Novel transplant cells with reduced immunogenicity

A gene editing method targeting the CIITA and B2M genes using guide RNA and RNA-guided endonucleases suppresses HLA type II protein expression, combined with HLA-E introduction, creates low immunogenic cells for long-term therapeutic efficacy in allogeneic transplantation.

JP7818537B2Active Publication Date: 2026-02-20GC CELL CORP
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2022578885
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-07-06
Filing Date
2021-07-06
Publication Date
2026-02-20
Estimated Expiration
2041-07-06

AI Technical Summary

Technical Problem

Current allogeneic NK cell transplantation faces challenges such as short persistence in recipients, immune rejection, and side effects like graft-versus-host disease, with cytokines like IL-2 potentially amplifying regulatory T cells, and the need for improved immunogenicity suppression in therapeutic cells.

Method used

A gene editing method targeting specific portions of the CIITA and B2M genes using guide RNA and RNA-guided endonucleases to suppress HLA type II protein expression, combined with introducing HLA-E to stimulate inhibitory receptors, is employed to create low immunogenic mammalian cells for long-term activity.

Benefits of technology

The method results in low immunogenic cells that persist longer in recipients, minimizing immune rejection and maintaining therapeutic efficacy, thereby enhancing therapeutic efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007818537000014
    Figure 0007818537000014
  • Figure 0007818537000015
    Figure 0007818537000015
  • Figure 0007818537000016
    Figure 0007818537000016
Patent Text Reader

Abstract

The present invention relates to a composition for inhibiting the immunogenicity of mammalian cells and a method for producing low-immunogenic mammalian cells using the same. The present invention can be useful as an efficient cell therapy agent for allogeneic transplantation of stem cells or immune cells for the treatment of diseases, which maintains long-term activity while minimizing immune rejection in the recipient's body.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to novel cell therapy agents with reduced immunogenicity using gene editing for efficient allogeneic transplantation. [Background technology]

[0002] Natural killer cells (NK cells) are lymphocyte cells that account for approximately 10% of blood cells and play an important role in immune responses. NK cells perform various functions, particularly killing cancer cells and cells infected with exogenous pathogens, and eliminating abnormal cells that may become diseased.

[0003] Most NK cells in the body are normally in an inactivated state, but to use them for therapeutic purposes, activated NK cells are required, and research into activating NK cells from normal blood or patient blood is actively underway. When NK cells are activated ex vivo, they exhibit high cytotoxicity, demonstrating their applicability in immune cell therapy. The therapeutic effects of ex vivo activated NK cells have also been confirmed when administered after allogeneic bone marrow transplantation to patients with various cancers, particularly blood cancers such as leukemia (Blood Cells Molecules & Disease, 33: p261-266, 2004).

[0004] Meanwhile, current NK cell-based anti-cancer immunotherapy focuses on NK cell inhibitory receptors. Specifically, the goal is to enhance NK cell activity by blocking the function of inhibitory receptors that suppress NK cell activity. To achieve this, the most common methods are to use allogeneic natural killer cells from donors whose major histocompatibility complex (MHC) is mismatched with the recipient, or to block inhibitory receptor function with antibodies. Because the MHC Class I genotypes of the donor and recipient are different, the inhibitory receptors (e.g., KIRs) on donor NK cells cannot recognize the recipient's MHC Class I, preventing their activity from being suppressed. Therefore, allogeneic NK cells are free from the inhibition of activity by MHC Class I that may still be present on cancer cells, and are therefore expected to exhibit more effective anti-cancer activity than the patient's own NK cells. The many benefits of allogeneic NK cells in anti-cancer therapy were first recognized through the effectiveness of allogeneic hematopoietic stem cell transplantation (HSCT) in treating patients with blood cancers. Further research revealed that a significant portion of the graft-versus-leukemia (GVL) response in allogeneic hematopoietic stem cell transplants is due to NK cells. Based on this, numerous attempts have been made to culture and activate pure allogeneic NK cells isolated from healthy donors in large quantities in vitro and then administer them to cancer patients. These attempts have demonstrated effective anti-cancer activity against acute myeloid leukemia (AML) and multiple myeloma (MM). However, in cases of allogeneic hematopoietic stem cell transplantation with complete MHC class I mismatch, the expected anti-cancer activity is often not observed in some patients, and serious side effects, such as infections caused by the immunosuppressants included in the conditioning regimen, have also been reported.Furthermore, recent research has revealed that NK cell differentiation requires interaction between inhibitory receptors and target cell MHC Class I (the "education" or "licensing" process) to acquire sufficient anti-cancer activity. Therefore, it is predicted that a certain degree of MHC Class I identity between the donor and recipient is necessary to obtain mature NK cells with sufficient anti-cancer activity. Therefore, haploidentical hematopoietic stem cell transplantation (HSCCT), in which one of various MHC Class I domains matches, and NK cells are currently widely used in the treatment of hematologic cancers, and this has been shown to result in relatively favorable clinical outcomes. Furthermore, while allogeneic immune cells used as cell therapy inevitably cause side effects such as graft-versus-host disease (GVHD), in which the recipient's own cells are attacked, such problems have rarely been reported with allogeneic NK cells. This is because, unlike cancer cells, normal cells rarely express ligands for NK cell activating receptors and do not induce NK cell activation. Currently, active research is being conducted into the use of allogeneic NK cells as a cell therapy agent for other solid cancers in addition to blood cancers (Kim, HS, Hanyang Med Rev, 33:59-64, 2013).

[0005] Another problem with allogeneic NK cell transplantation is that transplanted NK cells do not persist for long in the recipient. To overcome this problem, attempts have been made to periodically administer IL-2, a cytokine that can induce NK cell proliferation, after transplantation. However, IL-2 can also expand regulatory T cells (Tregs), which suppress anti-cancer immune responses, which can be a major problem (Romagne F, Vivier E., F1000 Med Rep, 3:9, 2011; Waldmann TA., Nat Rev Immunol, 6:595-601, 2006).

[0006] Numerous papers and patent documents are referenced throughout this specification and citations are provided, the disclosures of which are incorporated herein by reference in their entirety to more clearly describe the state of the art and the content of the present invention. Summary of the Invention [Problem to be solved by the invention]

[0007] The present inventors have conducted extensive research to develop an efficient cell therapy agent that maintains long-term activity while minimizing immune rejection in the patient's body. As a result, they discovered that when a gene editing method targeting a type II HLA gene or its activating protein, specifically a specific portion of the CIITA gene and a specific portion of the B2M gene, which are immunogenicity-inducing factors, is introduced into therapeutic cells, the immunogenicity suppression efficiency is maximized, making it useful as an excellent cell therapy agent for allogeneic transplantation, which led to the completion of the present invention.

[0008] Therefore, an object of the present invention is to provide a composition for inhibiting the immunogenicity of mammalian cells and low immunogenic mammalian cells produced using the same.

[0009] Another object of the present invention is to provide a method for producing low immunogenic mammalian cells.

[0010] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, the claims and the drawings. [Means for solving the problem]

[0011] According to one aspect of the present invention, there is provided a composition for inhibiting the immunogenicity of mammalian cells, which comprises, as an active ingredient, a nucleic acid molecule that suppresses the expression of HLA type II protein.

[0012] The present inventors have conducted extensive research to develop an efficient cell therapy agent that maintains long-term activity while minimizing immune rejection in the patient's body. As a result, they discovered that introducing a gene editing method that targets a type II HLA gene or its activating protein, specifically a specific portion of the CIITA gene and a specific portion of the B2M gene, which are immunogenicity-inducing factors, into therapeutic cells maximizes immunogenicity suppression efficiency and can be used as an excellent cell therapy agent for allogeneic transplantation.

[0013] As used herein, the term "nucleic acid molecule" is intended to encompass DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are the basic building blocks of nucleic acid molecules, include not only natural nucleotides but also analogues in which the sugar or base moiety has been modified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).

[0014] As used herein, the term "inhibition of expression" refers to reducing the activity or expression of a gene of interest, not only to the extent that the activity or expression of the gene of interest is undetectable or present at an insignificant level, but also to the extent that the biological function of the gene of interest is significantly reduced. The nucleic acid molecule for expression inhibition of the present invention is specifically a nucleic acid molecule complementary to the sequence of a gene of interest, including, but not limited to, shRNA, siRNA, miRNA, gRNA (guide RNA), and antisense oligonucleotides, and any nucleic acid molecule known in the art as a means for inhibiting gene expression can be used.

[0015] According to a specific embodiment of the present invention, the nucleic acid molecule is a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the HLA type II protein or its activating protein, or a nucleotide sequence encoding the gRNA.

[0016] As used herein, the term "guide RNA (gRNA)" refers to an RNA molecule used in a gene editing system that recognizes a target gene and induces a nuclease to specifically cleave the recognized site. A representative example of such a gene editing system is the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system.

[0017] As used herein, "specifically recognize" means that the gRNA has a sequence complementary to the target nucleotide sequence, thereby allowing selective hybridization. The term "complementary" means that the gRNA is sufficiently complementary to the target sequence under predetermined annealing or hybridization conditions to selectively hybridize to the target sequence, and encompasses both substantially complementary and perfectly complementary, preferably perfectly complementary. As used herein, the term "substantially complementary sequence" refers not only to a perfectly identical sequence, but also to a sequence that is partially mismatched with the sequence being compared, as long as it can anneal to a specific sequence and perform the function of gRNA.

[0018] Considering mutations with biologically equivalent activity, the nucleotides to be specifically recognized and inhibited in the present invention are understood to include sequences showing substantial identity to the known sequences of HLA type II genes. The term "substantial identity" refers to a sequence that shows at least 70% homology, specifically 80% homology, more specifically 90% homology, and most specifically 95% homology when the sequence of the known gene is aligned with any other sequence for maximum correspondence and the aligned sequences are analyzed using algorithms commonly used in the art. Alignment methods for sequence comparison are well known in the art. Various alignment methods and algorithms are disclosed in Huang et al., Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24:307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10 (1990)) is accessible from the National Center for Biological Information (NBCI) and elsewhere, and is available on the Internet in conjunction with sequence analysis programs such as blastp, blasm, blastx, tblastn, and tblastx.

[0019] More specifically, the activating protein for HLA type II proteins is a transactivator for HLA type II proteins, more specifically, CIITA (Class II Major Histocompatibility Complex Transactivator) protein.

[0020] According to a specific embodiment of the present invention, the composition further comprises an RNA-guided endonuclease or an RNA-guided endonuclease-encoding nucleotide. An "RNA-guided endonuclease" is an enzyme that cleaves a target gene when guided by a gRNA that recognizes a target gene site. Such an RNA-guided endonuclease may be delivered in the form of mRNA or protein, or may be delivered to a target cell by transforming it with a vector carrying DNA encoding the endonuclease. When a protein-based endonuclease is used, it can function as a ribonucleoprotein (RNP) complex that forms a complex with the guide RNA.

