was added to the cells and mixed. After that, the cell number was evaluated using a cell counter (Bio-Rad, C / N: TC-20). 2 ) (Nippi, 892012) coated plates were cultured with 1-5 × 10 253G1 cells. 5 The cells were seeded into a 6-well plate at a seeding density of 1 / well and placed in a 37°C, 5% CO2 incubator (PHC, C / N: MCO-170AICUV-PJ). The following day, the medium was replaced with cTeSR-E8 (without Y-27632). Similar medium changes were performed as appropriate from the day after that. After 3-5 days of culture, cell proliferation was confirmed, and the cells were passaged when they reached 50-90% confluence.

[0161] (Cell passage) Cells were observed under a microscope and passaged when the cells cultured on a 6-well plate were 50-90% confluent. The required amount of cTeSR-E8 was collected in a PP tube, and Y-27632 was added to a concentration of 10 μM. The tube was then warmed to room temperature. After washing the cells with D-PBS (Fujifilm Wako Pure Chemical Industries, Ltd., C / N: 045-29795), 300 μL of TrypLE Select Enzyme (ThermoFisher Scientific, 12604013) was added and the cells were placed in a 37°C, 5% CO2 incubator.

[0162] After 5-10 minutes, the culture vessel was removed from the CO2 incubator. After confirming under a microscope that the cells had become rounded, 1 mL of cTeSR-E8 was added to each well, and the cells were detached and suspended by pipetting. The cells were then collected in a 15 mL PP tube. The tube was centrifuged (200 × g, 5 minutes), and the supernatant was removed using an aspirator. An appropriate amount of cTeSR-E8 was added to the cell pellet and mixed by pipetting.

[0163] A portion of the cell suspension was collected and the cell number was assessed using a cell counter. The cell suspension was diluted appropriately with cTeSR-E8 and plated onto a new iMatrix-511-coated 6-well plate at a concentration of 0.1–5 × 10 cells. 5 The cells were seeded at 1000 x g / well. The volume was adjusted to 2 mL per well. The next day, the cTeSR-E8 was warmed to room temperature and used for medium replacement. During the culture period, the cells were observed under a microscope as needed, and images were taken and recorded as necessary. Medium replacement was performed in the same manner from the day after that.

[0164] 2. Evaluation (Evaluation purposes) To investigate whether VHHs can be used as an alternative to basic FGF in cTeSR-E7 medium, we evaluated the cell proliferation and undifferentiation potential of iPS cells. We also evaluated whether VHHs maintained their functionality after 3–4 weeks of storage at 4°C.

[0165] 2.1. Cell proliferation assessment (Evaluation Procedure) Complete TeSR-E6 (Stemcell Technologies, ST05946) was prepared according to the manufacturer's instructions. cTeSR-E7 was prepared by adding frozen stock TGF-β1 (R&D Systems, 240-B-002) diluted to 20 μg / mL with 0.1% w / v BSA and 4 mM HCl to a final concentration of 2 ng / mL. cTeSR-E7 was prewarmed to room temperature. Cells were cultured in cTeSR-E8 and passaged at 50-90% confluence. After washing with D-PBS, 300 μL of TrypLE Select was added per well to detach and recover the cells. After centrifugation, the supernatant was removed, and an appropriate amount of cTeSR-E7 was added to the pellet and suspended by pipetting.

[0166] The cell suspension was collected and the cell number was evaluated using a cell counter. A portion of the cell suspension was collected into a new 15 mL PP tube, and fresh cTeSR-E7 was added to obtain a cell count of 0.5–5 × 10 4 The cells were diluted to a concentration of 100 ng / mL. Stocks of basic FGF (PeproTech, AF-100-18B) (prepared with 0.1% BSA / PBS to a concentration of 10 μg / mL and stored in a freezer (-80°C). The amino acid sequence of basic FGF is SEQ ID NO: 58. Note that "basic FGF" may also be referred to as "bFGF") or VHH (homodimer (SEQ ID NO: 23, sequence name #1-L4-#1, hereinafter also referred to as "VHH (homodimer)"), 10 μg / mL) were thawed and added separately to the cell suspension at a concentration of 100 ng / mL. A cell suspension without addition was also prepared as a negative control.

