DNA composition and related methods

Abstract

The present disclosure provides, for example, single-stranded covalently closed circular DNA that does not form double-stranded structures longer than 100 base pairs. The ssDNA can code for effector sequences, for example therapeutic proteins. The ssDNA can include nuclear targeting sequences (NTS). In some embodiments, the ssDNA shows reduced activation of the innate immune system compared to otherwise similar dsDNA.

Description

[Technical Field]

[0001] Related applications This application claims priority to U.S. Patent Application No. 63 / 262,690 filed on 18 October 2021, U.S. Patent Application No. 63 / 304,913 filed on 31 January 2022, U.S. Patent Application No. 63 / 373,293 filed on 23 August 2022, and U.S. Patent Application No. 63 / 402,772 filed on 31 August 2022, the entire contents of each of the above applications being incorporated herein by reference. [Background technology]

[0002] Novel treatments are needed to address unmet medical needs. [Overview of the project] [Means for solving the problem]

[0003] Pharmaceutical DNA compositions, constructs, formulations, methods of using such compositions, constructs, and formulations, and methods of preparing them are described herein.

[0004] In some embodiments, the present disclosure provides a pharmaceutical formulation comprising a single-stranded DNA (ssDNA) LNP, wherein the ssDNA (a) encodes a therapeutic protein, (b) is covalently ring-bound, (c) does not form a double-stranded structure longer than 100 base pairs, (d) is longer than 200 nucleotides, and (e) does not contain a protelomerase target sequence; thereby, the pharmaceutical formulation provides a pharmaceutical formulation substantially free of linear DNA and protein. In some embodiments, the ssDNA does not form a double-stranded structure longer than 40 base pairs.

[0005] In some embodiments, the ssDNA includes a promoter sequence that is operably ligated to a sequence encoding a therapeutic polypeptide. In some embodiments, the therapeutic protein is selected from the group consisting of transcription factors, chromatin remodeling factors, antigens, peptides, hormones, enzymes, antibodies, receptor ligands, receptors, coagulation factors, and membrane proteins. In some embodiments, the ssDNA has a GC content of 30-40%, 40-50%, 50-60%, or 60-70%.

[0006] In some embodiments, the ssDNA lacks one or both of the bacteriophage packaging site and / or the bacteriophage replication origin, or the ssDNA does not encode a bacteriophage capsid gene. In some embodiments, the ssDNA was not generated by rolling circle amplification. In some embodiments, the ssDNA was not generated by strand substitution amplification.

[0007] In some embodiments, the ssDNA further comprises a nuclear targeting sequence (NTS). In some embodiments, the ssDNA further comprises a maintenance sequence. In some embodiments, the ssDNA further comprises a second-strand motif (SSM).

[0008] In some embodiments, the ssDNA contains 200 to 3,000 nucleotides. In some embodiments, the ssDNA contains 500 to 2,000 nucleotides. In some embodiments, the ssDNA is a sense ssDNA strand. In some embodiments, the ssDNA is an antisense ssDNA strand.

[0009] In some embodiments, the ssDNA includes at least one nucleotide modification. In some embodiments, the nucleotide modification is 5-formylcytosine.

[0010] In some embodiments, the pharmaceutical formulation is formulated for parenteral administration. In some embodiments, the pharmaceutical formulation is formulated for topical administration. In some embodiments, the pharmaceutical formulation is substantially free of one or more of endotoxin, mononucleotide, modified mononucleotide, and double-stranded DNA.

[0011] In some aspects, the present disclosure provides a method of delivering a therapeutic protein to a subject, the method comprising administering to the subject the pharmaceutical formulation described herein. In some embodiments, the method does not result in substantial integration of the ssDNA into the genome of the subject.

[0012] In one aspect, the invention is a composition, e.g., a pharmaceutical composition, comprising single-stranded DNA (ssDNA) comprising an effector sequence, wherein the single-stranded DNA has one, two, or three of the following properties: the ssDNA is covalently closed circular; the ssDNA does not form a double-stranded structure longer than 100 base pairs; the ssDNA comprises at least one covalent modification.

[0013] In one embodiment, the ssDNA has an effector sequence and one, two, or three of the following: a nuclear targeting sequence (NTS), a maintenance sequence, and a second-strand motif (SSM). In one embodiment, the ssDNA has a DNA effector sequence. In one embodiment, the ssDNA has a DNA effector sequence and an NTS. In one embodiment, the ssDNA has a DNA effector sequence, an NTS, and an SSM. In one embodiment, the ssDNA has a DNA effector sequence, an NTS, an SSM, and a maintenance sequence. In one embodiment, the ssDNA has a DNA effector sequence, an NTS, and a maintenance sequence. In one embodiment, the ssDNA has a DNA effector sequence, an SSM, and a maintenance sequence. In one embodiment, the ssDNA has a promoter operably ligated to a sequence encoding an RNA or protein (peptide or polypeptide) effector. In one embodiment, the ssDNA has a promoter operably ligated to a sequence encoding an RNA or protein (peptide or polypeptide) effector and an NTS. In one embodiment, the ssDNA has a promoter operably ligated to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an NTS, and an SSM. In one embodiment, the ssDNA has a promoter operably ligated to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an NTS, an SSM, and a maintenance sequence. In one embodiment, the ssDNA has a promoter operably ligated to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an NTS, and a maintenance sequence. In one embodiment, the ssDNA has a promoter operably ligated to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an SSM, and a maintenance sequence. In some embodiments, the ssDNA described herein includes an enhancer, for example, an SV40 enhancer. In some embodiments, the ssDNA includes two enhancers. In some embodiments, one or both of the enhancers are SV40 enhancers.In some embodiments, the ssDNA described herein includes NTS, for example, NTS that binds to a transcription factor, for example, NTS that binds to NF-κB, for example, the 3NF sequence. In some embodiments, the ssDNA includes 2, 3, or 4 NTS. In some embodiments, 1, 2, 3, or 4 of the NTS are the 3NF sequence. In some embodiments, the ssDNA described herein includes SMM (e.g., an Anellovirus hairpin). In some embodiments, the ssDNA described herein includes a polyA signal, for example, the bGH polyA signal. In some embodiments, the ssDNA described herein includes a promoter, for example, the EF1a promoter.

[0014] In some embodiments, the enhancer is located upstream of the promoter. The NTS can be located, for example, upstream of the promoter or downstream of the polyA signal. In some embodiments, the SMM (e.g., an Anellovirus hairpin) is located upstream of the promoter.

[0015] In some embodiments, the promoter is located between the enhancer and the effector sequence. In some embodiments, the NTS is located between the SMM (e.g., an Anellovirus hairpin) and the promoter. In some embodiments, the SMM (e.g., an Anellovirus hairpin) is located between the enhancer and the promoter. In some embodiments, the polyA signal is located between the effector sequence and the NTS. In some embodiments, the polyA signal is located between the effector sequence and the enhancer. In some embodiments, the polyA signal is located between the SMM (e.g., an Anellovirus hairpin) and the effector sequence. In some embodiments, the NTS is located between the SMM (e.g., an Anellovirus hairpin) and the polyA signal. In some embodiments, the first NTS sequence is directly adjacent to the second NTS sequence. In some embodiments, the ssDNA described herein includes a series of components arranged as shown in Table 5 herein.

[0016] In one embodiment, the ssDNA has at least 15 nucleotides, at least 30 nucleotides, at least 50 nucleotides, at least 75 nucleotides, 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 10,000 nucleotides, at least 15,000 nucleotides, at least 20,000 nucleotides, at least 25,000 nucleotides, at least 30,000 nucleotides, at least 35,000 nucleotides, at least 40,000 nucleotides, at least 45,000 nucleotides, at least 50,000 nucleotides, at least 60,000 nucleotides, or more.

[0017] In one embodiment, ssDNA consists of 20-1,000 nucleotides, 20-50 nucleotides, 100-500 nucleotides, 500-50,000 nucleotides, 1,000-50,000 nucleotides, 2,000-40,000 nucleotides, 5,000-50,000 nucleotides, 500-50,000 nucleotides, 500-25,000 nucleotides, 1,000-20,000 nucleotides, 1,000-10,000 nucleotides, and 10,000 nucleotides. It has ~60,000 nucleotides, 1,000~20,000 nucleotides, 1,000~40,000 nucleotides, 200~1,000 nucleotides, 200~2,000 nucleotides, 200~3,000 nucleotides, 500~1,000 nucleotides, 500~2,000 nucleotides, 500~3,000 nucleotides, 1,000~2,000 nucleotides, 1,000~3,000 nucleotides, or 2,000~3,000 nucleotides. In some embodiments, the ssDNA contains 20~20,000 nucleotides. In some embodiments, the ssDNA contains 50~50,000 nucleotides.

[0018] In one embodiment, the ssDNA is a sense ssDNA strand. In another embodiment, the ssDNA is an antisense ssDNA strand.

[0019] In some embodiments, the ssDNA includes at least one nucleotide modification, e.g., a covalent nucleotide modification, selected from, for example, N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5fC, f5C); 5-carboxylcytosine (ca5C, 5caC); 5-hydroxymethylcytosine (5hmC, hm5C); 5-methyldeoxycytosine (m5dC); 5-methylcytosine (5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioate; S and R phosphorothioate bond; methylthymine; N3'-P5' phosphoramidate (NP); cyclohexane nucleic acid (CeNA); and tricyclo-DNA (tcDNA). In some embodiments, the ssDNA includes N 6 -Contains methyladenosine. In some embodiments, most of the A position in ssDNA is N 6 -methyladenosine. In some embodiments, the nucleotide modification is a covalent modification selected from phosphothioate; boranophosphate; 1,5-disubstituted triazole; 2'-fluoro-2'deoxynucleoside 5'-triphosphate; and 7-methylguanine; 5-glucosylmethylcytosine.

[0020] In some embodiments, the nucleotide modification is a base modification. In some embodiments, the nucleotide modification is a skeletal modification. In some embodiments, the nucleotide modification is a sugar modification. In some embodiments, the nucleotide modification includes a peptide conjugate. In some embodiments, the nucleotide modification includes a protein conjugate.

[0021] In one embodiment, the effector sequence is a therapeutically functional sequence, such as a functional, structural DNA sequence, such as a DNA aptamer, DNA zyme, or allele-specific oligonucleotide (ASO).

[0022] In one embodiment, the effector sequence is a DNA sequence encoding therapeutic (e.g., regulatory) RNA that is operably ligated to a promoter. In one embodiment, the RNA may be, for example, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, exRNA, scaRNA, Y RNA, or hnRNA.

[0023] In some embodiments, the therapeutically functional sequence includes a promoter sequence operably ligated to a sequence encoding a therapeutic RNA or polypeptide. In some embodiments, the effector sequence is a DNA sequence encoding a therapeutic peptide or polypeptide, operably ligated to the promoter. The therapeutic peptide or polypeptide may be, for example, a DNA-binding protein; an RNA-binding protein; a transporter; a transcription factor; a translation factor; a ribosomal protein; a chromatin remodeling factor; an epigenetic modifier; an antigen; a hormone; an enzyme (nuclease, e.g., endonuclease, e.g., nuclease elements of the CRISPR system, e.g., Cas9, dCas9, Cas9-nickase, Cpf / Cas12a, etc.); a CRISPR linkage enzyme, e.g., a base editor or prime editor; a mobile genetic factor protein (e.g., a transposase, retrotransposase, recombinase, integrase); or a gene writer. writer); polymerase; methylase; demethylase; acetylase; deacetylase; kinase; phosphatase; ligase; dubiquitinase; protease; integrase; recombinase; topoisomerase; gyrase; helicase; lysosomal acid hydrolase; antibodies (e.g., intact antibodies, fragments thereof, or nanobodies); signaling peptides; receptor ligands; receptors; clotting factors; coagulation factors; structural proteins; caspases; membrane proteins; mitochondrial proteins; nucleoproteins; protein scaffolding binders, which may be centintin, darpin, or adnectin.

[0024] In embodiments, the ssDNA may include multiple effector sequences. These multiple effector sequences may be of the same or different types. For example, the ssDNA may include an effector sequence that is structural DNA and a second effector sequence that is a DNA sequence encoding functional RNA or polypeptide. In some embodiments, the ssDNA includes a second effector sequence that is the same as or different from the first effector sequence. The ssDNA may include an effector sequence that is a DNA sequence encoding functional RNA and a second effector sequence that is a DNA sequence encoding a functional polypeptide. The multiple effector sequences may be the same or different sequences of the same type.

[0025] In some embodiments, when ssDNA is introduced into cells, the cells exhibit a smaller increase in cytokine mRNA levels (normalized to, for example, GAPDH mRNA levels) compared to control cells of the same type that have been exposed to dsDNA having the same sequence as the ssDNA in the same molar amount as the ssDNA. In some embodiments, the cytokines include cytokines IFN-β, IL-6, IL-1β, TNF-α, or CXCL10. In some embodiments, the cytokine increase in control cells is less than 50%, 40%, 30%, 20%, or 10% of the cytokine increase in control cells.

[0026] In some embodiments, the ssDNA described herein has an A260 / A280 ratio of 1.6–1.7, 1.7–1.8, or 1.63–1.76. In some embodiments, the ssDNA described herein has an A230 / A260 ratio of 0.3–1, 1–1.5, 1.5–1.8, or 0.34–1.79.

[0027] In this embodiment, the ssDNA is not placed in a carrier; for example, it is formulated for unprotected administration.

[0028] In the embodiment, ssDNA is formulated together with a carrier, for example, a lipid-based carrier, for example, lipid nanoparticles (LNPs). In the embodiment, the pharmaceutical composition further comprises a carrier, for example, a lipid-based carrier, for example, LNPs.

[0029] In some embodiments, the composition containing ssDNA is substantially free of LNPs (e.g., does not contain LNPs). In some embodiments, the composition containing ssDNA is substantially free of lipid-based carriers (e.g., does not contain lipids). In some embodiments, the composition containing ssDNA is substantially free of lipids (e.g., does not contain lipids).

[0030] In this embodiment, ssDNA is formulated together with pharmaceutical excipients.

[0031] In this embodiment, the ssDNA is formulated for parenteral administration.

[0032] In this embodiment, the pharmaceutical composition is formulated for topical administration.

[0033] In the embodiments, the pharmaceutical composition is substantially free of impurities or process by-products selected from the group consisting of, for example, endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, DNA fragments or cuts, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes). In the case of cyclic, for example, covalently closed ssDNA, the pharmaceutical composition is substantially free of linear DNA.

[0034] In any embodiment described herein, the ssDNA may be covalently ring-closed, for example, the ssDNA may be circularized.

[0035] In another embodiment, the present invention includes a method for delivering an effector to a subject, for example, a subject that requires it. This method includes administering a composition described herein, for example, one of the embodiments described above, to the subject. In one embodiment, the subject has a medical condition that can be treated with the effector, or has been diagnosed with such a condition.

[0036] In another embodiment, the present invention includes a method for modulating (e.g., increasing or decreasing) a biological parameter in cells, tissues, or subjects. This method includes administering to a subject a composition described herein, for example, one of the embodiments described above. In the embodiment, the biological parameter is an increase or decrease in the gene expression of a subject gene in target cells, tissues, or subjects, and this increase or decrease is brought about by an effector sequence described herein. In one embodiment, the subject has or has been diagnosed with a condition that can be treated with the effector.

[0037] In another embodiment, the present invention includes a method for treating cells, tissues, or subjects. The method includes administering to cells, tissues, or subjects in need of it an ssDNA or construct as described herein, for example, as described in any of the embodiments above. In one embodiment, the subject has or has been diagnosed with a condition that can be treated with the effector.

[0038] In another embodiment, the present invention is characterized by a method for preparing a pharmaceutical composition comprising ssDNA containing an effector sequence. The method comprises (a) providing or generating a plasmid containing an effector sequence and optionally one or more (e.g., two, three, or four) of promoters, NTSs, SSMs, and maintenance sequences operably linked to the effector sequence; (b) providing or generating ssDNA containing an effector sequence and optionally one or more (e.g., two, three, or four) of promoters, NTSs, SSMs, and maintenance sequences operably linked to the effector sequence using the plasmid as a template; and (c) optionally circularizing the ssDNA.

[0039] In one embodiment, the method includes circularizing the ssDNA (for example, ligating the ends of the ssDNA).

[0040] In the embodiments, the ssDNA is any ssDNA described herein, for example, any of the ssDNA described in any of the embodiments described above.

[0041] In one embodiment, step (a) includes performing a golden gate assembly of the described array elements.

[0042] In one embodiment, the method further comprises (d) enriching or purifying the ssDNA produced in step (b), or the cyclic, for example, covalently cyclized ssDNA produced in step (c).

[0043] In one embodiment, step (d) includes substantially removing from the ssDNA one or more impurities selected from endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, DNA fragments or cuts, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes). In the case of circular, for example, covalently closed ssDNA, linear DNA is removed.

[0044] In one embodiment, the method further comprises formulating the concentrated or purified ssDNA or cyclized ssDNA of step (d) for use as a pharmaceutical, for example, with a pharmaceutically acceptable excipient and / or with a carrier, for example, an LNP, the concentrated or purified ssDNA or cyclized, for example, covalently ring-closed ssDNA.

[0045] In another embodiment, the present invention is characterized by a plasmid comprising the effector sequence described herein and one, two, three, or four of the following elements: promoter, NTS, SSM, and maintenance sequence.

[0046] In some embodiments, the Disclosure relates to a composition (e.g., a pharmaceutical composition) comprising covalently ring-bound single-stranded DNA (ssDNA) including an effector sequence, wherein a) at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, or 98%, or 99% by mass of the total DNA in the composition is covalently ring-bound ssDNA; b) at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, or 98% by mass of the total DNA in the composition. The present invention provides a composition (e.g., a pharmaceutical composition) that is one or more of the following: a) % or 99% of the DNA in the composition is full length; c) less than 10%, 5%, 4%, 3%, 2%, or 1% by mass of the DNA in the composition is double-stranded DNA (dsDNA); d) less than 10%, 5%, 4%, 3%, 2%, or 1% by mass of the DNA in the composition is linear DNA; or e) less than 10%, 5%, 4%, 3%, 2%, or 1% by mass of the DNA in the composition is linear ssDNA.

[0047] In some embodiments, the Disclosure provides compositions (e.g., pharmaceutical compositions) comprising covalently ring-closed single-stranded DNA (ssDNA) including an effector sequence, wherein a) the composition is substantially free of chloroform, e.g., chloroform-free; b) the composition is substantially free of phenol, e.g., phenol-free; c) the composition is substantially free of both phenol and chloroform, e.g., phenol-free; d) the composition is substantially free of organic solvents, e.g., organic solvents; or e) the composition is substantially free of aromatic organic solvents, e.g., organic solvents.

[0048] In some embodiments, the present disclosure provides compositions (e.g., pharmaceutical compositions) comprising covalently ring-closed single-stranded DNA (ssDNA) containing an effector sequence, wherein the ssDNA is produced by a method that does not involve a phenol-chloroform extraction step.

[0049] In some embodiments, the Disclosure provides compositions (e.g., pharmaceutical compositions) comprising covalently ring-closed single-stranded DNA (ssDNA) including an effector sequence, wherein a) the composition is substantially free of exonuclease III (e.g., does not contain); b) the composition is substantially free of T7 exonuclease (e.g., does not contain); or c) the composition is substantially free of T5 exonuclease (e.g., does not contain).

