Method and apparatus for detecting polyamines

Abstract

To provide an inspection method capable of speedily and easily examining a minute amount of marker components such as polyamine, and a method for selectively analyzing not a total amount of polyamine, but the presence and an amount of specific polyamine.SOLUTION: There is provided a detection method for polyamine included in liquid, and the detection method for polyamine includes detecting the polyamine in contact with aptamer, the detection being performed at least optically or electrically.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to a method for simply detecting polyamine in a short time and an apparatus used therefor.

Background Art

[0002] In recent years, the importance of early diagnosis of diseases such as infectious diseases and cancer has been increasing. Generally, diagnosis of a disease is performed by examining a specimen such as cells, blood, saliva, urine, or tears of a subject. Specifically, for example, a method of examining the risk of a specific cancer by using polyamine contained in saliva has been developed (see Patent Document 1).

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0004] However, the method for examining trace polyamine or the like in the above-mentioned saliva is analyzed using an expensive high-sensitivity mass spectrometer (LC / MS), so the examination cost becomes high, and high expertise and experience are required for measurement and result analysis. Therefore, development of an examination method capable of quickly and simply examining trace marker components such as polyamine is desired. In addition, development of a method for selectively analyzing the presence and amount of a specific polyamine rather than the total amount of polyamine is desired.

Means for Solving the Problems

[0005] [[ID=合41]] The present inventor has intensively studied to solve the above-mentioned problems. As a result, it has been found that the detection sensitivity can be improved by detecting polyamine in a state of being in contact with an aptamer, and the present invention has been achieved. That is, the gist of the present invention is as follows. The first gist of the present invention is a method for detecting polyamines contained in a liquid, wherein the polyamine is detected in contact with an aptama, and the detection is performed by at least one of optical and electrical methods. The second gist of the present invention is the detection method described in the first gist, wherein the polyamine contains at least one of spermine and spermidine. The third gist of the present invention is the detection method described in the first or second gist, wherein the liquid is saliva. The fourth gist of the present invention is the detection method described in any one of the first to third gibbers, wherein the detection is performed in contact with a porphyrin compound. The fifth gist of the present invention is the detection method described in the fourth gist, wherein the porphyrin compound is hemin. The sixth gist of the present invention lies in the detection method described in any one of the first to fifth philosophies, wherein the detection is performed in the presence of a substance whose absorbance changes due to peroxidase activity. Furthermore, the seventh gist of the present invention lies in a detection method described in any one of the first to sixth philosophies, characterized in that the base sequence of the aptama is GTGGGTAGGNCGGGTTGGNN (wherein N is independently A, C, G, T, or no base) (Sequence ID 1). Furthermore, the eighth gist of the present invention is a polyamine detection device for detecting polyamines contained in a liquid, comprising a sample introduction unit for introducing a liquid containing polyamines into the detection device, and a detection unit for detecting polyamines in the liquid, wherein the detection unit detects polyamines in contact with an aptama by at least one of an optical method and an electrical method. [Effects of the Invention]

[0006] The present invention provides a rapid and simple testing method for detecting trace amounts of marker components such as polyamines, and a testing apparatus for use therein. Furthermore, it allows for the selective analysis of the presence and quantity of specific polyamines. [Brief explanation of the drawing]

[0007] [Figure 1]This diagram schematically represents an example of an extended gate transistor type aptor sensor (bottom gate structure) used in this embodiment. [Figure 2] This diagram schematically represents an example of a transistor-type apter sensor (top gate structure) used in this embodiment. [Figure 3] This diagram schematically represents another example of the transistor-type apter sensor (top gate structure) used in this embodiment. [Figure 4] This figure shows the change in absorbance over time in Reference Example B. [Figure 5] This figure shows the shift of the IV curve in Example C1. [Figure 6] This figure shows the shift of the IV curve in Example C2. [Figure 7] This figure shows the shift of the IV curve in comparative example C. [Figure 8] This is a diagram showing the chip of Example D1. [Figure 9] This figure shows the change in potential difference in Example D1. [Figure 10] This figure shows the color changes in the image obtained using example D2. [Figure 11] This figure shows the grayscale average brightness of the colors in the image obtained in reference example D2. [Figure 12] This figure shows the relationship between the measured values ​​of absorbance and MedisafeFit® in the detection-2 results of Reference Example D3. [Modes for carrying out the invention]

[0008] The present invention will be described in detail below. However, the following description is an example (representative example) of the present invention, and the present invention is not limited thereto. Furthermore, the present invention can be modified and implemented as desired without departing from its essence. In this specification, any notation represented by "~" indicates a range that includes the numbers before and after it.

[0009] <Method for detecting polyamines> The present invention provides a method for detecting polyamines (hereinafter sometimes referred to as "the detection method of the present invention"), which detects polyamines contained in a liquid while in contact with an aptama. Here, the detection of polyamines is performed by at least one of optical and electrical methods. That is, the detection method of the present invention comprises a step of preparing a liquid containing polyamines (hereinafter sometimes referred to as "sample preparation step") and a step of detecting the polyamines in this liquid by at least one of optical and electrical methods while in contact with an aptama (hereinafter sometimes referred to as "detection step").

[0010] <Polyamine> The detection method of the present invention targets polyamines contained in liquids. Polyamines are compounds that exist in living organisms, and it is known that the types and amounts present in the body change depending on the subject's physical condition and whether or not they are suffering from an illness. In particular, it is known that their concentration may be high in rapidly proliferating cells such as cancer cells, and they are used as markers in cancer diagnosis. Examples of polyamines include spermine, spermidine, and putrescine. The detection method of the present invention is suitable for detecting these polyamines, and is particularly suitable for detecting spermine and spermidine. Therefore, it is preferable that the polyamine to be detected in the detection method of the present invention contains at least one of spermine and spermidine. Furthermore, because the detection method of the present invention is highly sensitive, it is preferable that the polyamine to be detected is a polyamine contained in bodily fluids such as saliva and blood, or in excretions, and is contained in saliva. Polyamines are particularly preferred. That is, in the sample preparation step of the detection method of the present invention, it is preferable to prepare a liquid containing at least one of spermine and spermidine. Furthermore, in the sample preparation step, it is preferable to prepare a liquid containing bodily fluids such as saliva and blood or excretions, and it is particularly preferable to prepare a liquid containing saliva.

[0011] <Contact with Aptama> The detection method of the present invention detects polyamines in contact with aptamas. The method of contacting polyamines with aptamas is not particularly limited as long as the polyamines come into contact with aptamas when detected. Preferred examples include a method in which both polyamines and aptamas are included in the liquid to be tested, and a method in which aptamas are present on the surface of the detection unit of the polyamine detection device that comes into contact with the liquid to be tested. Furthermore, the amount of aptama relative to polyamines is not limited if the detection sensitivity of polyamines is improved by the presence of aptamas.

[0012] The method for incorporating both polyamines and aptamas into the liquid to be tested is not particularly limited; aptamas may be added to a liquid containing polyamines, or a liquid containing polyamines and a liquid containing aptamas may be mixed. If an aptama is present on the surface of the detection unit of a polyamine detection device that comes into contact with the liquid being tested, the polyamine is brought into contact with it. In this case, as long as the polyamine comes into contact with the aptama when it is detected, there are no particular limitations.

[0013] The polyamine detection process is carried out by at least one of optical or electrical methods. When detecting by electrical method, an apter may be fixed to the surface of an electrode (e.g., gate electrode) or the like provided by the detection unit. Here, the apter may be fixed directly to the electrode or to a linker as described later. Furthermore, the apter does not necessarily have to be fixed to the detection unit; it may be present within the detection unit so as to come into contact with the liquid to be detected. Furthermore, when bringing the polyamine into contact with the aptama, the entire volume of the liquid containing the polyamine may be brought into contact with the aptama, but from the viewpoint of improving accuracy, it is preferable to bring it into contact in small amounts by dropwise addition or other means.

[0014] <Detection process (optical method)> When the detection process for polyamines is performed optically, there are no particular limitations as long as the polyamines in the liquid can be optically detected in contact with the aptama. When the detection process is performed optically, it is usually done by using a substance whose absorbance changes upon contact with the polyamine. The change in absorbance can also be measured by known methods, such as measuring the change in absorbance at a specific wavelength. In this case, the detection process usually includes the steps of irradiating a liquid containing polyamines with light and measuring the light that has passed through the liquid containing polyamines. The specific wavelength can be appropriately changed depending on the combination of the substance whose absorbance changes and the type of polyamine, but when using hemin, as described later, polyamines can usually be detected by measuring the change in absorbance at 414 nm.

[0015] The detection of polyamines is preferably carried out in contact with the porphyrin compound. Furthermore, the detection of polyamines is preferably carried out in the presence of a substance whose absorbance changes due to peroxidase activity. This is presumed to be because, when aptama and porphyrin compounds are present, a complex is formed between the aptama and the porphyrin compound, and this complex can reduce hydrogen peroxide (peroxidase activity). Here, the polyamine stabilizes the G-quadruplex structure of the aptama by interacting with it, thereby forming a complex with the porphyrin compound and reducing the peroxidase. This promotes the expression of sidase activity. Therefore, polyamines can be detected by carrying out this reduction reaction of hydrogen peroxide in the presence of a substance whose absorbance changes as a result of this reduction reaction (hereinafter sometimes referred to as "absorbance-changing substance"). Similarly, polyamines can be detected by using a substance that emits fluorescence as a result of this reduction reaction (hereinafter sometimes referred to as "fluorescent substance") or a substance whose luminescence intensity changes as a result of this reduction reaction (hereinafter sometimes referred to as "luminescence-changing substance"). (Hereafter, absorbance-changing substances, fluorescent substances, and luminescence-changing substances may be collectively referred to as "absorbance-changing substances, etc.").

