Primer set, and beet black root disease screening kit and screening method.
The LAMP primer set for Aphanomyces cochlioides allows rapid and accurate detection of sugar beet black root rot, overcoming the limitations of existing methods by providing sensitive and specific nucleic acid amplification without temperature control, enabling early disease control.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-02-17
- Publication Date
- 2026-03-17
AI Technical Summary
Current methods for detecting sugar beet black root rot caused by Aphanomyces cochlioides are time-consuming, require precise temperature control, and have limitations in accuracy and effectiveness, especially in distinguishing the pathogen from other fungi.
A primer set designed for Loop-Mediated Isothermal Amplification (LAMP) that specifically amplifies nucleic acids from Aphanomyces cochlioides, allowing for rapid and accurate detection using a simplified process that does not require temperature control, and can differentiate the pathogen from closely related species.
Enables immediate and sensitive detection of Aphanomyces cochlioides, facilitating early intervention and reducing disease progression, with improved accuracy and speed compared to conventional methods.
Smart Images

Figure 0007832011000005 
Figure 0007832011000006 
Figure 0007832011000001
Abstract
Description
Technical Field
[0001] The present invention relates to a primer set for specifically amplifying a nucleic acid derived from Aphanomyces cochlioides by the LAMP method, a detection kit for sugar beet black root rot containing the primer set, and a detection method for sugar beet black root rot including a step of detecting Aphanomyces cochlioides in a specimen obtained from a subject by the LAMP method using the primer set and the like.
Background Art
[0002] Sugar beet black root rot is one of the important diseases of sugar beet caused by Aphanomyces cochlioides. In sugar beet (Beta vulgaris L.) infected with sugar beet black root rot, a rough skin symptom occurs in which fine cracks are formed shallowly in the main root, and in severe cases, the internal tissue decays (Non-Patent Document 1).
[0003] The genus Aphanomyces, also called "water mold", is a kind of oomycetes and mainly survives durably in plant residues and soil in the state of oospores (Non-Patent Document 2). For example, in addition to Chenopodiaceae such as sugar beet and spinach, it parasitizes a wide range of higher plants including those cultivated as crops such as Leguminosae, Brassicaceae, and Solanaceae, as well as aquatic animals such as protozoa, carp, and goldfish.
[0004] Sugar beets infected with Aphanomyces cochlioides suffer from reduced yield and lower quality, directly leading to decreased income for farmers and significantly reducing work efficiency for sugar producers. Furthermore, spoilage can progress during the pile storage period between harvest and the sugar processing stage, resulting in a decline in quality, posing a major problem in many areas. In addition, Aphanomyces cochlioides is a pathogen that causes seedling blight, where the hypocotyl of young seedlings rots and the seedlings wither, and black root disease, where the main root rots. It is also a contributing factor to continuous cropping problems.
[0005] Sugar beet black root disease is known to actively infect sugar beet roots repeatedly under conditions of high temperature and humidity, as well as poor drainage (Non-Patent Literature 3). However, there is no established method of controlling the disease using pesticides that are highly effective against diseased plants with advanced disease progression. Furthermore, because the disease affects the roots, there are problems with the pesticides not reaching the affected area effectively.
[0006] Therefore, in order to mitigate the damage caused by this disease, it is necessary to detect the disease early and control it before the disease progresses. For example, one molecular biological method is to use PCR to detect the presence or absence of Aphanomyces cochlioides in soil or plants suspected of infection (Patent Document 1). In the PCR detection method, nucleic acids (e.g., DNA or mRNA) are extracted from a sample including soil or plants, and the extracted nucleic acids are used as a template to subject nucleic acids having a base sequence specific to the causative fungus to a polymerase chain reaction (PCR) that requires precise temperature control and rapid temperature changes. The presence or absence of the causative fungus in the sample is detected by detecting the products after transcription, reverse transcription, amplification, etc., as needed.
[0007] However, temperature control is essential for the PCR method, making a thermal cycler or electrophoresis apparatus indispensable. Furthermore, it requires multiple steps, takes time to detect the sample, and demands a certain level of technical skill to perform.