[0050] In some embodiments, the Disclosure provides compositions (e.g., pharmaceutical compositions) comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg of covalently ring-closed single-stranded DNA (ssDNA) containing an effector sequence.

[0051] In some embodiments, the Disclosure provides a composition (e.g., a pharmaceutical composition or a manufacturing intermediate) comprising an effector sequence, a circular double-stranded DNA comprising at least one modified nucleotide, and Nb.BsrDI or Nt.BspQI.

[0052] In some embodiments, the ssDNA is not placed in the carrier. In some embodiments, the composition further comprises a carrier. In some embodiments, the carrier is a lipid-based carrier. In some embodiments, the lipid-based carrier is lipid nanoparticles (LNPs). In some embodiments, the composition is formulated for naked administration. In some embodiments, the composition is formulated for parenteral administration. In some embodiments, the composition is formulated for topical administration. In some embodiments, the composition is substantially free of impurities or by-products selected from the group consisting of endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, DNA fragments or cleavage, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes).

[0053] In some embodiments, the Disclosure provides a method for producing circular ssDNA, a) providing (e.g., generating or obtaining) circular dsDNA such that the circular dsDNA is i) lacking a plasmid backbone; ii) lacking a bacterial origin of replication; iii) lacking a selectable marker, e.g., an antibiotic resistance marker; and / or iv) including chemical modifications, e.g., chemical modifications to sugars, chemical modifications to bases, or chemical modifications to the nucleic acid backbone; and b) introducing a discontinuity in one strand of the circular dsDNA (e.g., introducing a discontinuity in the circular dsDNA). The present invention provides a method comprising: a) contacting a nickel endonuclease that recognizes a recognition site (e.g., Nb.BsrDI, Nb.Bpu10I, or Nt.BspQI) with conditions that allow the nickel endonuclease to cleave the site in the dsDNA, thereby generating discontinuous dsDNA; and c) contacting the discontinuous dsDNA with an exonuclease (e.g., T7 exonuclease or exonuclease III) with conditions that allow for the degradation of the nick strand (e.g., complete degradation), thereby producing circular ssDNA.

[0054] In some embodiments, the Disclosure provides a method for producing circular ssDNA, comprising: a) providing (e.g., generating or obtaining) circular dsDNA; b) contacting the circular dsDNA with a nickeling endonuclease selected from Nb.BsrDI or Nt.BspQI that recognizes nickeling recognition sites in the dsDNA under conditions that allow the nickeling endonuclease to cleave sites in the dsDNA, thereby producing a nickel dsDNA; and c) contacting the nickel dsDNA with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow degradation (e.g., complete degradation) of the nickel strand, thereby producing a circular ssDNA.

[0055] In some embodiments, the Disclosure provides a method for producing circular ssDNA, comprising: a) providing (e.g., generating or obtaining) circular dsDNA; b) introducing a discontinuity into one strand of circular dsDNA (e.g., contacting the circular dsDNA with a nickeling endonuclease that recognizes a nickeling recognition site in the dsDNA (e.g., Nb.BsrDI or Nb.Bpu10I or Nt.BspQI) under conditions that allow the nickeling endonuclease to cleave the site in the dsDNA), thereby producing a nickel dsDNA having a discontinuity; and c) contacting the nickel dsDNA with a T7 exonuclease under conditions that allow for the degradation (e.g., complete degradation) of the nickel strand, thereby producing circular ssDNA.

[0056] In some embodiments, the Disclosure provides a method for producing circular ssDNA, comprising: a) providing (e.g., generating or obtaining) circular dsDNA; b) introducing a discontinuity into one strand of circular dsDNA (e.g., contacting the circular dsDNA with a nickeling endonuclease that recognizes nickeling recognition sites in the dsDNA (e.g., Nb.BsrDI or Nb.Bpu10I or Nt.BspQI) under conditions that allow the nickeling endonuclease to cleave sites in the dsDNA), thereby producing a nick dsDNA having a discontinuity; c) contacting the nick dsDNA with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow degradation of the nick strand (e.g., complete degradation), thereby producing circular ssDNA; and d) performing gel purification of the circular ssDNA.

[0057] In some embodiments, the circular dsDNA includes i) a plasmid backbone; ii) a bacterial origin of replication; iii) a selectable marker, e.g., an antibiotic resistance marker; and / or iv) chemical modifications, e.g., chemical modifications to sugars, chemical modifications to bases, or chemical modifications to the nucleic acid backbone.

[0058] In some embodiments, the method involves contacting circular dsDNA with a nickeling endonuclease selected from Nb.BsrDI or Nt.BspQI that recognizes nickeling recognition sites in the dsDNA, under conditions that allow the nickeling endonuclease to cleave sites in the dsDNA, thereby generating a nickel dsDNA. In some embodiments, the method involves contacting the nickel dsDNA with a T7 exonuclease under conditions that allow degradation (e.g., complete degradation) of the nickel strand. In some embodiments, the method involves performing gel purification of the circular ssDNA.

[0059] In some embodiments, the method comprises generating circular dsDNA, which means (i) providing a nucleic acid (e.g., plasmid) containing an effector sequence; and (ii) performing PCR to amplify a region of the nucleic acid (e.g., plasmid) containing the effector sequence, wherein performing PCR means contacting the plasmid with a first primer containing a first endonuclease recognition site and a second primer containing a second endonuclease recognition site and a nickeling recognition site, such that the first and second primers are positioned in the plasmid at a location suitable for amplifying the effector sequence (and optionally not amplifying the plasmid backbone), and then transferring the plasmid to a DNA-dependent DNA polymerase (e.g., high-fidelity polymerase). (iii) performing PCR, which includes contacting (for example, Q5) and applying thermal cycling conditions sufficient to amplify a region of nucleic acid containing an effector sequence, thereby generating linear dsDNA; (iv) digesting the linear dsDNA with an endonuclease that cleaves the endonuclease recognition site (e.g., BsaI, KpnI, or NheI), thereby generating digested linear DNA; (iv) circularizing the digested linear dsDNA (e.g., by contacting the digested linear dsDNA with a ligase, e.g., T4 ligase); and (v) digesting the remaining linear DNA by contacting a composition containing the digested linear dsDNA with an exonuclease (e.g., T5 exonuclease).

[0060] In some embodiments, the method includes one or more purification steps, such as gel purification or the use of a DNA purification column. In some embodiments, the purification step is carried out on linear dsDNA; digested linear dsDNA; circular dsDNA; or circular ssDNA. In some embodiments, the method does not include an organic extraction step (e.g., a phenol-chloroform extraction step).

[0061] In some embodiments, the method involves contacting the nicked dsDNA with an exonuclease (e.g., T7 exonuclease) for 15 to 120 minutes, for example, 20 to 60 minutes, for example, about 30 minutes. In some embodiments, introducing a discontinuity into one strand of circular dsDNA involves introducing a nick between two adjacent nucleotides. In some embodiments, introducing a discontinuity into one strand of circular dsDNA involves removing a nucleotide, for example, where the nucleotide is uracil.

[0062] In some embodiments, the present disclosure provides a method for evaluating a sample of a composition containing ssDNA, comprising determining whether the following conditions are met: a) at least 70%, 80%, 85%, 90%, 95%, 97%, or 98%, or 99% of the total DNA in the composition is covalently ring-closed ssDNA; b) at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total DNA in the composition is full length; c) less than 10%, 5%, 4%, 3%, 2%, or 1% of the DNA in the composition is double-stranded DNA (dsDNA); d) less than 10%, 5%, 4%, 3%, 2%, or 1% of the DNA in the composition is linear DNA; e) the mass of the DNA in the composition The present invention provides a method selected from the following: f) the composition is substantially free of chloroform, e.g., g) the composition is substantially free of phenol, e.g., g) the composition is substantially free of phenol and chloroform, e.g., g) the composition is substantially free of both phenol and chloroform, e.g., g) the composition is substantially free of organic solvents, e.g., g) the composition is substantially free of aromatic organic solvents, e.g., g) the composition is substantially free of exonuclease III (e.g., g) the composition is substantially free of T7 exonuclease (e.g., g) the composition is substantially free of T5 exonuclease (e.g., g). In some embodiments, if conditions are met, the method includes carrying out downstream processing steps in the composition, optionally being selected from dividing the composition into parts, packaging the composition, labeling the composition, transporting the composition, distributing the composition, storing the composition, or launching the composition. In some embodiments, the method includes evaluating a sample of the composition disclosed herein. In some embodiments, the method includes evaluating a sample of the composition prepared by the method disclosed herein.

[0063] In some embodiments, the ssDNA includes chemical modifications, such as chemical modifications to sugars, chemical modifications to bases, or chemical modifications to the nucleic acid backbone. In some embodiments, the ssDNA is not a bacteriophage genome. In some embodiments, the ssDNA lacks a bacteriophage packaging site. In some embodiments, the ssDNA lacks a bacteriophage replication origin. In some embodiments, the ssDNA does not encode a bacteriophage capsid gene. In some embodiments, the ssDNA was not generated by rolling circle amplification. In some embodiments, the ssDNA was not generated by strand substitution amplification. In some embodiments, the ssDNA does not contain a protelomerase target sequence. In some embodiments, the ssDNA does not contain a hairpin structure. In some embodiments, the ssDNA does not contain a first sequence that hybridizes with a second sequence, where the first and second sequences are at least 5 nt in length and the first and second sequences are located less than 6 nucleotides apart from each other. In some embodiments, the ssDNA does not contain double-stranded origin (DSO).

[0064] In some embodiments, the chemical modification is a covalent modification selected from 5-formylcytosine; phosphorothioate; 7-methylguanine; and 5-glucosylmethylcytosine.

[0065] definition As used herein, the term “antibody” refers to a molecule that specifically binds to or is immunologically reactive with a particular antigen and comprises at least a variable domain of the heavy chain, and typically at least variable domains of the heavy and light chains of an immunoglobulin. Antibodies and their antigen-binding fragments, variants, or derivatives include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primated, or chimeric antibodies, heteroconjugate antibodies (e.g., bispecific, tripspecific, and quadruplespecific antibodies, diabody, triabody, and tetrabody), single-domain antibodies (sdAb), epitope-binding fragments, e.g., Fab, Fab', and F(ab')2, Fd, Fvs, single-chain Fvs(scFv), rlgG, single-chain antibodies, disulfide-bound Fvs(sdFv), fragments containing any of the VL or VH domains, fragments produced by Fab expression libraries, and anti-idiotype (anti-Id) antibodies. The antibody molecules of the present invention may be any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecules. Furthermore, unless otherwise specified, the term “monoclonal antibody” (mAb) means including both an intact molecule capable of specifically binding to a target protein and antibody fragments (e.g., Fab and F(ab')2 fragments). Fab and F(ab')2 fragments lack the Fc fragment of the intact antibody.

[0066] As used herein, the term “bacteriophage packaging site” refers to a nucleic acid sequence in a bacteriophage genome sufficient to direct packaging to a virion. Bacteriophage packaging sites may originate, for example, from bacteriophages P1, T4, T7, or λ.

[0067] As used herein, the term “carrier” means a compound, composition, reagent, or molecule that facilitates or promotes the transport or delivery of a composition (e.g., ssDNA as described herein) into a cell. For example, a carrier may be a mounting agent, partially or completely.

[0068] As used herein, the term “circular” in relation to ssDNA as described herein means ssDNA lacking free ends. Circular ssDNA may be covalently circumferred or may form a circumferential structure without free DNA ends through non-covalent interactions. For example, ssDNA may be closed to form a DNA structure via sprints, e.g., nucleic acid (e.g., DNA or RNA) sprints, via portions such as proteins that bind to both ends of linear ssDNA and bring them together, or via the binding of multiple proteins (each of which binds to a different ssDNA end and then to each other or to a third portion). The term “circular” does not imply an ssDNA structure lacking a circular physical form or intramolecular structure; circular ssDNA may have intramolecular double-stranded regions or regions of other structures.

[0069] As used herein, the term "covalently ring-bound" in relation to ssDNA means that ssDNA is a continuous strand lacking a free 5' or 3' end.

[0070] As used herein, the term “exonuclease III” refers to the protein exonuclease III encoded by the Escherichia coli (E. coli) genome, or a fragment or variant thereof, which catalyzes the removal of nucleotides from the 3' end of DNA, for example, at terminals or nicks in DNA. In some embodiments, exonuclease III has an amino acid sequence represented by the NCBI reference sequence NP_416263.1 (which is incorporated herein by reference in its entirety), or a sequence having at least 75%, 80%, 85%, 90%, 95%, or 98% identity thereto.

[0071] As used herein, the term “T5 exonuclease” refers to a protein encoded by the D15 gene of a T5 bacteriophage, or a fragment or variant thereof, that catalyzes the removal of a nucleotide from the 5' end of DNA, for example, at the terminal or nick in DNA. In some embodiments, the T5 exonuclease has an amino acid sequence represented by the NCBI reference sequence YP_006958.1, or a sequence having at least 75%, 80%, 85%, 90%, 95%, or 98% identity thereto.

[0072] As used herein, the term “T7 exonuclease” refers to a protein encoded by gene 6 of the T7 bacteriophage, or a fragment or variant thereof, that catalyzes the removal of a nucleotide from the 5' end of DNA, for example, at the terminal or nick in DNA. In some embodiments, the T7 exonuclease has an amino acid sequence represented by the NCBI reference sequence NP_041988.1, or a sequence having at least 75%, 80%, 85%, 90%, 95%, or 98% identity thereto.

[0073] As used herein, the term “heterogeneous” means, when used to describe a first element in relation to a second element, that the first and second elements do not exist in nature in the configuration described. For example, heterogeneous polypeptide, nucleic acid molecule, construct or sequence means (a) a polypeptide, nucleic acid molecule or a portion of a polypeptide or nucleic acid molecule sequence that is not specific to the cell in which it is expressed, (b) a polypeptide or nucleic acid molecule or a portion of a polypeptide or nucleic acid molecule that is modified or mutated compared to its native state, or (c) a polypeptide or nucleic acid molecule that has a modified expression compared to its native expression level under similar conditions. For example, heterogeneous regulatory sequences (e.g., promoters, enhancers) may be used to regulate a gene or nucleic acid molecule in a manner different from how the gene or nucleic acid molecule is normally expressed in nature. In another example, a heterogeneous domain of a polypeptide or nucleic acid sequence (e.g., a DNA-binding domain of a polypeptide or a nucleic acid encoding a DNA-binding domain of a polypeptide) may be positioned relative to other domains, or may be a different sequence or originate from a different source compared to other domains or portions of the polypeptide or its coding nucleic acid. In certain embodiments, heterologous nucleic acid molecules may be present in the native host cell genome, but may have modified expression levels, different sequences, or both. In other embodiments, heterologous nucleic acid molecules may not be endogenous to the host cell or host genome, but instead may be introduced into the host cell by transformation (e.g., transfection, electroporation), where the added molecule may be integrated into the host genome, or may exist as extrachromosomal genetic material, either transiently (e.g., mRNA) or semi-stable for two or more generations (e.g., episomal viral vector, plasmid, or other self-replicating vector).

[0074] As used herein, the terms “increase” and “decrease” refer to modifications that result in an increase or decrease in the amount of an indicator of function, expression, or activity compared to a reference, respectively. For example, after administration of ssDNA in the methods described herein, the amount of an indicator described herein (e.g., gene expression level, or marker of innate immunity) may increase or decrease in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% or more compared to the amount of the marker before administration, such as modified ssDNA compared to unmodified sDNA, or compared to administration of control ssDNA. Generally, the indicator is measured after administration, at the point when the administration has had the listed effects, for example, at least 1 day, 1 week, 1 month, 3 months, or 6 months after the start of the treatment regimen.

[0075] As used herein, the term “intramolecular complementarity” refers to the ability of two regions within a single DNA strand to hybridize via complementary base pairs and / or form a double-stranded structure. Depending on how close the self-complementary sequence portions are, ssDNA may form, for example, hairpin loops, junctions, bulges, or internal loops.

[0076] As used herein, the term “linear” means DNA containing two free ends when used to describe DNA. Linear DNA may be single-stranded or double-stranded.

[0077] As used herein, the term “maintenance sequence” refers to a DNA sequence or motif that enables or facilitates the retention of a DNA molecule in the nucleus during cell division. Maintenance sequences typically enable the replication and / or transcription of DNA in the nucleus by interacting with proteins that facilitate chromatin looping. An example of a maintenance sequence is a scaffold / matrix-binding region (S / MAR element).

[0078] As used herein, “nuclear targeting sequence” is a DNA sequence that enables or facilitates DNA entry into the nucleus of a target cell.

[0079] As used herein, “nicking recognition site” refers to a DNA sequence that is specifically recognized and cleaved by a nicking endonuclease.

[0080] As used herein, “pharmaceutical composition” or “pharmaceutical preparation” means a composition or preparation adapted for use as a medicine for human use, for example, for preventive, diagnostic or therapeutic purposes for human use. A pharmaceutical preparation includes an active agent that, in combination with pharmaceutically acceptable excipients or diluents, has a biological effect on the cells or tissues of interest, for example, pharmacological activity or effect in the alleviation, treatment or prevention of disease. A pharmaceutical composition also means a finished dosage form or preparation of a preventive, diagnostic or therapeutic composition.

[0081] As used herein, the term “second strand motif” or SSM refers to a sequence or structural motif in ssDNA that promotes or enables second strand synthesis. An SSM may contain a binding site for a protein that initiates second strand DNA synthesis and / or positions the DNA in a suitable orientation for DNA polymerase binding.

[0082] As used herein, a “sense strand” ssDNA sequence is an ssDNA sequence that has the same sequence as the mRNA encoding the functional protein and does not function as a template for transcription. An “antisense strand” ssDNA sequence has a sequence complementary to the mRNA encoding the functional protein and / or may function as a template for transcription.

[0083] As used herein, the term “single-stranded DNA” or ssDNA means a DNA molecule consisting of a single strand of deoxyribonucleotides. ssDNA may have paired self-complementary regions that form intramolecular / intra-strand double-stranded motifs in its folded structure. Depending on how closely the self-complementary sequence portions are related, ssDNA may form, for example, hairpin loops, junctions, bulges, or internal loops.