[0016] The absorbance-changing substances are not particularly limited as long as they are substances whose absorbance changes upon reduction by hydrogen peroxide. Specifically, examples include 2,2'-azinobis[3-ethylbenzothiazoline-6-sulfonic acid]diammonium salt (ABTS), ortho-phenylenediamine 2-hydrochloride (OPD), 3,3',5,5'-tetramethylbenzidine (TMB), OxiRed, and Fe(CN)6. 4- These can be used. Examples of fluorescence-changing substances include Amplite™ ADHP, Amplex Red, etc.

[0017] Examples of porphyrin compounds include protoporphyrin IX, heme, hemin, zinc protoporphyrin, magnesium protoporphyrin, hematoporphyrin, benzoporphyrin, metalloporphyrin, 5-aminolevulinic acid, texaphyllin, chlorin, purpurin, bacteriochlorin, phthalocyanine, naphthalocyanine, and their derivatives. Metallic porphyrins are preferred due to their size, the planarity of the aromatic rings they possess, and their cell permeability, and metallic porphyrins with non-bulky side chains are even more preferred. This is because, when the metallic porphyrin, which is a prosthetic group, is coordinated to an aptama having a G-quartet plane, space for further coordination of peroxides is easily secured, and peroxidase activity is easily expressed. Among the porphyrin compounds, hemin is particularly preferred.

[0018] The method of contacting the polyamine with an absorbance-changing substance is not particularly limited, as long as the polyamine is in contact with the substance when it is detected optically in the detection step. That is, the polyamine may be in contact with the aptama at the same time as the aptama, or it may be in contact with the absorbance-changing substance first and then with the aptama, or it may be in contact with the aptama first and then with the absorbance-changing substance. The amount of absorbance-altering substances, etc., relative to polyamines is not limited as long as the absorbance can be altered in the reduction reaction of hydrogen peroxide.

[0019] <Detection process (electrical method)> When the polyamine detection step is performed by an electrical method, in the detection step, there is no particular limitation as long as polyamine in the liquid can be electrically detected in a state of being in contact with the aptamer. Detection by an electrical method is usually performed on a liquid in which a voltage, current, or the like changes due to the presence of polyamine. Here, changes in voltage, current, or the like can also be measured by known methods. The step of detecting polyamine by an electrical method can be performed, for example, by a system in which charge transfer occurs due to a reaction catalyzed by a complex composed of an aptamer in which a G-quadruplex structure is stabilized by interaction with polyamine and a porphyrin compound. Here, it is presumed that the aptamer can reduce the distance between the electrode and the porphyrin compound. Further, as another system in which electrical characteristics change due to the presence of polyamine, as will be described later, a system using nanocarbon having ambipolar characteristics or a system laminated on an electrode can be mentioned. Here, the type of nanocarbon is not particularly limited as long as it has ambipolar characteristics, but graphene is preferable from the viewpoint of mobility. In addition, the method of bringing polyamine into contact with nanocarbon is not particularly limited as long as they are in contact when detecting polyamine by an electrical method. That is, they may be brought into contact simultaneously when bringing the above-mentioned polyamine into contact with the aptamer, or polyamine may be brought into contact with nanocarbon first and then with the aptamer, or polyamine may be brought into contact with the aptamer first and then with nanocarbon. That is, they may be brought into contact simultaneously when bringing the above-mentioned polyamine into contact with the aptamer, or polyamine may be brought into contact with nanocarbon first and then with the aptamer, or polyamine may be brought into contact with the aptamer first and then with nanocarbon.

[0020] <Detection sensitivity> The detection method of the present invention can detect polyamine with high sensitivity by detecting it in a state of being in contact with the aptamer. Specifically, the lower limit of the detection sensitivity is usually 1×10 -6 mol / dm 3 and can be 1×10 -7 mol / dm 3 and can be 1×10 -9 mol / dm 3 and can be 1×10 -10 mol / dm 3 and can be. On the other hand, the upper limit is not particularly limited, but is usually 5×10-3 mol / dm 3 And, 2 × 10 -3 mol / dm 3 It may also be 1 × 10 -3 mol / dm 3 That's fine.

[0021] The detection method of the present invention allows for the detection of each type of polyamine by selecting an appropriate combination of aptamas, etc., according to the type of polyamine. Furthermore, the detection method of the present invention can be applied to the quantitative determination of each polyamine based on the degree of optical and electrical changes. The amount of polyamines such as spermine and spermidine contained in saliva is usually 1 to 10 × 10⁻⁶. -6 mol / dm 3 Therefore, the amount of polyamines such as spermine and spermidine contained in urine is usually 1 to 10 × 10 -8 mol / dm 3 Therefore, when analyzing polyamines in saliva or urine, the saliva or urine is usually diluted 10 to 100 times before analysis in order to eliminate the influence of impurities other than polyamines contained in the saliva or urine. Thus, the detection method of the present invention is considered applicable to the diagnosis of cancer using saliva, urine, etc.

[0022] <Other processes> The detection method of the present invention may include steps other than the sample preparation step and the detection step described above. Such other steps include a sample holding step of holding the liquid sample introduced into the apparatus by the sample introduction step described above, an irradiation step of irradiating the liquid sample held in the sample holding step with light, and a measurement step of measuring the light that has passed through the liquid sample. In this case, the detection step for detecting polyamines in the liquid described above will include the irradiation step and the measurement step. The sample holding step, irradiation step and measurement step will be described later as the sample holding unit, irradiation unit and measurement unit of the polyamine detection apparatus.

[0023] <Polyamine detection device> The polyamine detection device of the present invention (hereinafter sometimes referred to as "the detection device of the present invention") can detect polyamines contained in a liquid while they are in contact with an aptama. The detection device of the present invention comprises a sample introduction unit for introducing a liquid containing polyamines into the detection device and a detection unit for detecting polyamines in the liquid, and the detection unit can detect polyamines in contact with the aptama by at least one of optical and electrical methods. The optical detection device (hereinafter sometimes referred to as "the optical detection device of the present invention") and the electrical detection device (hereinafter sometimes referred to as "the electrical detection device of the present invention") will be described below.

[0024] <Optical detection device> The optical detection device of the present invention is not particularly limited as long as it can optically detect polyamines in contact with the aptama. Specifically, for example, when using the absorbance-changing substance described above, an apparatus can be provided that includes a sample holding unit for holding the liquid sample introduced into the apparatus from the sample introduction unit, an irradiation unit for irradiating the liquid sample held in the sample holding unit with light, and a measurement unit for measuring the light that has passed through the liquid sample. In this case, the detection unit for detecting polyamines in the liquid described above will have both an irradiation unit and a measurement unit.

[0025] The sample holder is not particularly limited as long as it can hold a liquid sample and measure its optical properties. Specifically, it may be a container-shaped holder for the liquid sample, or a plate-shaped holder. A recessed shape that can hold a liquid sample on top is also acceptable. If light is shone into the sample introduction section, the sample introduction section may also serve as the sample holding section. Furthermore, if the liquid sample is saliva, for example, the subject can hold the sample holding section in their mouth and apply saliva to it.

[0026] The optical detection device of the present invention measures the optical properties of polyamine in contact with aptama in the detection unit. Therefore, it is preferable that the optical detection device of the present invention comprises at least one of the following: a sample introduction unit that can introduce a liquid containing polyamine and aptama, or a sample holding unit that can introduce aptama.

[0027] The irradiation unit is not particularly limited as long as it can irradiate the liquid sample with light. The irradiation light used is light of a wavelength that changes absorbance due to the presence of polyamine in contact with the aptama. In other words, it is sufficient to irradiate with light of a wavelength that changes absorbance depending on the absorbance-changing substance, the type of polyamine and aptama, and their combination. Specifically, for example, when ABTS is used as the absorbance-changing substance, it is preferable to irradiate with light having a wavelength of 414 nm. Furthermore, the light source is not particularly limited as long as it can irradiate with light of the desired wavelength, and for example, halogen lamps, tungsten lamps, xenon lamps, LEDs, lasers, etc. can be used.

[0028] The measurement unit is not particularly limited as long as it can measure the light that passes through the liquid sample. The absorbance can be calculated from the ratio of the irradiated light intensity to the transmitted light intensity. Furthermore, the amount of polyamine in the liquid sample can be quantified from the intensity of this absorbance.

[0029] <Electrical detection device> The electrical detection device of the present invention is not particularly limited as long as it can electrically detect polyamine in contact with an aptama. Specifically, for example, a device having a gate electrode, a source electrode, a drain electrode, a semiconductor sandwiched between these electrodes, and a gate insulating layer can be preferably used. Here, it is preferable that the gate electrode is structured to be in contact with the liquid sample introduced into the device from the sample introduction section described above. It is also preferable that the gate insulating layer be between the source electrode, the semiconductor and drain electrode and the gate electrode. It is preferable to have a reference electrode that is in contact with the liquid sample separately from the gate electrode.

[0030] In the case of the electrical detection device described above, there are no particular restrictions on the shape of each component as long as it can perform its function. Similarly, there are no particular restrictions on the thickness of each component as long as it can perform its function, however, the electrodes are preferably 0.01 μm or thicker, more preferably 0.02 μm or thicker, and on the other hand, they are preferably 2 μm or less, and even more preferably 1 μm or less.

[0031] Furthermore, if aptamas are present on the surface of the detection unit that comes into contact with the liquid being detected, the aptamas may be present on any component if their presence improves the detection sensitivity of polyamines. Also, if the liquid being detected contains both polyamines and aptamas, the detection unit only needs to be structured in such a way that aptamas can be present.