[0021] The term "RNP complex" as used herein refers to a complex that contains the guide RNA and an RNA-guided endonuclease as active ingredients, and that can recognize, bind to, and selectively nick or cleave a target sequence. The RNA complex may be, for example, but is not limited to, a Cas9-gRNA complex.

[0022] In one embodiment of the present invention, the RNA-guided endonuclease is selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas14a, Cas14b, Cas14c, Cas14d, Cas14e ...b, Cas14c, Cas14d, Cas14e, Cas14b, Cas14c, Cas14d, Cas14e, Cas14b, Cas14c, Cas14d, Cas14e, Cas14b, 13d, Cpf1, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and MAD7, and specifically, Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1) or MAD7.

[0023] As used herein, the term "nucleotide" encompasses DNA (gDNA and cDNA) and RNA molecules. Nucleotides, the basic building blocks of nucleic acid molecules, include not only natural nucleotides but also analogs with modified sugar or base moieties. It will be apparent to those skilled in the art that the nucleotide sequence encoding a gRNA or RNA-guided endonuclease of the present invention is not limited to the nucleotide sequences set forth in the attached sequence listing. While mutations in nucleotides may not result in changes in proteins (e.g., endonucleases), such nucleic acids encompass all nucleic acid molecules having functionally equivalent codons, codons encoding the same amino acid due to codon degeneracy, or codons encoding biologically equivalent amino acids.

[0024] According to a specific embodiment of the present invention, the gRNA specifically recognizes a nucleotide sequence selected from the group consisting of sequence No. 20 of Sequence Listing 22, sequence No. 24, sequence No. 27, sequence No. 29, sequence No. 30, sequence No. 40 and sequence No. 44 of Sequence Listing, or a complementary sequence thereof.

[0025] According to a specific embodiment of the present invention, the composition of the present invention additionally comprises a nucleic acid molecule that inhibits the expression of the β2-microglobulin protein.

[0026] More specifically, the nucleic acid molecule is a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the β2-microglobulin protein or a nucleotide sequence encoding the gRNA.

[0027] Even more specifically, the guide RNA (gRNA) specifically recognizes a nucleotide sequence selected from the group consisting of Sequence No. 1, Sequence No. 8, Sequence No. 9 and Sequence No. 14, or a complementary sequence thereof.

[0028] According to a specific embodiment of the present invention, the composition additionally comprises a nucleic acid molecule encoding an HLA type I protein, more specifically, the HLA type I protein is an HLA-E protein.

[0029] Another problem with allogeneic cell transplantation is that transplanted therapeutic cells do not persist for long in the recipient. To overcome this, periodic injection of specific cytokines capable of inducing cell proliferation after transplantation has been proposed. However, cytokines such as IL-2 can potentially amplify regulatory T cells (Tregs), which suppress anti-cancer immune responses, potentially resulting in adverse effects in anti-cancer treatment (Romagne F, Vivier E., F1000 Med Rep, 3:9, 2011; Waldmann TA., Nat Rev Immunol, 6:595-601, 2006). Therefore, the present inventors attempted to introduce HLA-E, which stimulates the inhibitory receptor CD94 / NKG2A on therapeutic cells, such as immune cells and stem cells, to prevent cell death. As shown in the following examples, this prevented the transplanted therapeutic cells of the present invention from being killed by the recipient's immune response, allowing them to be maintained in the recipient's body for a long time and exert their pharmacological effects.

[0030] As used herein, the term "express" refers to the artificial introduction of an exogenous gene into a subject cell using a gene carrier, thereby making the gene replicable in the subject cell as an extrachromosomal element or by chromosomal integration, in order to express the exogenous gene or increase the natural expression level of an endogenous gene in the subject cell. Therefore, the term "expression" has the same meaning as "transformation," "transfection," or "transduction."

[0031] As used herein, the term "gene delivery system" refers to any means for transporting a gene into a cell, and gene delivery has the same meaning as intracellular gene transduction. At the tissue level, the term gene delivery has the same meaning as gene spread. Therefore, the gene delivery system of the present invention is described as a gene penetration system and a gene spread system.

[0032] To prepare the gene delivery vector of the present invention, the nucleotide sequence of the present invention is preferably present in a suitable expression construct. In the expression construct, the nucleotide sequence of the present invention is preferably operably linked to a promoter. As used herein, the term "operably linked" refers to the functional connection between a nucleic acid expression control sequence (e.g., a promoter, a signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence, whereby the control sequence controls the transcription and / or translation of the other nucleic acid sequence. The promoter linked to the nucleotide sequence of the present invention is specifically one that can function in animal cells, more specifically mammalian cells, to regulate the transcription of the HLA-E gene, and includes promoters derived from mammalian viruses and promoters derived from the genome of mammalian cells, such as, but not limited to, the CMV (mammalian cytomegalovirus) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, HSV tk promoter, RSV promoter, EF1 alpha promoter, metallothionine promoter, beta-actin promoter, human IL-2 gene promoter, human IFN gene promoter, human IL-4 gene promoter, human lymphotoxin gene promoter, and human GM-CSF gene promoter.

[0033] The nucleotide sequence of the HLA-E gene is applicable to all gene transfer systems commonly used for gene transfer, and preferably includes plasmids, adenoviruses (Lockett LJ, et al., Clin. Cancer Res. 3:2075-2080 (1997)), adeno-associated viruses (AAV, Lashford LS., et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), retroviruses (Gunzburg WH, et al., Retroviral vectors, Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), lentiviruses (Wang G., et al., J. Clin. Invest. 104(11):R55-62 (1999)), herpes simplex viruses (Chamber R., et al., Proc. Natl. Act. Sci. USA 92:1411-1415 (1995)), vaccinia virus (Puhlmann M. et al., Human Gene Therapy 10:649-657 (1999)), liposome (Methods in Molecular Biology, 199, S.C. Basu and M. Basu (Eds.), Human Press 2002), or niosome. Specifically, the gene delivery vehicle of the present invention can be produced by applying the nucleotide molecule of the present invention to a lentivirus.

[0034] In the present invention, when the gene transfer construct is based on a viral vector, the contacting step is carried out by a viral infection method known in the art. Infection of host cells with a viral vector is described in the above cited references.

[0035] According to a specific embodiment of the present invention, the cells into which the composition of the present invention is introduced are allogenic or autologous cells for transplantation, more specifically allogenic cells for transplantation.

[0036] More specifically, the cells are stem cells or immune cells.

[0037] As used herein, the term "stem cells" refers to undifferentiated cells at a stage before differentiation into the cells that make up tissues, and collectively refers to cells that have the ability to differentiate into specific cells under specific differentiation stimuli (environments). Unlike differentiated cells whose cell division has stopped, stem cells are capable of self-renewal through cell division and are characterized by their differentiation plasticity, which allows them to differentiate into various cells depending on the nature of the stimuli.

[0038] The stem cells to which the present invention is applicable are not limited, and any cells that have the properties of stem cells, i.e., undifferentiation, unlimited proliferation, and the ability to differentiate into specific cells, are applicable to the present invention. Specifically, the stem cells used in the present invention are mesenchymal stem cells or totipotent stem cells.

[0039] As used herein, the term "mesenchymal stem cells" refers to stem cells with multipotency that can differentiate into adipocytes, bone cells, chondrocytes, muscle cells, neurons, and cardiomyocytes. Mesenchymal stem cells are distinguished by their whorl-like morphology and the expression of basic cell surface markers CD73(+), CD105(+), CD34(-), and CD45(-). One of the important characteristics of mesenchymal stem cells is their ability to regulate immune responses. Mesenchymal stem cells have the ability to differentiate into bone tissue, central nervous system tissue, skin tissue, and muscle tissue, and can be used to regenerate physically lost tissues with appropriate differentiation inducers. They have also been reported to exert potent immunomodulatory effects by suppressing the proliferation, function, and activity of T cells, B cells, natural killer cells (NK cells), and dendritic cells. These findings may be useful in the treatment of various diseases, such as transplant rejection, autoimmune diseases, inflammatory diseases, and allergic diseases, caused by undesired or excessive immune responses. Therefore, when the present invention is applied to mesenchymal stem cells, it can be applied to regenerative therapy for various degenerative diseases or treatment of autoimmune / inflammatory diseases.

[0040] As used herein, the term "pluripotent stem cell" refers to a stem cell that is in a state where development has progressed from a fertilized egg and that can differentiate into all of the cells that make up the endoderm, mesoderm, and ectoderm. According to a specific embodiment of the present invention, the totipotent stem cell used in the present invention is an embryonic stem cell (ESC), an embryonic germ cell, an embryonic carcinoma cell, or an induced pluripotent stem cell (iPSC), more specifically, an induced pluripotent stem cell.

[0041] As used herein, the term "induced pluripotent stem cells" refers to a type of pluripotent stem cell artificially derived by inserting specific genes associated with an undifferentiated or pluripotent phenotype into a non-pluripotent cell (e.g., a somatic cell). Induced pluripotent stem cells are considered in the art to have the same phenotype, physiological characteristics, and developmental properties as natural pluripotent stem cells, such as embryonic stem cells, in terms of stem cell gene and protein expression, chromosome methylation, doubling time, embryo formation, teratoma formation, viability, chimera formation, hybridization, and differentiation.

[0042] As used herein, the term "immune cell" refers to any cell involved in the initiation or promotion of an immune response, and more specifically, refers to an immune effector cell. Examples of immune cells include, but are not limited to, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, and mast cells. More specifically, the immune cell is a natural killer cell.

[0043] When applied to immune cells, the present invention can be used to treat tumors and infectious diseases. NK cells prepared by the method of the present invention can be used to treat all types of tumors, including solid cancers and blood cancers. Solid cancer, unlike blood cancer, refers to cancer that forms as a mass in an organ and includes cancers that occur in most organs. Tumors that can be treated using the NK cells of the present invention are not particularly limited and may include, but are not limited to, gastric cancer, liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, cervical cancer, thyroid cancer, laryngeal cancer, acute myeloid leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, and lymphoma. Infectious diseases that can be treated using the immune cells of the present invention are diseases caused by infection with viruses or pathogens and include all diseases that can be transmitted through the respiratory tract, blood, or skin contact. Such infectious diseases include, but are not limited to, hepatitis B and C, human papilloma virus (HPV) infection, cytomegalovirus infection, viral respiratory diseases, and influenza.