[0167] Add 0.1-1 x 10 cells to a 6-well plate. 5The cells were seeded at a density of 2 mL / well and placed in a 37°C, 5% CO2 incubator. The following day, cTeSR-E7 cells were supplemented with the appropriate additives, i.e., basic FGF (positive control) or VHH (evaluation sample), or no additives (negative control), and these were used for medium changes in each group. During the culture period, cells were observed under a microscope as needed, and images were taken and recorded as necessary. Medium changes were also performed as needed from the day after that. Subculture was performed on days 5 to 7. However, at the time of subculture, the cell count in each well was individually assessed using a cell counter, and the cell suspensions from each group were mixed. The individual cell count values ​​were averaged and used to prepare the cell suspension for the next cell seeding. The individual cell count values ​​were used to calculate the cell growth line.

[0168] (result) Table 11 shows the individual count results, and Table 12 shows the cumulative cell counts calculated from the count values. Figure 25 is a graph showing the cumulative cell counts. Figure 26 is an image of the cells (3rd passage, Day 5). No differences in proliferation ability or cell morphology were observed between the two groups over the 3-4 week culture period. Furthermore, cells in the group to which no supplements were added to cTeSR-E7 had low proliferation ability, and after the first passage, cell morphology changed and they did not maintain their undifferentiated state, so culture was discontinued.

[0169] [Table 11]

[0170] [Table 12]

[0171] 2.2. Evaluation of undifferentiated tumors (Evaluation Procedure) Each group was cultured in the appropriate medium for 3 to 5 weeks, and the following procedures were performed on the 4th to 7th day of passage. After washing the cells with D-PBS, 1 mL / well of 4% formaldehyde was added. After leaving the cells to stand for at least 30 minutes, the solution was removed and the cells were washed with D-PBS. 0.1% Triton X-100 / D-PBS was added and the cells were left to stand at room temperature for 3 to 5 minutes. After washing with D-PBS, 1% BSA / D-PBS was added and the cells were left to stand for 30 minutes.

[0172] Antibodies for staining undifferentiated markers, such as OCT4 (Abcam, ab19857) and SSEA4 (Abcam, ab16287), were diluted appropriately in 1% BSA / D-PBS and added to the wells for 30–60 minutes. After washing with D-PBS, secondary antibodies (goat anti-rabbit IgG antibody (Abcam, ab150115) and goat anti-mouse IgG antibody (Abcam, ab150077)) were diluted appropriately in 1% BSA / D-PBS and added to the wells for 30–60 minutes, protected from light by aluminum foil. DAPI (Dojindo Laboratories, 340-07971) was diluted to 1–10 μg / mL in 1% BSA / D-PBS and added to the wells for 5 minutes. After washing two or three times with D-PBS, 1 mL of D-PBS was added to the wells. The cells were observed under a fluorescence microscope and images were taken.

[0173] (result) Figure 27 shows images of undifferentiated marker staining (2 passages, Day 6 (20th day of culture)). Both basic FGF-supplemented medium and VHH-supplemented medium were positive for the undifferentiated markers OCT4 and SSEA4, suggesting that the iPS cells maintained their undifferentiated state even after 20 days of culture.

[0174] 2.3.Storage stability evaluation (Evaluation Procedure) Stocks of basic FGF and VHH were collected into 1.5 mL microtubes 3 to 4 weeks before culture and stored in a refrigerator (4°C). The procedures for cell proliferation assessment were all the same, except that basic FGF and VHH were prepared using both refrigerated (4°C) and frozen (-80°C) stocks at 20 ng / mL.

[0175] (result) VHHs stored at 4°C showed similar proliferation ability to those stored at -80°C, indicating that they maintained their function. On the other hand, basic FGF showed a marked decrease in proliferation ability when stored at 4°C, indicating that it did not maintain the original function of basic FGF (data not shown).

[0176] (Example 18) Evaluation of MSC culturing ability (proliferation ability and maintenance of undifferentiated state) 1. Evaluation Preparation Cell sleep Ten mL of D-MEM medium (Low Glucose, Glutamin) (Fujifilm Wako Pure Chemical Industries, C / N: 041-29775) was added to each 15 mL PP tube and warmed in a constant temperature water bath (set at 37°C). A stock tube of human bone marrow-derived MSCs (Stemcell Technologies, C / N: 70022) stored in liquid nitrogen vapor was removed from the liquid nitrogen container and thawed in a constant temperature water bath (set at 37°C). The cells were then quickly transferred with a pipette into a tube (containing 10 mL of medium) that had been warmed to 37°C in a clean bench and mixed by pipetting. The tube was centrifuged (300 × g, 5 minutes), and the supernatant was removed using an aspirator.