[0032] The aptama is preferably immobilized on the gate electrode, and more preferably immobilized in layers on or within the electrode surface. When immobilized in layers, the aptama may be present in one or multiple layers. Immobilization of the aptama to the electrode can be carried out by methods such as physical adsorption or chemical bonding. The aptama may also be immobilized together with a binder. When the aptama is present on the electrode, a linker may be used. The type of linker is not particularly limited as long as it allows the aptama to be present on the electrode. When a linker is used, as described later, an amino group, an alkyl-linked amino group, or 6-8 atoms may be present at the 5' or 3' position. Spacer biotin molecules, those having terminal modification groups such as thiol groups and phosphothioates are preferred. When immobilizing aptamas in layers, the thickness of the aptama layer is not particularly limited as long as the presence of the aptama layer improves the detection sensitivity of polyamines. The size (area) of the aptama layer should be set appropriately according to the size and shape of the surface on which the aptama layer is to be installed. A specific example of the structure of the electrical detection device (transistor-type aptor sensor) of the present invention will be explained using Figures 1 to 3.

[0033] <Extended Gate Transistor Type Aptor Sensor> As shown in Figure 1, the extended gate transistor type aptor sensor consists of an aptama 21, an extended gate electrode 19 and a reference electrode 20 that come into contact with a sample solution (saliva in Figure 1) 18 containing polyamine 23, hydrogen peroxide W, a redox substance (redox substance Y in Figure 1), and hemin 22, a gate electrode 15 that receives the voltage change of the working electrode, a semiconductor layer 12, a gate insulating layer 14, a source electrode 11, and a drain electrode 13, and detects changes in the current between the source electrode 11 and the drain electrode 13. As shown in Figure 1, a substrate 16 and an outer casing 17 may be used as needed. Furthermore, as will be described later, the aptama 21 may be fixed in layers on the extended gate electrode 19 or as a mixed layer. Figure 1 shows a configuration in which the aptama 21 exists in layers within the extended gate electrode 19. Furthermore, in this specification, for the sake of ease of explanation, the "gate electrode 15" and the "extended gate electrode 19" shown in Figure 1 are referred to by different names, but they may also be treated collectively as "gate electrode 15". Note that a simplified configuration combining the gate electrode 15 and the extended gate electrode 19 in Figure 1 is shown in Figure 2 (top gate structure).

[0034] Figure 1 shows a basic configuration of a transistor-type aptor sensor, employing a bottom-gate transistor. An extended gate electrode 19 and a reference electrode 20 are formed on the surface of a substrate 16, and the extended gate electrode 19 and reference electrode 20 are in contact with the sample solution 18, which is the measurement solution. The extended gate electrode 19 is connected to the gate electrode 15 of the transistor, and the reference electrode 20 is connected to the source electrode 11 of the transistor. A gate insulating layer 14 is formed on the gate electrode 15, followed by the source electrode 11 and drain electrode 13, and then a semiconductor layer 12 is formed on top of them, constituting the transistor. A protective layer may be formed as needed.

[0035] The reference electrode 20 is connected to a reference potential point (ground), and a gate voltage Vg is applied to the gate electrode 15 to which the extended gate electrode 19 is connected via the sample solution 18. Due to the catalytic reaction of the aptama 21, the reducing substance Y is oxidized to the oxidizing substance Z, and as a result the potential of the extended gate electrode 19 changes, the voltage applied to the gate electrode 15 effectively changes. The source electrode 11 is connected to a reference potential point (ground), and the operating voltage Vsd is supplied to the drain electrode 13. This makes it possible to detect the change in current between the source electrode 11 and the drain electrode 13 with respect to the voltage Vtg supplied to the gate electrode 15 of the transistor, with a wide dynamic range according to the operating voltage Vsd.

[0036] As the material for the substrate 16, for example, resins such as polyethylene naphthalate, polyethylene terephthalate, polyethylene, polyimide, and polyparaxylylene (parylene®), paper, glass, and silicon can be used.

[0037] For example, aluminum, silver, gold, copper, platinum, titanium, indium tin oxide (ITO), poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS), etc. can be used as the material for the gate electrode 15.

[0038] For example, the constituent materials of the gate insulating layer 14 can be silica, alumina, self-assembled monolayer (SAM), polystyrene, polyvinylphenol, polyvinyl alcohol, polymethyl methacrylate, polydimethylsiloxane, polysilsesquioxane, polytetrafluoroethylene (Teflon® AF), Cytop®, etc.

[0039] The source electrode 11 and drain electrode 13 can be made from materials such as aluminum, silver, gold, copper, platinum, titanium, ITO, or conductive polymers such as PEDOT:PSS.

[0040] As the constituent material of the semiconductor layer 12, it is possible to use general semiconductors such as compound semiconductors, organic semiconductors, and nanocarbons. However, in the case of P-type semiconductors, it is preferable to use pentacene, dinaphthothienothiophene, benzothienobenzothiophene (Cn-BTBT), TIPS pentacene, TES-ADT, rubrene, P3HT, PBTTT, etc., and in the case of N-type semiconductors, it is preferable to use fullerene, etc. In addition, inorganic materials such as GaAs, AlN, and Si that can be introduced in a relatively low-temperature process that allows for transfer, etc., can also be used.

[0041] For example, the constituent materials of the protective layer can be polytetrafluoroethylene (Teflon® AF), Cytop®, polyparaxylylene (Parylene®), etc.

[0042] The manufacturing method for transistors may include, for example, dry processes such as vapor deposition and sputtering, coating methods such as spin coating, bar coating, and spray coating, and printing using various printing presses such as screen printing, gravure offset printing, letterpress reverse printing, and inkjet printing.

[0043] The gate electrode 15 and the extension gate electrode 19 are shown as an integrally manufactured extension gate, but the gate electrode 15 and the extension gate electrode 19 may also be manufactured separately and connected. If they are not formed integrally, the material of the extension gate electrode 19 is not limited, and for example, aluminum, silver, gold, copper, platinum, carbon, titanium, ITO, PEDOT:PSS, etc. can be arbitrarily selected and used.

[0044] Examples of redox substances include ABTS, OPD, TMB, Oxired, and Fe(CN)6. 4- These can be used individually or in combination. Alternatively, the hemin may react directly with the extended gate electrode.

[0045] The reference electrode 20 can be any electrode that exhibits a stable reference potential, such as a standard hydrogen electrode, calomel electrode, silver / silver chloride electrode, or a pseudo-reference electrode made of metal such as aluminum, silver, gold, copper, platinum, or titanium, a carbon electrode, or a conductive polymer such as ITO or PEDOT:PSS.

[0046] The aptama 21 and the redox substance may be dissolved in the measurement solution or fixed on the extended gate electrode 19. Furthermore, the aptama 21 and the redox substance may be fixed in layers on the extended gate electrode 19 or as a mixed layer.

[0047] The extended gate electrode 19 and the reference electrode 20 may be connected by an external resistor. In this case, the regeneration reaction of the redox substance proceeds spontaneously, and a steady drain current can be obtained.

[0048] The structure of a transistor is not limited to the bottom gate structure shown in Figure 1, but also includes the top gate structure shown in Figure 2. A different structure can also be used. In the case of the top gate structure shown in Figure 2, the gate electrode 15 and the extended gate electrode 19 are carried out by the same electrode. The structure of the surface of the gate electrode 15 can be the same as that shown in Figure 1. Figure 2 is a cross-sectional view of the detection unit having a top gate structure, and, similar to Figure 1, it assumes a configuration in which the aptama 21 is layered within the gate electrode 15, and shows a configuration in which the aptama 21 is present within the gate electrode 15. Furthermore, in the case of a transistor-type aptor sensor, the structure of the extended gate electrode 19 shown in Figure 1 is preferable because only the extended gate electrode 19 comes into contact with the measurement solution, thus enabling stable operation.

[0049] <Transistor-type apter sensor (top gate structure)> Figure 3 illustrates a different embodiment of the transistor-type apter sensor (top gate structure) from that shown in Figure 2. The transistor-type aptor sensor in Figure 3 consists of a source electrode G2, a drain electrode G3, a gate electrode, and a semiconductor layer G4 stacked on a substrate G1. A target trapper G5 containing an aptama is fixed (also called modified) on the semiconductor layer G4. A wall G6 (sometimes referred to as a "pool") for holding a liquid sample or a cover sheet layer G7 for transferring a liquid sample is in contact with the target trapper G5 as needed. A reference electrode G8, corresponding to the gate electrode, is placed inside, and a gate voltage Vtg is applied to detect the charge of the target trapped within the device length of the target trapper G5, or the charge of the redox reaction generated by the catalytic reaction in the aptama, or the intramolecular charge distribution of the linker and aptama portion resulting from the target trapping, the change in dipole moment, the intramolecular charge distribution in the target molecule, and the correspondence between the doping amount and charge due to the change in dipole moment are detected by the magnitude of the shift and whether the shift is positive or negative. Nanocarbons with particularly high mobility and ambipolar properties, such as graphene, are preferred.

[0050] The substrate G1 can be made of any material as long as it is an insulating substrate. Typically, an insulating substrate or an insulated semiconductor substrate is used. In this embodiment, unless otherwise specified, "insulating" refers to electrical insulation, and unless otherwise specified, "insulator" refers to an electrical insulator. Furthermore, when used as a sensor, in order to increase sensitivity, it is preferable to use an insulating substrate or a semiconductor substrate whose surface is insulated by coating it with a material that constitutes an insulating substrate (i.e., an insulator).