[0044] As used herein, the term "treatment" refers to (a) the inhibition of the development of a disease, disorder, or symptom; (b) the alleviation of a disease, disorder, or symptom; or (c) the elimination of a disease, disorder, or symptom. When stem cells transfected with the immunogenicity-suppressing composition of the present invention are administered to a subject, they serve to inhibit, eliminate, or alleviate the development of symptoms caused by an excessive or unwanted immune response. When immune cells transfected with the immunogenicity-suppressing composition of the present invention are administered to a subject, they similarly serve to inhibit, eliminate, or alleviate the development of symptoms caused by tumors or infectious diseases by inducing the death of cancer cells or infected cells. Therefore, the composition of the present invention may be used as a cell therapy composition for a disease by itself, or may be administered together with other pharmacological ingredients to be used as a therapeutic adjunct for the disease. Therefore, as used herein, the terms "treatment" or "therapeutic agent" encompass the meaning of "therapeutic adjunct" or "therapeutic adjunct."

[0045] As used herein, the term "administration" or "administering" refers to administering a therapeutically effective amount of a composition of the present invention directly to a subject, thereby allowing the same amount to be formed in the subject's body.

[0046] In the present invention, the term "therapeutically effective amount" means the content of the composition of the present invention contained in an amount sufficient to provide a therapeutic or prophylactic effect to an individual to whom the composition of the present invention is to be administered, and thus includes a "prophylactically effective amount."

[0047] As used herein, the term "subject" includes, without limitation, a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, monkey, chimpanzee, baboon, or rhesus monkey. Specifically, the subject of the present invention is a human.

[0048] According to another aspect of the present invention, there is provided a low immunogenic mammalian cell produced using the composition of the present invention described above.

[0049] The immunogenicity-inhibiting composition of the present invention and the target cells into which said composition is introduced have already been described above, so a description thereof will be omitted to avoid excessive duplication.

[0050] According to yet another aspect of the present invention, there is provided a method for producing a low immunogenic mammalian cell, comprising the steps of: (a) inhibiting the expression of a protein selected from the group consisting of β2-microglobulin protein, HLA type II protein, activator protein of HLA type II protein, and combinations thereof in cells isolated from a mammalian individual; and (b) introducing an HLA-E gene into said cells.

[0051] According to the present invention, in producing therapeutic allogeneic transplant cells of the present invention that have reduced immunogenicity and can maintain activity for a long period of time, it has been found that when the processes of first suppressing an immunogenicity-inducing gene and then introducing a gene to suppress attack from the recipient's NK cells are performed sequentially, the cells exhibit excellent growth characteristics, survival, and activity.

[0052] As shown in the examples below, when HLA-E is introduced first, the expression of HLA-E continues even after the B2M gene is removed, and HLA-ABC expression is maintained during the culture process. - / HLA-E + Contrary to expectations, the survival and growth of NK cells with the HLA-ABC phenotype can be maintained. - / HLA-E + The yield of cells with the specificity is very low, and the process of introducing HLA-E after removing immunogenic genes is rather HLA-ABC until the end of the culture. - / HLA-E + The high yield of cells with specific properties, with 96% or more cells present, confirmed that this is the optimal process sequence for producing the low immunogenic mammalian cells of the present invention.

[0053] According to a specific embodiment of the present invention, step (a) is carried out using a nucleic acid molecule and an endonuclease for silencing the expression of each of the above-mentioned proteins, which have already been described above, and therefore will not be described again to avoid excessive repetition.

[0054] According to a specific embodiment of the present invention, step (b) is performed 1 to 5 days, more specifically 2 to 5 days, and most specifically 3 days after step (a) is completed. [Effects of the Invention]

[0055] The features and advantages of the present invention can be summarized as follows: (a) The present invention provides a composition for inhibiting the immunogenicity of mammalian cells and a method for producing low immunogenic mammalian cells using the same. (b) The present invention can be useful as an efficient cell therapy agent for allogeneic transplantation of stem cells, immune cells, etc. for the treatment of diseases, which maintains long-term activity while minimizing immune rejection in the recipient's body. [Brief explanation of the drawings]

[0056] [Figure 1] FIG. 1 shows the results of measuring the expression level of HLA-ABC by FACS 3 days after treatment with gRNA against the B2M gene. [Figure 2] FIG. 1 shows the results of measuring the knockout efficiency of the B2M gene depending on the concentration of the shuttle used for delivery of the gene editing system of the present invention. [Figure 3] FIG. 1 shows changes in the expression ratio of HLA-ABC by culturing NK cells in which the B2M gene was knocked out. [Figure 4A] FIG. 1 shows the results of increased viability of B2M-NK cells by HLA-E transduction. [Figure 4B] FIG. 1 shows the results of increased viability of B2M-NK cells by HLA-E transduction. [Figure 4C] FIG. 1 shows the results of increased viability of B2M-NK cells by HLA-E transduction. [Figure 5A] FIG. 1 shows the viability of B2M knockout or HLA-E transformed NK cells. [Figure 5B] FIG. 1 shows the growth rate of B2M knockout or HLA-E transformed NK cells. [Figure 6] FIG. 1 shows Log-NK phenotype and production efficiency according to production method. [Figure 7A] FIG. 1 shows the expression level of HLA-ABC at different times during culture of Log-NK. [Figure 7B] FIG. 1 shows the expression level of HLA-E at different times during culture of Log-NK. [Figure 7C] FIG. 1 shows the expression level of HLA-E at different times during culture of Log-NK. [Figure 8] FIG. 1 shows the expression levels of NK characteristic markers at the end of Log-NK culture. [Figure 9A] FIG. 1 shows cell viability in Log-NK culture. [Figure 9B] FIG. 1 shows the cell growth rate in Log-NK culture. [Figure 10A] FIG. 1 shows the results of evaluating the ability of Log-NK to kill cancer cell lines, showing the degree of lysis of the K562 cancer cell line by wild-type NK cells or Log-NK cells. [Figure 10B] This figure shows the results of evaluating the ability of Log-NK to kill cancer cell lines, and shows the changes in cytokine expression levels in wild-type NK cells and Log-NK cells upon contact with K562 target cells. [Figure 11A] The results of long-term observation of the ratio of wild-type NK cells lysed by CD8(+) T cells using calcein AM are shown. [Figure 11B] The results of long-term observation of the ratio of wild-type NK cells and Log-NK cells lysed by CD8(+) cells using CFSE are shown. [Figure 12] FIG. 1 shows the results of flow cytometry confirming the suppression of HLA type II gene expression by knockout of the CIITA gene in NK cells. [Figure 13] FIG. 1 shows the results of confirming, by flow cytometry, the suppression of HLA type II gene expression in NK cells depending on the time point of culture after knockout of the CIITA gene. [Figure 14A] Schematic diagram summarizing the process for generating NK cells with simultaneous deletion of B2M and CIITA genes. [Figure 14B] FIG. 14B shows the double knockout efficiency of B2M and CIITA in NK cells produced by each of the production methods in FIG. 14A. [Figure 14C] FIG. 1 shows the sequences of predicted on-target and off-target sites of gRNA within the B2M gene. [Figure 14D]FIG. 1 shows that no insertions / deletions occurred at the three predicted off-target sites of B2M. [Figure 14E] FIG. 1 shows that no insertions / deletions occurred at the three predicted off-target sites of B2M. [Figure 14F] FIG. 1 shows the sequences of predicted on-target and off-target sites of gRNA within the CIITA gene. [Figure 14G] FIG. 1 shows that no insertions / deletions occurred at the two predicted off-target sites of CIITA. [Figure 14H] FIG. 1 shows that no insertions / deletions occurred at the two predicted off-target sites of CIITA. [Figure 15A] FIG. 14B shows the proliferation rate and survival rate of Log-NK-CIITA KO cells prepared by preparation method 1 in FIG. 14A. [Figure 15B] FIG. 14B shows the proliferation rate and survival rate of Log-NK-CIITA KO cells prepared by preparation method 2 in FIG. 14A. [Figure 16A] FIG. 1 shows the results of examining the phenotype of Log-NK-CIITA KO cells during the culture period, showing the suppression of HLA-ABC and HLA-DR / DP / DQ expression. [Figure 16B] FIG. 10 shows the results of examining the phenotype of Log-NK-CIITA KO cells during the culture period, showing the expression of HLA-E. [Figure 17A] 1 shows the results of measuring the cancer cell-killing ability of Log-NK-CIITA KO cells using a Calcein-AM cell staining method. [Figure 17B] 1 shows the results of measuring the cancer cell-killing ability of Log-NK-CIITA KO cells using a CFSE cell staining method. [Figure 18A] FIG. 1 shows the results of confirming the knockout efficiency of the B2M gene using various gRNA delivery methods. [Figure 18B] FIG. 1 shows the results of confirming the knockout efficiency of the CIITA gene using various gRNA delivery methods. [Figure 19A]FIG. 1 shows the results of examining whether the Log-NK-CIITA KO cells of the present invention can avoid attack by CD8(+) T cells of the donor. [Figure 19B] FIG. 1 shows the results of examining whether the Log-NK-CIITA KO cells of the present invention can avoid attack by CD4(+) T cells of the donor. DETAILED DESCRIPTION OF THE INVENTION

[0057] The present invention will be described in more detail with reference to the following examples. It will be obvious to those skilled in the art that these examples are merely for the purpose of explaining the present invention in more detail, and that the scope of the present invention is not limited by these examples according to the gist of the present invention. [Example]

[0058] Example 1: Knock-out of the B2M gene using genetic scissors Low-immunogenic NK cells were generated using NK (cord blood natural killer, CBNK) cells isolated from umbilical cord blood received from donors.

[0059] β2m, which is present on the cell surface of human leukocyte antigens (HLA) commonly present in HLA-A, HLA-B, and HLA-C, is expressed from the B2M gene. To generate NK cells that do not express HLA-ABC, we used genetic scissors to cut the desired portion of the B2M gene from the NK cell genome as follows, thereby suppressing β2m expression.

[0060] First, a ribonucleoprotein (RNP) reaction solution, which is a complex of gRNA and nuclease, was prepared in a 1.5 mL centrifuge tube as follows. The reaction mixture was allowed to react at room temperature for 5 minutes or more and then used within 60 minutes.