[0008] Another method for detecting this disease is to use an "Aphanomyces selective isolation medium" to detect it from diseased sugar beet tissue (Non-Patent Literature 4). An "Aphanomyces selective isolation medium" is a culture medium in which several types of drugs, such as antibiotics, are added to an artificial culture medium in which Aphanomyces grows to suppress the growth of filamentous fungi and bacteria other than Aphanomyces, thereby facilitating the pure isolation of Aphanomyces from diseased tissue.
[0009] However, the method using Aphanomyces selective isolation medium requires 4 to 7 days from the time the section of diseased tissue is placed on the medium until detection is complete. Furthermore, while this method inhibits the growth of various bacteria such as Rhizoctonia and Pythium, it does not inhibit the growth of other fungi such as Fusarium and Zygomycetes, so microscopic morphological observation is usually required for diagnosis. In addition, it is thought that the growth of Aphanomyces is also inhibited to some extent by the antibiotics in the medium, so there are limitations to the detection accuracy. [Prior art documents] [Patent Documents]
[0010] [Patent Document 1] Japanese Patent Publication No. 2003-274951 [Non-patent literature]
[0011] [Non-Patent Document 1] Sugar Beet Research Society Bulletin, 1999, 41:67-72 [Non-Patent Document 2] Sugar Beet Research Society Bulletin, 2003, 45:27-32 [Non-Patent Document 3] HARVESON, RMand RUSH, CM (1993): An Environmentally Controlled Experiment to Monitor the effect Aphanomyces Root rot and Rhizomania on Sugar Beet. Phytopathology, 83(11), 1220-1223. [Non-Patent Document 4] Japanese plant disease report, 51:16-21 [Overview of the project] [Problems that the invention aims to solve]
[0012] Therefore, the present invention provides a primer set that specifically amplifies nucleic acids derived from Aphanomyces cochlioides, the pathogen of sugar beet black root disease; a sugar beet black root disease screening kit containing the primer set; and a method for screening sugar beet black root disease, comprising the step of detecting Aphanomyces cochlioides in a sample obtained from a subject using at least one of the primer set and the screening kit. [Means for solving the problem]
[0013] As a result of diligent research, the inventors designed LAMP primers that specifically react to nucleic acids derived from Aphanomyces cochlioides, the pathogen of sugar beet black root disease, and completed a LAMP primer set. Furthermore, they discovered a screening kit for sugar beet black root disease using this LAMP primer set, and a method for screening for sugar beet black root disease using the LAMP method with this LAMP primer set and screening kit, thereby completing the following inventions.
[0014] (1) A primer set for specifically amplifying nucleic acids derived from Aphanomyces cochlioides by the LAMP method, comprising the following primers (a), (b), (c), and (d); (a) An FIP primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 2, (b) A BIP primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 3, (c) An F3 primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 4, (d) A B3 primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 5.
[0015] (2) The primer set according to (1), wherein the polynucleotide is derived from the ITS region of ribosomal DNA of Aphanomyces cochlioides.
[0016] (3) The primer set according to (1) or (2), which does not amplify nucleic acids derived from Rhizoctonia solani AG2-2IV and nucleic acids derived from Rhizoctonia solani AG2-2IIIB.
[0017] (4) The primer set according to any one of (1) to (3), which does not amplify nucleic acids derived from Aphanomyces cladogamus.
[0018] (5) A detection kit for sugar beet black root rot, comprising the primer set according to any one of (1) to (4).
[0019] (6) A detection method for sugar beet black root rot, comprising the step of detecting Aphanomyces cochlioides in a specimen obtained from a subject by the LAMP method using at least any one of the primer set according to any one of (1) to (4) and the detection kit according to claim 5.
Advantages of the Invention
[0020] According to the present invention, there is provided a novel primer set capable of specifically amplifying nucleic acid derived from Aphanomyces cochlioides using the LAMP method. By using this primer set, in a farm field, Aphanomyces cochlioides, which is the pathogen of sugar beet black root rot, can be immediately detected with high sensitivity, and individuals in the early stage of infection can be accurately diagnosed, so that control measures and drainage countermeasures can be taken at an early stage. As a result, the progression of the disease can be effectively suppressed.