[0051] The insulating material used to form the insulating substrate may be either an inorganic or organic material. Examples of inorganic materials include silicon oxide, silicon nitride, aluminum oxide, titanium oxide, and calcium fluoride. Examples of organic materials include aliphatic polyester, polyethylene terephthalate, polybutylene terephthalate, polycarbonate, polysulfone, polyethersulfone, polyethylene, polypropylene, polystyrene, polyphenylene sulfide, polyparaxylene, polyimide, polyvinyl alcohol, polyvinyl chloride, polyvinylidene fluoride, polysiloxane, polyvinylphenol, and polyaramid. These insulating materials may be used individually or in any combination and ratio of two or more materials.

[0052] A semiconductor substrate is typically a substrate made of a semiconductor. Specific examples of semiconductor materials used to form a semiconductor substrate include silicon, gallium arsenide, gallium nitride, zinc oxide, indium phosphide, and silicon carbide. These semiconductor materials may be used individually, or two or more may be used in any combination and ratio.

[0053] The method of insulating the semiconductor substrate is arbitrary, but it is usually preferable to insulate the surface by covering it with an insulator as described above. When insulating by forming an insulating film on the semiconductor substrate, specific examples of the insulator used for the covering are the same as the insulating material used to form the insulating substrate described above. It can be listed.

[0054] The configuration of the electrodes is not particularly limited, but for example, in the configuration shown in Figure 3, the first electrode G2 and the second electrode G3 are the source electrode and drain electrode, respectively, and the third electrode G8 is a reference electrode that functions as a gate electrode.

[0055] Examples of materials used for the first electrode (source electrode) G2 and the second electrode (drain electrode) G3 include, but are not limited to, conductive metal oxides such as tin oxide, indium oxide, and indium tin oxide (ITO); metals and alloys thereof such as platinum, gold, silver, aluminum, indium, chromium, titanium, and palladium; nanocarbon materials such as carbon nanotubes (CNTs) and graphene; and conductive carbon black. These materials may be used individually, or multiple materials may be used in layers or mixed. In the detection device of the present invention, from the viewpoint of stability with contact with aqueous solutions, etc., it is preferable that the first electrode G2 and the second electrode G3 be selected from gold, silver, platinum, palladium, titanium, chromium, and nanocarbon materials.

[0056] The width, thickness, and spacing of each electrode can be designed arbitrarily. The width of the electrodes is usually 1 μm or more and 1 mm or less. The thickness of the electrodes is usually 1 nm or more, preferably 0.01 μm or more, and more preferably 0.02 μm or more, while on the other hand, it is usually 10 mm or less, preferably 2 μm or less, and more preferably 1 μm or less. The spacing between the first electrode 2 and the second electrode 3 can be appropriately designed according to the structure and mobility of the semiconductor, but is usually 1 nm or more and 10 mm or less.

[0057] The third electrode (reference electrode) G8 corresponds to the gate electrode. The third electrode G8 may be the same as the reference electrode in Figure 1 above, from the viewpoint of being able to apply a stable voltage in a buffer solution such as physiological saline. That is, it may be a standard hydrogen electrode, a calomel electrode, a silver / silver chloride electrode, or a metal electrode such as aluminum, silver, gold, copper, platinum, or titanium, or a pseudo-reference electrode such as a conductive polymer such as ITO or PEDOT:PSS.

[0058] The semiconductor layer G4 is formed from semiconductor components such as elemental semiconductors, compound semiconductors, organic semiconductors, and nanocarbon materials. In the detection device of the present invention, organic semiconductors and nanocarbon materials are preferred from the viewpoint of coatability. Among nanocarbons, graphene and carbon nanotubes (CNTs) are preferred from the viewpoint of extremely high mobility, high stability, and transfer to coating materials such as inks. Furthermore, graphene is preferred from the viewpoint of easily ensuring uniformity of properties within the film. There are no particular restrictions on the film thickness of the semiconductor layer G4, but it is usually preferred to be between 0.2 nm and 100 nm. Being within this range makes it possible to sufficiently extract the change in electrical properties due to the interaction between the target recognition molecule and the target substance as an electrical signal. The film thickness of the semiconductor layer G4 can be measured by known methods, such as secondary ion mass spectrometry (SIMS), AFM, and ellipsometer.

[0059] As a method for forming the semiconductor layer G4, dry methods such as resistance heating deposition, electron beam deposition, sputtering, CVD, and transfer from other substrates can be used, but from the viewpoint of manufacturing cost and suitability for large areas, it is preferable to use wet methods such as coating methods. The coating method includes a step of forming the semiconductor layer G4 by coating semiconductor components. Specific coating methods include spin coating, blade coating, slit die coating, screen printing, bar coating, template method, print transfer method, immersion pulling method, or inkjet method. From these methods, a preferred method can be selected according to the characteristics of the coating film to be obtained, such as control of coating film thickness and orientation. The formed coating film may be subjected to annealing treatment in air, under reduced pressure, or in an inert gas atmosphere such as nitrogen or argon, or in a reducing gas atmosphere such as hydrogen or a mixture of hydrogen gases.

[0060] As mentioned above, it is preferable that the semiconductor layer G4 separately holds a target capturer G5. Here, the target capturer G5 refers to a substance that can specifically capture the target substance to be detected. In other words, in the detection method and detection apparatus of the present invention, the capturer is an aptama, a composite of an aptama and a porphyrin compound, etc. The capturer can be held in the semiconductor layer G4 by hydrophobic bonding. In this case, an aromatic ring such as pyrene, triphenylene, benzoanthracene, or terphenyl, which has an NCS group, can be introduced into the capturer as a linker. Those having pyrene are particularly easy to use stably. With such an aromatic ring, in addition to the hydrophobic bonding mentioned above, it is also possible to hold the target capturer G5 on the semiconductor layer G4 by π-π electron interaction.

[0061] Furthermore, it is preferable that the linker provides a space in which the aromatic ring and the NCS group substituted by the target capturer G5 maintain an appropriate positional relationship for the target capturer G5 to function, and it is preferable that the aromatic ring and NCS group of the linker are linked by a substituted or unsubstituted linear alkyl group. It is believed that such linkage makes it possible to avoid spatial arrangements that make it difficult to capture the target or that make it difficult for catalytic reactions using the target capturer G5 as a reaction field to occur. Furthermore, when the semiconductor layer G4 is an inorganic semiconductor such as a Si semiconductor, the target capturer G5 can be immobilized on the semiconductor surface using a silane coupling agent such as ATS.

[0062] The wall G6 may be formed by cutting out a silicone rubber sheet and pressing it into place. Alternatively, pressing a die-cut piece made from PDMF or silicone resin using a 3D printer, or directly forming the bank using an inkjet coating device, is more preferable from the standpoint of device manufacturing costs. Furthermore, the wall G6 may be replaced with a channel formed from PDMF or the like.

[0063] The cover sheet layer G7 can be, for example, a thin hydrophilic film such as gelatin, chitosan, collagen, PVA, or PVC, or a hydrogel film containing P2VP, PNIPAAm, HEMA, CMC, PEI, PEG, etc., or a nonwoven fabric having nanorods. This layer may be crosslinked as appropriate. This layer can be provided for purposes such as preventing the dispersion of the dropped sample solution and efficiently bringing it into contact with the semiconductor layer G4, or for capturing impurities so that they do not reach the semiconductor layer G4. Therefore, for the former purpose in particular, a thin film thickness is preferable. The diffusion coefficient D of molecules in a structure with a polymer network is, for example, in the hydrogel, D / D0 ∝ φ with respect to the diffusion coefficient D0 in water. -α Relationships such as the above are known, and the larger the mesh size φ and the difference α between the diffusing molecules and the mesh size, the easier diffusion occurs, and the interaction between diffusing molecules and polymers is small. By designing the film thickness of this layer to be sufficiently small, it may be possible to obtain a diffusion rate comparable to that of water. A suitable film thickness for this purpose is several nm to 50 nm, more preferably several nm to tens of nm.

[0064] The hydrogel can also be prepared from a photocurable resin composition, a thermosetting resin composition, etc. From the viewpoint of ease of handling, one prepared from a photocurable resin composition is preferred. These may further contain thickening agents, crosslinking agents, polar solvents, and other components as needed. When in use, this layer may be filled with an aqueous solution with a composition similar to the buffer buffer used to dilute the sample solution. Alternatively, a microchannel may be provided instead of the above layer.

[0065] <Information Processing Unit and Information Output Unit> The detection device of the present invention may further include an information processing unit for processing information such as measurement data and an information output unit for outputting information such as measurement data.

[0066] <Sample Collection Department> The detection device of the present invention may have a sample collection unit for collecting a sample solution. The sample collection unit may also function as the sample introduction unit described above. Alternatively, the device may be structured to allow the sample to be transferred from the sample collection unit to the sample introduction unit. The sample collection unit may, for example, include a functional unit for removing components that are not to be detected, such as ingested substance residues or proteins, when the sample is a bodily fluid. For such a sample collection unit, the parts described in Japanese Patent Publication No. 2019-502893 may be used.

[0067] <Aptama> The type of aptama is not limited as long as it can improve the detection sensitivity of the target polyamine. Aptamas (sometimes referred to as "Oligos") are nucleic acid molecules that specifically bind to target molecules. Aptamas are composed of nucleotide residues. Examples of nucleotide residues include ribonucleotide residues and deoxyribonucleotide residues.

[0068] The nucleic acid molecule may be, for example, RNA composed of ribonucleotide residues, DNA composed of deoxyribonucleotide residues, or a nucleic acid molecule containing both deoxyribonucleotides and ribonucleotides. The nucleic acid molecule may be single-stranded or double-stranded. Examples of single-stranded nucleic acids include single-stranded RNA and single-stranded DNA. Examples of double-stranded nucleic acids include double-stranded RNA, double-stranded DNA, and double-stranded nucleic acids of RNA and DNA. Single-stranded nucleic acids are preferred. In the nucleic acid molecule, each base may be a natural base (non-artificial nucleic acid) such as adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or an artificial base (non-natural base).

