Primer set, and beet root rot examination kit and examination method.

Abstract

To provide a primer set specifically amplifying a nucleic acid derived from a specific group of Rhizoctonia solani, which is pathogens of Rhizoctonia root rot, a medical examination kit for Rhizoctonia root rot comprising the primer set, and a screening method for Rhizoctonia root rot including a step of detecting a specific group of Rhizoctonia solani in a sample from a subject using at least one of the primer set and the medical examination kit.SOLUTION: A LAMP (Loop-Mediated Isothermal Amplification) method is used to specifically amplify a nucleic acid derived from a specific group of Rhizoctonia solani.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to a primer set for specifically amplifying nucleic acids derived from Rhizoctonia solani AG2-2IV and nucleic acids derived from Rhizoctonia solani AG2-2IIIB by the LAMP method, a diagnostic kit for sugar beet root rot containing the primer set, and a method for diagnosing sugar beet root rot, which includes the step of detecting Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB in a specimen obtained from a subject by the LAMP method using the primer set and the like.

Background Art

[0002] Rhizoctonia root rot is one of the important diseases of sugar beet, generally caused by Rhizoctonia solani AG2-2IV and rarely by Rhizoctonia solani AG2-2IIIB. In sugar beet (Beta vulgaris L.) infected with Rhizoctonia root rot, in the early stage of the disease, brown lesions are formed at the base of the petiole and the crown, and it gradually progresses to the roots (Non-Patent Document 1). In severe individuals, the entire root system decays and withers.

[0003] Rhizoctonia solani is a pathogenic bacterium of plant diseases inhabiting the soil and infects many crops such as rice, field crops, and vegetables. The genus Rhizoctonia is classified into 13 or more groups based on the hyphal fusion reaction, and in Japan, attention is mainly focused on AG1 to AG5 as groups that damage agricultural crops. Among them, the pathogenic bacteria of sugar beet root rot are AG2-2IV and AG2-2IIIB, which are classified as subgroups within AG2 (Non-Patent Document 2).

[0004] Sugar beets infected with Rhizoctonia solani AG2-2IV or Rhizoctonia solani AG2-2IIIB experience stunted growth, reduced sugar content in the roots, and a decline in quality. This directly leads to reduced income for farmers and significantly decreases work efficiency for sugar producers. Furthermore, spoilage can progress during storage between harvest and the sugar processing stage, leading to a decline in quality, posing a major problem in many areas.

[0005] Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB overwinter in the form of durable structures such as sclerotia, and germinate hyphae as soil temperature rises, existing in the soil as hyphae. They can survive even without a host by decomposing plant residues in the soil, and infect host plants when they are planted in that soil. Infection can occur at any time of year, but they prefer relatively high temperatures, and infection and disease outbreaks are particularly likely from late June to mid-July when root thickening rates are high.

[0006] Chemical control of sugar beet root rot is widely practiced, sometimes applied immediately after the onset of symptoms to suppress disease progression, and sometimes applied preventively before infection, with different types of chemicals used for each purpose. In the former case, early detection of the disease is particularly important in suppressing disease progression. The chemicals used in the former case are effective in suppressing the progression of sugar beet root rot, but they are ineffective against other diseases such as sugar beet black root rot, which is difficult to distinguish from sugar beet root rot based solely on symptoms, even though the causative fungi are completely different. Therefore, unless control is based on accurate examination of sugar beet root rot infection and disease, disease control will not be possible, and chemical application may become meaningless. On the other hand, in the latter case, in order to more effectively avoid damage from sugar beet root rot, a method is adopted in which the presence of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB in the soil is identified before the initial onset of the disease, and then chemical application is carried out for the purpose of disease prevention.

[0007] One method used to detect the disease involves culturing diseased sugar beet tissue in a designated medium and identifying it under a microscope. However, this method requires 7 to 10 days from the time the tissue section is placed on the medium until detection is possible. During this time, the disease progresses, making it impossible to detect sugar beet root rot early and implement effective control measures. Furthermore, this method has low detection sensitivity, requiring further morphological observation using a microscope, which necessitates specialized knowledge and skills in plant pathology.