Brief Description of Drawings
[0021] [Figure 1] The positional relationship of the base sequences recognized by the primers for detecting Aphanomyces cochlioides in the base sequence of the ITS region of the ribosomal DNA of Aphanomyces cochlioides is shown. [Figure 2] It is a photograph showing the color change of the reaction tube after the LAMP reaction in Example 1.
Modes for Carrying Out the Invention
[0022] Hereinafter, the primer set, the diagnostic kit for sugar beet black root rot, and the diagnostic method for sugar beet black root rot according to the present invention will be described in detail.
[0023] The primer set according to the present invention is a primer set for specifically amplifying nucleic acid derived from Aphanomyces cochlioides by the LAMP method, and includes the following primers (a), (b), (c) and (d); (a) An FIP primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 2, (b) A BIP primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 3, (c) An Fз primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 4, (d) A Bз primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 5.
[0024] The LAMP (Loop-Mediated Isothermal Amplification) method, developed by Notomi et al., is a nucleic acid amplification method that eliminates the need for temperature control, which is essential in the PCR (Polymerase Chain Reaction) method, and is reported in Japanese Patent Publication No. 3313358. Generally, the LAMP method can amplify genes quickly and easily compared to methods using PCR, and it has high specificity and is less affected by impurities in the sample. Therefore, it is possible to amplify the target nucleic acid with simple sample pretreatment.
[0025] The LAMP method uses four primers that recognize six gene regions. The 3' end of each primer anneals to a template nucleotide, creating a starting point for complementary chain synthesis. By combining this with a primer that anneals to the resulting loop, isothermal complementary chain synthesis is possible. Furthermore, because the 3' end of each primer is always annealed to a region derived from the sample, the complementary binding check mechanism of the base sequence repeatedly functions, enabling highly sensitive and specific nucleic acid amplification reactions.
[0026] In the LAMP method, regions called F3c, F2c, F1c, B1, B2, and B3 are defined sequentially from the 3' end of one strand of a double-stranded template DNA. Based on the base sequences of these regions, a set of four primers called F3 primer, FIP primer, BIP primer, and B3 primer is used.
[0027] The F3 primer is designed to have the F3 region sequence, which is complementary to the F3c region. The FIP primer is designed to have the F2 region sequence, which is complementary to the F2c region, at its 3' end and the same nucleotide sequence as the F1c region at its 5' end. The BIP primer is designed to have the B2 region sequence at its 3' end and the B1c region sequence, which is complementary to the B1 region, at its 5' end. The B3 primer is designed to have the B3 region sequence.
[0028] Of these primers, the FIP primer and BIP primer are called inner primers, and the F3 primer and B3 primer are called outer primers. Here, the inner primer is a polynucleotide that recognizes a specific base sequence region on the target region and has a base sequence at its 3' end that provides a starting point for synthesis, and at the same time has a base sequence at its 5' end that is complementary to any region of the nucleic acid synthesis reaction product starting from this primer. This inner primer may have any base sequence of any length from 0 to 50 bases between the F2 region and the F1c region, or between the B2 region and the B1c region.
[0029] On the other hand, outer primers are polynucleotides that have a base sequence that recognizes a sequence region located at the 3' end of a specific base sequence region on the target region and provides a starting point for synthesis.
[0030] The DNA amplification reaction using the LAMP method begins with a dumbbell-shaped structure with a stem-loop configuration, generated by two types of outer primers used to exfoliate the DNA strand synthesized from the template DNA as a single strand, starting from an inner primer. The reaction proceeds through repeated extension and strand-displacement extension reactions. Furthermore, by using two types of loop primers with complementary sequences to the single-stranded portion of the 5' end loop of the dumbbell structure, it is possible to increase the number of starting points for DNA synthesis and shorten the reaction time.
[0031] The following describes the detection of Aphanomyces cochlioides using the LAMP method, in the following order: (1) extraction of nucleic acids from the sample, (2) design of the primer set, (3) amplification of nucleic acids, and (4) confirmation of the presence or absence of amplification products.