[0084] As used herein, “treatment” and “to treat” refer to targeted medical treatment intended to improve, enhance, stabilize (i.e., prevent exacerbation), prevent or cure a disease, condition, or disorder. The term includes active treatment (treatment aimed at improving a disease, condition, or disorder), causal treatment (treatment aimed at the cause of the associated disease, condition, or disorder), palliative care (treatment aimed at reducing symptoms), preventive treatment (treatment aimed at minimizing or partially or completely suppressing the onset of the associated disease, condition, or disorder); and supportive care (treatment used to complement another treatment). Treatment also includes, whether detectable or undetectable, reduction in the degree of the disease or condition; prevention of the progression of the disease or condition; delay or slowing the progression of the disease or condition; improvement or relief of the disease or condition; and remission (whether partial or complete). To “improve” or “alleviate” a disease or condition means that the severity of the disease, disability, or condition and / or undesirable clinical symptoms are reduced and / or the progression of the disease or condition is delayed or prolonged compared to the degree or course of the condition if left untreated. “Treatment” may also mean prolonging survival compared to the predicted survival if left untreated. Those who require treatment include those who already have a condition or disability, as well as those who are susceptible to the condition or disability or who wish to prevent the condition or disability. [Brief explanation of the drawing]

[0085] [Figure 1-1]These are a series of diagrams illustrating the exemplary ssDNA designs described herein. (Figure 1A) Shows an ssDNA construct containing multiple effector DNA sequence types, in this case miRNA and a model protein (mCherry), operably ligated to the EF1a promoter. (Figure 1B) Shows an ssDNA construct containing sequences encoding the promoter and a polypeptide effector (in this case, the model protein mCherry). [Figure 1-2] These are a series of diagrams illustrating exemplary ssDNA designs described herein. (Figure 1C) Shows an ssDNA construct including a nuclear targeting sequence, a promoter, and a sequence encoding an RNA effector. (Figure 1D) Shows an ssDNA construct including a promoter, a polypeptide encoding sequence, and a second-strand motif. (Figure 1E) Shows an ssDNA construct including a promoter, a maintenance sequence, and a second-strand motif operably ligated to a nuclear targeting sequence and a polypeptide encoding sequence. [Figure 2] This is a schematic diagram of an exemplary production process for circular ssDNA as described herein. [Figure 3] These are a series of traces obtained using a Fragment Analyzer for the blank well (Figure 3), the construct 029 circular ssDNA preparation (Figure 4), the construct 029 circular dsDNA (Figure 5), the construct 001 circular dsDNA (Figure 6), the construct 001 circular ssDNA preparation #1 (Figure 7), and the construct 001 circular ssDNA preparation #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 4] These are a series of traces obtained using a Fragment Analyzer for the blank well (Figure 3), the construct 029 circular ssDNA preparation (Figure 4), the construct 029 circular dsDNA (Figure 5), the construct 001 circular dsDNA (Figure 6), the construct 001 circular ssDNA preparation #1 (Figure 7), and the construct 001 circular ssDNA preparation #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 5]These are a series of traces obtained using a Fragment Analyzer for the blank well (Figure 3), the construct 029 circular ssDNA preparation (Figure 4), the construct 029 circular dsDNA (Figure 5), the construct 001 circular dsDNA (Figure 6), the construct 001 circular ssDNA preparation #1 (Figure 7), and the construct 001 circular ssDNA preparation #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 6] These are a series of traces obtained using a Fragment Analyzer for the blank well (Figure 3), the construct 029 circular ssDNA preparation (Figure 4), the construct 029 circular dsDNA (Figure 5), the construct 001 circular dsDNA (Figure 6), the construct 001 circular ssDNA preparation #1 (Figure 7), and the construct 001 circular ssDNA preparation #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 7] These are a series of traces obtained using a Fragment Analyzer for the blank well (Figure 3), the construct 029 circular ssDNA preparation (Figure 4), the construct 029 circular dsDNA (Figure 5), the construct 001 circular dsDNA (Figure 6), the construct 001 circular ssDNA preparation #1 (Figure 7), and the construct 001 circular ssDNA preparation #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 8] These are a series of traces obtained using a Fragment Analyzer for the blank well (Figure 3), the construct 029 circular ssDNA preparation (Figure 4), the construct 029 circular dsDNA (Figure 5), the construct 001 circular dsDNA (Figure 6), the construct 001 circular ssDNA preparation #1 (Figure 7), and the construct 001 circular ssDNA preparation #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 9] This trace is obtained when 7.8 pg of construct 001 circular dsDNA is added to 1 ng of construct 001 circular ssDNA. The peak corresponding to the circular dsDNA is indicated by the arrow. [Figure 10]A series of DNA gel electrophoresis images are shown. Figure 10A is an image of a DNA gel containing a DNA ladder (lane 1) and nick DNA (lane 2). The size of the nick DNA construct is indicated by the arrow. Figure 10B is an image of a DNA gel containing a DNA ladder (lane 1) and nick DNA incubated with T7 exonuclease at 25°C for 16 hours (lane 2), 1 hour (lane 3), and 30 minutes (lane 4). The size of the ssDNA construct is indicated by the arrow. [Figure 11] These are DNA gel electrophoresis images showing circular ssDNA and linear ssDNA incubated in the absence (-) and presence (+) of exonuclease I. The circular ssDNA preparation was resistant to degradation by exonuclease I, while the linear ssDNA was degraded in the presence of exonuclease I. [Figure 12A] This is a series of graphs showing the expression of circular ssDNA constructs in HEK293 (Figure 12A), HepG2 (Figure 12B), U2OS (Figure 12C), and HEKa cells (Figure 12D). Details of the circular ssDNA constructs are shown in Table 5. The x-axis represents the percentage of reporter (mCherry)-positive cells, and the y-axis represents the fluorescence intensity of cells normalized to the expression of construct 001 plasmid. "C1" corresponds to construct 001, "C2" corresponds to construct 002, and so on. [Figure 12B] Same as above [Figure 12C] Same as above [Figure 12D] Same as above [Figure 13] This is a series of graphs showing the percentage of HEKa cells expressing mCherry after lipofection with construct 001. Construct 001 is generated as circular ssDNA and circular dsDNA, and the relative molar concentration of ssDNA or dsDNA is shown (e.g., 1x, 2x, or 4x). Figure 13A shows the percentage of HEKa cells expressing mCherry 3 days after lipofection, and Figure 13B shows the average percentage of mCherry+ cells at 6 hours, 1 day, and 3 days after transfection. [Figure 14]This is a series of graphs showing mRNA levels of IFNβ (Figure 14A), IL-6 (Figure 14B), CXCL10 (Figure 14C), TNFα (Figure 14D), and IL1B (Figure 14E) in HEKa cells after lipofection with construct 001. Construct 001 is generated as circular ssDNA and circular dsDNA, and the relative molar concentrations of ssDNA or dsDNA are shown (e.g., 1x, 2x, or 4x). mRNA levels are normalized to a lipofectamine-only control, and mRNA levels are shown compared to GAPDH. [Figure 15] This graph shows the percentage of mCherry+ cells after transfection with two constructs: unmodified single-stranded circular DNA and single-stranded circular DNA with m6A(N6-methyladenosine)DNA modification. [Figure 16] The secondary structure prediction of the circular single-stranded DNA morphology of construct 001 is shown. Construct 001 has the following sequence: [ka] [Modes for carrying out the invention]

[0086] This disclosure relates, for example, to compositions and methods for providing effectors, such as therapeutic effectors, to cells, tissues, or subjects in vivo or in vitro. The effectors may be DNA sequences, polypeptides, such as therapeutic proteins; or RNA, such as regulatory RNA or mRNA.

[0087] Elements of DNA constructs The ssDNA constructs described herein contain elements sufficient to deliver an effector sequence to a target cell, tissue, or object. In some embodiments, the effector sequence is a DNA sequence. In some embodiments, the ssDNA includes, for example, a promoter and a sequence encoding RNA or polypeptide, such as therapeutic RNA or polypeptide, which drives the expression of the effector. In some embodiments, the DNA constructs described herein further include one or more of a nuclear targeting sequence, a maintenance sequence, and a second-strand motif.

[0088] promoter The ssDNA constructs described herein may contain a promoter (a DNA sequence to which RNA polymerases and transcription factors directly or indirectly bind in order to initiate transcription) operably ligated to an effector sequence. The promoter may be operably ligated to an effector sequence and be naturally occurring or heterologous to the effector sequence. The promoters described herein may be specific to a target cell or tissue or heterologous to a target cell or tissue. The promoter may be constitutive, inducible, and / or tissue-specific.

[0089] Examples of constitutive promoters include the retroviral Roussarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (e.g., Boshart et al, Cell, 41:521-530 (see 1985)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter.

[0090] Inducible promoters allow for the regulation of expression, which can be controlled by externally supplied compounds, environmental factors such as temperature, or specific physiological conditions, such as the presence of an acute phase or a specific differentiation state of the cell, or only within replicating cells. Inducible promoters and inducible systems are available from a variety of sources. Examples of inducible promoters regulated by externally supplied promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary cancer virus (MMTV) promoter, the T7 polymerase promoter system (International Publication No. 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)); the tetracycline suppression system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)); and the tetracycline inducible system (Gossen et al., Science, 268:1766-1769 (1995), Harvey et al. Examples include the RU486-inducible system (see also al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)).

[0091] In some embodiments, a natural promoter of an effector-coding sequence may be used. Other natural expression regulatory elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, may also be used.

[0092] In some embodiments, regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, α-myosin heavy chain (α-MHC) promoter, or cardiac troponin T (cTnT) promoter. Other exemplary promoters, among those known to those skilled in the art, include the β-actin promoter, hepatitis B virus core promoter (Sandig et al., Gene Ther., 3:1002-9 (1996)); α-fetoprotein (AFP) promoter (Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)); bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)); and CD2 promoter (Hansal et al. Examples include: al., J.Immunol., 161:1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor α-chain promoter; and for nerve cells, such as the neuron-specific enolase (NSE) promoter (Andersen et al., Cell.Mol.Neurobiol., 13:503-15 (1993)), the neurofilament light chain gene promoter (Piccioli et al., Proc.Natl.Acad.Sci.USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)).

[0093] Examples of tissue / cell-specific promoters are listed in Table 1:

[0094] [Table 1-1]

[0095] [Table 1-2]

[0096] Effector layout The effector sequences of the ssDNA constructs described herein may be, for example, functional DNA sequences, such as therapeutically functional DNA sequences; DNA sequences encoding therapeutic peptides, polypeptides, or proteins; DNA sequences encoding therapeutic RNA (e.g., non-coding RNA); or DNA templates for genomic manipulation, and may be used in combination with gene editors, base editors, prime editors, gene writers, or mobile genetic factor proteins.

[0097] DNA Effector: A therapeutically functional DNA sequence may be a DNA sequence that forms a functional structure, such as a DNA aptamer, a DNA zyme, or a DNA sequence containing an allele-specific oligonucleotide (DNA ASO). A therapeutically functional DNA sequence may not have a promoter that is operably ligated. In embodiments, the ssDNA constructs or sequences described herein may include one or more functional DNA sequences, such as 2, 3, 4, 5, 6, or more sequences, which may be the same or different.

[0098] Polypeptide effector: A DNA sequence encoding a therapeutic polypeptide may be a DNA sequence encoding one or more effectors, which are peptides, proteins, or combinations thereof. For example, the DNA sequence may encode mRNA. Peptides or proteins may include transcription factors; chromatin remodeling factors; antigens; hormones; enzymes (nucleases, e.g., endonucleases, e.g., nuclease elements of the CRISPR system, e.g., Cas9, dCas9, Cas9-nickase, Cpf / Cas12a, etc.); CRISPR ligases, e.g., base editors or prime editors; mobile genetic factor proteins (e.g., transposases, retrotransposases, recombinases, integrases); gene writers; polymerases; methylases; demethylases; acetylases; deacetylases; kinases; phosphatases; ligases; dubiquitinases; integrases; recombinases; topoisomerases; gyrases; helicases; lysosomal acid hydrolases); antibodies; receptor ligands; receptors; coagulation factors; membrane proteins; mitochondrial proteins; nucleoproteins; and antibody or other protein scaffolding binders, e.g., centinrin, darpin, or adnectin. For example, see Gebauer & Skerra. 2020. Annual Review of Pharmacology and Toxicology 60:1,391-415.

[0099] In embodiments, the ssDNA constructs or sequences described herein may include one or more sequences encoding polypeptides, for example, two, three, four, five, six, or more sequences encoding polypeptides. Each of these sequences may encode the same or different proteins. For example, the ssDNA constructs or sequences described herein may include multiple sequences encoding multiple proteins, for example, multiple proteins in a biological pathway.

[0100] In some embodiments, the ssDNA constructs or sequences described herein may comprise multiple sequences encoding polypeptides, e.g., two, three, four, five, six, or more sequences encoding polypeptides, separated by self-cleaving peptides, e.g., P2A, T2A, E2A, or F2A. The self-cleaving peptides are 18 to 22 amino acids long and can induce ribosome skipping during protein translation so that two polypeptides can be encoded in the same transcript. Each polypeptide may encode the same or different proteins. In one embodiment, the ssDNA constructs or sequences described herein may comprise a promoter, followed by a sequence encoding the first polypeptide of interest, a sequence encoding the 2A self-cleaving peptide, a sequence encoding the second polypeptide of interest, and a poly-A tail. In another embodiment, the ssDNA construct or sequence described herein may comprise a promoter, followed by a sequence encoding the first polypeptide of interest, a sequence encoding the first 2A self-cleaving peptide, a sequence encoding the second polypeptide of interest, a sequence encoding the second 2A self-cleaving peptide, a sequence encoding the third polypeptide of interest, and a poly-A tail.

[0101] RNA effector: The effector sequence may be a DNA sequence that codes for one or more non-coding RNAs, such as small interfering RNA (siRNA), microRNA (miRNA), long non-coding RNA, piwi-interacting RNA (piRNA), nucleolar small RNA (snoRNA), Cajal small RNA-specific RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), RNA aptamer, and nuclear small RNA (snRNA).

[0102] In some embodiments, the ssDNA constructs or sequences disclosed herein include one or more expression sequences encoding regulatory RNA, such as RNA that modifies the expression of endogenous and / or exogenous genes. In some embodiments, the ssDNA constructs or sequences disclosed herein may include, but are not limited to, sequences that are antisense to regulatory nucleic acids such as non-coding RNAs such as tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA. In one embodiment, the regulatory nucleic acid targets a host gene. The regulatory nucleic acid may include, but is not limited to, endogenous genes, such as antisense RNA, nucleic acids that hybridize to guide RNA, nucleic acids that hybridize to exogenous nucleic acids such as viral DNA or RNA, nucleic acids that hybridize to RNA, nucleic acids that interfere with gene transcription, nucleic acids that interfere with RNA translation, nucleic acids that stabilize or destabilize RNA by targeting for degradation, and nucleic acids that modulate DNA or RNA binding factors. In one embodiment, the sequence is a miRNA. In some embodiments, the regulatory nucleic acid targets the sense strand of the host gene. In some embodiments, the regulatory nucleic acid targets the antisense strand of the host gene.

[0103] In some embodiments, the ssDNA constructs or sequences disclosed herein encode guide RNA. Guide RNA sequences are generally 15–30 nucleotides long (e.g., 17, 19, 20, 21, 24 nucleotides) and are designed to be complementary to the target nucleic acid sequence. Custom gRNA generators and algorithms are commercially available for use in designing effective guide RNAs. Gene editing has also been achieved using chimeric “single guide RNA” (“sgRNA”), which are engineered (synthetic) single RNA molecules that mimic the naturally occurring crRNA-tracrRNA complex and contain both tracrRNA (for nuclease binding) and at least one crRNA (for inducing the nuclease to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective for genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol., 985–991. gRNAs can recognize specific DNA sequences (e.g., sequences adjacent to or within the range of a gene's promoter, enhancer, silencer, or repressor). In one embodiment, gRNAs are used as part of a CRISPR system for gene editing. For gene editing, the ssDNA constructs or sequences disclosed herein may be designed to include one or more sequences encoding guide RNA sequences corresponding to a desired target DNA sequence; see, for example, Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308.

[0104] The disclosed ssDNA constructs or sequences may encode specific regulatory nucleic acids that can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules typically include RNA or RNA-like structures containing 15–50 base pairs (e.g., about 18–25 base pairs) and having a nucleic acid base sequence that is identical (complementary) or nearly identical (substantially complementary) to the coding sequence in a target gene expressed in a cell. Such RNAi molecules include, but are not limited to, small interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), microRNAs (miRNAs), short hairpin RNAs (shRNAs), meroduplexes, and Dicer substrates (US Patent Nos. 8,084,599, 8,349,809, and 8,513,207), and RNA antisense oligonucleotides (RNA ASOs).

[0105] In one embodiment, the ssDNA construct or sequence disclosed herein includes a sequence comprising the sense strand of an lncRNA. In one embodiment, the ssDNA construct or sequence disclosed herein includes a sequence encoding the antisense strand of an lncRNA.

[0106] The ssDNA constructs or sequences disclosed herein may encode regulatory nucleic acids that are substantially or fully complementary to a fragment of an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acid may complement the sequence at the boundaries between introns and exons, between exons, or adjacent to exons to prevent the maturation of a newly generated nuclear RNA transcript of a particular gene into mRNA for transcription. A regulatory nucleic acid complementary to a particular gene may hybridize with the mRNA for that gene and prevent its translation. The antisense regulatory nucleic acid may be DNA, RNA, or derivatives or hybrids thereof. In some embodiments, the regulatory nucleic acid includes a protein-binding site that can bind to a protein involved in regulating the expression of an endogenous or exogenous gene.

[0107] The lengths of the ssDNA constructs or sequences disclosed herein that can encode a regulatory nucleic acid to hybridize to a target transcript may be about 5 to 30 nucleotides, about 10 to 30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the regulatory nucleic acid to the target transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0108] The ssDNA constructs or sequences disclosed herein may encode a microRNA (miRNA) molecule identical to about 5 to about 30 consecutive nucleotides of a target gene. In some embodiments, the miRNA sequence targets mRNA, begins with dinucleotide AA, contains about 30–70% (about 30–60%, about 40–60%, or about 45–55%) GC content, and does not have a high percentage identity to any other nucleotide sequence in the mammalian genome into which it is introduced, as determined, for example, by a standard BLAST search. In some embodiments, the ssDNA constructs or sequences disclosed herein encode at least one miRNA, e.g., 2, 3, 4, 5, 6, or more. In some embodiments, the ssDNA constructs or sequences disclosed herein include sequences encoding miRNAs having at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with respect to any one of the nucleotide sequences, or sequences complementary to the target sequence. Lists of known miRNA sequences can be found, among other things, in databases maintained by research institutions such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, the Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory. Known effective siRNA sequences and homobinding sites are also well documented in the relevant literature. RNAi molecules can be readily designed using techniques known in the art. Furthermore, there are computational tools that increase the chances of discovering effective and specific sequence motifs (see, for example, Lagana et al., Methods Mol. Bio., 2015, 1269:393-412).

[0109] The ssDNA constructs or sequences disclosed herein can regulate the expression of RNA encoded by a gene. Since multiple genes may share some degree of sequence homology with one another, in some embodiments, the ssDNA constructs or sequences disclosed herein may be designed to target a class of genes with sufficient sequence homology. In some embodiments, the ssDNA constructs or sequences disclosed herein may contain sequences that are complementary to sequences shared between different gene targets or unique to a particular gene target. In some embodiments, the ssDNA constructs or sequences disclosed herein may target conserved regions of RNA sequences that are homologous between several genes, thereby being designed to target several genes in a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the ssDNA constructs or sequences disclosed herein may be designed to target sequences unique to a specific RNA sequence of a single gene.