[0177] An appropriate amount of room-temperature D-MEM was added to the cell pellet and mixed, after which the cell count was assessed using a cell counter. An appropriate amount of cell suspension was transferred to a 15 mL PP tube and centrifuged (300 × g, 5 minutes). The supernatant was removed, and an appropriate amount of D-MEM (containing 10% or 20% FBS (ThermoFisher Scientific, 16140071)). Stocks should be stored refrigerated and used within 2 weeks) was added to the cell pellet to prepare cell suspension (1).

[0178] The cell number was again assessed using a cell counter and diluted appropriately with the respective medium. Next, basic FGF or VHH stock was added to the cell suspension (1) to a final concentration of 1 ng / mL or 20 ng / mL, respectively. 3-5 x 10 4 The cells were seeded onto a CellBIND 6-well plate (Corning, C / N: 3335) at a density of 1000 / well. After 2 to 4 days, the medium was replaced with D-MEM (containing 10% or 20% FBS).

[0179] (Cell passage) Cells were observed under a microscope and generally subcultured 5 days after seeding. The amount of D-MEM (0% FBS, 10% FBS, or 20% FBS) to be used was pre-warmed in a thermostatic water bath (set to 37°C). After washing the cells with D-PBS, 500 μL of TrypLE Express was added and the cells were placed in a CO2 incubator. After 5–10 minutes, the culture vessel was removed from the CO2 incubator, and after confirming a change in cell morphology under a microscope, 1 mL of D-MEM was added to each well. The cells were detached and suspended by pipetting and then collected in a 15 mL PP tube.

[0180] The tubes were centrifuged (300 × g, 5 minutes) and the supernatant was removed using an aspirator. An appropriate amount of D-MEM medium (containing 10% or 20% FBS) was added to the cell pellet and mixed by pipetting. A portion of the cell suspension was collected and the cell number was assessed using a cell counter. After counting each well, cell suspensions from the same group were pooled into a single tube and mixed. The average value of each well was used to calculate the cell number at the time of passage.

[0181] The cell suspension was diluted appropriately with D-MEM (10% FBS or 20% FBS). 3–5 × 10 cells were placed in a new CellBIND 6-well plate. 5The cells were seeded at 1000 x g / well. The volume was adjusted to 2 mL per well. After 2-4 days, the medium was replaced with room temperature medium. During the culture period, the cells were observed under a microscope as appropriate, and images were taken and recorded as necessary.

[0182] 2. Evaluation (Evaluation purposes) Using fibroblasts, we will examine whether VHHs can be used as an alternative additive to basic FGF in D-MEM (containing 10% or 20% FBS) medium.

[0183] 2.1. Cell proliferation assessment (Evaluation Procedure) The average cell count per well obtained at each passaging was used to create a cell growth line. The cell count per well at each passaging was divided by the cell count at seeding, which was defined as the proliferation fold for that period. This fold was used to calculate the cumulative cell count. If the cell count per well at the first seeding is P(0) and the cell count at the Nth passage is P(N), the cumulative cell count at each passage can be calculated using the following formula: Cumulative cell number (P1) = initial seeding number / well (P0) x proliferation fold (P0-P1) Cumulative cell number (P(N)) = Cumulative cell number (P(N-1)) × proliferation fold (P(N-1) ~ P(N)) The growth line was created by plotting the cumulative cell numbers calculated by the above formula at each passage and then drawing an approximate line using Excel. However, this evaluation was performed at a fixed concentration of 20 ng / mL for VHH and basic FGF.

[0184] (result) Table 13 shows the seeding and cell numbers (average values) at each passage, and Table 14 shows the cumulative cell numbers (average values).

[0185] Figure 28 shows the morphology of MSCs (4 passages, day 1). When 10% FBS was used, cells were flattened at low VHH concentrations (1 ng / mL), which differed from that observed in the presence of basic FGF. However, cells at high VHH concentrations (20 ng / mL) showed a morphology similar to that observed in the presence of basic FGF. In contrast, cells in 20% FBS showed a similar morphology regardless of the concentration of VHH added.

[0186] A graph of the cumulative cell numbers is shown in Figure 29. Basic FGF and VHH showed almost the same proliferation ability regardless of the concentration of added FBS.