[0032] (1) Extraction of nucleic acids from the sample In this invention, any sample containing Aphanomyces cochlioides can be used, but it is preferable to use the roots, leaves, stems, or seedlings of sugar beet (Beta vulgaris L.). Sugar beet roots are particularly suitable for detection and can increase the detection rate.
[0033] In addition, soil can be used as a sample. Aphanomyces cochlioides is widely present in soil and spreads through soil, so by checking for the presence or absence of Aphanomyces cochlioides in a soil sample, it is possible to prevent the occurrence and spread of sugar beet black root disease.
[0034] The method for preparing DNA from a sample is not particularly limited as long as sufficient purity and quantity of DNA can be obtained for the detection of Aphanomyces cochlioides. It can be used in an unpurified state, but it can also be used after further pretreatment such as separation, extraction, concentration, and purification. For example, the purity of the nucleic acid can be increased by purification using phenol and chloroform extraction or by using a commercially available extraction kit.
[0035] (2) Design of the primer set <Primer Set> The primer set according to the present invention is specific to Aphanomyces cochlioides and is designed based on the ITS region (Internal Transcribed Spacers) of ribosomal DNA, which exhibits high species conservation. The target region is a nucleotide sequence region that can cover the diversity of Aphanomyces cochlioides.
[0036] The primers in the present invention are not particularly limited as long as they can be designed to amplify the target base sequence, and can be used as primers when used in nucleic acid amplification methods such as PCR and LAMP, but LAMP primers are preferred.
[0037] The primer set according to the present invention is designed as follows: First, the base sequences of the ITS regions of multiple Aphanomyces cochlioides ribosomal DNAs are aligned using alignment software such as Clustal X. Next, based on the obtained alignment information, the F3, F2, F1c, B1c, B2, and B3 regions are selected from highly conserved regions using software such as Primer Explorer V5 (manufactured by Eiken Chemical Co., Ltd.), and LAMP primers are designed. Therefore, the primer set according to the present invention is preferably a LAMP primer set.
[0038] For each primer, a primer having a nucleotide sequence with one or more (e.g., 1 to 10) bases deleted, substituted, or added can be used as a substitute, as long as it retains its primer function in the LAMP method.
[0039] As the primer set according to the present invention, a primer set was selected that targets the specific nucleotide sequence of Aphanomyces cochlioides, which encodes the ITS region (Figure 1) of the ribosomal DNA of the bacterium, as shown by the sequence of Sequence ID No. 1, and is a chemically synthesized polynucleotide complementary to a part of that nucleotide sequence, as shown by the sequences of Sequence ID Nos. 2 to 5.
[0040] Primer set for detecting Aphanomyces cochlioides (nucleotide sequence (5'-3')) FIP (Sequence ID 2) AGACATCCACTGTTGAAAGTTGTATACTTTATGACTGAACTATCTAGCAT BIP (Sequence ID 3) GGCTCGCACATCGATGAAGACAACGTTTCGATGACTCACT F3 (Sequence No. 4) ACCGATGTATTTTTTAATCCCTT B3 (Sequence ID 5) CTTCCAGGACTAACCCGA
[0041] In other words, the primer set according to the present invention is a primer set that specifically amplifies nucleic acids derived from Aphanomyces cochlioides, and comprises the following primers (a), (b), (c), and (d); (a) FIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 2, (b) BIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 3, (c) F3 primer consisting of a polynucleotide shown by the sequence of Sequence ID No. 4, (d) A B3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 5.
[0042] Therefore, the aforementioned polynucleotide originates from the ITS region of the ribosomal DNA of Aphanomyces cochlioides.
[0043] In this invention, "specifically amplifying nucleic acids derived from Aphanomyces cochloides" means that nucleic acids derived from Aphanomyces cochloides can be amplified when a nucleic acid amplification reaction is performed under normal conditions, but nucleic acids derived from other fungi other than Aphanomyces cochloides are not substantially amplified (or even if amplified, they are below the detection limit). In fact, the primer set according to the present invention does not amplify nucleic acids derived from Aphanomyces cladogamus, a close relative of Aphanomyces cochloides.