[0061] 26.84 μL of 1X PBS was mixed with 3.32 μL of 40 μM Cpf1 nuclease (Feldan Therapeutics), or 26 μL of 1X PBS was mixed with 4 μL of 40 μM MAD7 nuclease (Feldan Therapeutics) and 20 μL of gRNA (synthesized by IDT, 10 μM) with various sequences that cleave the B2M gene. The mixture was then incubated at room temperature for at least 5 minutes to obtain the RNP reaction solution. The resulting RNP reaction solution contained 1–4 × 10 cells. 6 In this example, the cell count was measured using an ADAM cell counter system (NanoEntec), and the cell count was 2 × 10 6 NK cells were used. 2 × 10 cells were placed in a separate 1.5 mL centrifuge tube. 6 NK cells were added to the tube and centrifuged at 2000 rpm for 3 minutes, after which the supernatant was removed. 500 μL of 1X PBS was added and centrifuged at 2000 rpm for 3 minutes, after which the supernatant was removed, leaving only the cells. In another 1.5 mL centrifuge tube, 48 μL of α-lpha MEM medium (Sigma, M8042) was added with 2 μL of Feldan shuttle (Feldan Therapeutics, 5 μM) and mixed with 50 μL of the pre-reacted RNP reaction solution. The supernatant was then removed and the mixture was added to the NK cells. The mixture was incubated at room temperature for 1 minute and 30 seconds, after which 2 mL of Cellgro medium (Cellgenix, 20802-0500) containing 1% (v / v) human plasma and 1000 IU hIL-2 (Proleukin Injection, Novartis Korea) was added to resuspend the NK cells, which were then transferred to a 6-well plate for culture.

[0062] After 72 hours of static culture, 2 × 10 5NK cells were collected and centrifuged at 1,200 rpm for 5 minutes. The medium was then removed, and the cells were suspended in 2 mL of FACS buffer supplemented with 2% FBS. The cells were then centrifuged at 2,000 rpm for 3 minutes, and the supernatant was removed, leaving only the NK cells. Next, 100 μL of FACS buffer was added, and the antibodies to be analyzed (see Table 1) were added and incubated at 4°C for 30 minutes. 2 mL of FACS buffer was added, and the cells were centrifuged at 2,000 rpm for 3 minutes. The supernatant was then removed, and 300 μL of Fixation (BD, 554655) solution was added to fix the NK cells. The surface expression of the stained NK cells was then analyzed using a flow cytometer, LSRFortessa (BD Bioscience).

[0063] The B2M gene was used as a guide RNA (gRNA) cleavable with Cpf1 or MAD7 nuclease using benchling (ttps: / / benchling.com) and CRISPR RGEN Tools (www.rgenome.net) programs. The candidate gRNA sequences are listed in Table 2. HLA-ABC expression was confirmed by FACS to evaluate the knockout efficiency of each gRNA. [Table 1] [Table 2]

[0064] As a result, we confirmed that the four gRNA sequences #1 (ATCCATCCGACATTGAAGTT), #8 (AGTGGGGGTGAATTCAGTGTA), #9 (AGTGGGGGTGAATTCAGTGTAGT), and #14 (AGCAAGGACTGGTCTTTCTAT) among the 19 sequences induced the highest knockout rates of the B2M gene (Figure 1). Among these, #9 gRNA, which showed the highest efficiency, was selected for knockout of the B2M gene using Cpf1. When using Cpf1, gRNA sequences ranging from 19-23 bp in length are applicable; when targeting the same site, longer sequences minimize off-target effects. On the other hand, since MAD7 nuclease requires a 21-bp gRNA, we used #8 gRNA, which is 2 bp shorter than the #9 gRNA sequence but cleaves the same site.

[0065] After cleaving the B2M gene in NK cells using gRNAs #8 and #9 and Cpf1 or MAD7, genomic DNA was isolated and subjected to whole-genome sequencing. Genomic DNA sequences with four or fewer mismatched nucleic acid sequences from the gRNA sequence were assumed to be potential off-target sites, and we investigated whether off-target insertions / deletions had occurred. Three predicted off-target sites were identified. Sequence analysis of gene insertions / deletions confirmed no insertions / deletions at two predicted sites. An insertion / deletion was found at the fourth chromosomal site, but it was located at the same position as in the control NK cells. Consequently, we confirmed that B2M knockout using gRNAs #8 and #9 did not result in mutations at predicted off-target sites (Appendix 1).

[0066] In this example, the RNP reaction mixture was delivered into cells using the peptide delivery system Shuttle (Feldan Therapeutics), but various delivery methods, such as electroporation, lipofectamine, and cationic polymers (e.g., polyarginine), can also be used.

[0067] Example 2: Shuttle efficiency evaluation for B2M gene knockout The B2M gene was knocked out using a shuttle protein. The sequence of the shuttle used is shown in Table 3. The B2M gene was knocked out in the same manner as described in Example 1. [Table 3]

[0068] The efficiency of knocking out the B2M gene in CBNK cells was confirmed using 5 μM and 10 μM shuttles. As a result, it was found that 5 μM FSD64d1 shuttles were superior to 10 μM in terms of B2M knockout efficiency and cell viability (Figure 2). Therefore, in the following examples, B2M knockout was performed using 5 μM FSD64d1 shuttles.

[0069] Example 3. Generation and in vitro evaluation of low-immunogenic NK cells We cultured NK cells with the B2M gene knockout and examined the expression of B2M and HLA-ABC. We found that the proportion of cells that did not co-express B2M and HLA-ABC decreased over time (Figure 3). To determine whether the results in Figure 3 were due to NK cells in which HLA-ABC expression was suppressed due to the B2M gene knockout being attacked by NK cells expressing HLA-ABC, we performed in vitro cell killing assays on wild-type CBNK, a group of isolated NK cells with the B2M gene knockout (B2M KO NK), a group of wild-type CBNK transduced with scHLA-E (HLA-E TD NK), and a group of isolated NK cells with the B2M gene knockout transduced with scHLA-E (B2M KO / HLA-E TD NK). The HLA-E gene is known to suppress the attack of foreign cells by the host's NK cells, and this gene was introduced into B2M gene knockout NK cells, thus suppressing the attack of B2M. - / HLA-E + It is predicted that when injected into the body, allogeneic, low-immunogenic NK cells with the expression characteristics of NK cells will be able to avoid attack by host CD8(+) T cells and NK cells.

[0070] 3-1) Generation of B2M KO NK cells (B2M - NK) On day 3 of the knockout period, when the proportion of cells not expressing HLA-ABC was maintained at its highest level, NK cells with the B2M gene knocked out were isolated. The B2M gene knocked out NK cells were collected by centrifugation, the supernatant was removed, and 1 × 10 7The cells were resuspended in MACS buffer (PBS (Lonza) with 0.5% FBS (GIBCO), 2 mM EDTA (Invitrogen)) at a concentration of 1 / 100 μL, and then stained with 10 μg of biotin-conjugated B2M antibody (Invitrogen, MA1-19506) per 100 μL at 4°C for 15 minutes. 2 mL of MACS buffer was then added, and the cells were centrifuged at 1200 rpm for 5 minutes, and the supernatant was removed. The pelleted NK cells were then suspended in 80 μL of MACS buffer, mixed with 20 μL of anti-biotin microbeads (Miltenyi Biotec, 130-090-485), and incubated at 4°C for 15 minutes. 2 mL of wash buffer (Miltenyi Biotec, 130-091-222) was added, and the cells were centrifuged at 1200 rpm for 10 minutes, and the supernatant was removed. NK cells were suspended in 500 μL of washing buffer. An LS column (Miltenyi Biotec) was loaded onto a QuadroMACS TM The NK cells were immobilized on a separator (Miltenyi Biotec) and washed with 2 mL of washing buffer. The suspended NK cells were then loaded onto the column. Then, 3 mL of washing buffer was loaded twice to recover the B2M knockout cells that did not bind to the column. After measuring the cell number, 1 × 10 NK cells were added to the NK cell medium. 6 The cells were suspended at a concentration of 1 / ml and then placed in a well plate culture vessel of an appropriate size and cultured.

[0071] 3-2) Generation of HLA-E TD NK cells (HLA-E + NK) A lentiviral vector was used to express single-chain HLA-E trimers (scHLA-E) in NK cells. The single-chain HLA-E trimers used in the present invention use the amino acid sequence disclosed in US20050196404A1, and the encoding nucleic acid sequence was codon-optimized (Sequence Listing No. 46). The lentiviral vector expressing the codon-optimized single-chain trimer sequence was produced by Flash Therapeutics (France).

[0072] To transduce NK cells with scHLA-E, a complex of 50 MOI (multiplicity of infection) scHLA-E lentiviral vector and 10 μg / mL Protransduzin-A (immundiagnostik / A 2115AG.1) was prepared and incubated at room temperature for at least 5 minutes before being applied to NK cells in a culture vessel. To promote intracellular delivery and expression of the lentiviral vector, the culture medium was treated with 6 μM 5Z-7-oxozeaenol (TOCRIS #360420) and 20 ng / mL IL-21 (Biolegend / 571204).

[0073] 3-3) B2M KO / HLA-E TD NK cells (B2M - / HLA-E + Preparation of NK The B2M KO NK cells prepared as described in 1) above were placed in a culture vessel and then transduced with scHLA-E as described in 2). - / HLA-E + or HLA-ABC - / HLA-E + The present inventors named these low-immunogenic NK cells that had undergone genetic recombination to have the phenotype "Log-NK" (Log-lasting NK). The generated NK cells were subjected to FACS analysis using the antibodies listed in Table 4. [Table 4]

[0074] Example 4. In vitro characterization of hypoimmunogenic NK cells Four groups of NK cells (wild-type CBNK, B2M - NK, HLA-E + NK, B2M - / HLA-E + NK) were used as target cells. After washing with 1X PBS, the supernatant was removed and 1 mL of assay medium, which was RPMI1640 medium (Gibco, 11875093) supplemented with 10% FBS, was added. 1 × 10 6After suspending the cells at a concentration of 1 × 10 / ml, 30 μL of Calcein-AM (Molecular probe, C34852) was added and the mixture was incubated in a CO2 incubator at 37°C for 1 hour. After washing twice with assay medium, the cells were suspended in 10 mL of assay medium and diluted to 1 × 10 5 The effector cells, PBNK (donor peripheral blood-derived NK cells) or CBNK (donor umbilical cord blood-derived NK cells), were also washed with 1x PBS, the supernatant was removed, and the assay medium was added. 3x10 cells were added to obtain an effector:target cell ratio of 30:1. 6 / ml, or 1 × 10 for a 10:1 effector:target cell ratio 6 Effector cells were prepared at a ratio of 30:1 or 10:1 in a round-bottom 96-well plate, and 100 μL of each was added to each of three wells. 5 100 μL of target cells at a concentration of 1 / mL were added to each well. To calculate cell killing capacity using a formula, spontaneous release and maximum release wells were prepared. Spontaneous release wells contained 100 μL of stained target cells and 100 μL of assay medium. Maximum release wells contained 100 μL of stained target cells and 100 μL of 2% Triton-X 100 solution. To correct for autofluorescence present in the assay medium and 2% Triton-X 100 solution, 200 μL of assay medium was added to prepare the medium value, and 100 μL of 2% Triton-X 100 solution was added to 100 μL of assay medium to prepare the mixture value. The difference (A), obtained by subtracting the mixture value from the medium value, was added to the maximum value to correct for autofluorescence. After incubation in a CO2 incubator at 37°C for 4 hours in the dark, the plate was centrifuged at 2,000 rpm for 3 minutes. 100 μL of the supernatant was placed in each well of a 96-well black plate, and the fluorescence value (OD ) was measured using a fluorescence plate reader (Perkin Elmer, VICTOR Nivo). 480 / 535nm) was measured, and the cell-killing ability of effector cells against target cells was calculated using the following formula: Cell killing activity (%) = (mean fluorescence value of sample wells - mean fluorescence value of spontaneous release wells) / {(mean fluorescence value of maximum emission wells + A) - mean fluorescence value of spontaneous emission wells} x 100