[0110] In one embodiment, the effector sequence encoding the regulatory RNA has a length of less than 5000 bps (for example, about 5000 bps, 4000 bps, 3000 bps, 2000 bps, 1000 bps, 900 bps, 800 bps, 700 bps, 600 bps, 500 bps, 400 bps, 300 bps, 200 bps, 100 bps, 50 bps, 40 bps, 30 bps, 20 bps, less than 10 bps, or less). In some embodiments, the effector array may, independently or in addition, have a bitrate greater than 10 bps (e.g., at least about 10 bps, 20 bps, 30 bps, 40 bps, 50 bps, 60 bps, 70 bps, 80 bps, 90 bps, 100 bps, 200 bps, 300 bps, 400 bps, 500 bps, 600 bps, 700 bps, 800 bps, 900 bps, 1000 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb). It has a length of 1.7kb, 1.8kb, 1.9kb, 2kb, 2.1kb, 2.2kb, 2.3kb, 2.4kb, 2.5kb, 2.6kb, 2.7kb, 2.8kb, 2.9kb, 3kb, 3.1kb, 3.2kb, 3.3kb, 3.4kb, 3.5kb, 3.6kb, 3.7kb, 3.8kb, 3.9kb, 4kb, 4.1kb, 4.2kb, 4.3kb, 4.4kb, 4.5kb, 4.6kb, 4.7kb, 4.8kb, 4.9kb, 5kb or more.

[0111] In some embodiments, the ssDNA constructs or sequences disclosed herein include one or more of the features described herein, e.g., one or more structural DNA sequences, one or more sequences encoding peptides or proteins, one or more sequences encoding regulatory elements, one or more sequences encoding regulatory nucleic acids, e.g., one or more non-coding RNAs, other expression sequences, and any combination thereof. The constructs described herein may have one or more effector sequences, e.g., two, three, four, five or more effector sequences. In the case of multiple effector sequences in a single construct, the effector sequences may be the same or different.

[0112] In one embodiment, the ssDNA comprises a therapeutically functional structural DNA sequence. In one embodiment, the ssDNA comprises a promoter and a sequence encoding a therapeutic peptide, polypeptide, or protein as described herein. In one embodiment, the ssDNA comprises a promoter and a sequence encoding a regulatory RNA as described herein.

[0113] In one embodiment, an effector sequence encoding a polypeptide or protein is codon-optimized, for example, for expression in mammals, such as humans. Generally, codon optimization involves modifying a nucleic acid sequence for enhanced expression in a target host cell by replacing at least one codon of the native sequence (e.g., one or more, e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons; e.g., at least 1%, 5%, 10%, 20%, 25%, 50%, 60%, 70%, 80%, 90%, or 100%) with a codon that is more or most frequently used in the host cell's gene while maintaining the native amino acid sequence. Codon usage tables are available, for example, in the "Codon Usage Database" available at http: / / www.kazusa.or.jp / codon / . These tables can be adapted in many ways; see, for example, Nakamura et al., 2000, Nucl. Acids Res. 28:292. Computer algorithms for codon-optimizing specific sequences for expression in specific host cells, such as Gene Forge, are also available.

[0114] DNA template: A DNA sequence can be a template for genome manipulation enzymes (nucleases, e.g., endonucleases, e.g., nuclease elements of the CRISPR system, e.g., Cas9, dCas9, aCas9-nickase, Cpf / Cas12a, etc.), CRISPR ligases, e.g., base editors or prime editors; mobile genetic element proteins (e.g., transposases, retrotransposases, recombinases, integrases); gene writers; polymerases). A DNA template may include one or more sequences that are bound by genome manipulation enzymes, e.g., DNA binding domain sequences, sequences targeted by guide RNA, reverse repeats, reverse end repeats, long end repeats, left-end sequences (LTS), right-end sequences (LTR), untranslated regions, binding sites (attP, attB, attL, attR, etc.), and lox sites (LoxP, loxB, etc.). A DNA template may include sequences homologous to a sequence in the genome, sequences non-homologous to a sequence in the genome, or a combination thereof. The template may be a substrate for DNA repair, such as non-homologous end joining, homologous recombination, or microhomology-mediated end joining. The DNA template may include a gene or RNA, such as an enhancer, promoter, protein-coding region, or mechanism for expressing an RNA-coding region. In some embodiments, the sequences linked by the genome-manipulating enzyme are positioned on either side of a functional DNA sequence that is inserted into the genome or used as a template for genome repair. In some embodiments, one or both of the sequences linked by the genome-manipulating enzyme are inserted into the genome, while in some embodiments they are not inserted. In embodiments, the ssDNA constructs or sequences described herein may include one or more functional template sequences, e.g., two, three, four, five, six, or more sequences, which may be the same or different.

[0115] Nuclear Targeting Sequence (NTS) The DNA constructs or sequences disclosed herein may include nuclear targeting sequences (NTS) that facilitate the transport of DNA from the cytoplasm to the nucleus of a cell. NTSs include binding sites to proteins (e.g., transcription factors, chaperones, etc.) that bind to importins that transport cargo into the nucleus via the nuclear pore complex. In embodiments, NTSs may function generally (e.g., SV40 enhancer NTS). In other embodiments, NTSs may be cell or tissue specific, for example, containing binding sites for transcription factors expressed in specific cell types, and may target the ssDNA sequences or constructs described herein to the nucleus in a cell-specific manner (e.g., SRF, Nkx3). NTSs may function at multiple locations in the ssDNA or constructs described herein, e.g., before a promoter and / or after an effector sequence.

[0116] NTS may be of viral or nonviral origin. NTS are described, for example, in Le Guen et al. 2021. Nucleic Acids Vol. 24:477-486. Examples of NTS are disclosed in Table 2:

[0117] [Table 2]

[0118] Nuclear transport proteins In some embodiments, ssDNA (e.g., as described herein) can be transported into the nucleus by, for example, a nuclear transport protein (e.g., nuclear transport proteins listed in Table 2B). In some embodiments, ssDNA (e.g., as described herein) can be bound by a nuclear transport protein (e.g., nuclear transport proteins listed in Table 2B). In some embodiments, ssDNA (e.g., as described herein) includes a recognition sequence for a nuclear transport protein (e.g., listed in any one row of Table 2B). In some embodiments, ssDNA (e.g., as described herein) includes a recognition sequence listed in Table 2B, or a nucleic acid sequence having at least 75%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0119] Exemplary transport proteins include, for example, basic helix-loop-helix (bHLH) proteins, heteronuclear ribonucleoprotein (hnRNP) isoforms, and nuclear factor I (NFI) proteins, such as those listed in Table 2B. In some embodiments, the bHLH protein includes an acetylcholine receptor subunit, e.g., an α subunit, e.g., CHRNA1, CHRNA2, CHRNA3, CHRNA4, CHRNA5, or CHRNA7. In some embodiments, the acetylcholine receptor subunit includes a γ or ε subunit. In some embodiments, the transport protein includes desmin. In some embodiments, the transport protein includes hnRNP, e.g., hnRNP A1, hnRNP C, hnRNP K, hnRNP U. In some embodiments, the transport protein includes importin. In some embodiments, the transport protein includes a myosin light chain. In some embodiments, the transport protein includes NFI. In some embodiments, the transport protein includes NFKB. In some embodiments, the transport protein includes a nucleoside diphosphate kinase, e.g., NM23-H2. In some embodiments, the transport protein includes Oct1. In some embodiments, the transport protein includes Oct2.

[0120] In some embodiments, the transport protein includes SRF. In some embodiments, the transport protein includes TEF-1. In some embodiments, the transport protein includes AP2. In some embodiments, the transport protein includes troponin, e.g., troponin I, e.g., troponin I2. In some embodiments, the transport protein includes TTF-1. In some embodiments, the transport protein includes Ran-binding protein, e.g., RanBP3 or RanBP1. In some embodiments, the transport protein includes a homeobox transcription factor, e.g., Chx10.

[0121] In some embodiments, the transport factor specifically binds to E-boxes, DTSs (e.g., SV40 DTS or SMGA DTS), promoters (e.g., SP-C promoter or htk promoter), telomeres, ATTT motifs, cell cycle regulatory units (CCRUs), CT3 sequences, S / MARs, topoisomerase II consensus sequences, ARS consensus sequences, 3NFs, and viral origins of replication (oris) (e.g., EBV oriP sites).

[0122] [Table 2B-1]

[0123] [Table 2B-2]

[0124] [Table 2B-3]

[0125] [Table 2B-4]

[0126] [Table 2B-5]

[0127] Table 2B-6

[0128] Table 2B-7

[0129] Table 2B-8

[0130] Table 2B-9

[0131] Table 2B-10

[0132] Table 2B-11

[0133] Table 2B-12

[0134] Table 2B-13

[0135] Table 2B-14

[0136] Table 2B-15

[0137] Table 2B-16

[0138] Table 2B-17

[0139] Table 2B-18

[0140] Table 2B-19

[0141] Table 2B-20

[0142] Table 2B-21

[0143] Table 2B-22

[0144] Table 2B-23

[0145] Table 2B-24

[0146] Table 2B-25

[0147] [Table 2B-26]

[0148] [Table 2B-27]

[0149] [Table 2B-28]

[0150] [Table 2B-29]

[0151] [Table 2B-30]

[0152] Maintenance sequence The DNA constructs or sequences disclosed herein may include maintenance sequences that support or enable sustained gene expression through a successive series of cell divisions and / or progenitor cell differentiations within a host cell for the ssDNA or constructs of the present invention. In embodiments, the maintenance sequence is a nuclear skeleton / matrix-binding region (S / MAR). S / MAR elements are diverse AT-rich sequences ranging from 60 to 500 bp that are conserved across species and are thought to fix chromatin to nuclear matrix proteins during intermediate phase (Bode et al. 2003. Chromosome Res 11, 435-445). S / MARs may be incorporated into the ssDNA or constructs described herein to promote long-term transgene expression and extrachromosomal retention. In one embodiment, the maintenance sequence is human interferon-β MAR(5'tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata-3'). In embodiments, useful S / MARs in the constructs described herein can be found by searching for MARome at http: / / bioinfo.net.in / MARome, and are also described in Narwade et al. 2019. Nucleic Acids Research. Volume 47, Issue 14:7247-7261.

[0153] In some embodiments, the ssDNA or constructs described herein can be replicated in mammalian cells, such as human cells. In some embodiments, the ssDNA or constructs described herein are maintained within a host cell, tissue, or subject by at least one cell division. For example, the ssDNA or constructs described herein are maintained within a host cell, tissue, or subject by at least 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 40, 50 or more cell divisions. In vitro cell division can be tracked by flow cytometry or microscopy. In vivo cell division can be tracked by biomicroscopy.

[0154] Second chain motif The DNA constructs or ssDNA sequences disclosed herein may also include second-strand motifs. Examples of SSMs are derived from viruses or mobile genetic elements. In some embodiments, SSMs are reverse repeats or hairpin sequences, e.g., viral-derived, e.g., reverse terminal repeats (ITRs) from AAV, or conserved 8-nucleotide hairpins at anerovirus replication origins. Examples of SSMs are listed in Table 3 below:

[0155] [Table 3]

[0156] In some embodiments, the SSM is a short RNA or DNA sequence complementary to the ssDNA region, such as an RNA primer or a DNA primer. In some embodiments, the primer is a sprint sequence that ligates the ends of the ssDNA as described herein. In some embodiments, the RNA or DNA primer is less than 100, 75, 50, 40, 30, 25, 20, 15, 10, or 5 nucleotides. In some embodiments, the RNA or DNA primer is 5 to 100 nucleotides, 10 to 100 nucleotides, 20 to 80 nucleotides, or 20 to 60 nucleotides.

[0157] Other elements The ssDNA constructs or sequences disclosed herein may include other regulatory elements operably ligated to effector sequences, such as effector-coding sequences, in a manner that enables their transport, localization, transcription, translation, and / or expression within target cells, or promotes their degradation or repression of expression within non-target cells. As used herein, “operably ligated” sequences include both effector-coding sequences and adjacent expression regulatory sequences, as well as expression regulatory sequences acting trans or at a distance controlling the effector-coding sequence. The exact nature of the regulatory sequences required for gene expression within host cells may vary between species, tissues, or cell types, but generally may include, as necessary, 5' untranscribed and 5' untranslated sequences involved in the initiation of transcription and translation, respectively, such as TATA boxes, capping sequences, CAAT sequences, and enhancer elements. The regulatory sequences may also include, as necessary, enhancer sequences or upstream activator sequences. The constructs described herein may optionally include 5' leader or signal sequences.

[0158] Modified nucleotides The DNA constructs and compositions described herein may have chemical modifications of nucleic acid bases, sugars, and / or phosphate backbones, whether linear or cyclic, for example, whether covalently cyclized. While we do not wish to be constrained by theory, such modifications may be useful in protecting DNA from degradation (e.g., from exonucleases) or from host tissue or the target immune system. Generally, modified nucleotides have the same base-pairing specificity as unmodified nucleotides; that is, a modified adenine "A" can base-pair with thymine "T". One or more atoms of pyrimidine nucleic acid bases may be replaced or substituted with optionally substituted aminos, optionally substituted thiols, optionally substituted alkyls (e.g., methyl or ethyl), or halos (e.g., chloro or fluoro). In certain embodiments, the modifications (e.g., one or more modifications) are present in both the sugar and nucleoside bonds.

[0159] In some embodiments, ssDNA includes at least one covalent modification. Preferred modifications are described by Sood et al. 2019. DNAmod: the DNA modification database. J Cheminform 11, 30. DNAmod is an open-source database (https: / / dnamod.hoffmanlab.org) that provides a single source for creating a catalog of DNA modifications and learning about their properties. DNAmod provides a web interface for easy browsing and searching of these modifications. The database annotates the chemical properties and structures of all curated modified DNA bases, as well as a much larger list of candidate chemicals. DNAmod includes manual annotations of available sequencing methods, descriptions of their occurrence in nature, and provides existing and recommended nomenclature. Examples of DNA modifications useful in the methods described herein include, for example, N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5fC, f5C); 5-carboxylcytosine (ca5C, 5caC); 5-hydroxymethylcytosine (5hmC, hm5C); 5-methyldeoxycytosine (m5dC); 5-methylcytosine (5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioates; S and R phosphorothioate bonds; methylthymine; N3'-P5' phosphoramidate (NP); cyclohexane nucleic acid (CeNA); and tricyclo-DNA (tcDNA).For example, see Pu et al. 2020. An in-vitro DNA phosphorothioate modification reaction. Mol Microbiol. 113:452-463; Zheng & Sheng. 2021. Synthesis of N4-methylcytidine (m4C) and N4,N4-dimethylcytidine (m42C) modified RNA. Current Protocols, 1, e248; Ohkubo et al. 2021. Chemical synthesis of modified oligonucleotides containing 5’-amino-5’-deoxy-5’-hydroxymethylthymidine residues. Current Protocols, 1, e70; Bao & Xu. 2021. Observation of Z-DNA structure via the synthesis of oligonucleotide DNA containing 8-rifluoromethyl-2-deoxyguanosine. Current Protocols, 1, e28; Skakuj et al. 2020. Automated synthesis and purification of guanidine-backbone oligonucleotides. Current Protocols in Nucleic Acid Chemistry, 81, e110.

[0160] In some embodiments, the ssDNA compositions described herein may contain either or both S-phosphorothioate modified nucleotide bonds and R-phosphorothioate modified nucleotide bonds. In one embodiment, the phosphorothioate bonds are prepared according to Iwamoto et al, 2017, Nature Biotechnology, Volume 35:845-851. Briefly, monomers of nucleoside 3'-oxazaphosphoridine derivatives undergo stereocontrolled oligonucleotide synthesis with repeated capping and sulfidation to form stereocontrolled phosphorothioate bonds. The final sample can be analyzed by reversed-phase high-performance liquid chromatography (RP-HPLC) and ultra-high-performance liquid chromatography-mass spectrometry (UPLC / MS) to determine the stereochemistry of the modifications. Nucleic acids containing phosphorothioate bonds are also commercially available.

[0161] In some embodiments, the ssDNA compositions described herein may comprise one or more boranophosphate-modified nucleotides according to the method described, for example, in Sergueev and Shaw, 1998, J Am Chem Soc, Volume 120, Issue 37:9417-9427. Briefly, in some embodiments, H-phosphonate chain elongation is followed by boration, in which uncrosslinked oxygen atoms in the phosphate backbone are replaced with borano groups. The final sample may be purified and analyzed by RP-HPLC to determine the stereochemistry of the modification. Boranophosphate-modified nucleotides are also commercially available.

[0162] In some embodiments, the ssDNA compositions described herein may comprise one or more 5-methylcytosine-modified nucleotides prepared, for example, according to the method in Lin et al, 2002, Mol Cell Biol, Volume 22, Issue 3:704-723. Briefly, in some embodiments, cytosine or a cytosine-containing sequence is incubated with unlabeled S-adenosylmethionine (AdoMet) and glutathione S-transferase fusion of wild-type Dnmt3a (GST-3a) protein. The nucleotides may be purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. 5-methylcytosine-modified nucleotides are also commercially available.

[0163] In some embodiments, the ssDNA compositions described herein may comprise one or more 7-methylguanine-modified nucleotides. In some embodiments, the 7-methylguanine-modified nucleotides are prepared according to the method described in Jones and Robins, 1963, Purine nucleosides. III. Methylation studies of certain naturally occurring purine nucleosides, J Am Chem Soc, Volume 85:193. Briefly, in some embodiments, 2'-deoxyguanosine in dimethyl sulfoxide is treated with methyl iodide. The nucleotides may be purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. In other embodiments, the 7-methylguanine-modified nucleotides are prepared according to the methods described in Hendler et al, 1970, Volume 9, Issue 21:4141:4153, and Kore and Parmar, 2006, Biochemistry, Volume 25, Issue 3:337-340. In short, in some embodiments, guanine 5'-diphosphate in water is added to dimethyl sulfate instead of guanosine 5'-diphosphate to obtain 7-methyl GDP. The nucleotide is purified and analyzed by HPLC to determine that the nucleotide is methylated at the appropriate position. 7-methylguanine-modified nucleotides are also commercially available.

[0164] In embodiments, the ssDNA constructs and compositions described herein include 1-100% modified nucleotides, 1-90% modified nucleotides, 1-80% modified nucleotides, 1-70% modified nucleotides, 1-60% modified nucleotides, 1-50% modified nucleotides, 1-40% modified nucleotides, 1-30% modified nucleotides, 1-20% modified nucleotides, 1-15% modified nucleotides, 1-10% modified nucleotides, 20-90% modified nucleotides, and 20-80% modified nucleotides. In embodiments, the ssDNA constructs and compositions described herein include at least 1% modified nucleotides; at least 5% modified nucleotides; at least 10% modified nucleotides; at least 15% modified nucleotides; at least 20% modified nucleotides; at least 25% modified nucleotides; at least 30% modified nucleotides; at least 40% modified nucleotides; at least 50% modified nucleotides; at least 60% modified nucleotides; at least 70% modified nucleotides; at least 80% modified nucleotides; at least 85% modified nucleotides; at least 90% modified nucleotides; at least 92% modified nucleotides; at least 95% modified nucleotides; and at least 97% modified nucleotides. In embodiments, the ssDNA constructs and compositions described herein include 0% to 100% modified nucleotides of each different nucleotide, for example, 0% to 100% modified T nucleotides, 0% to 100% modified A nucleotides, 0% to 100% modified C nucleotides, and 0% to 100% modified G nucleotides for each construct.In embodiments, the ssDNA constructs and compositions described herein include modified nucleotides of 0-100%, 10-100%, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, and 10-50% of each different nucleotide, for example, modified Tnucleotides of 0-100%, 10-100%, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, and 10-50%; and modified Tnucleotides of 0-100%, 10-100%, and 20%. Includes modified Anucleotides of ~100%, 30%~100%, 40%~100%, 50%~100%, 60%~100%, and 10%~50%; modified Cnucleotides of 0~100%, 10%~100%, 20%~100%, 30%~100%, 40%~100%, 50%~100%, 60%~100%, and 10%~50%; or modified Gnucleotides of 0~100%, 10%~100%, 20%~100%, 30%~100%, 40%~100%, 50%~100%, 60%~100%, and 10%~50%. For example, an ssDNA construct may contain 100% modified T nucleotides, 50% modified A nucleotides, 0% modified C nucleotides, and 25% modified G nucleotides.

