Oxaliplatin-induced peripheral neuropathy biomarkers

Abstract

To provide a biomarker for predicting or diagnosing the prognosis of oxaliplatin-induced peripheral neuropathy.SOLUTION: A biomarker for oxaliplatin-induced peripheral neuropathy comprises long-chain noncoding RNAs. There are also provided a method and a kit for predicting the prognosis using the biomarker.SELECTED DRAWING: None

Description

Technical Field

[0001] The present disclosure relates to oxaliplatin-induced peripheral neuropathy biomarkers.

Background Art

[0002] Oxaliplatin is a representative anticancer drug that is widely used. In human cancer patients who receive anti-cancer treatment with oxaliplatin, peripheral neuropathy occurs in almost all cases, and this is often a problem. In addition, drug development has been carried out to reduce peripheral neuropathy.

[0003] As a major side effect of oxaliplatin, peripheral nerve symptoms are primarily cited. When peripheral nerve symptoms occur, appropriate measures such as dose reduction, drug withdrawal, and discontinuation are required. Peripheral neuropathy caused by oxaliplatin is roughly classified into acute neuropathy that can be seen immediately after administration and chronic neuropathy that develops as the cumulative dose increases. In particular, it is known that there are patients in whom peripheral neuropathy persists even one year after the administration of oxaliplatin has ended. For such patients with delayed (chronic) conditions, the determination of whether to continue treatment with oxaliplatin is an important matter.

[0004] Patent Document 1 discloses a preventive and / or therapeutic agent for peripheral neuropathic pain caused by anticancer drugs. This document mainly focuses on treating or preventing the peripheral neuropathic pain of oxaliplatin by administering drugs such as thrombomodulin.

[0005] Patent Document 2 describes a GPR132 inhibitor for use in the prevention and / or treatment of chemotherapy-induced neuropathic pain. This document also mainly focuses on treating or preventing the peripheral neuropathic pain of oxaliplatin with a GPR132 inhibitor.

[0006] Non-patent document 1 is a comprehensive review of existing knowledge regarding biomarkers for oxaliplatin-induced peripheral neuropathy. The document lists physiological function tests (such as nerve conduction velocity and electromyography), genomic tests (such as single nucleotide polymorphisms), and neuroimaging (such as MRI and ultrasound) as previously reported predictive biomarkers. Several proteins are also listed as blood biomarkers. However, these are primarily focused on the grade of neuropathy, and many are of limited usefulness and do not assess the risk of chronicity. Furthermore, the document does not contain any information related to biomarkers focusing on non-coding RNAs.

[0007] In short, while the prevention and management of oxaliplatin-induced peripheral neuropathy are considered important, the only concrete measures currently recommended are to carefully observe the patient's condition and reduce the dosage or discontinue the drug if abnormalities are found. There are no indicators to guide the development of these measures, and more accurate methods for predicting oxaliplatin-induced peripheral neuropathy are needed. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] Japanese Patent Publication No. 2018-095652 (Patent No. 6427284) [Patent Document 2] Special table number 2019-529461 [Non-patent literature]

[0009] [Non-Patent Document 1] Roser Velasco et.al., J. Pers. Med. 2021, 11, 669. [Overview of the project] [Problems that the invention aims to solve]

[0010] In certain embodiments, the object of this disclosure is to provide a biomarker, a method for predicting prognosis, and / or a kit for predicting or diagnosing the prognosis of oxaliplatin-induced peripheral neuropathy, in order to at least partially solve the problems of the prior art. [Means for solving the problem]

[0011] The inventors of this invention have diligently conducted research to solve the aforementioned problems and have searched for biomarkers to determine whether or not nerve damage is likely to occur in the initial stages of oxaliplatin treatment. While some long non-coding RNAs (lncRNAs) are known to be involved in various biological processes such as cell differentiation, individual development, and various diseases including cancer, through the regulation of transcription, translation, and epigenetics, the role of most lncRNAs was unknown. In order to solve the aforementioned problems, we have identified specific lncRNAs as biomarkers for oxaliplatin-induced peripheral neuropathy and have completed the present invention, which incorporates these as specific embodiments.

[0012] This disclosure includes the following embodiments. [1] A biomarker for prognosis of oxaliplatin-induced peripheral neuropathy, comprising one or more long non-coding RNAs. [2] The one or more long non-coding RNAs mentioned above are LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT. A biomarker according to Embodiment 1, selected from the group consisting of (SEQ ID NO: 10), LOC284191 (SEQ ID NO: 11), LOC105371855 (SEQ ID NO: 12), LINC00976 (SEQ ID NO: 13), LINC01657 (SEQ ID NO: 14), LINC01703 (SEQ ID NO: 15), LOC105378269 (SEQ ID NO: 16), LOC101928797 (SEQ ID NO: 17), LINC02271 (SEQ ID NO: 18), MANCR (SEQ ID NO: 19), LINC01801 (SEQ ID NO: 20), LINC01689 (SEQ ID NO: 21), LOC105374516 (SEQ ID NO: 22), LINC01658 (SEQ ID NO: 23), and LINC02411 (SEQ ID NO: 24). [3] A biomarker according to Embodiment 1 or 2 for determining that peripheral neuropathic pain will not persist, by comparing the amount of one or more long non-coding RNAs in a biological sample of a subject before treatment with oxaliplatin and in a biological sample during or after treatment, and determining that the amount of one or more long non-coding RNAs is increased in the biological sample during or after treatment. [4] A prognostic diagnostic kit for oxaliplatin-induced peripheral neuropathy comprising a reagent for detecting a biomarker described in any of Embodiments 1 to 3. [5] A method for assisting in the determination of the prognosis of oxaliplatin-induced peripheral neuropathy using biological samples obtained from subjects during or after oxaliplatin treatment, comprising the following steps 1) A step of determining the amount of one or more long non-coding RNAs in a biological sample obtained from a subject during or after oxaliplatin treatment. 2) A step of comparing the above amount with a reference, Includes, The aforementioned reference is a pre-oxaliplatin treatment reference for the same subject based on the amount of long non-coding RNA in a biological sample obtained from the same subject before oxaliplatin treatment. The method wherein an increase in the amount compared to a reference subject before oxaliplatin treatment is used as an indicator of a favorable prognosis for oxaliplatin-induced peripheral neuropathy. [6] A method for assisting in the determination of the prognosis of oxaliplatin-induced peripheral neuropathy using biological samples obtained from subjects during or after oxaliplatin treatment, comprising the following steps 1) A step of determining the amount of one or more long non-coding RNAs in a biological sample obtained from a subject during or after oxaliplatin treatment. 2) A step of comparing the above amount with a reference, Includes, The aforementioned reference is a reference for the prolonged group, determined based on the amount of long-chain non-coding RNA in biological samples obtained in advance from a group of subjects in whom oxaliplatin-induced peripheral neuropathy was confirmed to have persisted as a result, during or after oxaliplatin treatment. The method wherein an increase in the amount compared to the group with prolonged symptoms is used as an indicator of a favorable prognosis for oxaliplatin-induced peripheral neuropathy. [7] A method for assisting in determining the prognosis of oxaliplatin-induced peripheral neuropathy using biological samples obtained from subjects during or after oxaliplatin treatment, comprising the following steps: 1) A step of determining the amount of one or more long non-coding RNAs in a biological sample obtained from a subject during or after oxaliplatin treatment. 2) A step of comparing the amount with a first reference, and 3) A step of comparing the amount with a second reference, Includes, The first reference mentioned above is a pre-oxaliplatin treatment same subject reference based on the amount of long non-coding RNA in a biological sample obtained from the same subject before oxaliplatin treatment, The second reference is the average growth rate reference for the prolonged group of subjects, and the second reference is based on the average growth rate of the prolonged group of subjects, determined by comparing the amount of long non-coding RNA contained in the biological samples of the prolonged group of subjects obtained before treatment with the amount of long non-coding RNA contained in the biological samples of the prolonged group of subjects obtained during or after oxaliplatin treatment. i) The amount of one or more long non-coding RNAs in the biological sample obtained from the subject during or after oxaliplatin treatment is increased compared to the first reference above. and, ii) When the ratio of the increase in i) above is significantly greater than the average increase rate of the subject population in the prolonged group described in reference 2 above, The method described above, which serves as an indicator of a favorable prognosis for oxaliplatin-induced peripheral neuropathy. [8] The method according to any one of Embodiments 5 to 7, wherein the one or more long non-coding RNAs are selected from the group consisting of LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), ETNK1-DT (SEQ ID NO: 10), LOC284191 (SEQ ID NO: 11), LOC105371855 (SEQ ID NO: 12), LINC00976 (SEQ ID NO: 13), LINC01657 (SEQ ID NO: 14), LINC01703 (SEQ ID NO: 15), LOC105378269 (SEQ ID NO: 16), LOC101928797 (SEQ ID NO: 17), LINC02271 (SEQ ID NO: 18), MANCR (SEQ ID NO: 19), LINC01801 (SEQ ID NO: 20), LINC01689 (SEQ ID NO: 21), LOC105374516 (SEQ ID NO: 22), LINC01658 (SEQ ID NO: 23), and LINC02411 (SEQ ID NO: 24).

Advantages of the Invention

[0013] As an effect of the present disclosure, the prognosis of peripheral neuropathy in treatment using oxaliplatin can be predicted. This can be utilized for treatment method selections such as continued determination of oxaliplatin dosing and drug switching.