[0008] In other crops, a method for detecting Rhizoctonia solani using molecular biological techniques has been adopted, specifically the PCR method for detecting Rhizoctonia solani AG2-2 (Patent Document 1). Furthermore, a method for detecting sheath blight in turfgrass has been employed using the LAMP method, by detecting the cells of Rhizoctonia solani AG2-2IV, Rhizoctonia solani AG2-2IIIB, and other mycelial fusion groups (Anastomosis group (hereinafter referred to as "AG")) using LAMP primers designed based on the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IIIB) (Patent Document 2).

[0009] However, the detection method using PCR described in Patent Document 1 requires a polymerase chain reaction that demands precise temperature control and rapid temperature changes, making temperature control essential and requiring a thermal cycler or electrophoresis apparatus. Furthermore, it requires multiple steps, takes time to detect, and requires a certain level of technical skill to operate. In addition, the primers used in the detection method described in Patent Document 2 detect not only Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, which are pathogens of sugar beet root rot, but also Rhizoctonia solani AG-1 and Rhizoctonia solani AG-4, which belong to different AG groups than Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB. If these primers are used for screening sugar beet root rot, it becomes difficult to screen accurately and quickly, and consequently, it becomes impossible to control sugar beet root rot disease early and appropriately. [Prior art documents] [Patent Documents]

[0010] [Patent Document 1] Japanese Patent Application Publication No. 10-234381 [Patent Document 2] Special Publication No. 2021-512609 [Non-patent literature]

[0011] [Non-Patent Document 1] Plant Disease / Vol. 96 No. 3 [Non-Patent Document 2] Manual for the Utilization of Microbial Genetic Resources (41) (2019) [Overview of the project] [Problems that the invention aims to solve]

[0012] Therefore, the present invention provides a primer set that specifically amplifies nucleic acids derived from Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, which are pathogens of sugar beet root rot; a sugar beet root rot screening kit containing the primer set; and a method for screening sugar beet root rot, comprising the step of detecting Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB in a sample obtained from a subject using at least one of the primer set and the screening kit. [Means for solving the problem]

[0013] As a result of diligent research, the inventors designed LAMP primers that specifically react to nucleic acids derived from Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, the pathogens of sugar beet root rot, and completed a LAMP primer set. Furthermore, they discovered a sugar beet root rot screening kit using the LAMP primer set, and a method for screening sugar beet root rot using the LAMP method with the LAMP primer set and the screening kit, thereby completing the following inventions.

[0014] (1) A primer set for specifically amplifying nucleic acids derived from Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB by the LAMP method, comprising the following primers (a), (b), (c), and (d); (a) FIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 2, (b) BIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 3, (c) F3 primer consisting of a polynucleotide shown by the sequence of Sequence ID No. 4, (d) A B3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 5.

[0015] (2) The primer set according to (1), wherein the polynucleotide is derived from the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IV and / or the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IIIB.

[0016] (3) A primer set according to (1) or (2) that does not amplify nucleic acids derived from Aphanomyces cochlioides.

[0017] (4) A primer set according to any one of (1) to (3), which does not amplify nucleic acids derived from Rhizoctonia solani AG1-1 or Rhizoctonia solani AG4.

[0018] (5) A kit for detecting sugar beet root rot, comprising the primer set described in any one of items (1) through (4).

[0019] A method for detecting sugar beet root rot, comprising the step of detecting Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB in a sample obtained from a subject by the LAMP method using at least one of the primer set described in any one of (1) to (4) and the screening kit described in claim 5. [Effects of the Invention]

[0020] According to the present invention, there is provided a novel primer set capable of specifically amplifying nucleic acids derived from Rhizoctonia solani AG2-2IV and nucleic acids derived from Rhizoctonia solani AG2-2IIIB using the LAMP method. By using this primer set, in the farm field, it is possible to immediately and highly sensitively detect Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, which are the pathogens of sugar beet root rot, and accurately diagnose individuals in the early stage of infection. As a result, early control and drainage measures can be taken, effectively suppressing the progression of the disease.