[0165] In embodiments, DNA modifications, such as those described herein, may be introduced into the ssDNA composition described herein throughout the entire sequence; within elements of the sequence, such as those described herein; at the 5' or 3' end; and / or between the last 10, 8, 6, 5, 4, 3, or 2 nucleotides at the 5' or 3' end.

[0166] In some embodiments, the ssDNA described herein has one or more modifications that interfere with the ssDNA's ability to form a double-stranded structure, for example, the ssDNA described herein has one or more modifications on nucleotides located in a region having intramolecular complementarity. In some embodiments, the ssDNA described herein has one or more modifications that interfere with base pairing in the region of intramolecular complementarity compared to the unmodified sequence of the ssDNA. In some embodiments, the modified nucleotides used herein have a reduced tendency to base pair with modified nucleotides compared to the unmodified nucleotides. In some embodiments, the modified nucleotides used herein have an increased tendency to base pair with unmodified nucleotides compared to modified nucleotides.

[0167] Other modifications are also possible. For example, the ends of linear DNA described herein may be modified, for instance, to protect them from exonucleases. For example, one or more dideoxynucleotide residues may be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides may be ligated to one or both ends. See, for example, Chang, et al. (1987) Proc. Nail. Acad. Sci. USA 84:4959-4963; Nehls, et al. (1996) Science 272:886-889.

[0168] In some embodiments, the ssDNA is substantially biotin-free (e.g., biotin-free).

[0169] In some embodiments, the modified ssDNA described herein exhibits reduced recognition by DNA sensors in host tissue or subjects compared to unmodified ssDNA of the same sequence, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more reduced recognition by DNA sensors in host tissue or subjects compared to unmodified ssDNA of the same sequence. In some embodiments, the modified ssDNA described herein exhibits reduced degradation by DNA nucleases compared to unmodified ssDNA of the same sequence, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more reduced degradation by DNA nucleases in host tissue or subjects compared to unmodified ssDNA. In some embodiments, the modified ssDNA described herein exhibits reduced activation of the innate immune system in the target / host tissue or subject compared to unmodified ssDNA of the same sequence, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced activation of the innate immune system in the target / host tissue or subject compared to unmodified ssDNA of the same sequence. In some embodiments, the modified ssDNA described herein exhibits any of the following properties in the target / host tissue or subject compared to unmodified ssDNA of the same sequence: increased integration of the exogenous construct into the genome of the target cell; increased retention within the target cell by replication; reduced secondary or tertiary structure formation; reduced interaction with innate immune sensors; reduced interaction with nucleases; improved stability; improved lifespan; reduced toxicity; improved delivery; increased expression; increased second-strand synthesis; increased transmembrane transport; or increased binding to DNA-binding sites such as nuclear DNA-binding proteins, transcription factors, chaperones, DNA polymerases. In embodiments, any of the characteristics listed above is regulated by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more in the target / host tissue or subject compared to unmodified ssDNA of the same sequence.

[0170] Structure of DNA constructs In some embodiments, the ssDNA constructs or sequences disclosed herein are at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 500 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 5000 nucleotides, at least about 6000 nucleotides, at least about 7000 nucleotides, at least about 8000 nucleotides, at least about 9000 nucleotides, at least about 10,000 nucleotides, at least about 20,000 nucleotides, at least about 30,000 nucleotides, at least about 40,000 nucleotides, and at least about 50,000 nucleotides. In some embodiments, the size of the ssDNA constructs or sequences disclosed herein is long enough to encode a useful polypeptide or RNA.

[0171] The ssDNA constructs described herein may be circular and, for example, may be covalently ring-bound.

[0172] The ssDNA constructs described herein may have intramolecular complementarity or a double-stranded structure below a threshold level. In one embodiment, the ssDNA does not contain 50, 40, 30, 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2, or more than one double-stranded region longer than 100, 80, 70, 60, 50, 40, 30, 20, or 10 base pairs, i.e., it does not contain intramolecular complementarity regions longer than 100, 80, 70, 60, 50, 40, 30, 20, or 10 base pairs. In some embodiments, the ssDNA contains 1, 2, 3, 4, 5, 7, 8, 10, 21, 14, 15, 18, or 20 double-stranded regions, for example, the double-stranded regions are 100, 80, 70, 60, 50, 40, 30, 20, or 10 or fewer base pairs. In one embodiment, the ssDNA does not contain intramolecular complementary regions longer than 100, 80, 70, 60, 50, 40, 30, or 20 base pairs. For example, the ssDNA is not a doggybone structure; that is, it is not primarily a double-stranded, closed-end construct.

[0173] In some embodiments, ssDNA does not form double-stranded structures longer than 100 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 80 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 60 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 50 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 45 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 40 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 35 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 30 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 25 base pairs. In some embodiments, ssDNA does not form double-stranded structures longer than 20 base pairs. In some embodiments, ssDNA does not include the length of the double-stranded structure recognized by intracellular cyclic GMP-AMP synthase (cGAS). While we don't want to be constrained by theory, cGAS is thought to mediate innate immunity against foreign double-stranded DNA.

[0174] In some embodiments, the ssDNA does not include a first sequence that hybridizes with a second sequence, the first sequence and the second sequence are at least 5, 10, 15, 20, or 25 nucleotides long, and the first sequence and the second sequence are spaced less than 6, 5, 4, 3, 2, or 1 nucleotide apart from each other.

[0175] In one embodiment, the double-stranded region formed by the ssDNA described herein is determined as described by Xayaphoummine et al. 2005. Kinefold web server for RNA / DNA folding path and structure prediction including pseudoknots and knots. Nucleic Acids Research, Volume 33:W605-610. In one embodiment, the Kinefold website (http: / / kinefold.curie.fr / cgi-bin / form.pl) is used to predict the double-stranded region of the construct described herein using the following parameters: • Folding sequence: Enter and select "DNA sequence" • Probabilistic simulation: co-transcriptional folding, 3 milliseconds • Molecular time to be simulated: default • Pseudoknot: Not acceptable • Confounding: No crossover • Random seed: 11453

[0176] In one embodiment, the double-stranded region formed by the ssDNA described herein is determined as described in Lorenz et al. 2011. ViennaRNA Package 2.0. Algorithms for Molecular Biology, Volume 6, Article 26. In one embodiment, the RNAFold web server (http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi) is used to predict the double-stranded region of the construct described herein using the following parameters: • Folding algorithm and basic options: • Minimum free energy (MFE) and partition function (default) • Avoid separated base pairs (default)

[0177] • Advanced folding options: In either case, the dangling energy on both sides of the helix (default) • DNA parameters (Matthews model, 2004) • After SHAPE reactivity conversion, apply pseudo-energy to the stacked pair (Deigan et al., 2009) (default) • Slope (m) = 1.9; Intercept (b) = -0; Rescaling energy parameters for a given temperature = 3 (default) Assume that the RNA molecule is circular.

[0178] Output options • Interacting RNA secondary structure plot (default) • RNA secondary structure plot with reliability annotation (partition function folding only) (default) • Mountain plot (default)

[0179] An exemplary computer folding of single-stranded, covalently ring-closed DNA is shown in Figure 16. As can be understood, it might be expected that ssDNA would have a considerable number of double-stranded regions, such as hairpins. However, the ssDNA in Figure 16 lacks long, continuous extensions of double-stranded DNA. More specifically, the longest continuous dsDNA region in Figure 16 is less than 16 nucleotides long. This construct is not expected to form double-stranded structures longer than 100 base pairs; rather, bulges, internal loops, and other structures are positioned between the shorter double-stranded regions.

[0180] production Generally, the ssDNA constructs of the present invention are produced from plasmids assembled to contain the desired elements described herein. Plasmid templates can be assembled using Golden Gate cloning for the assembly of multiple DNA fragments in a specified linear order in a recipient vector using a one-pot assembly procedure. Golden Gate cloning is described in Marillonnet & Gruetzner, 2020, Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline, Current Protocols in Molecular Biology, 130:e115. The template is then used to produce single-stranded DNA using methanol-responsive (MeRPy) PCR, for example, as described in Minev et al., 2019, Rapid in vitro production of single-stranded DNA, Nucleic Acids Research, Volume 47, Issue 22:11956-11962. In embodiments where the ssDNA is circular, the resulting ssDNA can be circularized, for example, using DNA ligase. A schematic diagram of an exemplary production process is shown in Figure 2.

[0181] In some embodiments, the methods or compositions described herein include a nickel endonuclease. In some embodiments, the endonuclease is naturally occurring. In some embodiments, the endonuclease is mutated or engineered and derived, for example, from an enzyme that causes double-strand breaks.

[0182] In some embodiments, the methods described herein include the use of the compositions described herein, or the compositions described herein include Nb.BsrDI. In some embodiments, Nb.BsrDI includes a large subunit of the BsrDI restriction gene derived from Geobacillus stearothermophilus D70, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nb.BsrDI includes an amino acid sequence represented by Genbank accession number ABD15132.1 (which is incorporated herein by reference in its entirety), or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nb.BsrDI is cleaved at the sites shown in the following sequences, indicated by SEQ ID NOs. 31 and 32, respectively: [ka] In some embodiments, the digestion reaction using Nb.BsrDI is carried out in rCutSmart® Buffer (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of the following: potassium acetate (e.g., at 50 mM), tris acetate (e.g., at 20 mM), magnesium acetate (e.g., at 10 mM), or recombinant albumin (e.g., at 100 μg / ml), where optionally the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is carried out at 30°C to 70°C (e.g., about 37°C or about 65°C). In some embodiments, the digestion reaction is carried out over a period of 10 minutes to 3 hours (e.g., about 30 minutes or about 1 hour).

[0183] In some embodiments, the methods described herein include the use of the compositions described herein, or the compositions described herein include Nb.Bpu10I. In some embodiments, Nb.Bpu10I includes the amino acid sequence encoded by wild-type bpu10IRα or the mutant bpu10IRβ gene derived from Bacillus pumilus RFL10, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nb.Bpu10I is cleaved at the sites shown in the following sequences, indicated by SEQ ID NOs. 33 and 34, respectively: [ka] In some embodiments, the digestion reaction using Nb.Bpu10I is carried out in R Buffer (ThermoFisher Scientific). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of the following: Tris-HCl (e.g., 10 mM), MgCl2 (e.g., 10 mM), KCl (e.g., 100 mM), and BSA (e.g., 0.1 mg / mL). In some embodiments, the digestion reaction is carried out at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is carried out over a period of 30 minutes to 3 hours (e.g., about 1 hour).

[0184] In some embodiments, the methods described herein include the use of the compositions described herein, or the compositions described herein include Nt.BspQI. In some embodiments, Nt.BspQI includes an engineered BspQI variant derived from a BspQI restriction enzyme, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nt.BspQI is cleaved at the sites shown in the following sequences, indicated by SEQ ID NOs. 35 and 36, respectively: [ka] In some embodiments, the digestion reaction using Nt.BspQI is carried out in NEBuffer® r3.1 (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of the following: NaCl (e.g., 100 mM), Tris-HCl (e.g., 50 mM), MgCl2 (e.g., 10 mM), and recombinant albumin (e.g., 100 μg / mL), where optionally the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is carried out at 40°C to 60°C (e.g., about 50°C). In some embodiments, the digestion reaction is carried out over a period of 30 minutes to 3 hours (e.g., about 1 hour).

[0185] In some embodiments, the methods described herein include the use of compositions described herein, or the compositions described herein include a T7 exonuclease. In some embodiments, the digestion reaction using a T7 exonuclease is carried out in NEBuffer® 4 (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of potassium acetate (e.g., at 50 mM), tris acetate (e.g., at 20 mM), magnesium acetate (e.g., at 10 mM), or DTT (e.g., at 1 mM), where optionally the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is carried out at 20°C to 50°C (e.g., about 25°C or about 37°C). In some embodiments, the digestion reaction is carried out over a period of 15 to 120 minutes, for example, 20 to 60 minutes, for example, about 30 minutes.

[0186] In some embodiments, the methods described herein involve the use of compositions described herein, or the compositions described herein include a T5 exonuclease. In some embodiments, the digestion reaction using the T5 exonuclease is carried out in NEBuffer® 4 (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of potassium acetate (e.g., at 50 mM), tris acetate (e.g., at 20 mM), magnesium acetate (e.g., at 10 mM), or DTT (e.g., at 1 mM), where optionally the buffer has a pH of 7.9 when measured at 25°C. In some embodiments, the digestion reaction is carried out at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is carried out over a period of 10 minutes to 3 hours (e.g., about 30 minutes).

[0187] In some embodiments, the methods described herein involve the use of compositions described herein, or compositions described herein include exonuclease III. In some embodiments, the digestion reaction using exonuclease III is carried out in NEBuffer® 1 (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of bis-tris-propane-HCl (e.g., 10 mM), MgCl2 (e.g., 10 mM), or DTT (e.g., 1 mM), where optionally the buffer has a pH of 7 when measured at 25°C. In some embodiments, the digestion reaction is carried out at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is carried out over a period of 10 minutes to 3 hours (e.g., about 30 minutes).

[0188] In some embodiments, the methods described herein include the use of compositions described herein, or the compositions described herein include a high-fidelity DNA polymerase, for example, Q5 high-fidelity DNA polymerase (M0491L, New England Biolabs). In some embodiments, the polymerase chain reaction is carried out using a high-fidelity DNA polymerase. In some embodiments, the polymerase chain reaction using Q5 high-fidelity DNA polymerase is carried out using Q5 reaction buffer (NEB).

[0189] In some embodiments, the methods described herein include the use of the compositions described herein, or the compositions described herein include exonuclease I. In some embodiments, exonuclease I includes the amino acid sequence of the Exo I gene derived from Escherichia coli (E. coli) NM554, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, exonuclease I catalyzes the removal of nucleotides from linear single-stranded DNA (for example, in the 3' to 5' direction). In some embodiments, the digestion reaction using exonuclease I is carried out in exonuclease I reaction buffer (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of glycine-KOH (e.g., at 67 mM), MgCl2 (e.g., at 6.7 mM), or β-ME (e.g., at 10 mM), where optionally the buffer has a pH of 9.5 when measured at 25°C. In some embodiments, the digestion reaction is carried out at 30°C to 50°C (e.g., about 37°C). In some embodiments, the digestion reaction is carried out over a period of 10 minutes to 3 hours (e.g., about 30 minutes). In some embodiments, the circular ssDNA is resistant to degradation by exonuclease I.

[0190] In some embodiments, the cyclization efficiency of the cyclization method provided herein is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or higher.

[0191] ssDNA or circular ssDNA, for example, covalently cyclized ssDNA, can be enriched or purified from impurities or by-products selected from the group consisting of endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, linear DNA (for circular products), proteins (e.g., enzymes, e.g., ligases, restriction enzymes), DNA fragments, or cuts. In some embodiments, the purified ssDNA is substantially free of process by-products and impurities, such as those described herein.

[0192] ssDNA or circular ssDNA, for example, covalently closed ssDNA, can be sequenced to confirm a desired designed sequence. In embodiments, other structural analyses of the ssDNA (e.g., restriction enzyme analysis) may be performed to confirm or validate its sequence.

[0193] purity In some embodiments, the compositions containing ssDNA described herein have a specific purity. For example, in some embodiments, at least 70%, 80%, 85%, 90%, 95%, or 99% by mass of the total DNA in the composition may be covalently ring-bound ssDNA. For example, the composition may also contain linear DNA or circular dsDNA as contaminants, for instance.

[0194] In some embodiments, the compositions described herein (e.g., compositions comprising circular ssDNA, e.g., pharmaceutical compositions comprising circular ssDNA, or manufacturing intermediates comprising circular ssDNA) are free from or substantially free from one or more contaminants, as described in this section, for example. In some embodiments, the methods described herein (e.g., methods for producing circular ssDNA) result in compositions free from or substantially free from one or more contaminants, as described in this section, for example. In some embodiments, the methods described herein (e.g., methods for producing circular ssDNA) include a step of assaying one or more contaminants, as described in this section, for example. In some embodiments, the method includes approving or launching a batch if the batch is free from or substantially free from contaminants.

[0195] In some embodiments, the contaminants include non-human animal serum (e.g., fetal bovine serum); enzymes, e.g., ligases, polymerases, or digestive enzymes (e.g., trypsin, collagenase, DNase, RNase, exonuclease, or endonuclease, e.g., restriction endonuclease); growth factors; cytokines; antibodies (e.g., monoclonal antibodies); beads (e.g., antibody-coated beads); antibiotics; cell culture media; components of cell culture media; detergents; proteins, e.g., host cell proteins; foreign nucleic acid sequences (e.g., mononucleotides (e.g., modified mononucleotides), or DNA fragments or cuts); helper virus contaminants (e.g., infectious viruses, viral DNA, or viral proteins); or solvents; cell debris; cells; pyrogens; fungi; or any combination thereof, or any part of any of the above. In some embodiments, the contaminants were components introduced during the manufacturing process.

[0196] In some embodiments, the contaminant includes a drug for transmissible spongiform encephalopathy (TSE). In some embodiments, testing for this contaminant is performed in a composition in which a bovine-derived substance was used in its manufacture.

[0197] In some embodiments, the contaminant includes zoonotic viruses, porcine circovirus 1, porcine circovirus 2, or porcine parvovirus; or any combination thereof, or any part thereof. In some embodiments, the testing for this contaminant is carried out in a composition in which a non-human animal-derived substance, such as a porcine-derived substance, was used in the manufacture.

[0198] In some embodiments, the contaminant includes viruses or parts thereof, e.g., human viruses; human immunodeficiency virus (HIV); HIV-1; HIV-2; hepatitis B virus (HBV); hepatitis C virus (HCV); human TSE including Creutzfeldt-Jakob disease (CJD); variant CJD (vCJD); Treponema pallidum (syphilis); human T-lymphotropic virus (HTLV), HTLV-1, HTLV-2; or cytomegalovirus, human herpesvirus (e.g., human herpesvirus-6, -7, or -8 (HHV-6, -7, and -8)), JC virus, BK virus, Epstein-Barr virus (EBV), human parvovirus B19, human papillomavirus (HPV); adenovirus, e.g., adenovirus E1; SV40 Large T antigen sequence; HPV E6 or E7 DNA; or any combination thereof, or parts of any of the above. In some embodiments, the testing for contaminants is performed in the composition used to produce human donor cells (e.g., leukocyte-rich cells). In some embodiments, the testing for contaminants is performed in the cell bank.