Brief Description of the Drawings

[0014] [Figure 1] Shows changes in extracellular RNA release from oxaliplatin-treated cells compared to non-treated controls. [Figure 2] Shows a partial excerpt of data showing the oxaliplatin dose-dependence of the extracellular release amount of lncRNA. [Figure 3] Shows the results of comparing the amounts of extracellularly released lncRNA and blood lncRNA for non-treated control cells. LncRNAs selective for primary sensory nerves with increased release by oxaliplatin were plotted. [Figure 4-1]The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 4-2] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 4-3] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 4-4] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 4-5] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 4-6] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 4-7] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 4-8] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The pre-treatment level in the same subject is set to 100% (see reference). [Figure 5-1] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The mean value in the pre-treatment subject group is set to 100% (see reference). [Figure 5-2] The following shows the blood lncRNA levels in the group with persistent neurological impairment and the group with recovery, approximately 3 months after the start of treatment. The mean value in the pre-treatment subject group is set to 100% (see reference). [Modes for carrying out the invention]

[0015] In one embodiment, the disclosure provides a biomarker for prognosis assessment of oxaliplatin-induced peripheral neuropathy, comprising one or more long non-coding RNAs. In one embodiment, the one or more long non-coding RNAs are LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT. The following can be selected from the group consisting of (SEQ ID NO: 10), LOC284191 (SEQ ID NO: 11), LOC105371855 (SEQ ID NO: 12), LINC00976 (SEQ ID NO: 13), LINC01657 (SEQ ID NO: 14), LINC01703 (SEQ ID NO: 15), LOC105378269 (SEQ ID NO: 16), LOC101928797 (SEQ ID NO: 17), LINC02271 (SEQ ID NO: 18), MANCR (SEQ ID NO: 19), LINC01801 (SEQ ID NO: 20), LINC01689 (SEQ ID NO: 21), LOC105374516 (SEQ ID NO: 22), LINC01658 (SEQ ID NO: 23), and LINC02411 (SEQ ID NO: 24).In another embodiment, from the lncRNAs of this disclosure, LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT are obtained. One or more of the following may be excluded: (Sequence ID 10), LOC284191 (Sequence ID 11), LOC105371855 (Sequence ID 12), LINC00976 (Sequence ID 13), LINC01657 (Sequence ID 14), LINC01703 (Sequence ID 15), LOC105378269 (Sequence ID 16), LOC101928797 (Sequence ID 17), LINC02271 (Sequence ID 18), MANCR (Sequence ID 19), LINC01801 (Sequence ID 20), LINC01689 (Sequence ID 21), LOC105374516 (Sequence ID 22), LINC01658 (Sequence ID 23), and LINC02411 (Sequence ID 24).

[0016] In one embodiment, the biomarker of this disclosure can be used to determine that peripheral neuropathic pain will not become chronic (persistent) by comparing the amount of one or more long non-coding RNAs in a biological sample of a subject before treatment with oxaliplatin with a biological sample during or after treatment, and if the amount of one or more long non-coding RNAs is increased in the biological sample during or after treatment.

[0017] In this specification, "lncRNA (long non-coding RNA)" refers to a transcript with a length of 200 nucleotides or more that is not translated into protein, unless otherwise specified. Regarding lncRNA, for example, there is FANTOM (Functional Annotation of the Mouse / Mammalian Genome), a consortium established primarily by researchers at RIKEN. There are also lncRNA databases such as RNAcentral, LNCipedia, and lncATLAS. Information such as sequence information and identification numbers of lncRNA, for example, in humans, can be obtained from publicly known databases, such as NCBI (URL: https: / / www.ncbi.nlm.nih.gov / ).

[0018] In one embodiment, the "biological sample" is not particularly limited as long as it is a sample derived from a living organism, and various biological samples derived from a subject can be used. Examples of biological samples include samples taken directly from a living organism, samples that have been washed or crushed, and body fluids, cancer tissue sections, etc. Body fluids are preferably used. The "body fluid sample" may be a sample of human body fluid, such as plasma, whole blood, serum, lymph, or other body fluids including extracellular vesicles. In one embodiment, the body fluid sample is a plasma sample. In one embodiment, the biological sample may be obtained from a subject receiving oxaliplatin treatment. In another embodiment, the biological sample may be obtained from a subject who is scheduled to receive oxaliplatin treatment. In another embodiment, the biological sample may be obtained from a subject who has previously received oxaliplatin treatment but has now discontinued treatment. In another embodiment, the biological sample may be obtained from a subject who started oxaliplatin treatment, then discontinued it, and has since resumed treatment. In another embodiment, the biological sample may be obtained from a subject who has completed treatment with oxaliplatin.

[0019] In one embodiment, the sample for measurement can be prepared by removing cells and other components from a plasma sample by centrifugation, then precipitating extracellular vesicles using a commercially available kit, and finally extracting RNA using a commercially available RNA extraction kit. Such a sample can then be subjected to RNA sequence analysis. Furthermore, the amount of extracellular RNA released can be quantified using quantitative PCR (qPCR).

[0020] In some embodiments, the term “reference” refers to a value determined based on the amount of extracellular RNA in a biological sample obtained from a subject before oxaliplatin treatment. For example, the reference is an lncRNA threshold (e.g., quantity or ratio of quantities) found in the plasma sample of the subject being tested, where a value above the threshold indicates recovery from oxaliplatin treatment, while essentially the same or lower values ​​indicate persistence. In some embodiments, the threshold may be set to, for example, 100% of the lncRNA level in the biological sample of the subject to be evaluated before oxaliplatin treatment.

[0021] In one embodiment, the reference may be based on the amount of lncRNA (e.g., measured by quantitative PCR) in a biological sample obtained from a subject prior to oxaliplatin treatment. Here, since this disclosure relates to the recovery or persistence of peripheral neuropathy induced by oxaliplatin treatment, unless otherwise specified herein, “subject” may be a subject receiving oxaliplatin treatment, a subject scheduled to receive oxaliplatin treatment, a subject who has previously received oxaliplatin treatment but has now discontinued treatment, a subject who has started oxaliplatin treatment, then discontinued and subsequently resumed treatment, or a subject who has completed oxaliplatin treatment. A subject is typically a human subject. Furthermore, “prior to oxaliplatin treatment” means before receiving oxaliplatin administration, i.e., before oxaliplatin treatment. “during treatment” means receiving treatment with oxaliplatin administration, i.e., receiving oxaliplatin treatment. "Post-treatment" refers to having received treatment with oxaliplatin and having completed oxaliplatin therapy.

[0022] The evaluation of peripheral neuropathy requires assessing severity based on subjective and objective symptoms. The Numeric Rating Scale (NRS) divides pain into 11 levels, from "0: no pain" to "10: the worst pain (the most severe pain ever experienced)," and patients self-assess the degree of pain by selecting a number (Japanese Society for Palliative Medicine, Palliative Care Guidelines Committee, ed.: Guidelines for Pharmacotherapy of Cancer Pain 2014 Edition, Kinbara Publishing Co., Ltd.). The Neuropathy Questionnaire (FACT / GOG NTX Ver. 4.0) allows patients to self-assess various sensory and functional symptoms on a 5-point scale (Functional Assessment of Chronic Illness Therapy (FACIT) http: / / www.facit.org / ). For example, some patients may have high scores on the NRS (high discomfort) but rate their neuropathy questionnaire as having little to no impact on their daily lives, so a multifaceted evaluation using multiple scales is necessary to measure the severity of peripheral neuropathy.

[0023] Another method involves gathering information about the extent of limitations patients experience in their daily lives, as described in the Common Terminology Criteria for Adverse Events (CTCAE) version 4.01, and having physicians assess the degree of these limitations using peripheral motor neuropathy and peripheral sensory neuropathy.

[0024] In one embodiment, the reference is based on the amount of lncRNA in a biological sample from a subject before oxaliplatin treatment, and this reference can be compared to the amount of lncRNA in a biological sample obtained from the same subject after initiating oxaliplatin treatment. In this case, if the value of at least one lncRNA found in a biological sample of a subject during or after oxaliplatin treatment is significantly higher than the reference, it can serve as an indicator of recovery from oxaliplatin-induced peripheral neuropathy. In this specification, recovery means recovery from peripheral neuropathy within one year of the end of oxaliplatin treatment. Recovery also means that the symptoms have disappeared or are almost completely gone. What values ​​are significantly higher can be determined by statistical methods. For example, for a population of subjects in the recovery group who have been confirmed to have recovered from oxaliplatin-induced peripheral neuropathy, the mean or median amount of lncRNA in the recovery group can be determined based on the amount of lncRNA in biological samples previously obtained from the subject population while they were receiving oxaliplatin treatment. Furthermore, a difference of one or two standard deviations from the mean or median lncRNA level of the recovery group, and values ​​greater than or equal to these, can be considered "significantly high." Also, for example, in a population consisting of subjects in the prolonged group who were confirmed to have persistent oxaliplatin-induced peripheral neuropathy, the mean or median lncRNA level of the prolonged group can be determined based on the lncRNA levels of biological samples previously obtained from this population of subjects receiving oxaliplatin treatment, and this can be compared to the mean or median lncRNA level of the prolonged group before oxaliplatin treatment. Even if the lncRNA level in the prolonged group during or after oxaliplatin treatment is slightly higher than the pre-treatment lncRNA level, such an increase can be considered "not significant." Additionally, if the value of at least one lncRNA of this disclosure found in the biological sample of a subject during or after oxaliplatin treatment has not changed or has decreased compared to the reference, it can serve as an indicator of the risk of prolonged oxaliplatin-induced peripheral neuropathy. In this specification, "persistence" refers to peripheral neuropathy that persists for one year after the completion of treatment.For convenience, such references may be referred to in this specification as "pre-oxaliplatin treatment references" or "references from the same subject before oxaliplatin treatment." That is, unless otherwise specified, pre-oxaliplatin treatment references in this specification are based on the amount of lncRNA in a biological sample obtained before oxaliplatin treatment from the same subject being evaluated.