[0069] Examples of artificial bases include modified bases and altered bases. Preferably, the artificial base has a function similar to that of a natural base (A, C, G, T, or U). Examples of artificial bases having a function similar to that of a natural base include artificial bases that can bind to cytosine (C) instead of guanine (G), artificial bases that can bind to guanine (G) instead of cytosine (C), artificial bases that can bind to thymine (T) or uracil (U) instead of adenine (A), artificial bases that can bind to adenine (A) instead of thymine (T), and artificial bases that can bind to adenine (A) instead of uracil (U). In the detection method and detection apparatus of the present invention, the bases represented by A, G, C, T, and / or U include not only natural bases but also artificial bases having a function similar to that of each natural base.

[0070] Modified bases include, for example, methylated bases, fluorinated bases, aminoated bases, and thiolated bases. Specific examples of modified bases include, for example, 2'-fluorouracil, 2'-aminouracil, 2'-O-methyluracil, and 2-thiouracil. In the detection method and detection apparatus of the present invention, DNA aptamas (A, T, C, G) are preferred from the viewpoint of synthesis and stability, and G-quadruplex having a G quartet plane is more preferred. Furthermore, a system that does not have various modifications that may cause steric modulation is preferred.

[0071] In particular, to obtain high peroxidase activity, it is preferable to have an aptama that can interact (coordinate) more stably with the prosthetic group described later, specifically an aptama having a G-quartet face that takes on a G-quadruplex structure, and a metal complex that has the potential to stably (rapidly) produce peroxide adducts using that aptama.

[0072] Regarding G-quadruplex (guanine quadruplex structure: G4), within the telomere region... G-rich sequences are being actively studied because it has become clear that these sequences can form a quadruple-stranded DNA structure called a G-quadruplex. Several patterns of G-quadruplexes are known, including the parallel type, where all four DNA strands point in the same direction from 5' to 3', and the antiparallel type, where two strands point in the same direction but the other two point in opposite directions.

[0073] The G-quadruplex has the characteristics shown in Figure 1. Specifically, four G bases form a structure called a G-quartet via Hougsteen-type hydrogen bonding, and this structure is maintained by π-π stacking interactions between the G-quartet planes. Figure 1 is a diagram (cross-sectional view of the device) showing an example of the detection unit in the detection device of the present invention when saliva is used as the detection target, and shows a bottom gate structure. The left side of Figure 1 shows the configuration of the detection unit, and the lower right side shows that the G-quadruplex structure is stabilized by the interaction of the aptama with the polyamine, forming a complex with hemin and exhibiting peroxidase activity. This complex catalyzes the oxidation reaction of an absorbance-changing substance by hydrogen peroxide, resulting in a color change. By evaluating this color change as absorbance, the amount of polyamine in saliva can be optically detected. Furthermore, by evaluating the change in charge produced by this redox reaction and the associated reactions, the amount of polyamine in saliva can be evaluated.

[0074] The aptama sequence, by arranging A, C, and T between consecutive G sequences such as GGG and GG, provides an appropriate distance to the G sequences, which can improve the peroxidase activity described later. However, some parts may form double helixs (loops), and depending on their spatial position, this may reduce the desired peroxidase activity. Therefore, the number and order of consecutive G sequences in the aptama sequence, and the selection of non-G sequences, are important factors in determining detection sensitivity. Accordingly, the molecular weight (number of bases) of the aptama is preferably within an appropriate range. Specifically, 6 to 30 bases is preferred, and 11 to 25 bases is more preferable, especially when detection is performed by an optical method. In the case of a top-gate method using an electrical double layer as the detection zone, detection sensitivity tends to be higher when the detection zone is closer to the semiconductor surface, and it is particularly preferable to be within 6 nm. Therefore, when comparing cases where only the number of bases differs, a smaller number of bases is preferable.

[0075] The formation of a G-quadruplex structure requires the coordination of metal ions between G-quartet planes, and it is known that K ions and Na ions can coordinate in this way.

[0076] It is known that various polycyclic compounds can coordinate to the G-quadruplex. In particular, from the perspective of utilizing the mechanism of peroxidase activity by heme proteins and heme enzymes, it is desirable to have a more planar structure that is advantageous for peroxidase activity, and the overall size of the polycyclic molecule can be efficiently π-π stacked on the G-quartet plane of the G-quadruplex, with O2 as the central metal. 2- A prosthetic group from which a high-valence metal oxo species is generated by the addition of peroxide is preferred. For example, as the central metal, Fe 2+ Ni 2+ Cu 2+ Co 2+ Mn 2+ Zn 2+These are preferred, and those that coordinate to the D4h structure at the axial position under multiple valencies are preferred. Examples include salen manganese complexes and porphyrin iron complexes, but metal porphyrins are preferred due to the planarity of their aromatic rings, the overall size of the polycyclic molecule, and cell permeability, and it is preferable to select side chains that do not become bulky as much as possible. This is because, in order for the metal complex, which is the prosthetic group, to acquire sufficient peroxidase activity as a result of its compounding with the G-quadruplex, it is necessary to coordinate the components of the G-quartet plane and also have enough space above and below to coordinate the peroxide. Examples of porphyrin compounds include hemins.

[0077] When fixing an aptama to a component of a detection unit such as an electrode, it is preferable that the aptama has terminal modifying groups such as an amino group, an alkyl-linked amino group, a 6-8 atom spacer biotin molecule, a thiol group, or a phosphothioate at the 5' or 3' position so that it can react with the sensitive groups and linker of the component.

[0078] <Color development in oxidation reactions> As a conjugate, a conjugate can be used in which a nucleic acid, protein, peptide, or ligand compound is bound to G4DNAzyme so that the G4DNAzyme can form a G4DNAzyme / hemin complex upon binding to the target substance. Contact between the porphyrin compound and the conjugate is preferably carried out in a buffer solution at 20°C to 30°C under standing or stirring conditions for several minutes to several days. Subsequently, if necessary, the G4 structure may be formed by heat treatment in a buffer solution (pH 7.5 to 8.5) in the presence of metal ions at 90 to 98°C for 1 to 10 minutes, followed by cooling to 20 to 30°C over 20 to 40 minutes. Contact with hemin can be carried out by adding a hemin solution to the sample-contacted conjugate and allowing it to stand at 20 to 30°C for 20 to 60 minutes, thereby forming a DNA(G4DNAzyme) / hemin complex. Measurement or detection of the formed G4DNAzyme / hemin complex can be performed by utilizing the oxidizing action of hemin.

[0079] The G4DNAzyme / hemin complex can be detected, for example, by utilizing the potential of the conductive electrode to which the G4DNAzyme / hemin complex is bound. Hemin becomes reduced by taking electrons from the electrode and returns to the oxidized state by reducing hydrogen peroxide. In this process, as shown in Figures 1 and 2, hydrogen peroxide (H2O2)W is reduced to water (H2O)X. For example, in differential pulsed voltammetry, if a peak cathode current relative to the reference electrode is detected, it means that the G4DNAzyme / hemin complex has been detected. Furthermore, in differential pulsed voltammetry, the intensity of the peak cathode current relative to the reference electrode can be used as an indicator of the abundance of the G4DNAzyme / hemin complex. That is, the level of the G4DNAzyme / hemin complex can be measured from the intensity of the peak cathode current.

[0080] The G4DNAzyme / hemin complex can also be detected by utilizing the peroxidase activity of the G4DNAzyme / hemin complex. In this method, the solution after the reaction treatment is reacted with a peroxidase substrate, and the color development of the substrate is detected. If color development of the dye is detected, it means that the G4DNAzyme / hemin complex has been detected. Furthermore, the intensity of the color development of the dye can be used as an indicator of the amount of G4DNAzyme / hemin complex present. That is, the level of the G4DNAzyme / hemin complex can be measured from the intensity of the color development of the dye. The color development of the substrate means that G4DNAzyme / hemin is present, and the degree of color development is an indicator of the amount of G4DNAzyme / hemin present. Numerous peroxidase substrates are known, for example, pigment precursors such as 3,3',5,5'-Tetramethylbenzidine (TMB), 3,3'-Diaminobendizine (DAB), and DAB10-Acetyl-3,7-dihydroxyphenoxazine are known.

[0081] When detection is performed using an optical method, the absorbance of the pigment precursor that changes color due to the reduction of hydrogen peroxide by the peroxidase activity described above is, for example, as described later. referenceIn examples A1-A9 and B, the absorbance increases near 410nm, 550nm, and 650nm. This change in absorbance can be quantified using software that converts brightness and color tone into color temperature or RGB coding by irradiating with a light source in the 450nm or 650nm emission band used in LED backlights for smartphones, etc., or by receiving the transmitted light with a CMOS or photodiode and monitoring the intensity of the light. Furthermore, when detection is performed using an electrical method, for example, an aptama can be fixed on a substrate such as a specific semiconductor or electrode via a linker, a sample is dropped onto it, and the charge generated by spermine or spermidine contained in the sample can be detected by detecting the current change at an equal voltage due to the shift in the current-voltage curve caused by the field effect of the semiconductor.

[0082] The nucleotide sequence of the aptama is preferably the sequence represented by Sequence ID No. 1, as it can be used for both optical and electrical detection.

[0083] <Aptomer suitable for electrical detection> For electrical detection, in addition to aptamas with the base sequence GTGGGTAGGNCGGGTTGGNN (wherein N is independently A, C, G, T, or no base) (SEQ ID NO: 1), aptamas with more flexible base sequences such as TTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 2) and GGGGACGTTGGCATGGGTGGCCGGGCCCTT (SEQ ID NO: 3) are also preferred. These aptamas are thought to have a tendency to ensure a spatial arrangement suitable for detection using an electrical method that uses the electrical double layer as the detection zone.