Brief Description of the Drawings

[0021] [Figure 1] Shows the positional relationship of the nucleotide sequences recognized by the primers for detecting Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB in the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IV. [Figure 2] It is a photograph showing the color change of the reaction tube after the LAMP reaction in Example 1.

Modes for Carrying Out the Invention

[0022] Hereinafter, the primer set, the diagnostic kit for sugar beet root rot, and the diagnostic method for sugar beet root rot according to the present invention will be described in detail.

[0023] The primer set according to the present invention is a primer set capable of specifically amplifying nucleic acids derived from Rhizoctonia solani AG२-२IV and nucleic acids derived from Rhizoctonia solani AG२-२IIIB by the LAMP method, and includes the following primers (a), (b), (c), and (d); (a) An FIP primer consisting of a polynucleotide represented by the sequence of SEQ ID NO: 2, (b) BIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 3, (c) F3 primer consisting of a polynucleotide shown by the sequence of Sequence ID No. 4, (d) A B3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 5.

[0024] The LAMP (Loop-Mediated Isothermal Amplification) method, developed by Notomi et al., is a nucleic acid amplification method that eliminates the need for temperature control, which is essential in the PCR (Polymerase Chain Reaction) method, and is reported in Japanese Patent Publication No. 3313358. Generally, the LAMP method can amplify genes quickly and easily compared to methods using PCR, and it has high specificity and is less affected by impurities in the sample. Therefore, it is possible to amplify the target nucleic acid with simple sample pretreatment.

[0025] The LAMP method uses four primers that recognize six gene regions. The 3' end of each primer anneals to a template nucleotide, creating a starting point for complementary chain synthesis. By combining this with a primer that anneals to the resulting loop, isothermal complementary chain synthesis is possible. Furthermore, because the 3' end of each primer is always annealed to a region derived from the sample, the complementary binding check mechanism of the base sequence repeatedly functions, enabling highly sensitive and specific nucleic acid amplification reactions.

[0026] In the LAMP method, regions called F3c, F2c, F1c, B1, B2, and B3 are defined sequentially from the 3' end of one strand of a double-stranded template DNA. Based on the base sequences of these regions, a set of four primers called F3 primer, FIP primer, BIP primer, and B3 primer is used.

[0027] The F3 primer is designed to have the F3 region sequence, which is complementary to the F3c region. The FIP primer is designed to have the F2 region sequence, which is complementary to the F2c region, at its 3' end and the same nucleotide sequence as the F1c region at its 5' end. The BIP primer is designed to have the B2 region sequence at its 3' end and the B1c region sequence, which is complementary to the B1 region, at its 5' end. The B3 primer is designed to have the B3 region sequence.

[0028] Of these primers, the FIP primer and BIP primer are called inner primers, and the F3 primer and B3 primer are called outer primers. Here, the inner primer is a polynucleotide that recognizes a specific base sequence region on the target region and has a base sequence at its 3' end that provides a starting point for synthesis, and at the same time has a base sequence at its 5' end that is complementary to any region of the nucleic acid synthesis reaction product starting from this primer. This inner primer may have any base sequence of any length from 0 to 50 bases between the F2 region and the F1c region, or between the B2 region and the B1c region.

[0029] On the other hand, outer primers are polynucleotides that have a base sequence that recognizes a sequence region located at the 3' end of a specific base sequence region on the target region and provides a starting point for synthesis.

[0030] The DNA amplification reaction using the LAMP method begins with a dumbbell-shaped structure with a stem-loop configuration, generated by two types of outer primers used to exfoliate the DNA strand synthesized from the template DNA as a single strand, starting from an inner primer. The reaction proceeds through repeated extension and strand-displacement extension reactions. Furthermore, by using two types of loop primers with complementary sequences to the single-stranded portion of the 5' end loop of the dumbbell structure, it is possible to increase the number of starting points for DNA synthesis and shorten the reaction time.

[0031] The following describes the detection of Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB using the LAMP method, in the following order: (1) extraction of nucleic acids from the sample, (2) design of the primer set, (3) amplification of nucleic acids, and (4) confirmation of the presence or absence of amplification products.