[0025] In another embodiment, the reference can be determined based on the amount of lncRNA in a biological sample obtained in advance from a subject or group of subjects who were receiving oxaliplatin treatment and who were confirmed to have consequently prolonged oxaliplatin-induced peripheral neuropathy. The subject or group of subjects in the prolonged group may be, for example, n=1, n≧5, n≧10, n≧50, or n≧100. The reference can then be compared with the amount of lncRNA in a biological sample obtained from another subject after initiating oxaliplatin treatment (i.e., a subject different from each subject used to determine the reference). In this case, if the value of at least one lncRNA found in a biological sample of a subject during or after oxaliplatin treatment is significantly higher than the reference, it may serve as an indicator of recovery from oxaliplatin-induced peripheral neuropathy. What constitutes a significantly higher value can be determined by statistical methods. Furthermore, if the value of at least one lncRNA of this disclosure found in a biological sample of a subject during or after oxaliplatin treatment is substantially the same as or lower than that of a reference, it may serve as an indicator of the risk of prolonged oxaliplatin-induced peripheral neuropathy. Here, what constitutes substantially the same value can be determined by statistical methods; for example, a difference of within one standard deviation from the median of the reference may be considered substantially the same. For convenience, such a reference may be referred to herein as the "prolonged group reference." Unless otherwise specified, the prolonged group reference herein is based on the amount of lncRNA in a biological sample obtained during oxaliplatin treatment of a subject or subject population different from the subject being evaluated.

[0026] In another embodiment, the reference may be based on the mean rate of increase in a population of subjects in the prolonged group who were confirmed to have consequently prolonged oxaliplatin-induced peripheral neuropathy. This reference may be determined by comparing the amount of long non-coding RNA in biological samples from the prolonged group of subjects obtained before treatment with the amount of long non-coding RNA in biological samples from the prolonged group of subjects obtained during or after oxaliplatin treatment. For convenience, such a reference is sometimes referred to as the second reference. To distinguish it from this, a reference from the same subject is sometimes referred to as the first reference. In one embodiment, if i) the value of at least one lncRNA of the Disclosure found in a subject's biological sample during or after oxaliplatin treatment is increased compared to the first reference (i.e., significantly higher), and ii) the rate of increase in the amount of the at least one lncRNA of the Disclosure in i) in the biological sample obtained during or after oxaliplatin treatment of the subject is greater than the average rate of increase in the subject population of the prolonged group (i.e., significantly greater), then this can be used as an indicator of a good prognosis for oxaliplatin-induced peripheral neuropathy. Conversely, for example, if the lncRNA value in a subject receiving oxaliplatin treatment is increased compared to the first reference during or after oxaliplatin treatment, but this increase is at a similar rate to the average rate of increase in the subject population of the prolonged group (the second reference), then this can be used as an indicator of a poor prognosis for oxaliplatin-induced peripheral neuropathy. The rate of increase that constitutes a similar rate of increase can be determined by statistical methods. For example, in a group of subjects in which oxaliplatin-induced peripheral neuropathy was confirmed to be persistent, the average rate of increase in lncRNA levels in the persistent group can be determined based on the lncRNA levels of biological samples previously obtained from this group of subjects while they were receiving oxaliplatin treatment. Then, a value within one or two standard deviations of the average rate of increase in lncRNA levels in the persistent group can be considered a "similar rate of increase."

[0027] In this specification, “comparison” refers to determining whether the measured value of lncRNA is substantially identical to or different from the reference value. For example, an lncRNA value can be considered different from the reference value if the measured difference is statistically significant. If the difference is not statistically significant, the lncRNA value and the reference value are substantially the same. Based on such comparisons, it can be assessed (or aided in such assessment) that a subject is likely to recover from or have a prolonged period of oxaliplatin-induced peripheral neuropathy. Unless otherwise specified, the assessment referred to herein does not include the judgment of a physician. Similarly, terms such as judgment, determination, detection, examination, and judgment used herein in relation to recovery from or prolonged period of oxaliplatin-induced peripheral neuropathy do not include the judgment of a physician unless otherwise specified. In this specification, unless otherwise specified, the term “diagnosis” is used when the prognosis of oxaliplatin-induced peripheral neuropathy includes or involves the judgment of a physician.

[0028] In one embodiment, the measured value of lncRNA can be corrected by an internal standard. In one embodiment, the measured value of lncRNA can be normalized by a specific lncRNA. In one embodiment, the measured value of lncRNA can be corrected by the mean value of all lncRNAs. In another embodiment, no correction with an internal standard is performed. In another embodiment, no normalization by lncRNA is performed. In another embodiment, no correction by the mean value of all lncRNAs is performed.

[0029] In one embodiment, oxaliplatin therapy includes cancer therapy using oxaliplatin. In one embodiment, cancers include, but are not limited to, colorectal cancer, colorectal cancer, for example, unresectable advanced or recurrent colorectal or colorectal cancer, postoperative colorectal cancer (as a result of adjuvant chemotherapy), pancreatic cancer, for example, unresectable pancreatic cancer, gastric cancer, and small intestinal cancer.

[0030] In one embodiment, the Disclosure provides a method for predicting the prognosis of a biological sample obtained from a subject who is receiving or scheduled to receive oxaliplatin therapy, specifically whether the subject will recover from or have persistent oxaliplatin-induced peripheral neuropathy, or a method to assist in such prediction.

[0031] In one embodiment, this prediction method includes the step of determining the amount of lncRNA relating to this disclosure in a biological sample obtained from a subject scheduled to receive oxaliplatin treatment, and using this as a pre-oxaliplatin treatment reference. Next, oxaliplatin treatment is initiated for the same subject, and the amount of lncRNA relating to this disclosure in a biological sample obtained from the subject during treatment is determined and compared with the pre-oxaliplatin treatment reference. If the subject's lncRNA level is significantly increased compared to the pre-oxaliplatin treatment reference, it can be determined, evaluated, or predicted that the prognosis for oxaliplatin-induced peripheral neuropathy is good. Unless otherwise specified in this specification, a good prognosis for oxaliplatin-induced peripheral neuropathy means that the oxaliplatin-induced peripheral neuropathy recovers within one year after the completion of treatment. Furthermore, predicting a good prognosis means predicting that there is a high probability that the oxaliplatin-induced peripheral neuropathy will recover within one year after the completion of treatment. Furthermore, if the subject's lncRNA levels are substantially unchanged or have decreased compared to pre-oxaliplatin treatment reference levels, it may be determined, evaluated, or predicted that the prognosis for oxaliplatin-induced peripheral neuropathy is poor. Unless otherwise specified in this specification, a poor prognosis for oxaliplatin-induced peripheral neuropathy means that the oxaliplatin-induced peripheral neuropathy persists for more than one year after the completion of treatment. Predicting a poor prognosis means predicting that there is a high probability that the oxaliplatin-induced peripheral neuropathy will persist for more than one year after the completion of treatment.

[0032] In another embodiment, this prediction method includes the steps of pre-determining a prolonged reference group for the lncRNA relating to this disclosure, or obtaining a value of a prolonged reference group that has already been determined, determining the amount of lncRNA relating to this disclosure in a biological sample obtained from a subject receiving oxaliplatin treatment, and comparing this with the prolonged reference group. If the subject lncRNA amount is significantly increased compared to the prolonged reference group, it can be determined, evaluated, or predicted that the prognosis for oxaliplatin-induced peripheral neuropathy is good. Conversely, if the subject lncRNA amount is substantially the same or decreased compared to the prolonged reference group, it can be determined, evaluated, or predicted that the prognosis for oxaliplatin-induced peripheral neuropathy is poor.

[0033] In one embodiment, the lncRNAs of this disclosure include LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT. Examples include, but are not limited to, LINC00976 (SEQ ID NO: 10), LOC284191 (SEQ ID NO: 11), LOC105371855 (SEQ ID NO: 12), LINC00976 (SEQ ID NO: 13), LINC01657 (SEQ ID NO: 14), LINC01703 (SEQ ID NO: 15), LOC105378269 (SEQ ID NO: 16), LOC101928797 (SEQ ID NO: 17), LINC02271 (SEQ ID NO: 18), MANCR (SEQ ID NO: 19), LINC01801 (SEQ ID NO: 20), LINC01689 (SEQ ID NO: 21), LOC105374516 (SEQ ID NO: 22), LINC01658 (SEQ ID NO: 23), and LINC02411 (SEQ ID NO: 24). One, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty-one, twenty-two, twenty-two, twenty-three, or twenty-four of these lncRNAs may be measured in combination, or all 24 may be measured. In one embodiment, the prognosis of oxaliplatin-induced peripheral neuropathy can be predicted by one or more of these lncRNAs.

[0034] The names of the genes represented by sequence numbers 1-24 and their corresponding IDs used in this specification are summarized in the table below.

[0035] [Table 1]

[0036] In one embodiment, the amount of lncRNA can be determined by quantitative PCR. Quantitative PCR, also known as real-time PCR, is a well-known method for quantifying nucleic acid molecules in a sample and can be performed using commercially available kits or conventional equipment. Unlike conventional PCR, which detects the concentration of the product after the reaction, qPCR detects the reaction product in real time. The concentration of the product during the reaction is usually detected and quantified using fluorescence.

[0037] In a typical PCR (PCR) procedure, the sample includes a target nucleic acid, a pair of oligonucleotide primers complementary to a specific region of the target (hereinafter also referred to as primers), a heat-resistant polymerase, and deoxynucleotide triphosphates (dNTPs). The target nucleic acid is amplified by repeating a predetermined cycle in which the heating temperature of the sample is continuously changed. The cycle typically consists of a denaturation step, an annealing step, and an extension step, each with a different set temperature. The denaturation step is, for example, at approximately 90-95°C. In this step, double-stranded nucleic acid (DNA) is denatured into single strands. Annealing takes place, for example, at approximately 45-65°C, where the primers form a complex with the target nucleic acid. The extension step takes place, for example, at approximately 68-72°C, where the heat-resistant polymerase acts on the primer-target nucleic acid complex to carry out the extension reaction. At this time, a new double-stranded nucleic acid is generated using the target nucleic acid as a template. Typically, these three steps are repeated approximately 20-50 times. When using non-specific dyes, a fluorescence measurement step at approximately 80°C for several seconds may be included to reduce signals caused by primer dimers. Intercalation dyes (such as SYBR Green) or fluorescent probes can be used for fluorescence detection. Furthermore, the TaqMan method or digital PCR can also be used.