[0075] We confirmed that the B2M knockout B2M KO NK group (donor 1) was susceptible to attack by PBNK cells derived from other donors (donor A or donor B) or wild-type NK cells from the same donor (donor 1). In contrast, the HLA-E TD NK or B2M KO / HLA-E TD NK groups, which express HLA-E, showed significantly reduced attack, confirming that HLA-E-expressing NK cells can efficiently evade attack by wild-type NK cells derived from other donors or expressing HLA-ABC (Figure 4). Table 5 shows the expression of HLA-E-binding receptors, NKG2A and NKG2C, on the surface of effector cells, as measured by FACS analysis. [Table 5]

[0076] Furthermore, when the genetically modified NK cell groups were cultured, there was no significant difference in survival between the groups, but the B2M KO NK group showed significantly lower growth rates than the other groups (Figures 5A and 5B).

[0077] Example 5: Log-NK cells (B2M - / HLA-E + Optimization of the method for producing NK cells Log-NK cells, in which the B2M gene was knocked out to suppress HLA-ABC expression and HLA-E gene was transduced, were generated by four methods as shown in Table 6. [Table 6]

[0078] Detailed experimental methods for each step and FACS analysis of expression characteristics are as described in Examples 1 and 3. In Figure 6, the area in the second quadrant of the graph (thick solid line) represents Log-NK cells. In the case of Production Method 1, B2M gRNA was treated on day 7, which is the initial time point of NK cell culture, and B2M was added after 3 days. - After isolating the cells, scHLA-E was introduced and expressed. As a result, it was confirmed that more than 96% of the cells were Log-NK cells by the end of the culture.

[0079] In the case of production method 2, scHLA-E was first introduced and expressed on day 14, which is the 1 / 3 point of the total culture, and B2M was removed 3 days later. - No cell isolation process was performed. Because HLA-E expressing cells can avoid attack by other NK cells, it was expected that HLA-E expression would continue even after the B2M gene was removed, maintaining cell survival and growth. However, the actual results showed that the efficiency of generating Log-NK cells was low (approximately 13%), and the number of Log-NK cells present decreased over the course of culture, with no Log-NK cells remaining at the end of the culture period.

[0080] In the case of manufacturing method 3, the manufacturing process is started on the 7th day of culture, as in manufacturing method 1, except that the order of B2M removal and HLA-E introduction is reversed. - Log-NK cells were produced, including the cell separation process. As a result, the production efficiency of Log-NK cells was higher (87%) than in Production Method 2, but at the end of the culture, the Log-NK cells decreased to about 20%, confirming a very low yield.

[0081] In the case of production method 4, B2M was removed on the 7th day of culture. - After introducing HLA-E without cell isolation, the cells were cultured and it was confirmed that almost no Log-NK cells were obtained (approximately 3%) compared to the three production methods mentioned above.

[0082] From the above results, it was confirmed that the Log-NK cells of the present invention, which suppress the expression of B2M gene to eliminate immunogenicity by suppressing the expression of HLA-ABC and express HLA-E to avoid attack by other NK cells, are best produced by the above-mentioned preparation method 1.

[0083] Example 6. Culture and characterization of NK or Log-NK cells CBNK or Log-NK cells were cultured by restimulation with feeder cells on the initiation day, 14th day, and 28th day of culture. The feeder cells used for culture were CD4+ T cells transfected with 4-1BBL, mbIL-21 (membrane-bound IL-21), and mTNF-α (membrane TNF-α) genes. Restimulation with feeder cells can be performed at intervals ranging from 14 to 16 days. Log-NK cells cultured statically in appropriate culture vessels can be frozen after 39 days of culture and cultured for up to 42 days depending on the cell growth rate. If culture is required for more than 42 days, restimulation with feeder cells on the 42nd day of culture is possible for continued culture. NK or Log-NK cells were stained with the antibodies listed in Table 7 and identified as CD3+ T cells. - / CD56 + Log-NK (HLA-ABC) - / HLA-E + The maintenance of the NK cell phenotype was confirmed until the end of the culture. As a result, it was confirmed that the expression of HLA-ABC genes in Log-NK cells was maintained at 5% or less, and that the expression level of HLA-E (mean fluorescence intensity, MFI) of each cell was maintained at a higher level than that of wild-type NK cells (Figure 7). To confirm NK cell characteristic markers at the end of the culture, a total of 14 staining tubes were prepared using antibodies corresponding to each marker listed in Table 7, along with human CD56, human CD3, and 7AAD antibodies listed in Table 4, and expression was confirmed by flow cytometry as in Example 3. As a result, there was no significant decrease in activation markers or increase in inhibitory markers compared to wild-type NK cells (Figure 8).

[0084] Log-NK cells generated by Production Method 1 showed similar cell viability compared to wild-type NK cells from day 10 of culture, when the generation process was completed, to day 39, when the culture was terminated. The decrease in the viability and growth rate of Log-NK cells that occurred between day 10 and day 14 of culture was due to the B2M cells remaining untransfected by the HLA-E lentiviral vector. - This is a temporary phenomenon that occurs during the process of NK cell death, and it was confirmed that the culture rate and survival rate were all restored after restimulation of the support cells on day 14 (Figure 9). [Table 7]

[0085] Example 7. Evaluation of tumor cell toxicity of Log-NK cells To evaluate the tumor cell killing ability of wild-type NK cells or Log-NK cells, K562 blood cancer cell line was used as the target cells. After washing K562 cells with 1X PBS, the supernatant was removed and 1x10 cells were added to the assay medium (RPMI1640 medium supplemented with 10% FBS). 6 After suspending the cells at a concentration of 1 × 10 / ml, 30 μL of Calcein-AM (Molecular probe, C34852) was added and the cells were incubated at 37°C for 1 hour in a CO2 incubator. After washing twice with 10 mL of assay medium, the cells were suspended in 10 mL of assay medium and diluted to 1 × 10 5 Wild-type NK cells or Log-NK cells were washed with 1x PBS, the supernatant was removed, and assay medium was added. 1x10 cells were cultured at a concentration of 1x10 for a 10:1 effector:target cell ratio. 6 / ml, 3 x 10 for a 3:1 effector:target cell ratio 5 / ml, 1 x 10 for a 1:1 effector:target ratio 5 / ml, 3 x 10 for an effector:target ratio of 0.3:1 4 The effector cells were prepared at four different ratios in a round-bottom 96-well plate, and 100 μL of each was added to three wells. 5100 μL of target cells at a concentration of 1 / mL were added to each well. The subsequent experimental procedures and calculation of tumor cell killing capacity were performed in the same manner as in Example 4. Evaluation of the cell killing capacity of the K562 cancer cell line confirmed that there was no significant difference in the cancer cell killing capacity between NK cells and Log-NK cells at a high E:T ratio, and as the E:T ratio decreased, the difference between NK cells and Log-NK cells completely disappeared (Figure 10A).

[0086] Example 8. Confirmation of cytokine secretion by Log-NK cells The secretion levels of CD107a, IFN-γ, and TNF-α, the main cytokines secreted by NK cells to kill cancer cells, were determined using intracellular cytokine staining (ICS) tests. The antibodies used in ICS experiments are listed in Table 8, and the types of antibodies used depending on the cell staining method are listed in Table 9. [Table 8] [Table 9]

[0087] After washing effector wild-type or Log-NK cells with 1x PBS, the supernatant was removed and 2.5 x 10 cells were added to the cells at a 1:1 effector:target cell ratio. 6 After adding the assay medium (RPMI 1640 medium supplemented with 10% FBS at 1 / mL) and suspending the cells, 1.2 mL of the medium was transferred to a new tube and 1.56 μL of Golgi-stop (BD, 554724) and 2.4 μL of Golgi-plug (BD, 555029) were added.

[0088] The target cells, K562, also showed 2.5 × 10 6The cells were suspended in assay medium at 100µL / ml. A 96-well round-bottom plate was prepared, and APC-CD107a antibody was placed in the (-) and target wells, and APC-IgG1k antibody in the iso wells. 100µL of RPMI 1640 medium supplemented with 10% FBS was placed in the (-) well, and 100µL of target cells were placed in the target and iso wells. 100µL of effector cells were added to all wells and incubated for 4 hours at 37°C in a CO2 incubator. The plate was centrifuged (2000 rpm, 3 minutes, 4°C) and washed twice with 200µL of Perm / Wash buffer (BD, 554723). 200µL of fixation / permeabilization solution (BD, 554655) was then added to all wells and incubated for 30 minutes at 4°C. The plate was centrifuged (2000 rpm, 3 min, 4°C) and washed twice with 200 μL of Perm / Wash buffer (BD, 554723). Then, 100 μL of Perm / Wash buffer (BD, 554723) was added to all wells. IFN-γ and TNF-α antibodies were added to the (-) and target wells, and FITC-IgG1k and PE-Cy7-IgG1k antibodies were added to the iso wells. The wells were incubated for 30 minutes at 4°C. 100 μL of 1X Perm / Wash buffer was added to each well. The plate was centrifuged (2000 rpm, 3 min, 4°C). The supernatant was discarded. The plate was centrifuged (2000 rpm, 3 minutes, 4°C) and washed twice with 200 μL of Perm / Wash buffer (BD, 554723). Then, 200 μL of 1X Perm / Wash buffer was added to each well. The cell pellet was transferred to a FACS tube (BD Falcon, 352052) and cytokine expression was analyzed using a flow cytometer. Upon contact with K562 target cells, the major cytokines of NK cells and Log-NK cells, CD107a, IFN-γ, and TNF-α, increased by more than 60%, with no significant difference between the NK cell and Log-NK cell groups (Figure 10B).