[0044] However, the primer set according to the present invention, with the exception of the closely related species Aphanomyces euteiches, nonspecifically amplifies nucleic acids derived from Aphanomyces euteiches. Aphanomyces euteiches is known as a fungus that causes Aphanomyces root rot mainly in leguminous crops. Since Aphanomyces euteiches does not use sugar beets as a host, it does not affect the screening of sugar beet black root disease.
[0045] Furthermore, the primer set according to the present invention does not amplify nucleic acids derived from Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, which are causative agents of sugar beet root rot. This indicates that it is possible to distinguish between sugar beet root rot and sugar beet black root disease, which are difficult to distinguish based solely on symptoms, even though the causative agents are completely different.
[0046] (3) Amplification of nucleic acids In the DNA amplification reaction using the LAMP method, nucleic acids extracted from the sample, a primer set, and DNA amplification reagents including four types of dNTPs (dATP, dCTP, dGTP, and dTTP) that serve as substrates for nucleic acid synthesis, a DNA polymerase such as a template-dependent nucleic acid synthase with strand displacement activity, a buffer that provides suitable conditions for the enzymatic reaction, salts as cofactors (such as magnesium salts or manganese salts), and protective agents to stabilize the enzyme and template should be left standing at isothermal temperature for a certain period of time.
[0047] The optimal temperature for enzyme activity is 60-70°C, preferably 63-65°C, when performing the DNA amplification reaction. While DNA amplification can be detected after 15 minutes or more, the reaction time can be set to a range of 30-120 minutes, more preferably 60-90 minutes.
[0048] The enzyme used in nucleic acid synthesis is not particularly limited as long as it is a template-dependent nucleic acid polymerase with strand displacement activity. Examples of such enzymes include Bst DNA polymerase (large fragment), Bca(exo-) DNA polymerase, and the Klenow fragment of E. coli DNA polymerase I, with Bst DNA polymerase (large fragment) being a preferred enzyme. Furthermore, the above DNA amplification reagent is commercially available as a kit for isothermal nucleic acid amplification, and examples of products that can be used include Loopamp® DNA amplification reagent kit (manufactured by Eiken Chemical Co., Ltd.) and LAMP method DNA amplification reagent set - for animal species and plant disease testing A - (Nippon Gene).
[0049] The reaction solution commonly used for DNA amplification has the following composition. Tris-HCl (pH 7-9) 10mM-25mM KCl 5mM~15mM MgSO45mM~40mM Surfactants 0.1%~0.4% Betaine 0.5~1M dNTPs 1mM~1.5mM each Strand displacement nucleic acid elongation enzyme 0.2~0.6U / μL
[0050] (4) Confirmation of the presence or absence of amplification products <Detection of pathogens> The presence of amplified DNA is confirmed in the solution after the nucleic acid amplification reaction. If Aphanomyces cochlooides is present in the test sample, the nucleic acid amplification reaction amplifies the DNA on the target region in the ITS region of ribosomal DNA. Conversely, if Aphanomyces cochlooides is not present in the test sample, normal DNA amplification does not proceed by the nucleic acid amplification reaction.
[0051] Known techniques can be applied to determine the presence or absence of DNA amplified by nucleic acid amplification reactions. For example, visual determination methods include visually checking the turbidity produced by magnesium pyrophosphate, a byproduct of nucleic acid synthesis, adding HNB reagent or malachite green to the reaction solution in advance, and facilitating the determination of DNA amplification by observing the color change of the reaction solution during a LAMP reaction using a DNA amplification reagent kit with a pre-added visual detection reagent. An example of such a DNA amplification reagent kit is WarmStart® Colorimetric LAMP 2X Master Mix (manufactured by New England Biolabs). Other methods for determining the presence or absence of amplified DNA include optical confirmation using a real-time turbidity measuring device (for example, LoopampEXIA manufactured by Eiken Chemical Co., Ltd.), and visual detection of luminescence indicating nucleic acid amplification by irradiating a solution amplified with UV light after adding a fluorescent intercalator such as Loopamp® Fluorescent Visual Detection Reagent (manufactured by Eiken Chemical Co., Ltd.).