[0038] In one embodiment, suitable primers may be designed to measure the lncRNA of this disclosure by qPCR. In another embodiment, a commercially available lncRNA assay kit may be used. In one embodiment, the primers may be those included with a commercially available assay kit. A table of primers for detecting the lncRNA of this disclosure is shown below. These are illustrative examples, and functional equivalents or other sequences may be used as long as the target sequence is amplified.

[0039] [Table 2]

[0040] In qPCR, the addition of dsDNA fluorescent dye is performed as usual. The reaction is then carried out in a qPCR instrument, and after each cycle, the fluorescence intensity is measured with a photodetector. Each sample is irradiated with one or more specific wavelengths, and the fluorescence emitted by the excited fluorophores is detected. In qPCR, the extension step can be omitted if the target nucleic acid is short. This is because the extension reaction is completed during the process of raising the thermal cycler temperature from the annealing temperature to the denaturation temperature.

[0041] In qPCR, nucleic acids can be quantified by plotting fluorescence intensity against the number of cycles on a logarithmic scale. The fluorescence detection threshold can be set to 3 to 5 times the standard deviation of the background noise. The number of cycles exceeding the threshold is called the quantitative cycle (Ct). A calibration curve can be created by preparing a dilution series from samples of known concentration and performing qPCR using these as templates. The amplification efficiency can be calculated by determining the slope from the Ct of each dilution using linear regression.

[0042] To quantify gene expression, the cyclic quantification (Ct) of RNA or DNA from the target gene can be subtracted from the Ct of RNA or DNA from housekeeping genes to normalize the variation in RNA quantity and quality between different samples. This normalization method is called the ΔCt method. Furthermore, the ΔΔCt method (also called the comparative Ct method) is known, which corrects for differences between samples using an internal standard (endogenous control) without using a calibration curve. This method detects how many cycles it takes for an unknown sample to reach a threshold compared to a reference sample, and performs relative quantification. The unknown sample can be quantified relatively from the difference in the number of cycles required to reach the threshold compared to the endogenous control. In one embodiment, qPCR can be performed using the ΔΔCt method. In this specification, the term quantitative PCR (qPCR) includes not only absolute quantification but also relative quantification.

[0043] When performing qPCR on lncRNA, DNA can first be synthesized using reverse transcriptase (RT). Alternatively, preliminary amplification can be optionally performed before qPCR. Then, the sample, with or without preliminary amplification, can be subjected to qPCR. Kits that perform all of these steps are commercially available and can be used in this disclosure.

[0044] In one embodiment, the Disclosure provides a prognostic diagnostic kit for oxaliplatin-induced peripheral neuropathy. The kit may include reagents for detecting one or more of the lncRNAs of the Disclosure, i.e., biomarkers of oxaliplatin-induced peripheral neuropathy of the Disclosure. Reagents for detecting lncRNAs include, but are not limited to, primer pairs (including labeled ones) capable of amplifying the lncRNAs of the Disclosure (or products generated from lncRNAs by reverse transcriptase) and probes that can specifically hybridize with the lncRNAs of the Disclosure. In certain embodiments, probes that can specifically hybridize with the lncRNAs of the Disclosure may be loaded onto a microarray. The kit of the Disclosure may also include such a microarray. The kit may further include reverse transcriptase and reagents for preliminary amplification. The kit may also include reagents for internal standards and references. In one embodiment, the kit of the Disclosure may include primer pairs for detecting one or more of the lncRNAs from SEQ ID NOs: 1 to 24. The primer pairs may target DNA generated from SEQ ID NOs: 1 to 24 by reverse transcriptase. In one embodiment, the kit of the present disclosure may include instructions for use. The instructions for use may include a description of the procedure for the method of predicting the prognosis of oxaliplatin-induced peripheral neuropathy of the present disclosure.

[0045] Peripheral neuropathy, a dose-dependent toxicity associated with oxaliplatin, a major anticancer drug for colorectal cancer, can persist long-term in some patients even after treatment interruption or termination. Therefore, predicting the prognosis of peripheral neuropathy is crucial for preventing a decline in patients' quality of life. The expression of many long non-coding RNAs (lncRNAs) is highly tissue-specific and diverse, making them potential specific blood biomarkers that reflect the state of sensory nerves.

[0046] The inventors of this application stimulated primary sensory nerve culture cells with oxaliplatin and comprehensively measured lncRNAs whose extracellular release was altered, identifying several lncRNAs that are expected to be specifically expressed in primary sensory nerves. The lncRNA group described herein showed increased blood levels during or after treatment in patients whose neuropathy recovered after oxaliplatin treatment, but no change in blood levels in patients whose neuropathy persisted for a long period. In other words, measuring these lncRNAs in the blood of patients during or after oxaliplatin treatment is expected to be extremely useful as a prognostic biomarker for peripheral neuropathy, allowing for consideration of the dosage and duration of oxaliplatin administration in cancer treatment, as well as switching to other drugs, from the perspective of peripheral neuropathy, and in suppressing the long-term decline in quality of life after treatment in cancer patients.

[0047] Oxaliplatin is a highly effective anti-cancer agent, and it is desirable to continue administering it to patients who are unlikely to experience residual neurological damage after discontinuation of the drug. However, for patients who continue to experience side effects after discontinuing oxaliplatin administration, it is advisable to consider administering another anti-cancer agent. Therefore, the biomarkers related to this disclosure are considered to be extremely important biomarkers for improving patients' quality of life.

[0048] In one embodiment, the disclosure can predict the prognosis of oxaliplatin-induced peripheral neuropathy. In another embodiment, the disclosure can assist in the diagnosis of the prognosis of oxaliplatin-induced peripheral neuropathy. In another embodiment, the disclosure can predict recovery from oxaliplatin-induced peripheral neuropathy. If a subject is expected to recover from oxaliplatin-induced peripheral neuropathy, the disclosure can help determine whether oxaliplatin treatment can be continued or whether it should be continued. In another embodiment, the disclosure can predict the persistence of oxaliplatin-induced peripheral neuropathy. If a subject is expected to have persistent oxaliplatin-induced peripheral neuropathy, the disclosure can help determine whether oxaliplatin treatment can be interrupted, the dose (dosage) reduced, the frequency of administration decreased, treatment discontinued, or switched to another therapeutic agent. In cases where the treatment regimen is a combination therapy containing multiple drugs, switching to another therapeutic agent includes discontinuing only oxaliplatin. Such a decision can help avoid prolonged oxaliplatin-induced peripheral neuropathy.

[0049] In cancer treatment using oxaliplatin, peripheral nerve symptoms such as abnormal or impaired sensation in the hands, feet, and around the lips, and a constricting sensation in the pharynx and larynx may occur. Therefore, careful observation is required, and if abnormalities are found, appropriate measures such as dose reduction or discontinuation of the drug are necessary. For this reason, the decision of whether or not to continue oxaliplatin treatment is made before the start of each cycle from the start of treatment, and blood tests are always performed before administration. The method disclosed herein can be implemented using these blood samples and samples taken before the start of oxaliplatin administration. Accordingly, in one embodiment, the decision of whether or not to continue oxaliplatin treatment can be made, for example, based on a blood sample taken after 6 cycles (6 courses) of oxaliplatin treatment. If the prognosis is judged to be good by the method disclosed herein at the 6th cycle, oxaliplatin treatment may be continued (or recommended to be continued), and if the prognosis is judged to be poor, oxaliplatin treatment may be interrupted or discontinued (or recommended to be interrupted or discontinued). Similarly, the prediction method described herein can be applied, for example, to the sixth cycle of oxaliplatin treatment after discontinuation. [Examples]

[0050] The following examples further illustrate the present disclosure. However, these examples are for illustrative purposes only and do not limit the present disclosure in any way. Unless otherwise specified, commercially available reagents were used without further purification. Synthetic primers were manufactured under contract by Eurofins Genomics.

[0051] Since many lncRNAs are human-specific genes, analysis using human samples is necessary. Because it is extremely difficult to comprehensively and quantitatively measure lncRNAs derived from sensory nerves in the blood, we first used primary sensory nerves differentiated from human iPS cells to comprehensively identify lncRNAs whose release is altered by oxaliplatin (Example 1), and then examined the relationship between the expression of these lncRNAs and the chronicity of sensory nerve damage in the blood of human patients treated with oxaliplatin (Example 2).

[0052] [Example 1] (1) Differentiation of human iPS cells into primary sensory nerves We induced differentiation into primary sensory neurons using six different human-derived iPS cell lines. The differentiation induction method was modified from a previous report (Young et al., Molecular Therapy vol22, 1530-1543, 2014) and was performed using the following differentiation induction medium. Differentiation induction days 0-4: Knockout DMEM (20% knockout serum replacement, 1x non-essential amino acid solution, 1x Glutamax®, 10 μM β-mercaptoethanol, 3 μM LDN193189, 3 μM SB431542, 3 μM CHIR99021) Differentiation induction days 5-9: Knockout DMEM (20% knockout serum replacement, 1x non-essential amino acid solution, 1x Glutamax, 10 μM β-mercaptoethanol, 1 μM LDN193189, 10 μM SB431542, 10 μM CHIR99021, 10 μM DAPT, 10 μM SU5402) Differentiation induction days 10-15: Knockout DMEM (10% fetal bovine serum, 10 ng / ml BDNF, 10 ng / ml GDNF, 10 ng / ml NGF, 10 ng / ml NT-3, 200 μM ascorbic acid) ·After 16 days of differentiation induction: Neurobasal (trademark) Plus Medium (B27 Plus Supplement, N2 Supplement, 10 ng / ml BDNF, 10 ng / ml GDNF, 10 ng / ml NGF, 10 ng / ml NT-3, 200 μM ascorbic acid) However, on day 14 of differentiation induction, the cells were treated with 1 mg / ml mitomycin C for 2 hours. While standard methodology typically uses Medium 4, which contains fetal bovine serum, serum also contains RNA; therefore, serum-free medium was used here.