[0187] [Table 13]

[0188] [Table 14]

[0189] 2.2.MSC marker evaluation (Evaluation Procedure) Five days after initial seeding, D-PBS was added to the cells and then aspirated. 500 μL of TrypLE Express was added to each well, and the cells were placed in a CO2 incubator for 5-10 minutes. After observing the cells under a microscope and confirming that their morphology had changed, medium was added, and the cells were pipetted into a PP tube and centrifuged (300 × g, 5 minutes). After centrifugation, the supernatant was aspirated, and an appropriate amount of 1% BSA / PBS was added to the pellet and pipetted to form a suspension.

[0190] A portion of the suspension was collected and the cell count was assessed using a cell counter. The cells were diluted with 1% BSA / PBS and diluted to 0.6–1.0 × 10 6 Dispense 50 μL into 2 mL tubes and add 3 to 5 × 10 4The antibodies (CD90: R&D Systems, FAB2067G; CD105: R&D Systems, FAB10971P; CD73: R&D Systems, FAB5795P; isotype control (for CD73): R&D Systems, IC0041P; isotype control (for CD90): R&D Systems, IC003G; isotype control (for CD105): R&D Systems, IC002P) were diluted in 1% BSA / PBS to twice the final concentration and prepared as needed.

[0191] The suspension subjected to the cell counter was mixed with an equal volume of the prepared antibody solution and left on ice for at least 30 minutes in the dark. 1% BSA / PBS was added, and the mixture was centrifuged (400-600 × g, 5 minutes). The supernatant was then aspirated. 300-500 μL of 1% BSA / PBS was then added, and the pipetted sample was analyzed by flow cytometry using an Attune NxT Flow Cytometer (ThermoFisher Scientific).

[0192] (result) Figure 30 shows a comparison of MSC marker expression (passage 4, 10% FBS), and Figure 31 shows a comparison of MSC marker expression (passage 4, 20% FBS). As can be seen from Figures 30 and 31, CD105 and CD73 were expressed in over 98% of cells, regardless of the concentration of basic FGF and VHH. On the other hand, the number of CD90-expressing cells decreased inversely with the concentration of basic FGF. In particular, at 20 ng / mL, CD90-expressing cells were less than 95%, failing to meet the minimum criteria for human MSCs recommended by the International Society for Cellular Therapy (ISCT). However, with VHH, over 97% of cells were positive at both concentrations, indicating a clear advantage. This result was similar whether 10% or 20% FBS was added.

[0193] The International Society for Cellular Therapy has proposed the following minimum criteria for defining human MSCs: (1) the ability to adhere to plastic under standard culture conditions; (2) the cell surface markers CD73, CD90, and CD105 are positive, and CD11b or CD14, CD19 or CD79α, CD34, CD45, and HLA-DR are negative; and (3) the ability to differentiate into osteoblasts, chondrocytes, and adipocytes. As described above, VHH demonstrated superiority over conventional recombinant bFGF in maintaining cell quality.

[0194] 2.3. Evaluation of adipogenesis induction (Evaluation Procedure) CellBIND for the third passage (R) After culturing in a 24-well transparent multiwell plate (Corning, C / N: 3337), the medium was changed to MesenCult Stem Cell Adipogenic Differentiation Medium (PromoCell, C / N: C-28016) when the cells reached 80-90% confluence. For negative control cells, D-MEM (10% FBS or 20% FBS) was used. The medium was changed every 2-4 days.

[0195] Fourteen days after seeding, 500 μL of 4% paraformaldehyde in phosphate buffer was added per well and allowed to stand for at least 2 hours. After fixation, 500 μL of purified water was added per well. Oil Red stock solution (Cosmo Bio, C / N: AK09F) and purified water were mixed at a 6:4 ratio and allowed to stand at room temperature for 10–15 minutes. The mixture was then filtered through a 0.5–1.0 μm pore size membrane filter, and the filtrate was designated Oil Red O solution. 500 μL of Oil Red O solution was added per well and allowed to stand at room temperature for 15 minutes. The Oil Red O solution was then removed, and the wells were washed with purified water at least three times until the water was clear. The water was then completely removed, the wells were dried, and the wells were observed and images were captured under a microscope. Extraction solution, isopropyl alcohol (Cosmo Bio, C / N: AK09F), was added to the dried wells to elute the dye. 100 μL of the eluate was transferred to a 96-well plate, and the absorbance at 520 nm was measured. However, the evaluation was performed with the concentrations of basic FGF and VHH fixed at 20 ng / mL.