[0032] (1) Extraction of nucleic acids from the sample In the present invention, any sample containing Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB can be used as the sample, but it is preferable to use the roots, leaves, stems, or seedlings of sugar beet (Beta vulgaris L.). Sugar beet roots are particularly suitable for detection and can increase the detection rate.

[0033] In addition, soil can be used as a sample. Since Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB are widely present in soil and spread through soil, checking for the presence or absence of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB in a soil sample can prevent the occurrence and spread of sugar beet root rot.

[0034] The method for preparing DNA from a sample is not particularly limited, as long as sufficient purity and quantity of DNA can be obtained for the detection of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB. It can be used in an unpurified state, but it can also be used after further pretreatment such as separation, extraction, concentration, and purification. For example, the purity of the nucleic acid can be increased by purification using phenol and chloroform extraction or by using a commercially available extraction kit.

[0035] (2) Design of the primer set <Primer Set> The primer set according to the present invention is specific to the nucleotide sequences of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, and is designed based on the ITS region (Internal Transcribed Spacers) of ribosomal DNA, which exhibits high species conservation. The target region is a nucleotide sequence region that can cover the diversity of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB.

[0036] The primers in the present invention are not particularly limited as long as they can be designed to amplify the target base sequence, and can be used as primers when used in nucleic acid amplification methods such as PCR and LAMP, but LAMP primers are preferred.

[0037] The primer set according to the present invention is designed as follows: First, the base sequences of the ITS region of multiple Rhizoctonia solani AG2-2IV ribosomal DNAs are aligned using alignment software such as Clustal X. Next, based on the obtained alignment information, the F3, F2, F1c, B1c, B2, and B3 regions are selected in highly conserved areas using software such as Primer Explorer V5 (manufactured by Eiken Chemical Co., Ltd.), and LAMP primers are designed. Therefore, the primer set according to the present invention is preferably a LAMP primer set.

[0038] For each primer, a primer having a nucleotide sequence with one or more (e.g., 1 to 10) bases deleted, substituted, or added can be used as a substitute, as long as it retains its primer function in the LAMP method.

[0039] As the primer set according to the present invention, we selected a primer set represented by sequences 2 to 5, which are chemically synthesized polynucleotides that target the specific nucleotide sequences of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, and which encode the ITS region (Figure 1) of the ribosomal DNA of the bacterial cells, as shown by the sequence of Sequence ID No. 1, and are complementary to a portion of that nucleotide sequence.

[0040] Primer set for detection of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB (nucleotide sequence (5'-3')) FIP (Sequence No. 2) CCATCCATGTCTCTGCCTCACCTTTTGCTCTTTTTTTAATCCAC BIP (Sequence ID 3) TACCCCCCCTCTGTCTACTCTGCGTTACATCCATTACATTC F3 (Sequence ID 4) AGCTGGCTCCATTAGTTTG B3 (Sequence ID 5) AAGAGATCCGTTGTTGAAAC

[0041] In other words, the primer set according to the present invention is a primer set that specifically amplifies nucleic acids derived from Rhizoctonia solani AG2-2IV and nucleic acids derived from Rhizoctonia solani AG2-2IIIB, and comprises the following primers (a), (b), (c), and (d); (a) FIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 2, (b) BIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 3, (c) F3 primer consisting of a polynucleotide shown by the sequence of Sequence ID No. 4, (d) A B3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 5.

[0042] Therefore, the polynucleotides are derived from the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IV and / or the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IIIB.

[0043] In this invention, "specifically amplifying nucleic acids derived from Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB" means that while nucleic acids derived from Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB can be amplified under normal conditions, nucleic acids derived from other bacterial cells other than Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB are not substantially amplified (or are below the detection limit even if amplified). In fact, the primer set according to the present invention does not amplify nucleic acids derived from Rhizoctonia solani AG1-1 and Rhizoctonia solani AG4, which belong to different AG groups than Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB.

[0044] Furthermore, the primer set according to the present invention does not amplify nucleic acids derived from Aphanomyces cochlioides, the causative agent of sugar beet black root disease. This indicates that it is possible to distinguish between sugar beet black root disease and sugar beet root rot, which are difficult to distinguish based solely on symptoms, even though the causative agents are completely different.