[0053] (2) Confirmation of differentiated primary sensory nerves The morphology of differentiated cells was observed over time using an inverted microscope. Neurite extension was observed from day 21 of differentiation induction and continued until at least day 42. Furthermore, similar morphologies were observed in all six induced cell lines at day 42 after differentiation induction. In addition, quantitative PCR confirmed that the expression of various primary sensory nerve marker genes was induced after differentiation induction. Quantitative PCR was performed using primers specific to each primary sensory nerve marker and Power SYBR Green Master Mix (Thermo Fisher Scientific), and analyzed using the QuantStudio 3 real-time PCR system (Thermo Fisher Scientific).

[0054] Next, Ca 2+ Imaging was performed. The imaging agent used was Flou-8 AM (AAT Bioquest). TRPA1 is highly expressed in primary afferent nociceptive fiber terminals and is known as a channel involved in pain. Calcium ion imaging of cells before and after stimulation with allyl isothiocyanate (AITC), and stimulation with AITC, a TRPA1 agonist, confirmed that TRPA1 is functional in differentiated cells.

[0055] (3) Comprehensive analysis of extracellular RNA Next, starting 42 days after differentiation induction, the differentiated cells were treated with oxaliplatin (Yakult) at 0.1 μg / ml and stimulated for 7 days. The culture supernatant was collected, and cells and other components were removed by centrifugation at 4,700 rpm for 30 minutes. Extracellular vesicles were then isolated using Total Exosome Isolation Reagent (from cell culture media) (Thermo Fisher Scientific). The particle size (nm) distribution of nanoparticles in the extracellular vesicles was confirmed using the NanoSight nanoparticle analysis system (Malvern). Total RNA was purified from the isolated extracellular vesicles using RNAiso Plus (Takara Bio), and the contained RNA was comprehensively analyzed by RNA sequencing. RNA sequencing was performed on a cDNA library prepared using the TaKaRa Smart-Seq Stranded Kit and sequenced using a NovaSeq instrument (Illumina). The obtained sequence data was analyzed using RNAseq Alignment and RNAseq Differential Expression in Illumina's BaseSpace Sequence Hub. Figure 1 shows the changes in extracellular RNA release from oxaliplatin-treated cells (vertical axis) compared to untreated controls (horizontal axis). Outlined circles indicate genes that were not statistically significant, while filled circles indicate genes that were statistically significant. From Figure 1, 270 genes were identified that showed a statistically significant change of more than twofold after oxaliplatin treatment. This represents total RNA, including lncRNA and mRNA.

[0056] Next, we focused on 99 genes identified as lncRNAs from among the 270 genes that showed a significant twofold or greater change in expression after oxaliplatin treatment. From these, we further extracted lncRNAs that were found to have low or no expression in organs other than the dorsal root ganglia where primary sensory nerves are present, according to the database. We then extracted 39 genes (of which 26 showed increased release and 13 showed decreased release) that could be measured by quantitative PCR.

[0057] The extracted lncRNAs were assigned the following IDs. Gene sequences are available from publicly known databases (e.g., NCBI).

[0058] [Table 3]

[0059] Furthermore, h_lnc5, h_lnc12, h_lnc21, h_lnc23, h_lnc24, h_lnc25, and h_lnc26 were difficult to detect specifically by quantitative PCR. Therefore, they have been excluded from subsequent analyses.

[0060] (4) Relationship between gene expression levels and extracellular release levels RNA expressed within cells that release the measured extracellular RNA was comprehensively measured by RNA sequencing, and quantitative correlations between intracellular and extracellular RNA were analyzed. When all genes were plotted, no linear correlation was observed in either the control group or the oxaliplatin-treated group. Furthermore, no linear correlation was observed when only the lncRNA extracted in (3) above was plotted.

[0061] (5) Oxaliplatin dose-dependent lncRNA release Next, the dose-dependent release of some lncRNAs with altered extracellular release was analyzed using oxaliplatin. After extracting the RNA as in the comprehensive analysis of extracellular RNA described in (3) above, reverse transcription was performed using the iScript Select cDNA synthesis kit (Bio-Rad), and the amount of lncRNA was measured by quantitative PCR as described in (2) above. Primers were synthesized by Eurofins, and the reagents included in the kit were used. Conditions such as lysis and centrifugation were also followed according to the protocol in the instructions for use. Figure 2 shows some of the dose-dependent extracellular release amounts of the lncRNAs of interest. As a result, dose-dependence was confirmed for many lncRNAs. In particular, the release of lncRNA_1, lncRNA_3, lncRNA_4, lncRNA_6, lncRNA_9, lncRNA_13, lncRNA_14, lncRNA_15, lncRNA_19, lncRNA_30, and lncRNA_31 increased in a dose-dependent manner.

[0062] (6) Analysis of lncRNA content in human plasma Next, extracellular vesicles were extracted from human plasma using the Total Exosome Isolation Kit (from plasma) (Thermo Fisher Scientific). RNA was extracted as in the extracellular RNA analysis described in (5) above, and the amount of lncRNA was measured by quantitative PCR. Specifically, after blood collection from human subjects, the samples were converted to plasma and cryopreserved. 400 μl of plasma was used for the extraction of extracellular vesicles. The plasma was lysed, recentrifuged, and then treated with the protease contained in the Total Exosome Isolation Kit (Invitrogen). Next, the extracellular vesicles were precipitated using the reagents included in the same kit. Subsequently, RNA extraction was performed, reverse transcription was carried out, and quantitative PCR was performed. Primers were synthesized by Eurofins, and the reagents included in the kit were used. The conditions for lysis and centrifugation were also in accordance with the protocol in the instructions for use.

[0063] To compare the lncRNA content in plasma with the amount of lncRNA released from cultured cells, we analyzed the correlation between the lncRNA content in healthy human pooled plasma and the amount of lncRNA released from cultured cells. A significant correlation was found, suggesting that the lncRNA content in plasma reflects, to some extent, the release from primary sensory nerves. To analyze in more detail, we separately examined the correlation between lncRNAs with increased and decreased release from primary sensory nerves. A stronger correlation was observed between plasma volume and release amount for lncRNAs with increased expression (Figure 3), while a weaker correlation was observed for lncRNAs with decreased expression.

[0064] [Example 2] (7) Analysis in patients treated with oxaliplatin Next, to verify the effectiveness of the lncRNA discovered by the inventors as a prognostic biomarker for oxaliplatin-induced peripheral neuropathy, the amount of lncRNA in actual oxaliplatin-treated patients was analyzed. Specifically, in patients for whom oxaliplatin (oxaliplatin intravenous infusion) treatment is recommended according to the colorectal cancer treatment guidelines, blood samples were taken before the start of oxaliplatin treatment, every two months after the start of treatment, six months, one year, one and a half years, and two years after the end of treatment, and the amount of lncRNA in the plasma of these patients was measured. In addition, when blood samples were taken, a diagnosis of whether peripheral neuropathy had disappeared or persisted (persisted) was made based on records of neurological and pain assessments according to the National Cancer Institute - Common Toxicity Criteria. Note that the dosage and method of administration of oxaliplatin differed depending on the patient; in method A, one dose was administered and one rest day for 13 days per cycle, and in method B, one dose was administered and one rest day for 20 days per cycle. In patients diagnosed by a physician as having resolved peripheral neuropathy within one year of discontinuing oxaliplatin administration, the expression of the lncRNA increased from approximately the fourth cycle of administration compared to pre-treatment levels. Figures 4-1, 4-2, 4-3, 4-4, 4-5, 4-6, 4-7, and 4-8 show the results for samples taken approximately three months (approximately six cycles) after the start of treatment, with the pre-treatment level in the same subject set to 100%. On the other hand, in the group of patients whose impairment persisted for more than one year, no increase in plasma lncRNA content was observed during or after treatment (Figures 4-1, 4-2, 4-3, 4-4, 4-5, 4-6, 4-7, and 4-8). In addition, even in the prolonged disease group, there are cases where the plasma lncRNA content increases during or after treatment compared to before treatment, such as h_lnc3 in Figure 4-1, h_lnc6 in Figure 4-2, h_lnc9 in Figure 4-3, h_lnc27 in Figure 4-7, and h_lnc29 in Figure 4-8. However, even in these cases, the rate of increase in plasma lncRNA content in the prolonged disease group is smaller than that in the recovered group. In other words, if a patient's rate of increase in plasma lncRNA content during or after treatment is greater than the average rate of increase in the prolonged disease group, that patient is in the recovered group.In particular, if the increase in plasma lncRNA content in the prolonged group is not significant, then if the increase in plasma lncRNA content during or after treatment in a patient is significantly greater than the average increase in the prolonged group, then that patient is in the recovery group. While we do not wish to be bound by any particular theory, for lncRNAs whose release increases in cultured cells, it is thought that these lncRNAs are also being released in the subject's primary sensory nerves. On the other hand, for lncRNAs whose release decreases in cultured cells, it is thought that the measurement in the patient's plasma sample may not necessarily only reflect the reduction in lncRNA release from the subject's primary sensory nerves, but may also reflect lncRNAs from other organs or cells. In this case, it is preferable to use lncRNAs whose release increases in cultured cells as a biomarker to predict the prognosis of oxaliplatin-induced peripheral neuropathy. Furthermore, lncRNAs whose release did not change in cell experiments did not show any change in quantity in plasma due to oxaliplatin.

[0065] Figures 5-1 and 5-2 show the results for samples taken approximately 3 months (approximately 6 cycles) after the start of treatment, with the pre-treatment average amount in the test subjects set to 100%. In patients whose peripheral neuropathy resolved within one year of discontinuing oxaliplatin administration, the expression of the lncRNA increased from around the 4th cycle of administration compared to pre-treatment levels. However, in the group of patients whose impairment persisted for more than one year, no increase in plasma lncRNA content during treatment was observed (Figures 5-1 and 5-2). Similar results were obtained when the reference point was set to the average amount of the patient group before the start of treatment.