[0089] Example 9. In vitro evaluation of low immunogenicity of Log-NK cells To evaluate the low in vivo immunogenicity of the generated Log-NK, an in vitro mixed lymphocyte reaction (MLR) test was performed. CD8(+) T cells were isolated using a CD8(+) T cell isolation kit (Miltenyi Biotec, 130-096-495) as follows: PBMCs obtained from donor blood were washed once with MACS buffer (0.5% FBS (GIBCO), 2 mM EDTA (Invitrogen) in PBS (Lonza)), and the resulting cell pellet was collected at a concentration of 1 × 10 7 The suspension was suspended in MACS buffer to a concentration of 1 × 10 7 The mixture was added to a concentration of 1 × 10 / 10 μL, mixed well, and allowed to react at 4°C for 5 minutes. 7 Add MACS buffer to 30 µL at a concentration of 1 x 10 cells per well. 7 After adding 20 μL of CD8(+) T cell microbead cocktail per cell, the mixture was incubated for 10 minutes at 4°C. After the incubation, the cell suspension was passed through an LS column (Miltenyi Biotec) to isolate only CD8-expressing T cells.

[0090] To culture the isolated CD8(+) T cells, PBMCs from another donor were irradiated at 2,000 cGy and mixed with CD8(+) T cells at a 1:1 ratio and cultured for 7 days. PBMCs were prepared in the same manner and cultured for 7 days. CD4(+) T cells and CD8(+) T cells were mixed at a 1:1 ratio and cultured for 7 days in RPMI 1640 medium containing anti-CD3 (1 μg / mL, Invitrogen), IL-2 (100 U / mL), and 10% FBS. Cultures were continued for another 7 days, and after a final 14-day culture, the cells were used for experiments. PBMCs from the same donor were irradiated again at 2,000 cGy and mixed with the cultured CD8(+) T cells at a 1:1 ratio and cultured for another week. CD8(+) T cells cultured for a total of 14 days were used as effector cells, and NK or Log-NK cells were used as target cells. The ability of Log-NK to evade CD8(+) T cell attack was confirmed by measuring cell killing activity using the same method as in Example 3. As shown in Figure 11A, the percentage of cells lysed by CD8(+) T cells was more than three times higher for NK cells than for Log-NK cells, confirming that Log-NK cells can evade CD8(+) T cell attack. To ensure a robust MLR reaction, the HLA-A, B, and C types of CD8(+) T cells and NK or Log-NK cells were 100% mismatched, and the irradiated PBMCs used for CD8(+) T cell culture were 83% HLA-A, B, and C-matched to those of NK or Log-NK cells.

[0091] In addition, NK and Log-NK were stained with CFSE (Thermo Scientific, C34554) and then cultured in RPMI1640 (10% FBS, 1000 IU IL-2) medium at a CD8(+) T:NK or Log-NK ratio of 30:1. 6 100 μL of 4 x 10 CD8(+) T cells / mL 4100 μL of NK or Log-NK at 100 μL / mL was added to three wells of a 96-flat well plate. The plates were maintained in a live state using an IncuCyte® S3 instrument (Sartorius) installed inside a cell culture incubator. Images of the wells were captured every hour and CFSE-positive cells were counted from the images. The results confirmed that when co-cultured with CD8(+) T cells, the proportion of NK cells decreased over time compared to the initial well population, whereas Log-NK cells maintained the initial cell population (Figure 11B).

[0092] Example 10: Selection of optimal gRNA sequence for CIITA gene knockout 10-1) Knockout of CIITA and RFXANK genes using genetic scissors Human MHC (major histocompatibility complex) class II genes consist of HLA-DR, HLA-DQ, and HLA-DP. To generate NK cells that do not express HLA-DR / DQ / DP, we used genetic scissors technology to transduce the desired portion of the Class II transactivator (CIITA) gene, known as a master controller, or the transcription factor RFXANK (RFX-associated ankyrin-containing protein) gene, to suppress CIITA or RFXANK expression.

[0093] For the candidate gRNA sequences targeting CIITA or RFXANK listed in Table 10, RNP reaction solutions were prepared in the same manner as in Example 1, and the reaction solutions were used within 60 minutes after reacting at room temperature for at least 5 minutes.

[0094] The prepared RNP reaction solution contains 1 to 4 x 10 cells. 6 The dose can be used up to 2 × 10 6The subsequent experimental procedures and cell culture were carried out in the same manner as in Example 1. [Table 10-1] [Table 10-2]

[0095] 10-2) NK cell staining for flow cytometry To confirm the degree of CIITA or RFXANK gene knockout in NK cells, NK cells treated with the CIITA RNP reaction solution in Example 10-1) were stained and then subjected to flow cytometry. 5 NK cells were suspended in 2 mL of FACS buffer containing 2% FBS and centrifuged at 2,000 rpm for 3 minutes. The cells were then resuspended in 100 μL of FACS buffer, and antibodies containing fluorescent dyes were added (Table 11) and incubated for 30 minutes at 4° C. After 30 minutes, 2 mL of FACS buffer was added, followed by centrifugation at 2,000 rpm for 3 minutes. 300 μL of fixative solution was added, and the cells were analyzed using a BD LSRFortessa (BD Bioscience) flow cytometer. The results are shown in Figure 12. [Table 11]

[0096] The degree of HLA class II knockout was confirmed by HLA-DR expression. Of the 25 gRNA sequences tested, NK cells treated with Cpf1-#1 gRNA demonstrated a 28.2% CIITA gene knockout efficiency compared to wild-type NK cells (control group). NK cells treated with Cpf1-#5 gRNA demonstrated a 17.7% knockout efficiency, and NK cells treated with Cpf1-#8 gRNA demonstrated a 19.9% ​​knockout efficiency. NK cells treated with MAD7-#21 gRNA demonstrated a 15.5% knockout efficiency, and NK cells treated with MAD7-#25 gRNA demonstrated a 40.1% knockout efficiency. Therefore, we selected the MAD7 nuclease and #25 gRNA, which demonstrated the highest CIITA gene knockout efficiency, for further experiments. In addition, as shown in Figure 13, the knockout efficiency of CIITA was confirmed after 3-7 days of culture following delivery of the RNP reaction solution. The efficiency increased from 21.3% compared to control NK cells at 3 days of culture to 50.4% at 7 days of culture. These results indicate that the knockout efficiency increases with increasing culture period after CIITA knockout in NK cells.

[0097] Example 11: Optimization of conditions for generating NK cells with B2M and CIITA genes deleted To generate NK cells with both B2M and CIITA genes simultaneously deleted, two methods were used to generate NK cells, as shown in Figure 14A, and the double knockout efficiency of the B2M and CIITA genes was compared. In method 1, 13 μL of 1X PBS, 2 μL of 3.2 μM MAD7, and 10 μL of 10 μM B2M gRNA were mixed in a 1.5 mL centrifuge tube and incubated at room temperature for at least 5 minutes to prepare RNP reaction solution tube 1. In another 1.5 mL centrifuge tube, 13 μL of 1X PBS, 2 μL of 3.2 μM MAD7, and 10 μL of 10 μM CIITA gRNA were incubated at room temperature for at least 5 minutes to prepare RNP reaction solution tube 2. The prepared RNP reaction solution tubes 1 and 2 were mixed to create a total of 50 μL of RNP reaction solution. The subsequent experimental procedure was performed in the same manner as in Example 10, using 2 × 10 6 The NK cells were cultured for 7 days and then grown to 2 × 10 cells. 6CIITA was knocked out in NK cells on day 7 of culture, and after 4 days of culture, 2 × 10 6 B2M was sequentially knocked out in NK cells on day 11 of culture. The specific experimental procedure and cell culture were performed in the same manner as in Example 1. The NK cells cultured after knockout were stained with antibodies for FACS in the same manner as in Example 10-2), and the knockout efficiency of the B2M and CIITA genes was confirmed using a flow cytometer.

[0098] As can be seen in Figure 14B, when NK cells isolated from three donors were tested using the above production methods, the double knockout efficiency of B2M and CIITA in NK cells generated from donor 1 using Production Method 1 was 32.4% compared to control NK cells, and the efficiency of NK cells generated using Production Method 2 was 17%. NK cells isolated from the remaining two donors also showed a higher double knockout efficiency using Production Method 1 than using Production Method 2.

[0099] Genomic DNA was isolated from B2M and CIITA double-knockout NK cells generated using Method 1 and subjected to whole genome sequencing. Genomic DNA sequences with four or fewer mismatched nucleic acid sequences from the B2M and CIITA gRNA sequences were assumed to be potential off-target sites, and we investigated whether off-target insertions / deletions had occurred. Three predicted off-target sites were identified in the B2M gRNA sequence (Figure 14C) and two predicted off-target sites were identified in the CIITA gRNA sequence (Figure 14F). Sequence analysis of gene insertions / deletions confirmed that no insertions / deletions occurred at any of the predicted off-target sites. Consequently, we confirmed that the B2M and CIITA double knockout using #8 gRNA (SEQ ID NO: 8) and #25 gRNA (SEQ ID NO: 44) did not result in mutations at the predicted off-target sites (Figures 14D, 14E, 14G, and 14H).

[0100] Example 12: Generation of Log-NK-CIITA KO cells (B2M- / CIITA- / HLA-E+ NK cells) HLA-ABC, in which the CIITA gene was knocked out in Log-NK, which has B2M- / HLA-E+ expression characteristics, and the expression of HLA-DR / DP / DQ, which are type II HLA proteins, was also suppressed. - / HLA-DR / DP / DQ - / HLA-E + NK cells with the phenotype were generated using Preparation Method 1 or 2 in Figure 14A and named "Log-NK-CIITA KO" cells. Allogeneic, low-immunogenic NK cells, in which HLA type I and HLA type II expression are simultaneously suppressed, are expected to evade immune responses from host CD8(+) T cells, CD4(+) T cells, and NK cells upon infusion. NK cells with B2M and CIITA knockout were generated using the same method as Preparation Method 1 in Example 11. B2M- and CIITA-knockout NK cells were then separated using a Magnetic Activated Cell Sorting (MACS) device, followed by subsequent separation of HLA-DR-nonexpressing NK cells. Biotin-labeled B2M antibody (Invitrogen) was incubated at 4°C for 20 minutes, followed by centrifugation at 1,200 rpm for 10 minutes in 2 mL of MACS buffer (PBS containing 0.5% FBS and 2 mM EDTA). After removing the supernatant, 80 μL of MACS buffer was added and 20 μL of anti-biotin Microbeads (Miltenyi Biotec) were mixed. After incubation at 4°C for 15 minutes, 2 mL of MACS buffer was added and the cells were centrifuged at 1,200 rpm for 10 minutes. NK cells were suspended in 500 μL of washing buffer and then analyzed using a QuadroMACS TM The cells were loaded onto an LS column (Miltenyi Biotec) attached to a separator (Miltenyi Biotec). Then, 3 mL of washing buffer was applied twice to remove B2M that did not bind to the column. -The cells were then collected. The collected cells were centrifuged again at 1,200 rpm for 10 minutes, the supernatant was removed, and 80 μL of washing buffer was added to the pelleted cells, mixed with 20 μL of anti-HLA-DR microbeads (Miltenyi Biotec), and incubated at 4°C for 15 minutes. 2 mL of washing buffer was then added, and the cells were centrifuged at 1,200 rpm for 10 minutes. NK cells were suspended in 500 μL of buffer and analyzed by QuadroMAC. TM The cells were loaded onto an LD column (Miltenyi Biotec) attached to a separator (Miltenyi Biotec), and 1 mL of washing buffer was added twice to the column. Finally, the B2M - / HLA-DR - NK cells were collected. Isolated B2M - / HLA-DR - Immediately after measuring the number of NK cells, single-chain HLA-E trimer (scHLA-E) was introduced using a lentiviral vector in the same manner as in Example 3-2). 6 NK cells were suspended in the medium at a concentration of 1 / mL and cultured in well plates of an appropriate size.