[0199] In some embodiments, the contaminant includes microorganisms or parts thereof; bacteria (e.g., Gram-negative bacteria); mycoplasma; spiroplasma (e.g., when insect cells are used); bacterial toxins (e.g., endotoxins); or adventitious agents, e.g., denominative viral agents or nonviral denominative agents, or any combination thereof, or parts of any of the above. In some embodiments, the contaminant includes Simian viruses, e.g., Simian polyomavirus SV40 or Simian retrovirus, or any combination thereof, or parts of any of the above. In some embodiments, the contaminant includes arboviruses. In some embodiments, the contaminant includes bacteriophages. In some embodiments, the contaminant is tested in a cell bank, e.g., a bacterial cell bank.

[0200] In some embodiments, the contaminant includes DNA derived from host cells, for example, where the host cells are non-cancerous cells. In some embodiments, the DNA is present at levels less than 10 ng / dose. In some embodiments, the DNA size is less than approximately 200 nucleotides in length.

[0201] In some embodiments, the contaminant is an endotoxin. In some embodiments, the endotoxin level is less than 5 endotoxin units (EU) / kg body weight / hour, and for example, the composition is formulated for parenteral administration. In some embodiments, the endotoxin level is less than 0.2 EU / kg body weight / hour, and for example, the composition is formulated for intrathecal administration. In some embodiments, the endotoxin level is 2.0 EU or less / administration / eye, and for example, the composition is formulated for intraocular injection or infusion, or 0.5 EU or less / mL, and for example, the composition is formulated for intraocular administration.

[0202] In some embodiments, the contaminant includes organic solvents, such as aromatic organic solvents, such as phenol or chloroform.

[0203] In some embodiments, the contaminants are those described in Chemistry, Manufacturing, and Control (CMC) Information for Human Gene Therapy Investigational New Drug Applications (INDs) - Guidance for Industry (U.S. Department of Health and Human Services, Food and Drug Administration, Center for Biologics Evaluation and Research, January 2020), which is hereby incorporated by reference in its entirety.

[0204] In some embodiments, the composition is substantially free (e.g., free) of polymerase. In some embodiments, the composition is substantially free (e.g., free) of polymerase that performs rolling circle amplification. In some embodiments, the composition is substantially free (e.g., free) of lipid nanoparticles (LNPs). In some embodiments, the composition is substantially free (e.g., free) of nanoparticles.

[0205] In some embodiments, the composition is substantially free (e.g., free) of agarose. In some embodiments, the composition is substantially free (e.g., free) of acrylamide.

[0206] In some embodiments, the composition is substantially free (e.g., free) of polypeptides.

[0207] In some embodiments, the ratio of the number of molecules of covalently closed circular ssDNA in the composition to other DNA molecules is at least 10:1, 20:1, 50:1, 80:1, 90:1, 100:1, 200:1, 500:1, or 1000:1. In some embodiments, the composition substantially does not contain DNA derived from a host cell; for example, the DNA is present at a level of less than 10 ng / dose. In some embodiments, the composition substantially does not contain DNA having a size less than about 200 nucleotides in length. In some embodiments, the composition substantially does not contain individual nucleotides. In some embodiments, the ratio of covalently closed circular ssDNA to dsDNA in the composition is at least 100:1, 200:1, 500:1, or 1000:1. In some embodiments, at least 70%, 80%, 85%, 90%, 95%, or 99% of the DNA in the composition, on a mass basis (or on a copy number basis), is full-length.

[0208] Pharmaceutical composition The present disclosure includes ssDNA and related compositions in combination with one or more pharmaceutically acceptable excipients and / or carriers.

[0209] The pharmaceutical composition may optionally include one or more additional active substances, for example, substances that are therapeutically and / or prophylactically active. The pharmaceutical compositions of the present invention are generally sterile and / or pyrogen-free.

[0210] The ssDNA or construct described herein can be formulated without a carrier; for example, the ssDNA or construct described herein can be administered "naked" to a host cell, tissue, or subject. A naked formulation can contain a pharmaceutical excipient or diluent but lacks a carrier.

[0211] Pharmacovigilant excipients or diluents may include inert substances acting as vehicles or media for the compositions described herein, such as any one of the active ingredients listed in the Inactive Ingredients Database approved by the United States Food and Drug Administration (FDA) and incorporated herein by reference. Non-limiting examples of pharmaceutically acceptable excipients or diluents include solvents, aqueous solvents, non-aqueous solvents, isotonic agents, dispersion media, antifreeze agents, diluents, suspension aids, surfactants, isotonic agents, thickeners, emulsifiers, preservatives, hyaluronidases, dispersants, preservatives, lubricants, granulators, disintegrants, binders, antioxidants, buffers (e.g., phosphate-buffered saline (PBS)), lubricants, oils, and mixtures thereof.

[0212] General considerations in the formulation and / or manufacture of pharmaceuticals can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).

[0213] Carrier The ssDNA or constructs described herein may also be formulated with or included in a carrier. General considerations for the delivery of carriers and pharmaceuticals can be found, for example, in *Delivery Technologies for Biopharmaceuticals: Peptides, Proteins, Nucleic Acids and Vaccines* (Lene Jorgensen and Hanne Morck Nielson, Eds.) Wiley; 1st edition (December 21, 2009); and Vargason et al. 2021. Nat Biomed Eng 5, 951-967.

[0214] Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydrous-modified phytoglycogen or glycogen-type materials, GalNAc), nanoparticles (e.g., nanoparticles encapsulating or covalently linked to ssDNA, gold nanoparticles, or silica nanoparticles), lipid particles (e.g., liposomes, lipid nanoparticles), cationic carriers (e.g., cationic lipopolymers or transfection reagents), fusosomes, non-nucleated cells (e.g., ex vivo differentiated reticulocytes), nucleated cells, exosomes, protein carriers (e.g., proteins covalently linked to ssDNA), peptides (e.g., cell-permeable peptides), materials (e.g., graphene oxide), single pure lipids (e.g., cholesterol), and DNA origami (e.g., DNA tetrahedrons).

[0215] In one embodiment, the ssDNA compositions, constructs, and systems described herein may be formulated in liposomes or other similar vesicles. Liposomes are spherical vesicular structures composed of a monolayer or multilayer lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes may be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, capable of delivering both hydrophilic and lipophilic drug molecules, protecting their cargoes from degradation by plasma enzymes, and transporting their cargoes across biological membranes and the blood-brain barrier (BBB) ​​(see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679 for an overview).

[0216] Vesicles can be made from several different types of lipids; phospholipids are most commonly used to generate liposomes as drug carriers. Methods for the preparation of multilayer vesicle lipids are known in the art (see, for example, U.S. Patent No. 6,693,086, which is incorporated herein by reference, teachings relating to the preparation of multilayer vesicle lipids). Vesicle formation can occur spontaneously when a lipid film is mixed with an aqueous solution, but it can also be facilitated by applying force in the form of shaking using a homogenizer, sonicator, or extruder (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, p. 12, 2011. doi:10.1155 / 2011 / 469679 for an overview). The extruded lipids can be prepared by extruding them through a size-reducing filter, as described in Templeton et al., Nature Biotech, 15:647-652, 1997, for which instructions on the preparation of extruded lipids are incorporated herein by reference.

[0217] Exosomes may also be used as drug delivery vehicles for the compositions and systems described herein. For an overview, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0218] Ex vivo differentiated erythrocytes can also be used as carriers for the drugs described herein (e.g., ssDNA). For example, see International Publication No. 2015073587; International Publication No. 2017123646; International Publication No. 2017123644; International Publication No. 2018102740; International Publication No. 2016183482; International Publication No. 2015153102; International Publication No. 2018151829; International Publication No. 2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; U.S. Patent No. 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136.

[0219] For example, the fusosome composition described in International Publication No. 2018208728 can also be used as a carrier for delivering the ssDNA described herein.

[0220] Lipid nanoparticles: Lipid nanoparticles (LNPs) are carriers made from ionizable lipids. LNPs are taken up by cells via endocytosis, and their properties allow for endosomal escape, which enables the release of cargo into the cytoplasm of target cells. In addition to ionizable lipids, LNPs may contain helper lipids that promote cell binding, cholesterol that fills the gaps between lipids, and / or polyethylene glycol (PEG) that reduces opsonization by serum proteins and reticulocellular clearance. In some embodiments, lipid nanoparticles include one or more ionic lipids, e.g., noncationic lipids (e.g., neutral, anionic, or amphoteric lipids); one or more conjugate lipids (such as PEG conjugate lipids or lipids conjugated to polymers listed in Table 5 of International Publication No. 2019217941, which is incorporated herein by reference); one or more sterols (e.g., cholesterol); and optionally, one or more targeting molecules (e.g., conjugate receptors, receptor ligands, antibodies); or a combination of the above.

[0221] Lipids that can be used in nanoparticle formulations (e.g., lipid nanoparticles) include, for example, those listed in Table 4 of International Publication No. 2019217941 (incorporated by reference), for example, lipid-containing nanoparticles may contain one or more lipids from Table 4 of International Publication No. 2019217941. Lipid nanoparticles may contain additional elements, such as polymers, including those listed in Table 5 of International Publication No. 2019217941 (incorporated by reference).

[0222] In some embodiments, if conjugated lipids are present, PEG-diacylglycerol (DAG) (e.g., l-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), PEG-diacylglycerol succinate (PEGS-DAG) (4-O-(2',3'-di(tetradecanoyloxy)propyl-l-O-(w- It may include one or more of the following: methoxy(polyethoxy)ethyl)butanediate (PEG-S-DMG, etc.), PEG dialkoxypropyl carbam, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those listed in Table 2 of International Publication No. 2019051289, dx.doi.org / 10.1021 / acs.nanolett.0c01386 (incorporated by reference), as well as one or more combinations thereof.

[0223] In some embodiments, sterols that can be incorporated into lipid nanoparticles include one or more cholesterol or cholesterol derivatives, such as those described in International Publication No. 2009 / 127060 or U.S. Patent Application Publication No. 2010 / 0130588 (incorporated by reference). Additional exemplary sterols include plant sterols, including those described in Eygeris et al (2020) (incorporated herein by reference).

[0224] In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid, a conjugate lipid that inhibits particle aggregation, and a sterol. The amounts of these components can be varied independently and to achieve desired properties. For example, in some embodiments, the lipid nanoparticles comprise an ionizable lipid in an amount of about 20 mol% to about 90 mol% of the total lipid (in other embodiments, it can be 20 - 70% (mol), 30 - 60% (mol) or 40 - 50% (mol); it can be in an amount of about 50 mol% to about 90 mol% of the total lipid present in the lipid nanoparticles), a non-cationic lipid in an amount of about 5 mol% to about 30 mol% of the total lipid, a conjugate lipid in an amount of about 0.5 mol% to about 20 mol% of the total lipid, and a sterol in an amount of about 20 mol% to about 50 mol% of the total lipid. The ratio of total lipid to nucleic acid can be varied as needed. For example, the total lipid to nucleic acid (mass or weight) ratio can be about 10:1 to about 30:1.

[0225] In some embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) can be in the range of about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to obtain a desired N / P ratio, such as an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or more. Generally, the total lipid content of the lipid nanoparticle formulation can be in the range of about 5 mg / ml to about 30 mg / mL.

[0226] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form the lipid nanoparticles for delivery of the compositions described herein, such as the nucleic acids (e.g., RNA) described herein, include

Chemical formula

[0227] In some embodiments, the LNP comprising formula (i) is used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [ka]

[0228] In some embodiments, an LNP comprising formula (ii) is used to deliver the DNA composition described herein to the liver and / or hepatocytes. [ka]

[0229] In some embodiments, an LNP comprising formula (iii) is used to deliver the DNA composition described herein to the liver and / or hepatocytes. [ka]

[0230] In some embodiments, an LNP comprising formula (v) is used to deliver the DNA composition described herein to the liver and / or hepatocytes. [ka]

[0231] In some embodiments, an LNP comprising formula (vi) is used to deliver the DNA composition described herein to the liver and / or hepatocytes. [ka]

[0232] In some embodiments, LNPs comprising formula vii or (viii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [ka]

[0233] In some embodiments, the LNPs comprising formula (ix) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0234] In some embodiments, the LNPs comprising formula (x) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes:

Chemical formula

Chemical formula

Chemical formula

[0235] In some embodiments, an LNP comprising formula (xi) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0236] In some embodiments, an LNP comprising formula (xii) is used to deliver the DNA composition described herein to the liver and / or hepatocytes. [ka]

[0237] In some embodiments, the LNP includes compounds of formula (xiii) and formula (xiv). [ka]

[0238] In some embodiments, an LNP comprising formula (xv) is used to deliver the DNA composition described herein to the liver and / or hepatocytes. [ka]

[0239] In some embodiments, LNPs comprising the formulation of formula (xvi) are used to deliver the DNA compositions described herein to lung endothelial cells.

[0240] In some embodiments, LNPs comprising formulations of formula (xvii), xviii, or xix are used to deliver the DNA compositions described herein to lung endothelial cells. [ka]

[0241] In some embodiments, the compositions described herein, for example, lipid compounds used to form lipid nanoparticles for the delivery of nucleic acids (e.g., RNA) described herein, are prepared by one of the following reactions: [ka]

[0242] In some embodiments, the compositions described herein (e.g., nucleic acids or proteins) are provided in LNPs containing ionizable lipids. In some embodiments, the ionizable lipid is, for example, heptadecan-9-yl8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), as described in Example 1 of U.S. Patent No. 9,867,888 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is, for example, 9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate (LP01), as synthesized in Example 13 of International Publication No. 2015 / 095340 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is di((Z)-nonano-2-en-1-yl)9-((4-dimethylamino)-butanoyl)oxy)heptadecanedioate (L319), for example, as synthesized in Example 7, 8, or 9 of U.S. Patent Application Publication No. 2012 / 0027803 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azandiyl)bis(dodecane-2-ol)(C12-200), for example, as synthesized in Example 14 and 16 of International Publication No. 2010 / 053572 (which is incorporated herein by reference in its entirety).In some embodiments, the ionizable lipid is the imidazole cholesterol ester (ICE) lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthrene-3-yl3-(1H-imidazole-4-yl)propanoate, for example, structure (I) from International Publication No. 2020 / 106946 (which is incorporated herein by reference in its entirety).

[0243] In some embodiments, the ionizable lipid may be a cationic lipid, an ionizable cationic lipid, for example, a cationic lipid that can exist in a positively charged or neutral form depending on the pH, or an amine-containing lipid that can be readily protonated. In some embodiments, the cationic lipid is a lipid that can be positively charged, for example, under physiological conditions. An exemplary cationic lipid contains one or more positively charged amine groups. In some embodiments, the lipid particles include cationic lipids in formulations with one or more of the following: neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structural lipids (e.g., sterols), PEG, cholesterol, and polymer conjugate lipids. In some embodiments, the cationic lipid may be an ionizable cationic lipid. The exemplary cationic lipids disclosed herein may have an effective pKa greater than 6.0. In embodiments, the lipid nanoparticles may include a second cationic lipid having a different effective pKa (e.g., higher than the first effective pKa) from the first cationic lipid. Lipid nanoparticles may comprise 40–60 mol percent of cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and therapeutic agents, such as nucleic acids (e.g., RNA) described herein, encapsulated within or bound to the lipid nanoparticles. In some embodiments, nucleic acids are compounded simultaneously with cationic lipids. Nucleic acids may be adsorbed onto the surface of LNPs, such as LNPs containing cationic lipids. In some embodiments, nucleic acids may be encapsulated within LNPs, such as LNPs containing cationic lipids. In some embodiments, lipid nanoparticles may comprise a target moiety coated with, for example, a targeting agent. In embodiments, the LNP formulation is biodegradable.In some embodiments, lipid nanoparticles comprising one or more lipids described herein, for example, formula (i), (ii), (vii), and / or (ix), encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% RNA molecules.

[0244] Examples of ionizable lipids that may be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of International Publication No. 2019051289 (incorporated herein by reference). Additional examples of lipids include, but are not limited to, one or more of the following formulas: X of U.S. Patent Application Publication No. 2016 / 0311759; I of U.S. Patent Application Publication No. 20150376115 or U.S. Patent Application Publication No. 2016 / 0376224; I, II, or III of U.S. Patent Application Publication No. 20160151284; I, IA, II, or IIA of U.S. Patent Application Publication No. 20170210967; U.S. Patent Application Publication No. 20150140070 Ic of the specification; A of U.S. Patent Application Publication No. 2013 / 0178541; I of U.S. Patent Application Publication No. 2013 / 0303587 or U.S. Patent Application Publication No. 2013 / 0123338; ​​I of U.S. Patent Application Publication No. 2015 / 0141678; II, III, IV, or V of U.S. Patent Application Publication No. 2015 / 0239926; I of U.S. Patent Application Publication No. 2017 / 0119904; I or of International Publication Brochure No. 2017 / 117528 II; Part A of the specification of U.S. Patent Application Publication No. 2012 / 0149894; Part A of the specification of U.S. Patent Application Publication No. 2015 / 0057373; Part A of the brochure of International Publication No. 2013 / 116126; Part A of the specification of U.S. Patent Application Publication No. 2013 / 0090372; Part A of the specification of U.S. Patent Application Publication No. 2013 / 0274523; Part A of the specification of U.S. Patent Application Publication No. 2013 / 0274504; Part A of the specification of U.S. Patent Application Publication No. 2013 / 0053572; International Publication No. 2013 / 01 Pamphlet No. 6058, Part A; Pamphlet No. 2012 / 162210, Part A; Specification I of U.S. Patent Application Publication No. 2008 / 042973; Specification I, II, III, or IV of U.S. Patent Application Publication No. 2012 / 01287670; Specification I or II of U.S. Patent Application Publication No. 2014 / 0200257; Specification I, II, or III of U.S. Patent Application Publication No. 2015 / 0203446; Specification I or III of U.S. Patent Application Publication No. 2015 / 0005363;Sections I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV of U.S. Patent Publication No. 2014 / 0308304; Sections I, II, III, or IV of U.S. Patent Publication No. 2013 / 0338210; Sections I, II, III, or IV of International Publication No. 2009 / 132131; Section A of U.S. Patent Publication No. 2012 / 01011478; Section I or XXXV of U.S. Patent Publication No. 2012 / 0027796; Section XIV or XVII of U.S. Patent Publication No. 2012 / 0058144; U.S. Patent Publication No. 2013 / 0 Specification No. 323269; Specification I of U.S. Patent Application Publication No. 2011 / 0117125; Specification I, II, or III of U.S. Patent Application Publication No. 2011 / 0256175; Specification I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII of U.S. Patent Application Publication No. 2012 / 0202871; Specification I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of U.S. Patent Application Publication No. 2011 / 0076335; Specification I or II of U.S. Patent Application Publication No. 2006 / 008378; U.S. I of National Patent Application Publication No. 2013 / 0123338; ​​I or XAYZ of U.S. Patent Application Publication No. 2015 / 0064242; XVI, XVII, or XVIII of U.S. Patent Application Publication No. 2013 / 0022649; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I or II of U.S. Patent Application Publication No. 2010 / 0062967; I-X of U.S. Patent Application Publication No. 2013 / 0189351; U.S. Patent Application Publication No. I of U.S. Patent Application Publication No. 2014 / 0039032; V of U.S. Patent Application Publication No. 2018 / 0028664; I of U.S. Patent Application Publication No. 2016 / 0317458; I of U.S. Patent Application Publication No. 2013 / 0195920; 5, 6, or 10 of U.S. Patent No. 10,221,127; III-3 of International Publication Brochure No. 2018 / 081480; I-5 or I-8 of International Publication Brochure No. 2020 / 081938; 18 or 25 of U.S. Patent No. 9,867,888; A of U.S. Patent Application Publication No. 2019 / 0136231;Examples include: International Publication No. 2020 / 219876, Part II; U.S. Patent Application Publication No. 2012 / 0027803, Specification 1; U.S. Patent Application Publication No. 2019 / 0240349, Specification OF-02; U.S. Patent No. 10,086,013, Specification 23; Miao et al (2020), cKK-E12 / A6; International Publication No. 2010 / 053572, Part C12-200; Dahlman et al (2017), Part 7C1; Whitehead et al, Part 304-O13 or 503-O13; U.S. Patent No. 9,708,628, Specification TS-P4C2; International Publication No. 2020 / 106946, Part I; International Publication No. 2020 / 106946, Part I.