[0084] <Applications> The detection method and detection apparatus of the present invention can also be performed by using a known biosensor and ensuring that the sample comes into contact with the aptama during detection. Specifically, for example, it can be performed using a known blood glucose meter. When an enzyme that reacts with glucose in the blood is added to blood, electrons are released when the glucose is oxidized to gluconic acid, changing the charge of the "mediator" in the reagent. After a few seconds, when a voltage is applied, an electric current is generated and the mediator returns to its original state. Blood glucose meters usually calculate the amount of glucose from the amount of current at this time. Therefore, when detecting polyamines electrically, it is possible to detect polyamines by utilizing the mechanism of this blood glucose meter. Furthermore, in commercially available blood glucose meters, it is also possible to detect the coloration of a redox dye that exhibits the above-mentioned charge change of the mediator by optical means. Moreover, it is also possible to detect polyamines in the same way using saliva or the like as a sample instead of blood. [Examples]

[0085] The present invention will be described in more detail below based on examples, but the present invention is not limited to the following examples.

[0086] [Polyamines] Spermine; manufactured by Nacalai Tesque. Spermidine; manufactured by Nacalai Tesque.

[0087] [Absorbance measurement] Absorbance was measured using a plate reader (Multiskan Sky T, ThermoFisher Scientific).

[0088] [ reference Examples A1~A9] [Preparation of sample solution] A total of 10 mmol / dm³ of NaH2PO4 / Na2HPO4 is added to water. 3 Potassium chloride is 100 mmol / dm³ 3 Magnesium chloride is 2 mmol / dm 3 , and Triton An aqueous solution with a pH of 7.0 was prepared by adding X-100 (a nonionic surfactant) to a concentration of 0.003% by volume. After adding each aptama listed in Table 1 to this aqueous solution (when the volume is adjusted to 100 μL in the well, the concentration is 2 μmol / dm³ 3 An aptama aqueous solution was prepared by heating a certain amount of solution in a warm bath at 95°C for 10 minutes, then cooling it in a refrigerator at 4°C for 15 minutes, and then letting it stand at room temperature (25°C) for 15 minutes. 95 μL of this aptama aqueous solution was placed in one well of a 96-well plate. Spermine or spermidine, 10 mmol / dm 3 Using a Tris-HCl aqueous solution (pH 7.0), 5 mmol / dm 3 An aqueous solution of (hereinafter, both may be collectively referred to as "polyamine aqueous solution") was prepared.

[0089] 2 μL of polyamine aqueous solution was added to a well containing aptama aqueous solution, gently shaken, and then allowed to stand at room temperature (25°C) for 30 minutes. Furthermore, hemin solution (Dimethyl sulfoxide, 100 μmol / dm³) was added. 3 After adding 1 μL of (prepared as described above), gently shake and let stand at room temperature (25°C) for 10 minutes. 40 mmol / dm 3 Aqueous solution of ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)) (prepared using the pH 7.0 aqueous solution mentioned above) and 60 mmol / dm 3 A sample solution containing polyamines and aptamas was prepared by adding 1 μL each of the following H2O2 aqueous solutions (prepared using the pH 7.0 aqueous solution mentioned above), gently shaking, and letting it stand for 3 minutes. Furthermore, in preparing this sample solution, instead of a polyamine aqueous solution, use 10 mmol / dm 3 A reference solution was prepared using a Tris-HCl aqueous solution (pH 7.0).

[0090] [Detection of polyamines] The absorbance of the sample solution and reference solution in the wells at 414 nm was measured using a plate reader (Multiskan Sky T, ThermoFisher Scientific). Table 1 shows the change in absorbance for each sample solution relative to the reference solution.

[0091] [Table 1]

[0092] The results in Table 1 confirm that trace amounts of polyamines can be detected optically using Aptama.

[0093] [ reference Example B] reference In Examples A1 to A9, the absorbance at 414 nm was measured continuously, except that the timing of adding the polyamine aqueous solution to the wells during sample preparation was changed as follows, using a thrombin aptama (nucleotide sequence GTTGGTGTGGTTGG (SEQ ID NO: 13)) instead of the aptamas listed in Table 1. Specifically, ABTS aqueous solution and H2O2 aqueous solution were added and allowed to stand for 3 minutes. When the absorbance at 414 nm stabilized, 2 μL of spermine aqueous solution (spermine concentration of 1 mmol / dm3 at the time of absorbance measurement) was added, and the change in absorbance at 414 nm over time was measured. Furthermore, as a comparative experiment, 2 μL of a pH 7.0 aqueous solution was added instead of the spermine aqueous solution in Example C, and the absorbance at 414 nm was measured over time. The measurement results are shown in Figure 4. These results show a significant increase in absorbance upon addition of spermine aqueous solution. This confirms that polyamines can be detected through a simple procedure, such as adding a sample like blood or saliva.

[0094] [Examples C1-C4, Comparative Example C] [Aptama] A modified form of telo24 with a C6 amino group at its terminus (C6 amino group modified telo24) was synthesized. The base sequence is 5'-NH2-(CH2)6-TTAGGGTTAGGGTTAGGGTTAGGG(SEQ ID NO: 2)-3'. The number of bases is 24. We synthesized 7K16 modified with a C6 amino group at its terminus (C6 amino group modified 7K16). The base sequence is 5'-NH2-(CH2)6-GGGGACGTTGGCATGGGTGGCCGGGCCCTT(SEQ ID NO: 3)-3'. The base number is 30.

[0095] [Preparation of Aptama-containing solution] Each aptama is treated with phosphate-buffered saline (10 mmol / dm³). 3 NaH2PO4 / Na2HPO4, 137 mmol / dm 3 By diluting with sodium chloride, pH 7.2-7.4 (sometimes referred to as "PBS"), it can be obtained at 100 nmol / dm³. 3 The concentration was set to [concentration value]. After heating in a 90-95°C bath for 5 minutes, the aptama-containing solution was prepared by cooling to room temperature (25°C) for 1 hour.

[0096] [Manufacturing of transistor-type sensors] A transistor-type sensor with the structure shown in Figure 3 was manufactured. A Ti / Au film (70 nm) was deposited onto a silicon oxide film (1 cm wide x 2 cm long x 285 nm thick) by vapor deposition, and then the source electrode and drain electrode were formed by patterning using photolithography. Each electrode was 5 mm long x 10 μm wide, with a gap of 5 μm between the source electrode and the drain electrode. Dozens of electrodes were placed on the silicon oxide film at equal intervals, with their lengths perpendicular to the length direction of the silicon oxide film, to fabricate a silicon wafer. A graphene monolayer crystalline film, synthesized on copper foil by CVD, was transferred onto this silicon wafer. A semiconductor layer was formed by patterning this graphene film using photolithography. Subsequently, a graphene device was fabricated by annealing at 300°C for 1 hour in an Ar / H2 atmosphere.

[0097] A square hole was made in the center of a 5mm thick silicone rubber sheet to create a wall for the buffer pool. The hole was made so that the pool capacity would be 40-80 microliters each if two pools were to be installed on a single silicon wafer. The pool was created by installing the pool wall on a graphene element so that the graphene portion was in the center. In the pool, 10 mmol / dm 3 A 2-methoxyethanol solution of pyrenebutyric acid N-hydroxysuccinimide ester (linker) (1-Pyrenebutyric acid N-hydroxysuccinimide ester) was filled into the pool and allowed to stand for 10 minutes. After that, the excess linker was washed away by rinsing the pool 4-5 times with PBS. The linker concentration at the time of polyamine quantification was 0.1 μmol / dm³. 3 That's what happened. Fill the pool with the Aptama-containing solution and leave it to stand overnight at room temperature (25°C) to allow the glass to develop. The aptama was modified onto the fen via a linker. It was gently rinsed 3-4 times with PBS. Diluted with PBS, 1 mol / dm³ 3 The unreacted linker was blocked by adding ethanolamine dropwise and letting it stand for 10 minutes. A transistor-type sensor was manufactured by allowing a silver / silver chloride electrode to be mounted as the gate electrode inside the pool.

[0098] [Preparation of sample solution] Spermine and spermidine solutions of the concentrations listed in Tables 2-5 were prepared by dissolving spermine or spermidine in PBS.

[0099] [Quantitative determination of polyamines] Voltage and current were continuously measured while dropping a fixed amount of spermidine solution (Examples C1, C3) or spermine solution (Examples C2, C4) from the lowest concentration to the highest concentration into a pool of transistor-type sensors, as described below.

[0100] [Example C1] After filling the pool with 80 μL of PBS, a voltage (gate voltage, also referred to as Vtg) was swept across the reference electrode corresponding to the gate electrode in the range of 0V to 0.15V, and the change in current between the source and drain electrodes (referred to as Isd) was measured using a measuring unit (Keysight B2912, connected to N1294) (IV curve in transfer characteristic evaluation). The voltage applied between the source and drain electrodes was set to 0.05V. 10 nmol / dm 3 Add 20 μL of spermidine solution to the pool (the spermidine concentration after addition is 2 nmol / dm³). 3 ), waited 15 minutes, and then measured the IV curve. 50 nmol / dm³ 3 Add 20 μL of spermidine solution dropwise (the spermidine concentration after addition is 10 nmol / dm³). 3 ), measure the IV curve after 15 minutes or more, and further, add 500 nmol / dm³ to this pool. 3 Add 20 μL of spermidine solution dropwise (the spermidine concentration after addition is 80 nmol / dm³). 3 ), and the IV curve was measured 15 minutes later. Then, 1000 nmol / dm³ was added to this pool. 3 Add 20 μL of spermidine solution dropwise and wait 15 minutes to obtain a concentration of 5000 nmol / dm³. 3 Add 20 μL of spermidine solution dropwise and wait 15 minutes to obtain a concentration of 5000 nmol / dm³. 3 Add 20 μL of spermidine solution dropwise (the spermidine concentration after addition is 1156 nmol / dm³). 3 We waited 15 minutes and measured the IV curve. Furthermore, 50,000 nmol / dm³ was added to this pool. 3 Add 40 μL of the solution (the spermidine concentration after addition was 9297 nmol / dm³). 3 The IV curve was measured. Here, the drop was gently injected so as to be inserted directly below the reference electrode corresponding to the gate electrode.