[0052] Furthermore, it is preferable to determine the presence or absence of the amplification product by comparing it with a negative control, which is a primer set according to the present invention with water instead. Using a negative control prevents judgments based on false positives. Alternatively, a positive control may be used to confirm that the LAMP reaction proceeds normally with the primer set of the present invention.
[0053] Next, the primer set according to the present invention can be provided alone or together with the reagents necessary for LAMP as a diagnostic kit for sugar beet black root disease. Examples of reagents necessary for LAMP include the aforementioned chain-displacement nucleic acid elongation enzyme, dNTPs, buffer solutions such as Tris-HCl (pH 7-9), sterile water, and reagents necessary for detecting reaction products.
[0054] Furthermore, the present invention relates to a method for screening for sugar beet black root disease, comprising the step of detecting Aphanomyces cochlioides in a sample obtained from a subject by the LAMP method using at least one of the primer set or sugar beet black root disease screening kit according to the present invention described above. The method according to the present invention enables screening for the sugar beet black root disease. [Examples]
[0055] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to these examples.
[0056] [Example 1] Detection of Aphanomyces cochlioides using LAMP primer (1) Design of the primer set We collected nucleotide sequence data of the ITS region in the ribosomal DNA of Aphanomyces cochlioides from GenBank (https: / / www.ncbi.nlm.nih.gov / genbank / ), and extracted specific nucleotide sequences of Aphanomyces cochlioides from the ITS region using alignment analysis with Clustal X.
[0057] Based on the obtained alignment information, LAMP primers were designed using the 88-302 base region of Sequence ID No. 1 (Figure 1). Primer Explorer V5 (http: / / primerexplorer.jp / ) was used to design the LAMP primers. The designed LAMP primers are shown in Table 1 below.
[0058] [Table 1] TIFF0007832011000001.tif62165
[0059] (2) DNA extraction from pathogens DNA extraction from Aphanomyces cochlioides was performed using the following procedure. First, the boundary between the blackened and healthy parts of a rotten sugar beet root was excised, washed with water, and placed in a 1.5 mL tube. The tissue was then disrupted using zirconia beads and a shaking lithograph. Next, DNA was extracted from the disrupted tissue fragments using Nucleospin® DNA Plant (manufactured by Takara Bio Inc.).
[0060] (3) Detection of pathogens using the LAMP method The DNA extracted in Example (2) was prepared to a concentration of 10 μg / mL to serve as the template DNA solution. The LAMP reaction was carried out by mixing the template DNA solution, WarmStart® Colorimetric LAMP 2X Master Mix (manufactured by New England Biolabs), sterile distilled water, and the primer sets listed in Table 1 above, and reacting the resulting mixture at 63°C for 60 minutes, as shown in Table 2 below. As a negative control, a solution was used in which sterile distilled water was added instead of the template DNA solution.
[0061] [Table 2] TIFF0007832011000002.tif126165
[0062] (4) Confirmation of DNA amplification The amplification of pathogenic bacterium DNA was evaluated visually. The results are shown in Figure 2. As shown in Figure 2, the reaction solution of DNA extracted from Aphanomyces cochlioides changed color from red to yellow (yellow coloration) (right side of Figure 2), while the negative control showed no change in color and remained red (red coloration; left side of Figure 2). This indicates that the DNA amplification reaction occurred only in the positive control.
[0063] [Example 2] Comparison of detection sensitivity with a conventional detection method using rotten sugar beet root (detection method by microscopic examination of cultures prepared in Aphanomyces selective isolation medium). Using 35 rotten sugar beet roots, the detection sensitivity of a detection method using Aphanomyces selective isolation medium (hereinafter referred to as the "conventional method") and a detection method using the LAMP method of Example 1 (hereinafter simply referred to as the "LAMP method") were compared.
[0064] The conventional method was performed as follows: The boundary between the blackened and healthy parts of a rotten sugar beet root was cut out and washed with running water and sterile water. After thoroughly removing moisture from the tissue piece using sterile filter paper, it was placed on Aphanomyces selective isolation medium (CMA medium (cornmeal agar medium)) to which predetermined amounts of metalaxyl (phenylamide fungicide), thiophanate-methyl (methylbenzimidazole carbamate fungicide), iprodione (dicarboximide fungicide), and chloramphenicol were added as fungicides. After 4 to 7 days, the culture of the cultured medium with fungal flora was transferred to CMA medium and cultured, then examined under a microscope for identification. The results of the conventional method and the LAMP method are shown in Table 3 below.