[0245] In some embodiments, the ionizable lipid is, for example, MC3(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3), as described in Example 9 of International Publication No. 2019051289A9 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is, for example, lipid ATX-002, as described in Example 10 of International Publication No. 2019051289A9 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocosa-13,16-diene-l-amine (compound 32), as described in Example 11 of International Publication No. 2019051289A9 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, as described in Example 12 of International Publication No. 2019051289A9 (which is incorporated herein by reference in its entirety).

[0246] Examples of noncationic lipids include, but are not limited to, distearoyl-sn-glycerol-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), and palmitoyloleoylphosphatidyl 18-1-trans ethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (e.g., 16-O-monomethylPE), dimethyl-phosphatidylethanolamine (e.g., 16-O-dimethylPE), l8-l-trans PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), diylcoyl phosphatidylcholine (DEPC), palmitoyl oleoyl phosphatidyl phosphate Examples include phatidylglycerol (POPG), dierydoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetylphosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof.It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having a C10-C24 carbon chain, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Additional exemplary lipids, in certain embodiments but not limited to, are those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386 (incorporated herein by reference). Such lipids include plant lipids that have been shown to improve hepatic transfection with mRNA (e.g., DGTS) in some embodiments.

[0247] Other examples of noncationic lipids suitable for use in lipid nanoparticles include, but are not limited to, nonphospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine lauryl sulfate, alkyl-aryl sulfate polyethyl oxy-fatty acid amides, dioctadecyldimethylammonium bromide, ceramides, and sphingomyelin. Other noncationic lipids are described in International Publication No. 2017 / 099823 or U.S. Patent Application Publication No. 2018 / 0028664 (the entire content of which is incorporated herein by reference).

[0248] In some embodiments, the noncationic lipid is oleic acid or a compound of formula I, II, or IV of U.S. Patent Application Publication 2018 / 0028664 (which is incorporated herein by reference in its entirety). The noncationic lipid may account for, for example, 0 to 30% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the noncationic lipid content is 5 to 20% (mol) or 10 to 15% (mol) of the total lipids present in the lipid nanoparticles. In embodiments, the molar ratio of ionizable lipids to neutral lipids is in the range of about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0249] In some embodiments, the lipid nanoparticles do not contain any phospholipids.

[0250] In some embodiments, lipid nanoparticles may further contain components such as sterols to provide membrane integrity. One exemplary sterol that may be used in lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs, e.g., 5α-cholestanol, 53-coprostanol, cholesteryl-(2 , Examples include hydroxy-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs, such as 5a-cholestane, cholestane, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT International Publication No. 2009 / 127060 and U.S. Patent Application Publication No. 2010 / 0130588 (each incorporated herein by reference in whole).

[0251] In some embodiments, components that provide membrane integrity, such as sterols, may account for 0-50% (mol) of the total lipids present in the lipid nanoparticles (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, such components account for 20-50% (mol) or 30-40% (mol) of the total lipid content of the lipid nanoparticles.

[0252] In some embodiments, lipid nanoparticles may include polyethylene glycol (PEG) or conjugated lipid molecules. Generally, these are used to inhibit aggregation of lipid nanoparticles and / or provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, for example, a (methoxypolyethylene glycol) conjugated lipid.

[0253] Examples of PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (e.g., l-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), and PEG-succinate diacylglycerol (PEGS-DAG) (4-0-(2',3'-di(tetradecanoyloxy)propyl- Examples include l-O-(w-methoxy(polyethoxy)ethyl)butanediate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-l,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Additional exemplary PEG-lipid conjugates are, for example, U.S. Patent No. 5,885,613, U.S. Patent No. 6,287,591, and U.S. Patent Application Publication No. 2003 / 0077829. The specifications of U.S. Patent Application Publication No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2010 / 0130588, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2017 / 0119904, and U.S. Patent Application No. 099823 (all of which are incorporated herein by reference in their entirety) As described herein. In some embodiments, the PEG-lipid is a compound of formula III, III-aI, III-a-2, III-b-1, III-b-2, or V of U.S. Patent Publication No. 2018 / 0028664 (the entire content of which is incorporated herein by reference). In some embodiments, the PEG-lipid is of formula II of U.S. Patent Publication No. 20150376115 or U.S. Patent Publication No. 2016 / 0376224 (both of which the entire content of which is incorporated herein by reference).In some embodiments, the PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipids may be PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (l-[8'-(cholesta-5-ene-3[β]-oxy)carboxamide-3',6'-dioxaoctanyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB(3,4 The PEG-lipid may be one or more of -ditetradecoxylbenzyl-[ω]-methyl-poly(ethylene glycol) ether) and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid is... [ka] Includes structures selected from.

[0254] In some embodiments, lipids conjugated with molecules other than PEG may also be used instead of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates may be used instead of or in addition to PEG-lipids.

[0255] Exemplary conjugate lipids, namely PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer lipids, are described in PCT and LIS patent applications listed in Table 2 of International Publication No. 2019051289A9 (all of which are incorporated herein by reference in their entirety).

[0256] In some embodiments, PEG or conjugate lipids may account for 0-20% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the PEG or conjugate lipid content is 0.5-10% or 2-5% (mol) of the total lipids present in the lipid nanoparticles. The molar ratios of ionizable lipids, noncationic lipids, sterols, and PEG / conjugate lipids may be varied as needed. For example, the lipid particles may contain 30-70% ionizable lipids, 0-60% cholesterol, 0-30% noncationic lipids, and 1-10% conjugate lipids per mole or total weight of the composition. Preferably, the composition contains 30-40% ionizable lipids, 40-50% cholesterol, and 10-20% noncationic lipids per mole or total weight of the composition. In some other embodiments, the composition comprises 50-75% ionizable lipids per mole or total weight of the composition, 20-40% cholesterol per mole or total weight of the composition, 5-10% noncationic lipids per mole or total weight of the composition, and 1-10% conjugate lipids per mole or total weight of the composition. The composition may also contain 60-70% ionizable lipids per mole or total weight of the composition, 25-35% cholesterol per mole or total weight of the composition, and 5-10% noncationic lipids per mole or total weight of the composition. The composition may also contain up to 90% ionizable lipids per mole or total weight of the composition and 2-15% noncationic lipids per mole or total weight of the composition.The formulation may also contain, for example, 8-30% ionizable lipids per mole or total weight of the composition, 5-30% noncationic lipids per mole or total weight of the composition, and 0-20% cholesterol per mole or total weight of the composition; 4-25% ionizable lipids per mole or total weight of the composition, 4-25% noncationic lipids per mole or total weight of the composition, 2-25% cholesterol per mole or total weight of the composition, 10-35% conjugate lipids per mole or total weight of the composition, and 5% cholesterol per mole or total weight of the composition; or the composition may contain The lipid nanoparticle formulation may contain 2-30% ionizable lipids per mole or total weight of the composition, 2-30% noncationic lipids per mole or total weight of the composition, 1-15% cholesterol per mole or total weight of the composition, 2-35% conjugate lipids per mole or total weight of the composition, and 1-20% cholesterol per mole or total weight of the composition; or up to 90% ionizable lipids and 2-10% noncationic lipids per mole or total weight of the composition, or 100% cationic lipids per mole or total weight of the composition. In some embodiments, the lipid particle formulation contains ionizable lipids, phospholipids, cholesterol and PEGylated lipids in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation contains ionizable lipids, cholesterol and PEGylated lipids in a molar ratio of 60:38.5:1.5.

[0257] In some embodiments, the lipid particles include ionizable lipids, noncationic lipids (e.g., phospholipids), sterols (e.g., cholesterol), and PEGylated lipids, where the molar ratio of lipids is in the range of 20 to 70 mole percent for ionizable lipids, with a target of 40 to 60; the molar percentage of noncationic lipids is in the range of 0 to 30, with a target of 0 to 15; the molar percentage of sterols is in the range of 20 to 70, with a target of 30 to 50; and the molar percentage of PEGylated lipids is in the range of 1 to 6, with a target of 2 to 5.

[0258] In some embodiments, the lipid particles contain ionizable lipids / noncationic lipids / sterols / conjugate lipids in a molar ratio of 50:10:38.5:1.5.

[0259] In one embodiment, the disclosure provides a lipid nanoparticle formulation comprising phospholipids, lecithin, phosphatidylcholine, and phosphatidylethanolamine.

[0260] In some embodiments, one or more additional compounds may also be included. These compounds may be administered separately, or the additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticles may contain other compounds in addition to nucleic acids or at least a second nucleic acid different from the first nucleic acid. The other additional compounds may be selected from the group consisting of, but are not limited to, small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptide mimetic drugs, nucleic acids, nucleic acid analogs and derivatives thereof, extracts made from biomaterials, or any combination thereof.

[0261] In some embodiments, LNPs are directed to specific tissues by the addition of a targeting domain. For example, a biological ligand may be presented on the surface of an LNP to facilitate interaction with cells presenting a related receptor, thereby driving binding to the receptor and cargo delivery by the cells to tissues expressing the receptor. In some embodiments, the biological ligand may be a ligand that drives delivery to the liver; for example, a GalNAc-presenting LNP results in the delivery of nucleic acid cargo to hepatocytes presenting the asialoglycoprotein receptor (ASGPR). The paper by Akinc et al., Mol Ther 18(7):1357-1364 (2010), teaches the conjugation of a trivalent GalNAc ligand to a PEG-lipid (GalNAc-PEG-DSG) for obtaining ASGPR-dependent LNPs for an observable LNP cargo effect (see, e.g., Figure 6 in Akinc et al. 2010 above).For example, folate, transferrin, or other ligand-presenting LNP formulations incorporating antibodies are described in International Publication No. 2017223135 (which is incorporated herein by reference in its entirety), and the references used therein, namely, Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319;Akinc et al.,Mol Ther.2010 18:1357-1364;Srinivasan et al.,Methods Mol Biol.2012 820:105-116;Ben-Arie et al.,Methods Mol Biol.2012 757:497-507;Peer 2010 J Control Release.20:63-68;Peer et al.,Proc Natl Acad Sci US A.2007 104:4095-4100;Kim et al.,Methods Mol Biol.2011 721:339-353;Subramanya et al.,Mol Ther.2010 18:2028-2037;Song et al.,Nat Biotechnol.2005 This is described in 23:709-717; Peer et al., Science. 2008 319:627-630; and Peer and Lieberman, Gene Ther. 2011 18:1127-1133.

[0262] In some embodiments, LNPs are selected for tissue-specific activity by adding a Selective Organ Targeting (SORT) molecule to formulations containing conventional components, such as ionizable cationic lipids, amphiphilic phospholipids, cholesterol, and poly(ethylene glycol) (PEG) lipids. The teachings of Cheng et al. Nat Nanotechnol 15(4):313-320 (2020) demonstrate that the addition of an auxiliary “SORT” component precisely alters the in vivo RNA delivery profile and mediates tissue-specific (e.g., lung, liver, spleen) gene delivery and editing depending on the percentage and biophysical properties of the SORT molecule.

[0263] In some embodiments, the LNP comprises a biodegradable, ionizable lipid. In some embodiments, the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate (also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate) or another ionizable lipid. For example, see International Publication No. 2019 / 067992, International Publication No. 2017 / 173054, International Publication No. 2015 / 095340, and International Publication No. 2014 / 136086, and the lipids in the references provided therein. In some embodiments, the terms cationic and ionizable with respect to LNP lipids are synonymous; for example, ionizable lipids are cationic depending on pH.

[0264] In some embodiments, the average LNP diameter of the LNP formulation may be in the range of several tens to several hundred nm, as measured, for example, by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of the LNP formulation may be in the range of about 40 nm to about 150 nm, for example, about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average LNP diameter of the LNP formulation may be approximately 50 nm to 100 nm, approximately 50 nm to 90 nm, approximately 50 nm to 80 nm, approximately 50 nm to 70 nm, approximately 50 nm to 60 nm, approximately 60 nm to 100 nm, approximately 60 nm to 90 nm, approximately 60 nm to 80 nm, approximately 60 nm to 70 nm, approximately 70 nm to 100 nm, approximately 70 nm to 90 nm, approximately 70 nm to 80 nm, approximately 80 nm to 100 nm, approximately 80 nm to 90 nm, or approximately 90 nm to 100 nm. In some embodiments, the average LNP diameter of the LNP formulation may be approximately 70 nm to 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation may be approximately 80 nm. In some embodiments, the average LNP diameter of the LNP formulation may be approximately 100 nm. In some embodiments, the average LNP diameter of the LNP formulation is approximately 1 mm to 500 mm, 5 mm to 200 mm, 10 mm to 100 mm, 20 mm to 80 mm, 25 mm to 60 mm, 30 mm to 55 mm, 35 mm to 50 mm, or 38 mm to 42 mm.

[0265] LNPs can be relatively homogeneous in some cases. The polydispersity index can be used to indicate the homogeneity of LNPs, for example, the particle size distribution of lipid nanoparticles. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow particle size distribution. LNPs may have a polydispersity index of about 0 to about 0.25, for example, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of LNPs may be about 0.10 to about 0.20.

[0266] The zeta potential of LNPs can be used to indicate the interfacial dynamic potential of a composition. In some embodiments, the zeta potential may represent the surface charge of the LNPs. Lipid nanoparticles with relatively low positive or negative charges are generally preferred because more highly charged species may unnecessarily interact with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP may be approximately -10mV to approximately +20mV, approximately -10mV to approximately +15mV, approximately -10mV to approximately +10mV, approximately -10mV to approximately +5mV, approximately -10mV to approximately 0mV, approximately -10mV to approximately -5mV, approximately -5mV to approximately +20mV, approximately -5mV to approximately +15mV, approximately -5mV to approximately +10mV, approximately -5mV to approximately +5mV, approximately -5mV to approximately 0mV, approximately 0mV to approximately +20mV, approximately 0mV to approximately +15mV, approximately 0mV to approximately +10mV, approximately 0mV to approximately +5mV, approximately +5mV to approximately +20mV, approximately +5mV to approximately +15mV, or approximately +5mV to approximately +10mV.

[0267] The efficiency of protein and / or nucleic acid encapsulation represents the amount of protein and / or nucleic acid encapsulated by LNPs or otherwise bound to LNPs after preparation, compared to the initial amount provided. High encapsulation efficiency (e.g., nearly 100%) is desirable. Encapsulation efficiency can be measured, for example, by comparing the amount of protein and / or nucleic acid in a solution containing lipid nanoparticles before and after degrading the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid (e.g., RNA) in a solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid (e.g., RNA) in a solution. In the case of lipid nanoparticles described herein, the encapsulation efficiency of proteins and / or nucleic acids may be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.

[0268] LNP may optionally include one or more coatings. In some embodiments, LNP may be formulated into capsules, films, or tablets having the coatings. Capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0269] Additional exemplary lipids, formulations, methods, and characterizations of LNPs are taught in International Publication No. 2020061457 (which is incorporated herein by reference in its entirety). See also Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Mater (2021). https: / / doi.org / 10.1038 / s41578-021-00358-0.

[0270] In some embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA Transfection Reagent (Mirus Bio). In certain embodiments, LNPs are formulated using GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, LNPs are formulated using 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA or MC3), the formulation and in vivo use of which are taught in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012) (the whole is incorporated herein by reference).

[0271] CRISPR-Cas systems, such as LNP formulations optimized for the delivery of Cas9-gRNA RNP, gRNA, and Cas9 mRNA, are described in International Publication No. 2019067992 and International Publication No. 2019067910 (both incorporated by reference).

[0272] Additional specific LNP formulations useful for nucleic acid delivery are described in U.S. Patent No. 8,158601 and U.S. Patent No. 8,168775 (both incorporated by reference), including formulations used in patisirane marketed under the name ONPATTRO.

[0273] The exemplary doses of DNA described herein in conjunction with LNP may include approximately 0.1, 0.25, 0.3, 0.5, 1, 2, 3, 4, 5, 6, 8, 10, or 100 mg / kg (DNA).

[0274] The following embodiments are possible: A. Lipid nanoparticles (LNPs) comprising ssDNA constructs, sequences, or compositions described herein. B. The LNP according to Embodiment A, comprising a cationic lipid. C. Cationic lipids [ka] The LNP according to Embodiment B, having a structure represented by [the given formula]. D. An LNP according to any one of Embodiments A to C, further comprising one or more neutral lipids, for example DSPC, DPPC, DMPC, DOPC, POPC, DOPE, SM, a steroid, for example cholesterol, and / or one or more polymer conjugate lipids, for example pegylated lipids, for example PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer, or PEG dialkyloxypropyl carbamate.

[0275] In embodiments, LNP formulations comprising ssDNA or constructs described herein may be targeted to desired cell types by surface decoration with targeted effectors. Examples of such targeted effectors include cell-specific receptor ligands that bind to target cells; antibodies or other binders to target cells; centrins; cell-permeable peptides; and peptides that enable endosomal escape (e.g., GALA, KALA). For an overview, see, for example, Tables 1 and 2 of Tai & Gao. 2017. Adv Drug Deliv Rev. 110-111:157-168.

[0276] In embodiments, LNP formulations comprising the ssDNA or constructs described herein may be co-administered with an adjuvant, for example, co-delivered in the same formulation as the adjuvant.

[0277] Route of administration The ssDNA or constructs described herein are introduced into cells, tissues, or subjects by any preferred route.

[0278] Administration to target cells or tissues (e.g., ex vivo) may be carried out by methods known in the art, such as transfection, e.g., transient or stable transfection using reagents (e.g., liposomes, calcium phosphate) or by physical means (e.g., electroporation, gene gun, microinjection, microfluidic shear, cell squeezing). Other methods are described, for example, in Rad et al. 2021.Adv.Mater.33:2005363, which is incorporated herein by reference.

[0279] Administration to subjects, such as mammals, such as humans, may be carried out by parenteral (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous, intracranial) routes; or by topical, transdermal, or transcutaneous administration. Other preferred routes include oral, rectal, transmucosal, intranasal, inhalation (e.g., via aerosol), oral cavity (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intraendothelial, intrauterine (or intraocular), intrauterine (or intraocular), intrapleural, intracerebral, intraarticular, topical, and intralymphatic. Direct injection into tissues or organs (e.g., into the liver, eye, skeletal muscle, cardiac muscle, diaphragm, muscle, or brain) is also included.