[0101] Figure 5 shows the IV curves for each spermidine concentration. Polyamines are positively charged. Therefore, the presence of polyamines can be confirmed by a shift of the Dirac Point to the negative side. Using the graphing software "Origin" from Lightstone, the amount of voltage shift at the Dirac Point was calculated from the IV curves. Specifically, in this pattern, the Dirac Point for each spermidine concentration was not within the applied voltage range, and each IV curve was parallel throughout the entire voltage sweep range. The applied gate voltage at which the Id of the IV curve is 50 μA was defined as the Dirac Point, and the amount of shift from the Dirac Point at which the Id of the IV curve before spermidine addition is 50 μA was defined as the amount of shift at the Dirac Point. The results are shown in Table 2.

[0102] [Table 2]

[0103] As shown in Table 2, using C6 amino group modified telo24 significantly improved the sensitivity of detecting spermidine using an electrical method, reaching 0.002 μmol / dm³. 3 This confirmed that it is possible to detect extremely small amounts of spermidine. Furthermore, since the change in the amount of Dirac Point shift was large depending on the spermidine concentration, it was confirmed that the detection method and detection apparatus of the present invention can be applied to the quantitative determination of spermidine.

[0104] [Example C2] In Example C1, spermine solution was used instead of spermidine solution, and the IV curves at each spermine concentration were measured in the same manner as in Example C1. The results are shown in Figure 6. In this pattern, the Dirac Point was within the applied voltage range. The applied gate voltage at which the Id of the IV curve was 60 μA was defined as the Dirac Point, and the shift amount from the Dirac Point at which the Id of the IV curve before spermine addition was 60 μA was defined as the shift amount at the Dirac Point. The results are shown in Table 3.

[0105] [Table 3]

[0106] As shown in Table 3, using C6 amino group modified telo24 significantly improved the sensitivity of spermine detection by electrical method, reaching 1.156 μmol / dm³. 3 This confirmed that it is possible to detect trace amounts of spermine. Furthermore, the spermine concentration was 1.156 μmol / dm³. 3 From 9.297 μmol / dm 3 As the amount of Dirac Point shift increased, the change in the amount of shift of the Dirac Point became larger, therefore, the detection method of the present invention and the present invention The detection device was confirmed to be applicable to the quantitative determination of spermine. Furthermore, a comparison of the results in Tables 2 and 3 showed that the detection sensitivity and quantitative sensitivity were higher for spermidine than for spermine. This confirms that when each is present in trace amounts, the detection method and detection apparatus of the present invention can selectively detect and quantify only spermidine.

[0107] [Example C3] In Example C1, instead of C6 amino group modified telo24 as the aptama, C6 amino group modified 7K16 was used, and the IV curves at each spermidine concentration were measured in the same manner as in Example C1. In this pattern, Dirac at each spermidine concentration The point was not within the applied voltage range, and each IV curve was parallel throughout the entire voltage sweep range. The applied gate voltage at which the Id of the IV curve was 56 μA was defined as the Dirac Point, and the Dirac point was at which the Id of the IV curve before spermidine dropping was 56 μA. The shift amount from Point was defined as the shift amount at Dirac Point. The results are shown in Table 4.

[0108] [Table 4]

[0109] As shown in Table 4, using C6 amino group modified 7K16 significantly improved the sensitivity of detecting spermidine using an electrical method, reaching 0.002 μmol / dm³. 3 This confirmed that it is possible to detect extremely small amounts of spermine. Furthermore, the significant change in the shift amount of the Dirac Point depending on the spermidine concentration confirmed that the detection method and detection apparatus of the present invention can be applied to quantitative methods.

[0110] [Example C4] In Example C3, a spermine solution was used instead of a spermidine solution, and the IV curves at each spermine concentration were measured in the same manner as in Example C3. In this pattern, the Dirac Point for each spermine concentration was not within the applied voltage range, and the IV curves were parallel throughout the entire voltage sweep range. The applied gate voltage at which the Id of the IV curve was 44 μA was defined as the Dirac Point, and the shift amount from the Dirac Point at which the Id of the IV curve was 44 μA before spermine dropping was defined as the shift amount at the Dirac Point. The results are shown in Table 5.

[0111] [Table 5]

[0112] As shown in Table 5, using C6 amino group modified 7K16 significantly improved the sensitivity of spermine detection by electrical method, reaching 0.080 μmol / dm³. 3 This confirmed that it is possible to detect extremely small amounts of spermine. Furthermore, the spermine concentration was 0.080 μmol / dm³. 3 From 9.297 μmol / dm 3 As the amount of Dirac Point shift increased, the change in the amount of shift of the Dirac Point also increased, which confirmed that the detection method and detection apparatus of the present invention can be applied to quantitative methods. Furthermore, a comparison of the results in Tables 4 and 5 showed that the detection sensitivity and quantitative sensitivity were higher for spermidine than for spermine. This confirms that when each is present in trace amounts, the detection method and detection apparatus of the present invention can selectively detect and quantify only spermidine.

[0113] [Comparative example C] In Example C1 described above, when manufacturing the transistor-type sensor, the pool was filled with PBS instead of the aptama-containing solution, Vtg was swept in the range of -0.15V to 0.05V, and the concentrations of each spermine solution were set to the concentrations listed in Table 6. Except for these differences, the IV curves for each spermine concentration were measured in the same manner as in Example C1. The results are shown in Figure 7. In this pattern, no shift of the Dirac Point toward the negative side occurred. The results are summarized in Table 6.

[0114] [Table 6]

[0115] Thus, in Comparative Example C, where the aptama-containing solution was not used, the addition of spermine solution did not shift the Dirac Point to the negative side, whereas, as described above, in Examples C2 and C4, where the aptama-containing solution was used, the addition of spermine solution shifted the Dirac Point to the negative side. Therefore, using aptama... Furthermore, the sensitivity of detecting spermine using an electrical method was significantly improved, confirming that even trace amounts of spermine can be detected. In addition, when using Aptama, the change in the amount of Dirac Point shift increased as the spermine concentration increased, confirming that the detection method and detection apparatus of the present invention can be applied to the quantitative determination of spermine. Furthermore, the addition of spermine solution significantly increased the negative shift of the Dirac Point, confirming that polyamines can be detected through a simple procedure, such as adding a sample like blood or saliva.

[0116] [Example D1] (Detection of polyamines using a chip) (1) Preparation of Solution A A total of 10 mmol / dm³ of NaH2PO4 / Na2HPO4 is added to water. 3 Potassium chloride is 100 mmol / dm³ 3 Magnesium chloride is 2 mmol / dm 3 , and Triton An aqueous solution with a pH of 7.0 (hereinafter sometimes referred to as a buffer) was prepared by adding X-100 (a nonionic surfactant) to a concentration of 0.003% by volume. Using this buffer, a 4.2 μM aqueous solution of Aptama PS2.M3 was prepared in the same manner as in Example A4. A 100 units / μL aqueous solution of glucose oxidase was also prepared using the above buffer. Solution A was prepared by mixing 47 μL of the above Aptama PS2.M3 aqueous solution, 2 μL of a 40 mM aqueous solution of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), and 1 μL of the above glucose oxidase aqueous solution.

[0117] (2) Preparation of Solution B A 10 mM spermine aqueous solution and a 100 μM hemin solution were prepared in the same manner as in Example A4. A 1 M glucose aqueous solution was also prepared using the above buffer. Solution B was prepared by mixing 1 μL of the 10 mM spermine aqueous solution, 1 μL of the 100 μM hemin solution, and 1 μL of the 1 M glucose aqueous solution.

[0118] (3) Detection The following explanation will be given using Figure 8. A pair of carbon electrode patterns S2, each 20 mm long and 5 mm wide, were coated onto a polyethylene naphthalate (Teijin DuPont, Q51-A4) film S1 using carbon paste (Jujo Chemical Co., Ltd., JELCON CH-8), with their short sides facing each other at a 2 mm gap, and dried at 120°C for 15 minutes. Silver / silver chloride ink was applied to one of the carbon electrode patterns S2 and dried at 80°C for 10 minutes to form the ink-coated area S3. 50 μL of solution A was dropped between the electrodes and dried overnight at room temperature (S5 in Figure 8). A liquid reservoir frame was formed by drilling a 6mm diameter through-hole in a 2mm thick silicone rubber sheet, and it was placed on top of the sheet so that the area where solution A was applied between the electrodes was centered (S4 in Figure 8). 97 μL of the buffer was dropped into this through-hole to dissolve solution A, and the measurement of the potential difference between the electrodes was started using an electrochemical analyzer (BAS Corporation, ALS Electrochemical Analyzer Model 612E). After 5 minutes of measurement, 3 μL of solution B was dropped, and the change in the potential difference between the electrodes was measured to obtain Figure 9.

[0119] The above results demonstrate that hydrogen peroxide can be generated by the reaction of glucose oxidase and glucose, reduced by the reducing power (peroxidase activity) obtained by the reaction of hemin and aptama, and that this reduction reaction can be detected as a potential difference produced by the redox reaction of ABTS. According to one aspect of the present invention, polyamines can be detected on a chip, and since the concentration of polyamines can be detected as a potential difference independent of the electrode area, it becomes possible to miniaturize and increase the sensitivity of the detection device.