[0066] These results suggest that the lncRNA discovered by the present inventors can be used as a biomarker to predict the prognosis of oxaliplatin-induced peripheral neuropathy. [Industrial applicability]

[0067] This disclosure makes it possible to predict the prognosis of oxaliplatin-induced peripheral neuropathy and avoid its prolongation by changing the treatment method. Furthermore, this disclosure enables more appropriate cancer treatment using oxaliplatin.

[0068] References Young et al., Molecular Therapy vol22, 1530-1543, 2014

[0069] This specification references numerous documents, including patent applications, literature, and manufacturers' manuals. While the disclosures of these documents are not considered relevant to the patentability of this disclosure, their entirety is incorporated herein by reference. More specifically, all referenced documents are incorporated herein by reference in the same manner as each individual document is specifically and individually indicated as being incorporated by reference.

[0070] Regarding the sequence information of lncRNA Sequence ID 1 h_lnc1 LOC105374297 atacgcttgtgatcaagggcctggtctcccctcaagacacggtcacagatcagaggccacaccatcctagcagtggagcaggaccagctgggacagggtccttctgtgacacctgctgcatcaccaggctgggtgaacggacacaattgccagaactcacagaatagaagtatcagcaccgaaacctcacaggaaaaatgaagacattttctttctcttctgagtaactgaaataaaatctggcctctgtgaaaccctggaaataccacgaccctcaactagaaacaccaataccagctcctccgcgagtttccagctccacaacctaagacatcagaggcagcattggttcctcacgtagagtccagctccgggaccctcatatttgaaccgcagggccatctcatccctggatctccagctgcaccacactcaaattagaacaacatcagttcctccccaggtctccacctgcacagccctcgaaagggaatgtcagctcctccccgggtctccagctgtagggccctaaaactagaacatcagcttctccccaagtcttcagctgcgtgaccctcaatctagaacatcagttcctctacaggtctgcagctgcaagaccctcaatct Sequence number 2 h_lnc2 LOC105371430 tgggctgcctgtggctggagctgccatctttgtccgagaggtaggtttatagatgcgaatcctttccttctctgcctccgggtcagcaagaattccatcccaacgcagactttcgttgatccgattcgcaaggttctctatttcggcaaagtcggggaggctgacggtggaggagtcagaagggaggtgcttcttttccactttgctctgtctgtgctctggtttcgggccacgctctttgcaaggacttaagatgtcatgaaaggaggaagaaagcggctggctcttcaggctctgactctgatgtttatctgctgagtagatgagcagcccactacagttgtagttctggcaccatcgtgccatcaaagccgctttacaacgtcac Accession number 3 h_lnc3 LOC105370489 gtggtccgccccacccccagcaccccggcagaaaccgcaccccacttcccatagccacgttcttccccagaccttaccctgcccaagaggttgtcctgaagtaatgtctgctgcagcactggggccacctcctccaagctcaacatgtggcaaagttcatttttaacgtgctggattttccgatgaaagcctgaaacctgcacatctgaagatgccttcgccatgatgcaatggatgccaaacacgacatacacccttgggacggtgacctcagccatctgcaacaaggctctcagaaccagtcctttgactataaaaaaagcagcagctttcactaaccaagcatctttaatccaagccaaattacagaactctctaacttagaggtgatcgtccatacggcagatcattacaacatgaaaaacgtaagctaagatgttgaacacagccagaactgaaaataaaagagctttctaaaacaaaaaaaaaaaaaaaa Accession number 4 h_lnc4 LOC730234 tatgcccaactaatatttggaattttcctatacgtggattccagaggggtgacagcgaaacgtaggaccatccagttgcagaaaaacaagcttaacacgcccactgattctacattatgcccctacctcccggcagcctctccaggcccagaactttctccagtcagcctccacagaccaagctcatgactcacaatggcctatttaggcccataccctacctcacggcagtctctgcagatgaggctactgcctcacaacagcctccacaggcacagctccaccgttacaatggcctctttagacccagctcctgcctcccagccttctctccaggccctgagctttctcaagtcgacctcaccaggcccagctcatgcttcttggcagcctctccaggcccagctcctgcatcttggcagcctctccaggcccagcctctgcctcctgtcagcctctacagtcccaacatctgcctcacagcagattcttcaggcccagtatctgcctcactgtggaccacccaagccaagctcccaa Sequence number 5 h_lnc6 LINC02198 Array number 6 h_lnc7 LINC02186 tgaatagcagggcttggtctaaaaatatctcctccactgacataccacatgggttgatattcctgctgtcagaggcacaccttgaaattaaggtgtcttcctacaaaaagtcttgttgttaagttcagacactgtctgagatgaggtatttataattcctgccccaaatttggctataagcttcaagaatactgggacctggcttgtttactgaagcatctctagagccacaacaatgggtgaaacaccatggacagttagcaaatatttgctaagcaaatgaaagactacacgacaagagcaaaagaagtgcaggaatgggcccatgctcatggaattcactggtcttaccatgttcgtcatgatgctgaagcagctggcttcatagaatattgtaacagccctttgaagactcaattacagcaccagctaagtagtaataccttggagggctggggcaagtttctccagaaggctgaatatgctctgaattagtatccaatatatggtgctatttctcccctagccgggattcacagatccaggaatcaacggggtggaaatgggagtggcaccagtcaccatcacccctagcgacccactagcaaaatgtttttttcctgttcttgagactttatgctttgctggcctagaggtcttagttccagagggaagaatgctgccaccagaagacaaaacaatgatttcactgagctggaagttaagactgccaccccgccacttggggctcttcatgcctttgagtcaacaggctaagagaggaagagaaggaaggaatagccaatgatcagtaactgtgcagagccaggatcaaaaactcaaatgcccacaggggccaggtaataaagcaagtaaatgaaggcaaaaaaaaaaaaaaaa Sequence ID 7 h_lnc8 DIRC1 Array number 8 h_lnc9 LINC01925 gggcgcgtggccgaggtccgaggagggcccggaggtctggccgaggtccgaggaggggcccggaggtctggccgaggtccgaggaggggcccggaggtctggccgaggtccgaggaggggcccggaggtctggccgaggtccgaggaggggcccggaggtctggccgaggtccgaggaggggtccggaggtctggccgaggtccgaggagggcccggaggtctggccgaggtccgaggagggcccggaggtctggccgaggtgataatagttaagcctagagccatgagaggcctgtgctccgtgggacaggaggctaagagcggaacagggcccactgttggatgctactgatcaccagactgtggcctttatacacatcaacttgcttcatctccaccagaacaaatgaatgacaaaacccgatgaaagacaaagccagagtaaatcccttctcatctatgtcacggcaaaagatatagtaacagcaaaaacaagctc Array number 9 h_lnc10 FAM85B gggttcgcgctttggtcctggaggccttatcctagcctcctctgtatcagcgccaccagtctggggcccgaaaggagggagctttccctctgtcccccagcctttggactgtcaccaaacaagccattcgttcaccaaatacttattaagcgcctaccatgtgcctgacaagggagatgtaacgatagagtctctctctctgccacccaggccagagtgcagttgacgcagggcaggggagccccgaagtggagcatagtgtgtccggaactggtgggttcttggtctccctgacttcaagaatgaagccacggaccctcgggaaactcctggagggcagaggcatgcctgccatcttcatcattgcattaccaccacccaacactatcgggggacctgccctgataatcagtctacaggtgtatccagcagctccagagagacagcgaccagcgagaaggggccatgatgatggtggtggttttgtcaaaacgaaaagggggatatgtagggaaaagaaagagagatcagactgttactgtgtctacatagaaagggaagccataagagactccattttgaaaaagacctgtactttaaacaattgcttgctgagatgttgtttatctgtagctttgccccagccactttgccccaaccactttgacccaatctggagctcacaaaaacatgtttgtatgaaatcaaggtttaaggcatgtagggctgtgcaggacgtgccttgttaaccaaatatttggaagcagtatacttggtaaaagtcatcaccattctctcgtctcaataaaccaggggcacaatgcactgtggaaagccgcagggacctctgcccttgaaagctgggtatt SEQ ID NO: 10 h_lnc11 ETNK1-DT gttggcctgcgattagcacacacccatccctgggaactgctagtctggaaagcggggctgcttctccgggatgagcccgagccctgccaagcccctcaaggcattgaagctttagctcaccttatccgaatggtcattgggcatctggacttgagttaacgactgaatttttctgggaagcaagggacacgttctaaaataaccccaggatcactctccgaacttggcctgagtctaggcaagcagtgttactcggtcgccttgatcttggagctgctgtgtactggggacctcatactagttgggttaactatattcccattagcagtacgcgggatcgcagtactcgggacaagctgagttcaggtatttggctgctatgagtaacacgatctggaaagacagcgctagcaaggaatgaggagtgatacagtgactggaggctaagagataatgtctgcaagtcacctaaaaccattgcagacacagggagattgatggatttggaggacttctggttgtgaagactctgacgattgctaaagatgtctcaatctatcgcccaagctggactgcagtggtgcaatcatggcccactgcagccacaacttcctgggttcaagtgatcatcccacctcagcctcctgagtagctgagaccacagcttagtaacagtcatggacaacagcatgcgaatcttagagctgttattggtcgacctagcaaccatgcggttcccaag Sequence number 11 h_lnc13 LOC284191 Sequence ID 12 h_lnc14 LOC105371855 Array number 13 h_lnc15 LINC00976 gcgcttcttgctgccaacatgtgaagaaagacgtgtttgcttccccttccaccatgattgtaaaatcaacaaggaaggcgatgagcacagcagtgtgaagcaatgacaaggatgccctaagctctatgaaactgcgagataaacatctaccaggttgatatcatatcactcaaaagcaaaatttattcctcaggtctcttcacagcgtggcgcctgggttccaaggggaatcatcccaagagagaaccagggagaaactgtatccacctgcaagatctaacatcagaagtcatatagaacaccattccctactcttagctaaggaagtcacagagatctgactcccttccttcaagggagggaaccatagactctacttgtgggactggctgggttctgatagaatatggacatatgacttcagccatttttggaaattatactgtgccacaccttaacgtgtcagaagacgaggacactgtcataactttcagtcaattgctcaaaccaaatatcaaagtattatcctgaa