[0196] (result) Figure 32 shows images of adipogenic induction (after three subcultures), and Figure 33 shows a graph of the quantitative evaluation of Oil Red O extracted after adipogenic differentiation. Similar differentiation was observed in both basic FGF- and VHH-supplemented media, suggesting that MSCs maintain their ability to differentiate into adipocyte lineages.

[0197] 2.4. Evaluation of bone differentiation induction (Evaluation Procedure) CellBIND for the third passage (R) After culturing in a 24-well transparent multiwell plate, the medium was changed to MesenCult Stem Cell Osteogenic Differentiation Medium (PromoCell, C / N: C-28013) when the cells reached 80-90% confluence. For negative control cells, the medium was changed to D-MEM (10% FBS or 20% FBS). The medium was changed every 2-4 days.

[0198] Fourteen days after seeding, 500 μL of 4% paraformaldehyde in phosphate buffer was added per well and allowed to stand for at least 2 hours. After fixation, 500 μL of purified water was added per well. 500 μL of alizarin red solution (PG Research, ARD-SET) was added per well and allowed to stand at room temperature for 30 minutes. The alizarin red solution was removed, and the wells were washed with purified water at least three times until the water became clear. The water was completely removed, the wells were dried, and the wells were observed under a microscope and images were captured. 500 μL of calcified nodule dissolving solution (PG Research, ARD-SET) was added to each well and allowed to simmer for 10 minutes to elute the dye. 100 μL of the eluate was transferred to a 96-well plate, and the absorbance at 450 nm was measured. Evaluation was performed using basic FGF and VHH at a fixed concentration of 20 ng / mL.

[0199] (result) Figure 34 shows images of osteogenic differentiation (after three passages). Figure 35 shows a graph of the quantitative evaluation of alizarin red extracted after osteogenic differentiation. Differentiation was observed in both basic FGF- and VHH-supplemented media, suggesting that MSCs maintained their differentiation potential. As described above, the single domain antibodies provided by the present invention have been shown to be able to replace human bFGF in the culture of iPS cells and MSCs to maintain their undifferentiated state and differentiation potential. Single domain antibodies have extremely high heat resistance, with Td values ​​of 70°C or higher, making them proteins with excellent structural stability. Therefore, they are superior to human bFGF in terms of solution storage, transportation, and other aspects of practical use.

[0200] The cell culture method of the present invention is an extremely useful technique in the field of regenerative medicine, since it can maintain the undifferentiated state, differentiation potential, and viability of stem cells at a high level.

[0201] (Example 19) Evaluation of fibroblast culturing 1. Promotion of fibroblast proliferation by VHH (homodimer) The mouse fibroblast cell line NIH / 3T3 was used as the fibroblast. The mouse fibroblast cell line NIH / 3T3 was obtained from ECACC via a domestic distributor. After expansion, the cells were cryopreserved at -80°C using CellBanker1 plus (Zenoac). Maintenance culture was performed in D-MEM (high glucose: Fujifilm Wako Pure Chemical Industries, Ltd., hereafter referred to as "DMEM"), 10% bovine serum (New Zealand origin: Thermo Fisher Scientific, hereafter referred to as "CS"), and 100U Pen-Strep (Thermo Fisher Scientific, hereafter referred to as "PS(+)"). Passage procedures were performed using Trypsin-EDTA (Thermo Fisher Scientific) and D-PBS(-) according to the supplier's instructions. Cell proliferation assays were performed using cells at passages 3 to 10.

[0202] The bFGF cell proliferation assay was performed as follows: On day 1, 2.5 × 10 cells were cultured in a DMEM, 10% CS, and PS(+) medium. 4 A suspension containing 100 cells / mL was prepared and seeded at 100 μL / well into a CulturPlate-96 (White Opaque 96-well Microplate, Perkin Elmer, Cat# 6005680) and cultured at 37°C and 5% CO2 for 16–24 hours. On day 2, the medium was replaced with serum-free DMEM, PS(+) containing bFGF (PeproTech Cat# AF-100-18B) or various test substances (antibodies or bFGF), and cultured for an additional 2 days. On day 4, the 96-well plate was left at room temperature for 30 minutes, after which 100 μL of room-temperature Cell Titer Glo 2.0 Reagent (Promega) was added to each well and mixed at 500 rpm for 2 minutes. After allowing to stand for an additional 8 minutes, the luminescence in each well was measured using a Synergy HTX plate reader (BioTek) at a gain setting of 200 and a measurement time of 1 second per well. The antibody used was a VHH homodimer (SEQ ID NO: 23, sequence name #1-L4-#1; hereinafter also referred to as "single domain antibody").