[0045] (3) Amplification of nucleic acids In the DNA amplification reaction using the LAMP method, nucleic acids extracted from the sample, a primer set, and DNA amplification reagents including four types of dNTPs (dATP, dCTP, dGTP, and dTTP) that serve as substrates for nucleic acid synthesis, a DNA polymerase such as a template-dependent nucleic acid synthase with strand displacement activity, a buffer that provides suitable conditions for the enzymatic reaction, salts as cofactors (such as magnesium salts or manganese salts), and protective agents to stabilize the enzyme and template should be left standing at isothermal temperature for a certain period of time.

[0046] The optimal temperature for enzyme activity is 60-70°C, preferably 63-65°C, when performing the DNA amplification reaction. While DNA amplification can be detected after 15 minutes or more, the reaction time can be set to a range of 30-120 minutes, more preferably 60-90 minutes.

[0047] The enzyme used in nucleic acid synthesis is not particularly limited as long as it is a template-dependent nucleic acid polymerase with strand displacement activity. Examples of such enzymes include Bst DNA polymerase (large fragment), Bca(exo-) DNA polymerase, and the Klenow fragment of E. coli DNA polymerase I, with Bst DNA polymerase (large fragment) being a preferred enzyme. Furthermore, the above DNA amplification reagent is commercially available as a kit for isothermal nucleic acid amplification, and examples of products that can be used include Loopamp® DNA amplification reagent kit (manufactured by Eiken Chemical Co., Ltd.) and LAMP method DNA amplification reagent set - for animal species and plant disease testing A - (Nippon Gene).

[0048] The reaction solution commonly used for DNA amplification has the following composition. Tris-HCl (pH 7-9) 10mM-25mM KCl 5mM~15mM MgSO45mM~40mM Surfactants 0.1%~0.4% Betaine 0.5~1M dNTPs 1mM~1.5mM each Strand displacement nucleic acid elongation enzyme 0.2~0.6U / μL

[0049] (4) Confirmation of the presence or absence of amplification products <Detection of pathogens> The presence of amplified DNA is confirmed in the solution after the nucleic acid amplification reaction. If the test sample contains Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB, the nucleic acid amplification reaction amplifies the DNA on the target region in the ITS region of ribosomal DNA. Conversely, if the test sample does not contain Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB, there is no DNA amplified by the nucleic acid amplification reaction.

[0050] Known techniques can be applied to determine the presence or absence of DNA amplified by nucleic acid amplification reactions. For example, visual determination methods include visually checking the turbidity produced by magnesium pyrophosphate, a byproduct of nucleic acid synthesis, adding HNB reagent or malachite green to the reaction solution in advance, and facilitating the determination of DNA amplification by observing the color change of the reaction solution during a LAMP reaction using a DNA amplification reagent kit with a pre-added visual detection reagent. An example of such a DNA amplification reagent kit is WarmStart® Colorimetric LAMP 2X Master Mix (manufactured by New England Biolabs). Other methods for determining the presence or absence of amplified DNA include optical confirmation using a real-time turbidity measuring device (for example, LoopampEXIA manufactured by Eiken Chemical Co., Ltd.), and visual detection of luminescence indicating nucleic acid amplification by irradiating a solution amplified with UV light after adding a fluorescent intercalator such as Loopamp® Fluorescent Visual Detection Reagent (manufactured by Eiken Chemical Co., Ltd.).

[0051] Furthermore, it is preferable to determine the presence or absence of the amplification product by comparing it with a negative control, which is a primer set according to the present invention with water instead. Using a negative control prevents judgments based on false positives. Alternatively, a positive control may be used to confirm that the LAMP reaction proceeds normally with the primer set of the present invention.

[0052] Next, the primer set according to the present invention can be provided alone or together with the reagents necessary for LAMP as a diagnostic kit for sugar beet root rot. Examples of reagents necessary for LAMP include the aforementioned chain-displacement nucleic acid elongation enzyme, dNTPs, buffer solutions such as Tris-HCl (pH 7-9), sterile water, and reagents necessary for detecting reaction products.