Array number 14 h_lnc16 LINC01657 agtggggctagagttgcctccccaggaggggctggaggtcagggcctggtgggctctgcaggcttatcagttcagcacaacgtgctcctgcattcaagaaacagggcatggggctgctcactggcactggaggccgaaagaaggtgagggcaagtgagatgcagggacctcttctcacagctgtgctgacaagcacaaaaaggagccccccacgtccacaccaggaaaggggggatggtgcacaagatccagcaggaactttggagtcacactgacgtgggttcaaatcccagctctgccgctgagcaactgtgagatcttggcaaatgtttaactttcctgatcctctattgactcatatgctaaatgtgacttagaatgcttgtgtcgtaagactggcgtgagataaagtacggcaagtgggaaacacaaagcctgtgcacgtgaggccctcaacagaaaaagctgaattgctgtgtactggtagcctcctttctcttaccaggaagcccacgcctctggctaaaccctcaggctcacttgcccaccattaccaggtgcctgtctcccttgcctgtcttcccttgactcggggaacttcacctgctttccttccctagaaggccccagcgcccaccttgcttgctgtccttcaaatcaaacaacctgccctttcttctaaaaaggctttactgttatcactaaagggaaacaaaaaggtgcaactaaaactagccttccttaagcctgggcccaagt Sequence number 15 h_lnc17 LINC01703 acgcccaccgggtccgcccccacgcggccgcctgcacagggggttccagccacccgcgctctcccaggtttgccgaccttacgggcccttctccgccagccctggctgggtcacccccacgacccgggactcccccgccgttccctcccgggctgcctgcagtgaggtccgctcctgaggcctcagcctcgccgggggtagggccctctcccgccgtcgccgcagctcctttccgtcccggggcctggggggcaccgtcccacgggtgagggccgcctccagcgcctggcccagccatgcgaacgcctggagcccgcgagctgcagctgcggccctgaaggtgccgcatatcctgccgagtgggtgaagcgtggcactttggaaaacaaatcgggtgatccgcccacctcggcctcccaaagtgctggaattacaggcatgaaccacggtgcccggctgacacaaggaactttctatgaggtcctaggaatgaaggaaaacaggcaataaggcaagaatcgctgtcgaaggagtctgcgccacctgctcgcacagctcacttgtgccttctgagcctgctggagcccagtgtacatatgccgtctccgcgtgattagagattgctgctgcacgtgcccaatcccgtggcggggctggaacacaaacggggtggtgttccagctgcaaccatgcagatgaagactataccctaggagatggaggaacaacagacaagaaagaaacctgggttcctgaata Sequence number 16 h_lnc18 LOC105378269 ctcttggctccggggcccgcagccgtcggggcccggaagggctccccggggcgttccctcaggagcggtggccagggctgatggggcgtgtacgacgcgggaccccgagcccggcagcagccaagtatggcaaggaccagcgcgagcatctccccactgcggccggggacggcgtggggtgggagccgacccgggacatccaggtgggatcggccaccgctcaggcgctgtcccaggcgaacgccgccaggggcaggctcagcaccgcccaggccgccggctcgccccctcgccctaaggacacagtgtgggctgttgcaggtcctcctgaccaggacgcgacttccctgaggcggaggaggagctgaggacgaacaaggactgggctgggtccagctggtgggcgtagggctggccagtgccttggcctttaacctgcagcgtcctgggtctctttggcccagccagtcgtgaggactgtggcccaggatgctgccgaacagtgagggtgcccattgtggactggaatccagctagctattcctcattcgagaccccatagaaccccacaaacatgattggggttgacatggattttgaatattaaagttacatgagatttctgaaaaaaaaaaaaaaaaaa Sequence number 17 h_lnc19 LOC101928797 Sequence number 18 h_lnc20 LINC02271 attatgtaatatgcctcaggcagtggcagaaacctaggctgaaataaccagcactacttgccaaacactttagaaagattatgtttcttctccattacagaagtggaacatatggttcaggaatttaccctaaaggcaaactacagaggttaagcatgtgatgcaggggccaaaattgtgagttcaaatgccaacatgtttacttactaacttcatgacctcacaaacttgcttcaactttctgtaactttgtctgcttatctataaaacaatacgtacctcaacgtctggttaaaagtttcaattggcataatatatataaagctcttagaagactgcctggaacagtttgcagcaagatcctcccaggaaagtgaagcggagaaaatggaggtagaaactattctcctcattaaactacctgccctctgtaatgtagctcttctgtgctgcagaaattgatactacacaagaaaagaaatgatgggagaatagtgaagaagagaagaactggccag Sequence number 19 h_lnc22 MANCR atgatgttggaggatacctgtgcatctcatgctgtggttacagcatcaattgtgatgaatataggatactgagtccctcctagaaatgacttcaggaacttcaccccccaactccacaatctgggaatggcagacagattcagcaccaggagaacatcacataaaggacaagtgtgtatgtttaaaaatggcaagtttcggcctggcatggtggctcacgtctataatcccagcactttgggaggctgagtctaagtgtacagtgcttgtaaagtctgcagtagcatacagtaatgtccaaggctttcacatccactcaccactcgctcactgacccagccagagcaacttccagtcctgaaagctgcattcatgactcaatcaccacaattgcaatcaaaagacggctttagttggaacctggaacgtgctaatcctgtcaggcagcctgtgattctggaagtgaaggaacaaaaaaaaaaaaaaaaagggaaaatttcacataaaatttccatatgaggaagaagatggaaacttttgtgttgtgcgttcagtaaaacgggcactttcttaagcaggtggcaaagaaagcctgagaatccggcctgactttttcatttcagaaccctgcatttcccacacagaggagatagagcacagccattgcatggtagatccagcttgctctcacagccattgtgcaaataaacatacatgtggcaaggcagtgcagttttcagttgttaaaagttctgtcat Sequence number 20 h_lnc27 LINC01801 gtcagcagcactgggtcagccggtgaacgggtgtgcagcgtcctcagcgccgcagcagtcagcacctgtgggtgctctagctctttccctcggggtcaccggaggcagagcctcccctacgcggagtagaggagcagctcacatggcagccgccacagaggacaccagatcatgccaacacccccacaactcctgcccgcctgcaggcagctctgggctcaggacaccgcctgcaagaacctttatagcgcagctctccaaaccttggaggcgaggacattctatgtgcccgccctggaaaggcctgaacctataacatctgggctgtgatggtttctgaggtggacaccaggaccaacacttgtcagcatggcacaatcaggcatttctcttctaagtaggatgtgcagccaaaaactcagctgtctgtgagctgtcttctcccaggaacgaggacataagatgtacatcaggttttgatattagagtaatactggccttatagaatgagttacgaaaagttgcccctttctccactttctgaaagagtttgtgtaacacaggtctgaactgcacagatccacttacatgtggattttcttccactgcggcctctcctgagacagcaagaccaacccctccttttcatcctcctcctcctcctcagcctactcaacatgaaaatgacaaggatgaaacctttatgatgatccactcatccattttcttttctctagcttattgtgaacatcttaggct Sequence number 21 h_lnc28 LINC01689 ggccatttctcatggaaaatcaggaaaagagaatgaaacattaattttcatgttgagttattacagacatcagcagtatggaccaagcacccatgagataacgagtcctgaactgggcaccaagagagggtcacagatataaagagtttgccttgagtctcagatgaaactttgaatattggacatttgagttgatgctggaacaagttaagagttttgaagactatgggatagaatgactatattcaacactgaaagaacgaagacaatggctcttccagaggaagaaagattatcctgtcctggctatcttgtctattaccaacattccaggatgaagaaatatggtgatacactcaggccactggaatggcctccagtacagcagtgaataccagtggaatgcaacttcttttgctttagaagacaagctcttagcaatgtcaagtttccaggtacgaccgagagatattcaacatattataatttccactaagatgggaaacatttcctaggggttatttctctttgacagcagagaagtatccaagttattctagataataaagcaaagttttcctcaagtcctgtattatatgagactgctgtttctgaaaattatagtcccacagcaacctacgaagtttagagatcaatatttgatttttctatcttgctaaatattcttcaaatcaagtattagttgtccctgtcactcagcatgaagaaaaactgtgttaaagaggacctggagaagta Sequence number 22 h_lnc29 LOC105374516 tattgtcagagaatatgacacatagcaaaggtaatattcaaagtcatctgacaagcattgggcaggatgatgtccaacattaatgctctgctactcatctagccactgaccctggtcactcaatattcaagacttaatgaatggaaagtggaagatgcattttgccttccttttgcttttgaggtgagactccgagttctcaaagaaaatcaaggcatatggctgggcatctcttttagcatccttgaacagtctgtaatggcccaaatgtacttcaagaatgcagcaattgaaaacaagtcacccggagcacacagactagagtctctgtgggccaccatgcatgaggacattcaagcagccttatggagcagtttacatggagaaaaactaaggcctcctgccaacagccagcaccaactggccatataaatgaactaccttgatcatgaatgcagactctctaaagcctttacatggatgcaacctcatgagagacccctgtccagaagaacacaattaagctcctgaattcctgacccacagaagagctgtgagatactaaatgcctattgttgttttaagccactaaattttgaggtaatttattatgtggtaatagataactaagacatgagtatacactaaccctaaaataatctcaaaatcccttcatgttgtccaggtagtaccattaaatgtgacctgcatgttcaaaaaaaaaaaaaaa Sequence number 23 h_lnc30 LINC01658 Sequence number 24 h_lnc31 LINC02411 aggtcagaccaggaagacagaggccaaacccagcatcacactttgacctgcccgggaacacagtggctcctgggaaataaccactaaagtcttgaaatgtcttgagtgattggaggacctttatttttcacgcctgatgccttatgctgatgagatgactcagcaggggatggccaggccagaaagaccaaaactgtatcctgaggtttgagtttctgagccaggtgatgtcatcctccagcttggccggcctctttctgggagcctctggtgtgaaagagagcagatttattaaaaatcatcaacttcaaattatttggatggaaacattgccaaatcatagagatgtttgctaccacccgcacaccaagcagctgggtaactagaagtgcaggatcagcttattcacctccgaaagcctgcatgcaaccactgaggccgcctctattttttacatagttctacttggtgtatgtaaccccacagagaaacctggaagaatgcatgaaacctagtaaggcaaccagcacatgcaacagaatgaaccgtttctttccatctgaatgcctaaatgtggactctgatcctttctaccaagtcctaagtttgggaaaagaggacaaggacaggggctctgtcccatatcataatgtgcttgtgaatggctaaaattacaatgctgagataagtgtgtgtaataaaataattgcaccccgaattgaa Sequence numbers 25 to 72 Primers