[0203] Measurements were made at three points for each concentration of the test substance, and for measurements at a single concentration, 100 ng / mL bFGF was used as the positive control and no addition was used as the negative control. 50 For the measurement, a 2-fold dilution series starting from 100 ng / mL (bFGF) was prepared for 12 concentrations and used for the measurement. 50 The measurement data was fitted to a 4-parameter fit using the control software attached to the plate reader in the usual way, and the EC 50 The value was calculated.

[0204] As shown in Figure 36, the EC 50 The EC of bFGF was 11.6 nM. 50 The EC value was 5.1 nM. 50 It was found to have the following.

[0205] 2. Inhibition of growth factor activity of VHH homodimers by FGFR inhibitors To confirm whether VHH homodimers exert cell proliferation activity via FGFR, we examined proliferation inhibition by an FGFR kinase inhibitor. NVP-BGJ398 (IC value for FGFR1 / FGFR2 / FGFR3) was used as a kinase inhibitor, which shows selective inhibitory activity against FGFR. 50 The same procedures as in the bFGF cell proliferation assay were performed for no addition (-), 10 ng / mL and 100 ng / mL bFGF, and 10 ng / mL and 100 ng / mL VHH homodimer (SEQ ID NO: 23, sequence name #1-L4-#1; sometimes referred to as single domain antibody). Simultaneously with the addition of these, 20 nM NVP-BGJ398 (ChemScene) was added, and a comparison was made with the no addition control under the same conditions as in "1. Promotion of fibroblast proliferation by VHH (homodimer)" above.

[0206] We also confirmed separately that 20 nM NVP-BGJ398 itself had little effect on cell proliferation. We then examined whether the cell proliferation activity of bFGF and single-domain antibodies was inhibited by NPV-BGJ398, an FGFR kinase inhibitor.

[0207] As shown in Figure 37, the addition of NPV-BGJ398, an FGFR kinase inhibitor, suppressed cell proliferation induced by bFGF and single domain antibodies, confirming that single domain antibodies, like bFGF, have FGFR-mediated cell proliferation activity.

[0208] 3. Comparison of solution storage stability between bFGF and VHH homodimer bFGF and VHH homodimer (SEQ ID NO: 23, sequence name #1-L4-#1, sometimes referred to as single-domain antibody) were mixed at a concentration of 0.5 mg / mL in D-PBS solution (-) (Fujifilm Wako Pure Chemical Industries, Ltd.) and incubated at 37°C for 1 week. The ability of the incubated VHH homodimer, incubated bFGF, VHH homodimer thawed from frozen storage, and bFGF immediately after reconstitution of lyophilized product in D-PBS to promote proliferation of the four test fibroblasts was evaluated. As a negative control, cultures without either bFGF or VHH homodimer were also performed. Culture conditions were the same as in items 1 and 2 of this example, and cell proliferation was evaluated by counting the number of cells on day 2 after the start of culture.

[0209] As shown in Figure 38, the single domain antibody incubated at 37°C for one week (center column in Figure 38) exhibited cell proliferation activity similar to that of bFGF immediately after dissolution (rightmost column in Figure 38). Furthermore, the single domain antibody after incubation exhibited proliferation activity similar to that of the single domain antibody after thawing after cryopreservation (data not shown). On the other hand, in the case of bFGF, the culture-promoting ability after one week of incubation at 37°C was similar to that of the untreated control (leftmost column in Figure 38) (data not shown).

[0210] From the above, it was found that the storage stability of single-domain antibodies (VHH homodimers) in solution is overwhelmingly higher than that of bFGF, and that they can be used more effectively than bFGF in cell cultures such as fibroblasts and stem cells.

[0211] The receptor tyrosine kinase agonist of the present invention is highly stable and can be used as a substitute for human fibroblast growth factor 2 (FGF2) during cell culture of human iPS cells. Moreover, only a small amount is required, which contributes to reducing the cost of iPS cell culture.

[0212] [Sequence List] The base sequence and amino acid sequence are shown below.