[0053] Furthermore, the present invention relates to a method for detecting sugar beet root rot, comprising the step of detecting Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB in a sample obtained from a subject by the LAMP method using at least one of the primer set or sugar beet root rot screening kit according to the present invention described above. The method according to the present invention enables the screening of said sugar beet root rot. [Examples]

[0054] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to these examples.

[0055] [Example 1] Detection of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB using LAMP primers (1) Design of the primer set We collected nucleotide sequence data of the ITS region in the ribosomal DNA of Rhizoctonia solani AG2-2IV from GenBank (https: / / www.ncbi.nlm.nih.gov / genbank / ), and extracted specific nucleotide sequences of Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB on the ITS region using alignment analysis with Clustal X.

[0056] Based on the obtained alignment information, LAMP primers were designed using the 33-262 base region of Sequence ID No. 1 (Figure 1). Primer Explorer V5 (http: / / primerexplorer.jp / ) was used to design the LAMP primers. The designed LAMP primers are shown in Table 1 below.

[0057] [Table 1] TIFF0007832013000001.tif62165

[0058] (2) DNA extraction from pathogens DNA extraction from Rhizoctonia solanii AG2-2IV was performed using the following procedure. First, the boundary between the blackened and healthy parts of a rotten sugar beet root was excised, washed with water, and placed in a 1.5 mL tube. The tissue was then disrupted using zirconia beads and a shaking lithograph. Next, DNA was extracted from the disrupted tissue fragments using Nucleospin® DNA Plant (manufactured by Takara Bio Inc.).

[0059] (3) Detection of pathogens using the LAMP method The DNA extracted in Example (2) was prepared to a concentration of 10 μg / mL to serve as the template DNA solution. The detection method using the LAMP method in Example 1 (hereinafter simply referred to as the "LAMP method") was carried out by reacting a reaction solution prepared by mixing the template DNA solution, WarmStart® Colorimetric LAMP 2X Master Mix (manufactured by New England Biolabs), sterile distilled water, and each primer set listed in Table 1 above, at 63°C for 60 minutes, as shown in Table 2 below. Meanwhile, the DNA amplification reaction was carried out using the same process and conditions, except that Rhizoctonia solani AG2-1, Rhizoctonia solani AG4, and Aphanomyces cochlioides, the pathogen of sugar beet black root disease, were used as samples. Furthermore, as a negative control, a solution with sterile distilled water added instead of the template DNA solution was used.

[0060] [Table 2] TIFF0007832013000002.tif126165

[0061] (4) Confirmation of DNA amplification The amplification of pathogenic DNA was evaluated visually. The results are shown in Figure 2. As shown in Figure 2, the reaction solution of DNA extracted from Rhizoctonia solani AG2-2IV changed color from red to yellow (yellow coloration) (all of Figure 2(b) and (c) 5, 6, 7), whereas the reaction solutions of the negative control (Figure 2(a) 1 and (c) 1), Rhizoctonia solani AG2-1 (Figure 2(a) 2 and (c) 2), Rhizoctonia solani AG4 (Figure 2(a) 3 and (c) 3), and Aphanomyces cochlioides (Figure 2(c) 4) remained red without any change in color. This indicates that DNA amplification occurred only in the reaction solution of DNA extracted from Rhizoctonia solani AG2-2IV.

[0062] [Example 2] Verification of the specificity of the designed LAMP primer For the designed LAMP primers, 24 cells of various Rhizoctonia solani species shown in Table 3 below, 7 cells of Aphanomyces cochlioides (the pathogen of sugar beet black root disease), and 3 closely related species were used to perform the LAMP reaction under the conditions of Example 1(3). The results are shown in Table 3 below.