Claims

1. LOC105374297 (Sequence ID 1), LOC105371430 (Sequence ID 2), LOC105370489 (Sequence ID 3), LOC730234 (Sequence ID 4), LINC02198 (Sequence ID 5), LINC02186 (Sequence ID 6), DIRC1 (Sequence ID 7), LINC01925 (Sequence ID 8), FAM85B (Sequence ID 9), ETNK1-DT A prognostic diagnostic kit for oxaliplatin-induced peripheral neuropathy, comprising a reagent for detecting a biomarker for prognosis determination of oxaliplatin-induced peripheral neuropathy, and instructions for use, comprising one or more long non-coding RNAs selected from the group consisting of (SEQ ID NO: 10), LOC284191 (SEQ ID NO: 11), LOC105371855 (SEQ ID NO: 12), LINC00976 (SEQ ID NO: 13), LINC01657 (SEQ ID NO: 14), LINC01703 (SEQ ID NO: 15), LOC105378269 (SEQ ID NO: 16), LOC101928797 (SEQ ID NO: 17), LINC02271 (SEQ ID NO: 18), MANCR (SEQ ID NO: 19), LINC01801 (SEQ ID NO: 20), LINC01689 (SEQ ID NO: 21), LOC105374516 (SEQ ID NO: 22), LINC01658 (SEQ ID NO: 23), and LINC02411 (SEQ ID NO: 24), The above-mentioned instruction manual describes a method for determining the prognosis of oxaliplatin-induced peripheral neuropathy in biological samples obtained from subjects during or after oxaliplatin treatment, and comprises the following steps: 1) A step of determining the amount of one or more long non-coding RNAs in a biological sample obtained from a subject during or after oxaliplatin treatment. 2) A step of comparing the above quantity with a reference, Includes, The aforementioned reference is a pre-oxaliplatin treatment reference for the same subject based on the amount of long non-coding RNA in a biological sample obtained from the same subject before oxaliplatin treatment. Compared to the same subject before oxaliplatin treatment, an increase in the aforementioned amount is used as an indicator of a favorable prognosis for oxaliplatin-induced peripheral neuropathy. The one or more long non-coding RNAs mentioned above are LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT. The kit describes using the oxaliplatin-induced peripheral neuropathy prognostic diagnostic kit, selected from the group consisting of (SEQ ID NO: 10), LOC284191 (SEQ ID NO: 11), LOC105371855 (SEQ ID NO: 12), LINC00976 (SEQ ID NO: 13), LINC01657 (SEQ ID NO: 14), LINC01703 (SEQ ID NO: 15), LOC105378269 (SEQ ID NO: 16), LOC101928797 (SEQ ID NO: 17), LINC02271 (SEQ ID NO: 18), MANCR (SEQ ID NO: 19), LINC01801 (SEQ ID NO: 20), LINC01689 (SEQ ID NO: 21), LOC105374516 (SEQ ID NO: 22), LINC01658 (SEQ ID NO: 23), and LINC02411 (SEQ ID NO: 24), as a method for determining the prognosis of the oxaliplatin-induced peripheral neuropathy.

2. The kit according to claim 1, wherein the instructions for use further state that the amount of one or more long non-coding RNAs is compared between a biological sample of the subject before treatment with oxaliplatin and a biological sample during or after treatment, and if the amount of one or more long non-coding RNAs is increased in the biological sample during or after treatment, it is determined that peripheral neuropathic pain will not persist.

3. A method for assisting in determining the prognosis of oxaliplatin-induced peripheral neuropathy using biological samples obtained from subjects during or after oxaliplatin treatment, comprising the following steps: 1) A step of determining the amount of one or more long non-coding RNAs in a biological sample obtained from a subject during or after oxaliplatin treatment. 2) A step of comparing the above quantity with a reference, Includes, The aforementioned reference is a pre-oxaliplatin treatment reference for the same subject based on the amount of long non-coding RNA in a biological sample obtained from the same subject before oxaliplatin treatment. Compared to the same subject before oxaliplatin treatment, an increase in the aforementioned amount is used as an indicator of a favorable prognosis for oxaliplatin-induced peripheral neuropathy. The one or more long non-coding RNAs mentioned above are LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT. The method is selected from the group consisting of (Sequence ID 10), LOC284191 (Sequence ID 11), LOC105371855 (Sequence ID 12), LINC00976 (Sequence ID 13), LINC01657 (Sequence ID 14), LINC01703 (Sequence ID 15), LOC105378269 (Sequence ID 16), LOC101928797 (Sequence ID 17), LINC02271 (Sequence ID 18), MANCR (Sequence ID 19), LINC01801 (Sequence ID 20), LINC01689 (Sequence ID 21), LOC105374516 (Sequence ID 22), LINC01658 (Sequence ID 23), and LINC02411 (Sequence ID 24).

4. A method for assisting in determining the prognosis of oxaliplatin-induced peripheral neuropathy using biological samples obtained from subjects during or after oxaliplatin treatment, comprising the following steps: 1) A step of determining the amount of one or more long non-coding RNAs in a biological sample obtained from a subject during or after oxaliplatin treatment. 2) A step of comparing the above quantity with a reference, Includes, The aforementioned reference is a reference for the prolonged group, determined based on the amount of long non-coding RNA in biological samples obtained in advance from a group of subjects in whom oxaliplatin-induced peripheral neuropathy was confirmed to have persisted, either during or after oxaliplatin treatment. Compared to the aforementioned prolonged group, an increase in the aforementioned amount is used as an indicator of a favorable prognosis for oxaliplatin-induced peripheral neuropathy. The one or more long non-coding RNAs mentioned above are LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT. The method is selected from the group consisting of (Sequence ID 10), LOC284191 (Sequence ID 11), LOC105371855 (Sequence ID 12), LINC00976 (Sequence ID 13), LINC01657 (Sequence ID 14), LINC01703 (Sequence ID 15), LOC105378269 (Sequence ID 16), LOC101928797 (Sequence ID 17), LINC02271 (Sequence ID 18), MANCR (Sequence ID 19), LINC01801 (Sequence ID 20), LINC01689 (Sequence ID 21), LOC105374516 (Sequence ID 22), LINC01658 (Sequence ID 23), and LINC02411 (Sequence ID 24).

5. A method for assisting in determining the prognosis of oxaliplatin-induced peripheral neuropathy using biological samples obtained from subjects during or after oxaliplatin treatment, comprising the following steps: 1) A step of determining the amount of one or more long non-coding RNAs in a biological sample obtained from a subject during or after oxaliplatin treatment. 2) A step of comparing the amount with a first reference, 3) A step of comparing the amount with a second reference, Includes, The first reference mentioned above is a pre-oxaliplatin treatment same subject reference based on the amount of long non-coding RNA in a biological sample obtained from the same subject before oxaliplatin treatment, The second reference is the average growth rate reference for the prolonged group of subjects, and the second reference is based on the average growth rate of the prolonged group of subjects, determined by comparing the amount of long non-coding RNA contained in the biological samples of the prolonged group of subjects obtained before treatment with the amount of long non-coding RNA contained in the biological samples of the prolonged group of subjects obtained during or after oxaliplatin treatment. i) The amount of one or more long non-coding RNAs in the biological sample obtained from the subject during or after oxaliplatin treatment is increased compared to the first reference above. and, ii) When the ratio of the increase in i) above is significantly greater than the average increase rate of the subject population in the prolonged group described in reference 2 above, As an indicator of a good prognosis for oxaliplatin-induced peripheral neuropathy, The one or more long non-coding RNAs mentioned above are LOC105374297 (SEQ ID NO: 1), LOC105371430 (SEQ ID NO: 2), LOC105370489 (SEQ ID NO: 3), LOC730234 (SEQ ID NO: 4), LINC02198 (SEQ ID NO: 5), LINC02186 (SEQ ID NO: 6), DIRC1 (SEQ ID NO: 7), LINC01925 (SEQ ID NO: 8), FAM85B (SEQ ID NO: 9), and ETNK1-DT. The method is selected from the group consisting of (Sequence ID 10), LOC284191 (Sequence ID 11), LOC105371855 (Sequence ID 12), LINC00976 (Sequence ID 13), LINC01657 (Sequence ID 14), LINC01703 (Sequence ID 15), LOC105378269 (Sequence ID 16), LOC101928797 (Sequence ID 17), LINC02271 (Sequence ID 18), MANCR (Sequence ID 19), LINC01801 (Sequence ID 20), LINC01689 (Sequence ID 21), LOC105374516 (Sequence ID 22), LINC01658 (Sequence ID 23), and LINC02411 (Sequence ID 24).

Images