[0213] [Table 15]

[0214] [Table 16]

[0215] [Table 17]

[0216] [Table 18]

[0217] [Table 19]

[0218] The amino acid sequences of VHH monomer Clone #1 (VHH Clone #1) and VHH monomer clone #2 (VHH Clone #2) are shown in Table 20. Furthermore, the amino acid sequences of the tandem dimers are shown in Tables 10+X and 11+X. [Table 20]

[0219] [Table 21]

[0220] [Table 22]

[0221] The amino acid sequences of the CDR3 region of VHH clone #1 (#1-CDR) and the CDR3 region of VHH clone #2 (#2-CDR) are shown in the table below.

[0222] [Table 23]

[0223] The framework sequences 1 to 4 of humanized VHH, human VH reference, universal VHH, CAMDR, LAMGL, and VICPA are shown in the table below. Amino acid numbers are based on Kabat numbering (Dondelinger, Mathieu et al., Understanding the Significance and Implications of Antibody Numbering and Antigen-Binding Surface / Residue Definition, Frontiers in Immunology, 2018, Vol. 9, p. 2278).

[0224] [Table 24]

[0225] [Table 25]

[0226] [Table 26]

[0227] [Table 27]

[0228] [Table 28] [Industrial Applicability]

[0229] The receptor tyrosine kinase agonists of the present invention are useful in the technical fields of cell culture and stem cell culture.

Claims

1. a single domain antibody having cell proliferation activity, which is an agonist of at least one receptor tyrosine kinase selected from the group consisting of human fibroblast growth factor receptor 1 (FGFR1), human fibroblast growth factor receptor 2 (FGFR2), human fibroblast growth factor receptor 3 (FGFR3), and human fibroblast growth factor receptor 4 (FGFR4); the amino acid sequence of CDR1, which is a complementarity determining region of the single domain antibody, is the amino acid sequence represented by SEQ ID NO:59; the amino acid sequence of CDR2, which is a complementarity determining region of the single domain antibody, is the amino acid sequence represented by SEQ ID NO: 60; the amino acid sequence of CDR3, which is a complementarity determining region of the single domain antibody, comprises the amino acid sequence represented by SEQ ID NO: 29; The receptor tyrosine kinase agonist is a dimer in which the single domain antibodies having the same amino acid sequence are linked by a linker.

2. Cell proliferation activity EC ５０ 2. The receptor tyrosine kinase agonist of claim 1, wherein the agonist has a vasoconstriction value of 10 μg / mL or less.

3. The receptor tyrosine kinase agonist of claim 1 , wherein the linker is an oligopeptide linker or a chemical linker.

4. 2. The receptor tyrosine kinase agonist according to claim 1, which has a denaturation temperature (Td) of 65°C or higher.

5. The equilibrium dissociation constant (KD) is 5 x 10 －９ 2. The receptor tyrosine kinase agonist of claim 1, wherein the agonist is M or less.

6. The receptor tyrosine kinase agonist of claim 1 or 2, wherein the single domain antibody comprises an amino acid characterized by any one of the following (1) to (5) at a position defined by Kabat numbering: (1) The 37th amino acid is any amino acid selected from the group consisting of tyrosine (Y), phenylalanine (F), and valine (V). (2) The 41st amino acid is proline (P). (3) The 44th amino acid is any amino acid selected from the group consisting of glutamine (Q), glycine (G), glutamic acid (E), and lysine (K). (4) The 45th amino acid is arginine (R) or leucine (L). (5) The 47th amino acid is any amino acid selected from the group consisting of leucine (L), alanine (A), tryptophan (W), glycine (G), and phenylalanine (F).

7. The receptor tyrosine kinase agonist according to claim 1, wherein the linker is an oligopeptide linker, and the amino acid sequence of the oligopeptide linker is the amino acid sequence represented by SEQ ID NO:

16.

8. A cell culture medium composition comprising the receptor tyrosine kinase agonist according to claim 1 at a concentration of 0.1 ng / mL to 10 μg / mL.

9. 9. The cell culture medium composition according to claim 8, wherein the cells proliferated by the cell proliferation activity are at least one type of cells selected from the group consisting of fibroblasts, mesenchymal stem cells, and iPS cells.

10. A composition for maintaining the undifferentiated state of stem cells, comprising the receptor tyrosine kinase agonist according to claim 1 as an active ingredient.

11. The composition for maintaining an undifferentiated state according to claim 10, wherein the stem cells are mesenchymal stem cells or iPS cells.

Images