[0101] Example 13: Cultivation of Log-NK-CIITA KO cells and confirmation of phenotypic expression 13-1) Measurement of proliferation ability of Log-NK-CIITA KO cells To confirm the proliferation ability of the Log-NK-CIITA KO cells prepared in Example 12, cell proliferation and cell viability were measured during the culture period, as shown in Figure 15. As a result, the viability of the Log-NK-CIITA KO cells prepared by Preparation Method 1 was not significantly different from that of the control NK cells, and the proliferation of the control NK cells continued to increase over 43 days of culture, with the Log-NK-CIITA KO cells increasing by approximately 268-fold from the initial cell number at 43 days of culture (Figure 15A). The Log-NK-CIITA KO cells prepared by Preparation Method 2 showed a decrease in cell number after the cell isolation process in Example 12, but cell proliferation recovered up to day 39 of culture, and the cell number increased by approximately 936-fold from the initial cell number at 39 days of culture (Figure 15B).

[0102] 13-2) Phenotype of Log-NK-CIITA KO cells during culture To confirm whether the expression of HLA-ABC and HLA-DR / DP / DQ was continuously suppressed during the 43 days of culture after the generation of Log-NK-CIITA KO cells, NK cells prepared by the method of Example 11 were stained and the expression was confirmed using a flow cytometer. 5 NK cells were added to 2 mL of FACS buffer containing 2% FBS and centrifuged at 2,000 rpm for 3 minutes, after which the supernatant was removed. The cells were then suspended in 100 μL of FACS buffer, and the antibodies listed in Table 12 were added and incubated at 4°C for 30 minutes. 2 mL of FACS buffer was then added, and the cells were centrifuged at 2,000 rpm for 3 minutes. The supernatant was then removed, and 300 μL of fixative solution was added. Expression was analyzed using a BD LSRFortessa (BD Bioscience) flow cytometer. As shown in Figure 16A, after 22 days of culture in all three donors, cells with simultaneous suppression of HLA-ABC and HLA-DR / DP / DQ expression accounted for more than 60% of the total cells. In the case of donors 1 and 2, this figure increased to more than 90% of the total cells by 43 days of culture. Furthermore, analysis of HLA-E expression in Log-NK-CIITA KO cells on day 43 of culture confirmed that HLA-E expression was increased by 69.1% in donor 1, 72.3% in donor 2, and 53.8% in donor 3 compared to control NK cells (Figure 16B). [Table 12]

[0103] Example 14: Analysis of the anti-cancer ability of Log-NK-CIITA KO cells 14-1) Confirmation of cancer cell killing ability using Calcein-AM To use cancer cells K562 (chronic myeloid leukemia), DU145 (prostate cancer), HepG2 (liver cancer), HCC1954 (breast cancer), MDA-MB-231 (breast cancer), MDA-MB-468 (breast cancer), and SKOV3 (ovarian cancer) as target cells, 1 × 10 6The cells were suspended in 1 mL of assay medium (RPMI1640 medium supplemented with 10% FBS at a concentration of 1 × 10 / mL), treated with 30 μL of Calcein-AM (Invitrogen), and incubated in a CO2 incubator at 37°C for 1 hour. After the incubation, the cells were washed twice with assay medium and then incubated at 1 × 10 5 Effector cells, NK or Log-NK-CIITA KO, were prepared at a concentration of 3 x 10 / mL for a 3:1 effector:target cell ratio. 6 1 x 10 cells / mL for a 1:1 effector:target cell ratio. 6 The effector cells were suspended in assay medium at 1 × 10 / mL. 100 μL of the prepared effector cells were placed in each of three wells of a round-bottom 96-well plate, and then diluted to 1 × 10 5 100 μL of target cells at a concentration of 1 / mL were added to each well. The subsequent experimental procedures and calculation methods for measured values ​​were the same as in Example 4.

[0104] As shown in Figure 17A, Log-NK-CIITA KO cells exhibited similar or increased cancer cell killing ability compared to control NK cells against various cancer cell lines.

[0105] 14-2) Confirmation of cancer cell killing ability using CFSE staining The cancer cells DU145, HepG2, HCC1954, MDA-MB-231, MDA-MB-468, and SKOV3 were 4 × 10 4 The cells were suspended in assay medium (RPMI 1640 medium supplemented with 10% FBS) at a concentration of 8 × 10 / mL, and then placed in 100 μL per well of a 96-well plate. After culturing for 18-22 hours, effector cells were added. NK or Log-NK-CIITA KO cells were used as effector cells, with a concentration of 8 × 10 for a 2:1 effector:target cell ratio. 4The target cells were suspended in RPMI 1640 medium containing 10% FBS and 1000 IU IL-2 at 100 μL / mL and then added to three wells of a 96-well plate incubating at 37°C. The cells were cultured for 7 days using a real-time cell imaging analyzer, the IncuCyte® S3 (Sartorius), in a CO2 incubator. Cell images were captured and analyzed every two hours to assess cancer cell killing activity. The Log-NK-CIITA KO cells exhibited increased cancer cell killing activity compared to control NK cells in DU145 and MDA-MB-231 cancer cells, but exhibited similar killing activity to control NK cells in other cancer cell lines (Figure 17B). These results indicate that gene editing and transfection to generate Log-NK-CIITA KO cells did not result in a decrease in the NK cells' own ability to kill cancer cells.

[0106] Example 15: Knockout of B2M and CIITA genes using various gRNA delivery methods To further confirm whether a delivery system other than the shuttle system would produce the same knockout effect, we delivered B2M gRNA or CIITA gRNA and MAD7 nuclease RNP to NK cells using various methods to confirm the knockout efficiency of each gene. For the B2M gene, we used #8 gRNA (SEQ ID NO: 8), and for the CIITA gene, we used #25 gRNA (SEQ ID NO: 44). For each delivery method, we used 1 x 10 6 On the day of knockout, the cells were suspended in 500 μL of opti-MEM (Gibco, 31985062) and cultured in a 12-well plate. The following day, 1 mL of NK cell culture medium was added to each well.

[0107] Method 1: 26μL of PBS, 4μL of 40μM MAD7 nuclease, and 2μL of 100μM B2M or CIITA gRNA were mixed and incubated at room temperature for at least 5 minutes to prepare an RNP reaction solution. 2μL of 5μM FSD64d1 shuttle was added to 48μL of α-MEM medium and mixed with the 50μL of the previously reacted RNP reaction solution. NK cells were treated with the solution and incubated at room temperature for 1 minute 30 seconds. The detailed transfer method was the same as described in Example 1.

[0108] In Method 2, gRNA was delivered to NK cells by electroporation using a Nucleofector (Lonza) device and the Human Natural Killer Cell Nucleofector Kit (Lonza, VPA-1005). The same amount of gRNA, MAD7 nuclease, and NK cells as in Method 1 were mixed with 100 μL of the solution provided by the kit, placed in a cuvette, and electroporation was performed using the U-01 program.

[0109] Method 3 used Lipofectamine CRISPRMAX transfection reagent (Invitrogen, CMAX00008). 1 × 10 cells were transfected into a 12-well plate. 6 NK cells were pre-suspended and mixed in a 1.5mL tube with the same amount of gRNA as in Method 1, 2.5μL of MAD7 nuclease and Cas9 plus reagent, and 25μL of opti-MEM to prepare Tube 1, which was then incubated at room temperature. Tube 2 was prepared by mixing 1.5μL of CRISPRMAX reagent and 25μL of opti-MEM in another 1.5mL tube, and the reaction mixture prepared in Tube 1 was then mixed and incubated at room temperature for 5 minutes before being used with NK cells.

[0110] Method 4 used Lipofectamine 2000 Transfection Reagent (Invitrogen, 11668027). 1 × 10 cells were transfected into a 12-well plate. 6NK cells were pre-suspended and mixed with the same amount of gRNA as in Method 1, MAD7 nuclease, and 25 μL of opti-MEM in a 1.5 mL tube to prepare Tube 1. 2.5 μL of Lipofectamine 2000 and 25 μL of opti-MEM were mixed in another 1.5 mL tube to prepare Tube 2. The reaction solution prepared in Tube 1 was then mixed and reacted at room temperature for 5 minutes before being used to treat the NK cells.

[0111] The reduction in gene expression was confirmed by flow cytometry using a B2M antibody for B2M gene knockout NK cells after 3 days of culture, and an HLA-DR antibody for CIITA gene knockout NK cells after 7 days of culture. The gene expression level measured by flow cytometry was converted to 1 for wild-type NK cells, and the expression levels of B2M or CIITA gene knockout NK cells were calculated as a ratio to NK cells to confirm the efficiency of gene expression reduction. As shown in Figure 18A, when the B2M expression level in control NK cells was set to 1, B2M expression was reduced by 0.46 for Method 1, 0.74 for Method 2, 0.89 for Method 3, and 0.74 for Method 4. The differences in expression reduction levels between the delivery methods were not statistically significant. As shown in Figure 18B, when the HLA-DR expression level of control NK cells was set to 1, Method 1 was 0.48, Method 2 was 0.53, Method 3 was 0.67, and Method 4 was 0.66. Knockout of CIITA reduced HLA-DR expression, and the difference in expression reduction between delivery methods was not statistically significant. The results of Example 14 confirmed that the gene editing system containing B2M gRNA or CIITA gRNA used in the present invention can be delivered to target cells using a variety of delivery methods.