[0063] [Table 3] TIFF0007832013000003.tif101166

[0064] As shown in Table 3 above, Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, the pathogens of sugar beet root rot, were specifically detected. On the other hand, amplification reactions did not occur for the nucleic acids of other AGs: Rhizoctonia solani AG1, Rhizoctonia solani AG2-1, Rhizoctonia solani AG3, Rhizoctonia solani AG4, and Rhizoctonia solani AG5. Furthermore, amplification reactions did not occur for the nucleic acids of Aphanomyces cochlioides, the pathogen of sugar beet black root disease, and its close relatives. From this, it was confirmed that the designed LAMP primer specifically detects Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIB, which are pathogens of sugar beet root rot, and does not detect Aphanomyces cochlioides, which is a pathogen of sugar beet black root disease. Therefore, it was confirmed that it is possible to differentiate between sugar beet root rot and sugar beet black root disease using the designed LAMP primer.

[0065] [Example 3] Comparison of detection sensitivity with a conventional detection method using rotten sugar beet roots (detection method by microscopic examination of cultures prepared in a medium for sugar beet root rot fungus). Using 35 rotten sugar beet roots, the detection sensitivity of a detection method using a culture medium for sugar beet root rot fungus (hereinafter referred to as the "conventional method") and a detection method using the LAMP method of Example 1 (hereinafter simply referred to as the "LAMP method") were compared.

[0066] The conventional method was performed as follows: The boundary between the blackened and healthy parts of a rotten sugar beet root was cut out and washed with running water and sterile water. After thoroughly removing moisture from the tissue piece using sterile filter paper, it was placed on a root rot fungus medium prepared by adding lactic acid to plain agar. After 4 to 7 days, the culture of the fungus that had grown on the medium was transferred to PDA medium (potato dextrose agar) and cultured, then examined under a microscope for identification. Furthermore, the pathogen was identified using the conventional detection method with Aphanomyces selective isolation medium and the LAMP method described in Japanese Patent Application No. 2022-023335 for the detection method of sugar beet black root disease, using 35 of the same rotten sugar beet roots as test subjects. The results of the conventional method and the LAMP method for detecting both pathogens are shown in Table 4 below.

[0067] [Table 4] TIFF0007832013000004.tif201165

[0068] As shown in Table 4 above, using the conventional method for detecting sugar beet root rot, 14 out of 35 plants were diagnosed with sugar beet root rot. On the other hand, using the LAMP method for detecting sugar beet root rot, 21 out of 35 plants were diagnosed with sugar beet root rot. No plants that tested positive using the conventional method tested negative using the LAMP method. Furthermore, the examination time was at least one week using the conventional method, while it was completed in 1-2 days using the LAMP method. In addition, no plants diagnosed with sugar beet black root disease were misdiagnosed with sugar beet root rot, and no plants diagnosed with sugar beet root rot were misdiagnosed with sugar beet black root disease.

[0069] These results suggest that by extracting DNA from sugar beet roots exhibiting rot symptoms and performing the LAMP method using LAMP primers, it is possible to distinguish between sugar beet black root disease and sugar beet root rot more accurately and quickly than with conventional methods.

Claims

1. A primer set for specifically amplifying nucleic acids derived from Rhizoctonia solani AG2-2IV and Rhizoctonia solani AG2-2IIIIB using the LAMP method, comprising the following primers (a), (b), (c), and (d); (a) FIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 2, (b) BIP primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 3, (c) F3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No. 4, (d) A B3 primer consisting of a polynucleotide represented by the sequence of Sequence ID No.

5.

2. The primer set according to claim 1, wherein the polynucleotide is derived from the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IV and / or the ITS region of the ribosomal DNA of Rhizoctonia solani AG2-2IIIIB.

3. A primer set according to claim 1 or 2, which does not amplify nucleic acids derived from Aphanomyces cochlioides.

4. A primer set according to any one of claims 1 to 3, which does not amplify nucleic acids derived from Rhizoctonia solani AG1-1 or nucleic acids derived from Rhizoctonia solani AG4.

5. A diagnostic kit for sugar beet root rot, comprising the primer set described in any one of claims 1 to 4.

6. A method for detecting sugar beet root rot, comprising the step of detecting Rhizoctonia solani AG2-2IV and / or Rhizoctonia solani AG2-2IIIB in a sample obtained from a subject by the LAMP method using at least one of the primer set described in any one of claims 1 to 4 and the screening kit described in claim 5.

Images