[0065] [Table 3] TIFF0007832011000003.tif201165
[0066] As shown in Table 3 above, using the conventional method, 5 out of 35 individuals were diagnosed with sugar beet black root disease. On the other hand, using the LAMP method, 8 out of 35 individuals were diagnosed with sugar beet black root disease. No individuals that tested positive using the conventional method tested negative using the LAMP method. Furthermore, the examination time was at least one week using the conventional method, while it was completed in 1-2 days using the LAMP method.
[0067] These results suggest that extracting DNA from sugar beet roots exhibiting rot symptoms and performing the LAMP method using LAMP primers allows for more accurate and rapid screening for sugar beet black root disease compared to conventional methods.
[0068] [Example 3] Detection of other bacterial cells using LAMP primers Using the LAMP method, we investigated whether amplification was possible for nucleic acids derived from Aphanomyces cladogamus, a close relative of Aphanomyces cochlioides; nucleic acids derived from Aphanomyces euteiches, another close relative of Aphanomyces cochlioides; nucleic acids derived from Rhizoctonia solani AG2-2IV, a causative agent of sugar beet root rot, which is difficult to distinguish from sugar beet black root disease based solely on symptoms, despite being caused by a completely different type of fungus; nucleic acids derived from Rhizoctonia solani AG2-2IIIB; and nucleic acids derived from other Rhizoctonia solani species (AG1, AG2-1, AG3, AG4, and AG5). The procedure followed Examples 1(1) to (4). The results are shown in Table 4 below.
[0069] [Table 4] TIFF0007832011000004.tif101165
[0070] As shown in Table 4 above, it was revealed that the primer set designed in Example 1(1), i.e., the primer set according to the present invention, does not amplify any of the nucleic acids derived from Aphanomyces cladogamus, a close relative of Aphanomyces cochlioides; nucleic acids derived from Rhizoctonia solani AG2-2IV, the causative agent of sugar beet root rot; nucleic acids derived from Rhizoctonia solani AG2-2IIIB; and nucleic acids derived from other Rhizoctonia solani species (AG1, AG2-1, AG3, AG4, and AG5). On the other hand, while nonspecific nucleic acid amplification was confirmed for nucleic acids derived from Aphanomyces euteiches, a close relative of Aphanomyces cochloides, the amplification was less advanced compared to the nucleic acid amplification reaction of Aphanomyces cochloides, and the degree of discoloration of the reaction solution was also smaller. Therefore, it became clear that the primer set according to the present invention, with the exception of Aphanomyces cochloides, nonspecifically amplifies nucleic acids derived from Aphanomyces euteiches, a close relative of Aphanomyces cochloides.
Claims
1. A primer set for specifically amplifying nucleic acids derived from Aphanomyces cochlioides by the LAMP method, comprising the following primers (a), (b), (c), and (d); (a) FIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 2, (b) BIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 3, (c) F3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 4, (d) A B3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No.
5.
2. The primer set according to claim 1, wherein the polynucleotide is derived from the ITS region of ribosomal DNA of Aphanomyces cochlioides.
3. A primer set according to claim 1 or claim 2, which does not amplify nucleic acids derived from Rhizoctonia solani AG2-2IV or Rhizoctonia solani AG2-2IIIIB.
4. A primer set according to any one of claims 1 to 3, which does not amplify nucleic acids derived from Aphanomyces cladogamus.
5. A screening kit for sugar beet black root disease, comprising the primer set according to any one of claims 1 to 4.
6. A method for screening for sugar beet black root disease, comprising the step of detecting Aphanomyces cochlioides in a sample obtained from a subject by the LAMP method using at least one of the primer set described in any one of claims 1 to 4 and the screening kit described in claim 5.
Citation Information
Patent Citations
Method for detecting mold belonging to the genus aphanomyces
JP2003274951A