[0112] Example 16: In vitro low immunogenicity evaluation of Log-NK-CIITA KO cells Because Log-NK-CIITA KO cells are NK cells with suppressed surface expression of HLA type I and HLA type II, we predicted their low immunogenicity. To confirm their long-term survival and avoidance of attack by recipient CD4(+) and CD8(+) T cells upon infusion, we performed an in vitro mixed lymphocyte reaction (MLR) assay. To ensure a robust MLR response, CD8(+) T cells or CD4(+) T cells were 100% HLA-A, B, C, and DRB1 mismatched with wild-type NK or Log-NK-CIITA KO cells. The irradiated PBMCs used for CD8(+) or CD4(+) T cell culture were 37.5% HLA-A, B, C, and DRB1 matched with wild-type NK or Log-NK-CIITA KO cells. The method for isolating CD8(+) T cells from PBMCs was the same as that described in Example 9, and a CD4(+) T cell isolation kit (Miltenyi Biotec, 130-096-533) was used to isolate CD4(+) T cells. The method was as follows: PBMCs were washed once with MACS buffer, and the cell pellet was collected at 1 × 10 7 / 40μL, and biotin-antibody cocktail was added at 1 × 10 7 10 μL of cells were added and incubated at 4°C for 5 minutes. 7 Add 1 x 10 / 30 μL of MACS buffer. 720 μL of CD4(+) T cell microbead cocktail was added and incubated at 4°C for 10 minutes. The incubated cell suspension was passed through an LS column (Miltenyi Biotec) to isolate CD4-expressing T cells. 37.5% HLA-matched PBMCs were irradiated at 2,000 cGy and mixed with isolated CD4(+) T cells or CD8(+) T cells at a 1:1 ratio and cultured for 7 days. PBMCs were prepared in a similar manner and cultured for 7 days. CD4(+) T cells and CD8(+) T cells were mixed at a 1:1 ratio and cultured for another 7 days. After a final 14-day culture, they were used for experiments. Control NK cells and Log-NK-CIITA KO cells were fluorescently stained with CFSE, and CD8(+) T cells or CD4(+) T cells were diluted in the same manner as in Example 9 to create a 10:1 effector:target ratio and then placed in a 96-well plate. CD3 T cell-depleted PBMCs irradiated with 2,000 cGy were added to wells containing CD4(+) T cells at the same cell count as the CD4(+) T cells. The 96-well plates containing the cells were incubated in a CO2 incubator at 37°C, and CFSE-positive cells were counted every two hours using an IncuCyte® S3 instrument (Sartorius). As shown in Figure 19A, when co-cultured with CD8(+) T cells for four days, Log-NK-CIITA KO cells were found to contain up to five times more cells than control NK cells. Furthermore, after co-culture with CD4(+) T cells and irradiated PBMCs for four days, Log-NK-CIITA KO cells were found to contain 1.6 times more cells than control NK cells (Figure 19B). These results demonstrate that Log-NK-CIITA KO cells can evade attack by CD4(+) T cells and CD8(+) T cells with significantly higher efficiency than wild-type NK cells.

[0113] Although certain parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and should not be construed as limiting the scope of the present invention, and the true scope of the present invention is therefore defined by the appended claims and their equivalents. The present disclosure relates, for example, to the following: [1] A composition for inhibiting the immunogenicity of mammalian cells, comprising as an active ingredient a nucleic acid molecule that suppresses the expression of type II HLA protein. [2] The composition described in [1], wherein the nucleic acid molecule is a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the HLA type II protein or its activating protein, or a nucleotide sequence encoding the gRNA. [3] The composition according to [2] above, wherein the activator protein of the HLA type II protein is a CIITA (Class II Major Histocompatibility Complex Transactivator) protein. [4] The composition according to [2], further comprising an RNA-guided endonuclease or an RNA-guided endonuclease-encoding nucleotide. [5] The composition described in [3] above, characterized in that the gRNA specifically recognizes a nucleotide sequence selected from the group consisting of sequence No. 20 of the sequence listing, sequence No. 22 of the sequence listing, sequence No. 24 of the sequence listing, sequence No. 27 of the sequence listing, sequence No. 29 of the sequence listing, sequence No. 30 of the sequence listing, sequence No. 40 of the sequence listing, and sequence No. 44 of the sequence listing, or a complementary sequence thereof. [6] The composition described in [1] above, further comprising a nucleic acid molecule that suppresses the expression of β2-microglobulin protein. [7] The composition described in [6], wherein the nucleic acid molecule is a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the β2-microglobulin protein or a nucleotide encoding the gRNA. [8] The composition according to [7], further comprising an RNA-guided endonuclease or an RNA-guided endonuclease-encoding nucleotide. [9] The composition according to [7], wherein the guide RNA (gRNA) specifically recognizes a nucleotide sequence selected from the group consisting of sequence 1 of the sequence listing, sequence 8 of the sequence listing, sequence 9 of the sequence listing, and sequence 14 of the sequence listing, or a complementary sequence thereof.

[10] The composition according to [4] or [8], wherein the RNA-guided endonuclease is selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), and MAD7.

[11] The composition according to [1], further comprising a nucleic acid molecule encoding an HLA type I protein.

[12] The composition according to

[11] , wherein the type I HLA protein is an HLA-E protein.

[13] The composition according to [1] above, wherein the cells are allogenic or autologous cells for transplantation.

[14] The composition according to

[13] above, wherein the cells are stem cells or immune cells.

[15] The cells according to

[14] , wherein the immune cells are natural killer cells.

[16] A low immunogenic mammalian cell produced using the composition according to any one of [1] to [9] and

[11] to

[15] above.

[17] A method for producing low immunogenic mammalian cells comprising the steps of: (a) suppressing the expression of a protein selected from the group consisting of β2-microglobulin protein, HLA type II protein, activator protein of HLA type II protein, and combinations thereof in cells isolated from a mammalian individual; and (b) introducing an HLA-E gene into said cells.

[18] The method according to

[17] , wherein step (a) is carried out by introducing into the cell a guided RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the protein, or nucleotides encoding the gRNA, and an RNA-guided endonuclease or nucleotides encoding the RNA-guided endonuclease.

[19] The method described in

[18] , wherein the guided RNA (gRNA) that specifically recognizes the nucleotide sequence encoding the β2-microglobulin protein specifically recognizes a nucleotide sequence selected from the group consisting of Sequence Listing 1, Sequence Listing 8, Sequence Listing 9, and Sequence Listing 14, or a complementary sequence thereof.

[20] The method according to

[17] , wherein the activator protein of the HLA type II protein is a CIITA (Class II Major Histocompatibility Complex Transactivator) protein. [twenty one] The method according to

[20] , wherein the guided RNA (gRNA) that specifically recognizes the nucleotide sequence encoding the CIITA protein specifically recognizes a nucleotide sequence selected from the group consisting of sequence No. 20 of the sequence listing, sequence No. 22 of the sequence listing, sequence No. 24 of the sequence listing, sequence No. 27 of the sequence listing, sequence No. 29 of the sequence listing, sequence No. 30 of the sequence listing, sequence No. 40 of the sequence listing, and sequence No. 44 of the sequence listing, or a complementary sequence thereof. [twenty two] The method according to

[17] , wherein step (b) is carried out 2 to 4 days after step (a) is completed. [twenty three] The method according to

[17] , further comprising, after step (a), a step of isolating cells in which expression of the protein is suppressed. [twenty four] A method for inhibiting the immunogenicity of mammalian cells, comprising the step of introducing the composition according to any one of [1] to

[15] above into mammalian cells.

Claims

1. A composition for inhibiting the immunogenicity of mammalian cells, comprising as active ingredients a guided RNA (gRNA) that specifically recognizes a nucleotide sequence encoding a CIITA (Class II Major Histocompatibility Complex Transactivator) protein or a nucleotide encoding the gRNA; and an RNA-guided endonuclease or a nucleotide encoding the RNA-guided endonuclease, wherein the gRNA specifically recognizes the nucleotide sequence of sequence No. 44 in the Sequence Listing or a sequence complementary thereto.

2. The composition of claim 1, further comprising a nucleic acid molecule that inhibits the expression of β2-microglobulin protein.

3. The composition of claim 2, wherein the nucleic acid molecule is a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the β2-microglobulin protein or a nucleotide encoding the gRNA.

4. The composition described in Claim 3, characterized in that the guided RNA (gRNA) that specifically recognizes a nucleotide sequence encoding a β2-microglobulin protein specifically recognizes a nucleotide sequence selected from the group consisting of Sequence List 1, Sequence List 8, Sequence List 9 and Sequence List 14, or a complementary sequence thereof.

5. 2. The composition of claim 1, wherein the RNA-guided endonuclease is selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), and MAD7.

6. The composition of claim 1, further comprising a nucleic acid molecule encoding an HLA type I protein.

7. The composition according to claim 6, wherein the type I HLA protein is an HLA-E protein.

8. The composition of claim 1, wherein the cells are allogenic or autologous cells for transplantation.

9. The composition of claim 8 , wherein the cells are stem cells or immune cells.

10. The composition of claim 9, wherein the immune cells are natural killer cells.

11. A low immunogenic mammalian cell produced using the composition according to any one of claims 1 to 10.

12. A method for producing low immunogenic mammalian cells, comprising the steps of: (a) suppressing the expression of β2-microglobulin protein and CIITA (Class II Major Histocompatibility Complex Transactivator) protein in cells isolated from a mammalian individual; and (b) introducing an HLA-E gene into the cells; wherein the step (a) is carried out by introducing into the cell a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the protein or a nucleotide encoding the gRNA, and an RNA-guided endonuclease or a nucleotide encoding the RNA-guided endonuclease; The gRNA that specifically recognizes the nucleotide sequence encoding the CIITA protein is characterized by specifically recognizing the nucleotide sequence of sequence No. 44 of the sequence list or a complementary sequence thereof.

13. The method of claim 12, wherein the guide RNA (gRNA) that specifically recognizes the nucleotide sequence encoding the β2-microglobulin protein specifically recognizes a nucleotide sequence selected from the group consisting of Sequence Listing 1, Sequence Listing 8, Sequence Listing 9, and Sequence Listing 14, or a complementary sequence thereof.

14. 13. The method of claim 12, wherein step (b) is performed 2 to 4 days after step (a) is completed.

15. The method according to claim 12, further comprising, after step (a), a step of isolating cells in which expression of the protein is suppressed.

Citation Information

Patent Citations

  • Transformed human cell and use thereof

    CA3082331A1

  • Compositions and methods for immuno-oncology

    JP2018536436A

  • Stem cell-engineered INKT cell-based off -the-shelf cellular therapy

    WO2019241400A1