[0120] [ reference Example D2] (1) Preparation of Solution C A 20 μM aqueous solution of Aptama PS2.M2 reference Solution C was prepared in the same manner as in Example A3. 98 μL of Aptama PS2.M2 aqueous solution and 2 μL of 40 mM ABTS aqueous solution were mixed to prepare Solution C.

[0121] (2) Preparation of Solution D Tris-HCl aqueous solutions of spermine or putrescine at various concentrations and 100 μM hemin solution reference Solution D was prepared in the same manner as in Example A3. Solution D was prepared by mixing 1 μL of spermine or putrescine aqueous solution, 1 μL of 100 μM hemin solution, and 1 μL of 60 mM hydrogen peroxide aqueous solution.

[0122] (3) Detection 30 μL of solution C was added dropwise to a circular piece of chromatography paper (Whatman, 3001-861) cut to a diameter of 6 mm, and dried at room temperature for 2 hours. Then, 10 μL of solution D was added dropwise, and after 10 minutes, the color change was photographed with a digital camera to obtain Figure 10. The captured image was converted to grayscale using the free software IrfabView, and the average brightness within the circle was calculated to create Figure 11. The average brightness increased in a spermine concentration-dependent manner, but did not respond to the concentration of putrescin used as a control. This indicates that spermine can be detected by colorimetric method using absorbance.

[0123] [ reference Example D3] (1) Preparation of PS2.M aptama aqueous solution and MO-10 aptama aqueous solution reference Regarding the PS2.M aptama of Example A1 and the newly synthesized MO-10 aptama consisting of the sequence GTGGGTAGGGGCGGGTTGG (sequence number 14), reference A 2.1 μmol / dm3 aqueous solution of PS2.M aptama and a 2.1 μmol / dm3 aqueous solution of MO-10 aptama were prepared in the same manner as in Example A1.

[0124] (2) Detection-1 Add 47.5 μL of Aptama PS2.M aqueous solution to one well of a 96-well plate. reference 2 μL of a 25 mmol / dm3 spermidine aqueous solution, prepared in the same manner as in Example A1, was added dropwise and shaken for 10 seconds. After standing for 2 minutes, referenceAdd 1 μL of the hemin solution prepared in the same manner as in Example A1, shake for 10 seconds, let stand for 2 minutes, and then... reference ABTS aqueous solution and hydrogen peroxide aqueous solution, prepared in the same manner as in Example A1, were added dropwise in 1 μL each. After shaking for 10 seconds, the absorbance was measured 10 minutes later using a plate reader (AS ONE MPRA-100, measurement wavelength 405 nm) (referred to as PS2.M aptamars spermidine detection solution), and the result was 0.979. The PS2.M aptamars spermidine detection solution was drawn up with a 20 μL pipette and dropped onto a petri dish. The dropped droplet was measured using a commercially available Terumo MedisafeFit® blood glucose meter, which displayed a reading of 51 mg / dl. The absorbance of the MO-10 aptamas spermidine detection solution, obtained in exactly the same manner as in the above example except that PS2.M aptamas were replaced with MO-10 aptamas, was 0.535. When a droplet of this solution was measured with a Terumo Medisafe Fit blood glucose meter, it displayed 63 mg / dl.

[0125] When detecting spermidine, the more favorable the aptama sequence is for the hemin-spermidine combination, the stronger the peroxidase activity becomes, resulting in the reduction and elimination of more hydrogen peroxide. Depending on the amount of reduction, more colored ABTS oxide is generated, leading to an increase in absorbance at 405-420 nm. As shown above, the absorbance of PS2.M Aptama is higher than that of MO-10 Aptama. Because of the higher activity, PS2.M exhibits higher peroxidase activity, and it is thought that the amount of residual hydrogen peroxide (unreacted portion) is greater in MO-10 aptama.

[0126] (3) Detection-2 When 1 μL of the hydrogen peroxide aqueous solution was added dropwise to 47.5 μL of the buffer used in Example D1 and mixed, and allowed to stand, and when 1 μL each of the hemin solution and ABTS aqueous solution were further mixed to these solutions, the absorbance was measured in the same manner as above, yielding 0.02 and 0.045, respectively. When measured with a Terumo blood glucose meter MedisafeFit (registered trademark), the values ​​were 117 and 110, respectively. Figure 12 shows the results of Detection-2 (relationship between absorbance and MedisafeFit® measurement values).

[0127] As shown in Figure 12, there is a negative correlation between absorbance and the measured value of MedisafeFit®, making it possible to apply the detection method of the present invention to certain commercially available blood glucose meters. The Terumo MedisafeFit® blood glucose meter is equipped with a glucose oxidase in its testing unit to break down glucose in the sample. The system spectroscopically measures the amount of hydrogen peroxide generated by the breakdown of glucose and displays the blood glucose level. It has been confirmed that this mechanism of the MedisafeFit® blood glucose meter can be used to measure the amount of residual hydrogen peroxide. Commercially available blood glucose meters manufactured by Terumo are measuring devices that have red and green LED light. In the reaction using the aptama of the present invention, there is coloration due to the reduction of ABTS and absorption enhancement of hemin due to energy transfer resulting from this coloration, and these absorb red and green light, respectively. Therefore, if monitoring is done with red and green light, it is thought that the color change in the polyamine detection method of the present invention using aptama can be tracked even if other commercially available blood glucose meters are used. However, since the absorption band of green corresponds to the wavelength range of the absorption edge of coloration due to the reduction of ABTS, when using ABTS, an LED with a shorter wavelength than green is preferable.

[0128] [ reference Example D4] below reference In this example, a simple and stable method for supplying hydrogen peroxide was investigated. The only difference is that the aptama Oligo347-9, which has the sequence GTGGGTGGGGCGGTTGGAT (sequence number 15), was synthesized and the PS2.M aptama was replaced with this aptama. reference A similar aqueous solution of Aptama was prepared as in Example A1. In addition, a hemin solution, an aqueous solution of hydrogen peroxide, and an aqueous solution of ABTS were prepared. referenceThe same procedure as in Example D3 was followed. 1 μl each of hemin solution, hydrogen peroxide solution, and ABTS solution were mixed in a plate reader well and allowed to dry at room temperature (dry solution C). After 4 days, 47.5 μl of aptama solution and 2 μl of spermidine solution were mixed and added dropwise to dry solution C. The mixture was mixed and shaken for 10 seconds, but it remained colorless. This colorless mixture was drawn up with a tip and dropped onto a commercially available 0.5% hydrogen peroxide disinfectant wet wipe (HYPROX), which immediately turned blue. From the above results, it has been shown that, according to the present invention, it is possible to perform tests simply by dropping a sample onto a sheet-like reagent portion that can be stored over time, and that a sealed pack of hydrogen peroxide sheet can be used as a hydrogen peroxide supply source in the method of the present invention.

[0129] [ reference Example D5] We investigated the matrix used in chips such as Example D1. reference The solution prepared in Example D4 was used. After mixing hemin solution, hydrogen peroxide aqueous solution, and ABTS aqueous solution with hydrogel (Nissan Chemical Aqua Joint) polymer B (dendrimer), reference When 47.5 μl of the aptama aqueous solution used in Example D4 was mixed with 2 μl of spermidine aqueous solution, it turned blue. On the other hand, when polymer B was replaced with hydrogel... When the same procedure was performed using polymer A (silicic acid-based) (Nissan Chemical's Aqua Joint), it remained colorless. From the above, polymer B (ethylene glycol-terminated gel polymer) can be used as a matrix in the method of the present invention. [Explanation of symbols]

[0130] 11 Source electrodes 12 Semiconductor layer 13 Drain electrode 14 Gate Insulation Layer 15 Gate Shuttle 16 circuit boards 17 Exterior 18. Sample solution (saliva) 19 Extended gate 20 Reference electrode 21 Aptama 22 Hemin 23 Polyamines G1 circuit board G2 Source Electrode G3 Drain Electrode G4 Semiconductor Layer G5 Target Capture System G6 Wall (Pool) G7 Cover Sheet Layer G8 Reference electrode (gate electrode) S1 Film S2 Carbon Electrode Pattern S3 Ink coating area S4 Silicone Rubber Sheet S5 Solution A dripping part

Claims

1. A method for detecting polyamines contained in a liquid, wherein the polyamines are detected in contact with an aptama, and the detection is performed by an electrical method.

2. The method for detecting polyamines according to claim 1, wherein the electrical method is performed by a transistor-type aptor sensor having a top gate structure.

3. The detection method according to claim 1 or 2, wherein the polyamine contains at least one of spermine and spermidine.

4. The detection method according to any one of claims 1 to 3, wherein the liquid is saliva.

5. The detection method according to any one of claims 1 to 4, wherein the detection is performed while the polyamine is in contact with the porphyrin compound.

6. The detection method according to claim 5, wherein the porphyrin compound is hemin.

7. The base sequence of the aforementioned aptama is GTGGGTAGGNCGGGGTTGG A detection method according to any one of claims 1 to 6, characterized in that it is one of the following: NN (wherein N is independently A, C, G, T or no base) (SEQ ID NO: 1), TTAGGGTTTAGGGGTTTAGGGGTTTAGGGG (SEQ ID NO: 2), and GGGGACGTGGCATGGGGGTGGCCCCTT (SEQ ID NO: 3).

8. A polyamine detection device for detecting polyamines contained in a liquid, comprising a sample introduction unit for introducing a liquid containing polyamines into the detection device, and a detection unit for detecting polyamines in the liquid, wherein the detection unit detects polyamines in contact with an aptama by an electrical method.

Images