[0280] Integration into the genome In some embodiments, the ssDNA described herein integrates into the cell's genome when introduced into a cell. In other embodiments, the ssDNA described herein does not integrate into the cell's genome when introduced into a cell. In some embodiments, the ssDNA described herein integrates into the target genome at a frequency of less than 0.0001%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the ssDNA copies administered to the target.

[0281] In some embodiments, the ssDNA described herein does not contain homology arms. In some embodiments, the ssDNA described herein does not contain two homology arms. In some embodiments, the ssDNA described herein does not have more than 70%, 80%, or 90% identity with any 15-nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not have more than 70% identity with any 15-nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not have more than 70%, 80%, 90%, or 95% identity with any 25-nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not have more than 70%, 80%, 90%, 95%, or 98% identity with any 50-nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not have more than 70%, 80%, 90%, 95%, 98%, or 99% identity with any 100-nucleotide portion of the reference human genome hg38.

[0282] In some embodiments, the ssDNA described herein is not a template for homologous recombination repair (HDR). In some embodiments, the ssDNA described herein is not involved in microhomology-mediated end joining (MMEJ). In some embodiments, the ssDNA described herein is not involved in DNA repair.

[0283] In some embodiments, the formulation does not contain a nuclease (e.g., a CRISPR nuclease, e.g., a CRISPR nuclease that produces single-strand or double-strand breaks). In some embodiments, the formulation does not contain a protein that promotes the integration of ssDNA into the genome, for example, the protein includes a recombinase or an integrase.

[0284] Purpose The ssDNA and constructs described herein may be used in therapeutic or medical applications for subjects, e.g., humans. The descriptions of pharmaceutical compositions provided herein relate primarily to pharmaceutical compositions suitable for administration to humans, but it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other animals. The subjects may be any animals, e.g., mammals, e.g., humans or non-human mammals. In embodiments, the subjects are vertebrates (e.g., mammals, birds, fish, reptiles, or amphibians). In embodiments, the subjects are humans. In embodiments, the subjects of the method are non-human mammals. In embodiments, the subjects are non-human mammals, e.g., non-human primates (e.g., monkeys, apes), ungulates (e.g., cattle, buffalo, sheep, goats, pigs, camels, llamas, alpacas, deer, horses, donkeys), carnivores (e.g., dogs, cats), rodents (e.g., rats, mice), or animals of the order Lagomorpha (e.g., rabbits). In the embodiments, the subjects are birds, for example, members of the bird taxonomy of the orders Galliformes (e.g., chickens, turkeys, pheasants, quail), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In the embodiments, the subjects are invertebrates, for example, arthropods (e.g., insects, arachnids, crustaceans), nematodes, annelids, parasitic worms, or mollusks.

[0285] In some embodiments, the ssDNA or constructs described herein impart the biological effects of the effector, such as the expression of a therapeutic polypeptide, to host cells, tissues, or subjects for at least 2, 3, 4, 5, 6 days or 1 week; at least 8, 9, 10, 12, 14 days or 2 weeks; at least 16, 18, 20 days or 3 weeks; at least 22, 24, 25, 27, 28 days or 1 month; at least 2 months, 3 months, 4 months, 5 months, 6 months or longer; and over periods of 1 week to 6 months, 1 month to 6 months, and 3 months to 6 months.

[0286] In embodiments, the ssDNA or constructs described herein may be used to deliver effectors, such as those described herein, to cells, tissues, or subjects.

[0287] In embodiments, the ssDNA or constructs described herein may be used to modulate (e.g., increase or decrease) biological parameters in cells, tissues, or subjects. These biological parameters may include increased or decreased gene expression of target genes in target cells, tissues, or subjects.

[0288] In embodiments, the ssDNA or constructs described herein may be used to treat cells, tissues, or subjects in need by administering the ssDNA or constructs described herein to such cells, tissues, or subjects. [Examples]

[0289] Example 1: Design and assembly of plasmid templates for covalently ring-closed ssDNA This example describes a method for preparing a plasmid template for an ssDNA construct. In this example, the construct template is designed using the following specific sequence components. • Promoter Ef1a: [ka] • Effector sequence encoding the model / marker protein (mCherry): [ka] any: NTS:SV40 enhancer:5'-cccaagaagaagaggaaagtc-3'(Sequence ID 1) • Maintenance sequence: Human interferon-β MAR 5' tataattcactggaatttttttgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3' (SEQ ID NO: 39) • Second chain motif: AAV2 wild-type ITR 5' aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg-3' (SEQ ID NO: 26)

[0290] Plasmid templates are designed using these elements with standard DNA design software. Assembly is performed by Golden Gate Assembly according to published protocols and commercially available kits (Marillonnet & Gruetzner. 2020. Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline. Current Protocols in Molecular Biology. 130:e115; Golden Gate Assembly Protocol for Using NEB Golden Gate Assembly Mix (E1600) (New England Biolabs)). Golden Gate assembly of the designed construct is performed using a 120 bp long set of primers, including the first 30 bp to match the relevant adjacent fragments, the next 60 bp to encode a new sequence, and the last 30 bp to anneal to the target sequence. The fragments are assembled into the final construct design (NEB Golden Gate Assembly Kit), and the sequence is verified by Sanger Sequencing (Sigma Aldrich) according to the manufacturer's protocol.

[0291] Example 2: Conversion from plasmid DNA to circular ssDNA This example illustrates the generation of ssDNA from a template prepared as described in Example 1, according to the method described in Minev et al., 2019, Rapid in vitro production of single-stranded DNA, Nucleic Acids Research, Volume 47, Issue 22:11956-11962, which is incorporated herein by reference. Briefly, PCR using forward primers having methanol-responsive polymers generates tagged amplicons that allow for selective precipitation of modified strands under denaturing conditions. Unmodified and modified bases can be incorporated into the construct using these methods.

[0292] The final sample is analyzed using NanoDrop to determine its purity and concentration. The construct sequence is confirmed by next-generation sequencing according to the manufacturer's protocol (Illumina).

[0293] Example 3: Generation of circularized ssDNA The linear ssDNA construct prepared as described in Example 2 is circularized, for example, covalently closed, using a DNA ligase, such as Ampligase® Thermotable DNA ligase (Lucigen, MA023E-Ampligase® Thermotable DNA ligase) or CircLigase® II ssDNA ligase (Lucigen, MA298E-CircLigase-II-ssDNA-ligase). Ampligase ligates DNA ends that anneal adjacent to each other in complementary DNA sequences, while CircLigase II ssDNA ligase ligates ssDNA ends in the absence of complementary sequences. Any remaining linear DNA construct after ligation is removed by treatment with exonuclease I and exonuclease III. Agarose gel electrophoresis of the starting product and the resulting product is performed to confirm that the DNA construct is circularized.

[0294] Example 4: Formulation of circular ssDNA using LNPs This example illustrates a method for formulating a construct prepared using lipid nanoparticles as described in the previous example.

[0295] Nucleic acid constructs are combined with lipid components by a microfluidic device according to the method described in Chen et al. 2012. J Am Chem Soc. Volume 134, Issue 16:6948-6951. Briefly, the microfluidic device is prepared in polydimethylsiloxane (PDMS) according to a standard lithography procedure (McDonald & Whitesides. 2002. Accounts Chem Res Volume 35, Issue 7:491-499). Typically, lipid components containing cationic lipids, cholesterol, helper lipids, polyethylene glycol-modified lipids, and lipids that promote targeted partial conjugation (optional) are combined and solubilized in 90% ethanol. The nucleic acid construct is dissolved in a buffer. The nucleic acid solution, lipid solution, and phosphate-buffered saline (PBS) are injected into the microfluidic device. The newly prepared LNP is dialyzed against PBS buffer using a membrane with a 3.5 kD MWCO to remove ethanol and exchange buffer.

[0296] LNPs were characterized for effective diameter, polydispersity, and zeta potential using dynamic light scattering (DLS) (ZetaPALS, Brookhaven Instruments, NY, 15mW laser, incident beam 676nm); and total nucleic acid concentration was determined using the Quant-iT® OliGreen® ssDNA Assay Kit according to the manufacturer's protocol (ThermoFisher Scientific, O11492).

[0297] Example 5: Evaluation of intracellular innate immune response in vitro This example illustrates a method for testing gene expression and a method for determining the effect of a construct on the innate immune response of cultured cells.

[0298] The experimental constructs are prepared in the same manner as in Examples 1-4 above. The constructs and controls are administered by electroporation to cells selected from HEK, keratinocytes, macrophages, T cells, and epithelial cells at multiple concentrations. After electroporation, the cells are transferred to the final culture vessel. The constructs formulated with LNP are administered directly to the cells in a well plate.

[0299] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells are first washed with PBS before flow cytometry analysis. All flow cytometry is performed in a Miltenyi MACSQuant VYB. For detection of the mCherry signal, a yellow laser (wavelength 561 nm) is used for excitation, and a 615 / 620 nm emission filter is used. 20,000 events are recorded for each sample, and the data are analyzed using Flowjo V.9.0 software. Cells are first gated in FSC-A and SSC-A plots to remove cell debris. Populations are further plotted in FSC-A and FSC-H plots so as to surround single-cell populations. Finally, the percentage of expressing cells is determined using a bivariate plot between fluorescent signal-expressing and non-expressing cells. The level of expression within each cell is determined using the distribution of expressing cells. Expression analysis is performed at multiple time points.

[0300] As described in Jakobsen et al. 2013. Proc Natl Acad Sci USA Volume 110, Issue 48:E4571-80, qPCR is performed in cells to determine the RNA level of IFN-b in test cells. Briefly, the probe-primer set used in qPCR is human IFN-b (ThermoFisher, Hs01077958_s1) and β-actin (ThermoFisher, Hs00357333_g1). The analysis is performed using a pre-prepared Taqman assay and RNA-to-Ct one-step kit (Applied Biosystems). qPCR is performed using the MX3005 system (Stratagene). RNA expression is normalized to β-actin and associated untreated controls. Data are expressed as mean ± SEM from biological replicates.

[0301] ELISA is performed in the cell supernatant according to the manufacturer's protocol to determine the secretion level of IFN-β.

[0302] Example 6. Preparation of circular single-stranded DNA (ssDNA) This example demonstrates the preparation of circular ssDNA.

[0303] Plasmid DNA (1 ng / 50 µl PCR reaction) was used as a template for PCR amplification using Q5 polymerase (M0494L, New England Biolabs). Other commercially available polymerases may also be used. In addition to containing sequences complementary to the plasmid, the primers contained further sequences useful in downstream processes: a. Nicking enzyme recognition sequence; b. Restriction enzyme recognition sequences (e.g., BsaI, KpnI, or NheI) used to generate sticky ends in DNA after restriction enzyme digestion and facilitate DNA circularization; and c. Additional bases to enhance restriction enzyme digestion efficiency (e.g., 5'-CCGTGGTCCTTC-3') (SEQ ID NO: 40).

[0304] The PCR product was purified using a DNA purification column (M0494L, Zymo Research). The DNA was digested overnight using a restriction enzyme corresponding to the restriction enzyme recognition sequence, such as BsaI-HF-V2 (R3733L, New England Biolabs). Next, the DNA was purified using a DNA purification column.

[0305] The digested DNA was circularized using T4 DNA ligase (M0202M, New England Biolabs) at room temperature for 1 hour. The non-circularized DNA was degraded by incubation with T5 exonuclease (M0663L, New England Biolabs) at 37°C for 1 hour. Linear dsDNA was digested using T5 exonuclease, but circular dsDNA was not. The DNA was purified using a DNA purification column. Other similar methods, such as agarose gel purification, may also be used.

[0306] Circular dsDNA was incubated with a nicking endonuclease (e.g., Nb.BsrDI, R0648L, New England Biolabs). This endonuclease is sequence-specific and cleaves only one strand in the dsDNA molecule. The nicking DNA strand was removed by incubating the DNA with T7 exonuclease (New England Biolabs, M0263) at 25°C for 30 minutes. Exonuclease III (M0206, New England Biolabs) can also be used, for example, at 37°C for 30 minutes. The incubation of DNA with exonucleases is described in more detail in Example 7. The reaction samples were electrophoresed on an agarose gel to confirm the formation of circular ssDNA (nicking DNA migrates more slowly than circular ssDNA). Circular ssDNA was directly purified using a purification column (Oligo Clean & Concentrator, D4061, Zymo Research) or agarose gel purification (for 3kb samples, Long ssDNA Gel Extraction Kit, DS640, DiagnoCine). Circular ssDNA prepared by the methods described herein was shown to be resistant to degradation by exonuclease I, while linear ssDNA was degraded by exonuclease I (Figure 11).

[0307] The composition and purity of both single-stranded and double-stranded DNA were analyzed using the CRISPR Discovery Kit (DNF-930-K1000CP) on an Agilent 5300 Fragment Analyzer. Fresh dsDNA inlet buffer and electrophoresis gels, along with intercalating dyes, were prepared daily, while fresh marker trays and capillary conditioning solutions containing mineral oil overlays were prepared monthly. Buffers were prepared according to the manufacturer's specifications. Single-stranded DNA samples were diluted with water to a final concentration of 1 ng / uL, and double-stranded DNA samples were diluted with water to a final concentration of 100 pg / uL. For each sample well, 2uL of DNA sample was added to 22uL of dilution buffer (0.1x TE), and each sample was run in 2-4 replicates, with one well used for the MDK DNA ladder. The samples were electrophoresed using the instrument controller software with the default settings for the CRISPR Discovery Method (CRP-910-33).

[0308] The sample traces were analyzed using ProSize Data Analysis Software v4.0.2.7. Peak analysis conditions were set to 15 for "Peak Width (sec)", 75 for "Minimum Peak Height (RFU)", and 3 for the number of extra valley points, with "Valley to Valley Baseline" turned off. Manual baselines were set to -2 minutes from the lower marker and +2 minutes from the upper marker. Peaks were automatically detected by the software under these conditions, and peak widths were selected by the software unless manual adjustment was required, for example, due to wide peaks, peak shoulders, or multiple peaks within a narrow peak range.

[0309] The circular ssDNA and circular dsDNA of the two constructs (construction 029) and (construction 001) were purified and analyzed using the method described in this example. Each DNA preparation was analyzed in a Fragment Analyzer using 4× replication, and the sample traces are shown in Figures 3-9.

[0310] Notable peaks include: • Lower marker (LM) = 1 bp, • Residual peak at 19 bp (This peak was also present in the blank well and did not originate from the DNA preparation, therefore it was not considered in the final peak quantification value). • Primary peak, • Secondary peaks (impurities), and • Upper marker (UM) = 6000bp

[0311] Blankwell traces show the presence of a peak only at 19 bp (Figure 3). Constructor 029 circular ssDNA was quantified at 98.8% of the total peak area (n=4; Figure 4; Table 4). Constructor 029 circular dsDNA, constructor 001 circular dsDNA, constructor 001 circular ssDNA preparation #1, and constructor 001 circular ssDNA preparation #2 were each quantified at 100% of their respective samples, meaning no impurities were detected (n=4; Figures 5-8).

[0312] To evaluate the identification of circular dsDNA contamination in circular ssDNA preparations, 7.8 pg of construct 001 circular dsDNA was added per 1 ng of construct 001 circular ssDNA, and the lowest concentration at which a peak could be easily distinguished was examined. Peaks corresponding to circular dsDNA are indicated by red arrows (Figure 9). Decomposition of impurities was >6 pg / uL.

[0313] [Table 4]

[0314] In summary, this example describes the successful preparation of high-purity circular ssDNA from plasmid DNA.

[0315] Example 7. DNA incubation with exonuclease This example illustrates the effects of exonuclease III and T7 exonuclease on nick circular dsDNA. As described above, the specific manufacturing methods described herein involve treating nick circular dsDNA with one of these exonucleases to remove the nick strand and produce circular ssDNA. While these enzymes are generally considered to be specific to linear or nick DNA, this example demonstrates that these enzymes have some activity towards circular ssDNA. This example shows preferred digestion conditions for reducing the amount of nick DNA while retaining a high level of circular ssDNA.

[0316] 7.2 μg of circular dsDNA in 100 μl of 1×rCutSmart buffer (NEB, B6004S) was cleaved with 20 units of Nb.BsrDI (NEB, R0648L) at 37°C for 30 minutes. The enzyme was inactivated by heating the reaction mixture at 80°C for 20 minutes. Figure 10A shows the nick DNA construct visualized by DNA gel electrophoresis. The nick DNA was converted to ssDNA by incubating 50 μl of the sample (3.6 μg of DNA) with 7.5 units of T7 exonuclease (NEB, M0263L) at 25°C for 30 minutes (Figure 10B; lane 4), 1 hour (Figure 10B; lane 3), and 16 hours (Figure 10B; lane 2). The 30-minute incubation resulted in the loss of detectable nick DNA and the persistence of a large amount of circular ssDNA. In contrast, a 16-hour incubation period with T7 exonuclease resulted in some degradation of the circular single-stranded DNA.

[0317] This example also illustrates the effect of exonuclease I on linear and circular dsDNA. Figure 11 shows the degradation of the linear and circular ssDNA forms of construct 001 by exonuclease I. The circular ssDNA prepared by the method herein was shown to be resistant to degradation by exonuclease I, while the linear ssDNA was degraded by exonuclease I. This highlights the general resistance of circular DNA to exonucleases that naturally contribute to the intracellular degradation of DNA, including the intracellular degradation of therapeutic constructs.

[0318] Example 8: Evaluation of reporter gene expression in vitro This example demonstrates successful gene expression using a circular ssDNA construct in cultured cells.

[0319] The experimental constructs were prepared in the same manner as in Examples 1-4 above. The circular ssDNA constructs and controls used in this example are listed in Table 5. The constructs and controls were administered at multiple concentrations by electroporation using a Neon Transfection System (ThermoFisher, MPK5000). The recipient cell lines included HEKa keratinocytes (American Type Culture Collection (ATCC), PCS-200-011), HepG2 hepatocytes (ATCC, HB-8065), U2OS osteosarcoma cells (ATCC, HTB-96), and HEK293 epithelial cells (ATCC, CRL-1573). In the electroporation experiment, approximately 5 × 10⁻⁶ cells were obtained. 6 Cells were electroporated in DPBS buffer at 1500 volts for 30 ms. After electroporation, the cells were transferred to the final culture vessel. Constructs formulated with LNP were directly administered to the cells in well plates.

[0320] [Table 5]

[0321] Furthermore, the experimental constructs and controls were administered by lipid transfection (lipofection). Lipofection for DNA was performed in HEKa, HepG2, HEK293, and U2OS cells using Lipofectamine 3000 transfection reagent (# L3000001, ThermoFisher) according to the manufacturer's instructions. A ratio of 1:2:3 DNA:P3000:Lipofectamine 3000 was used for all DNA constructs and controls. 10,000 cells were pre-seed in each well of a 96-well plate one day before transfection. Transfection was carried out until the cells reached approximately 80-90% confluence. For each well of the 96-well plate, 3×Lipofectamine 3000 was initially diluted in 5 μL of Opti-MEM® I Reduced Serum Medium (#31985070, ThermoFisher). The DNA was diluted with 2×P3000 reagent in 5 μL of Opti-MEM® I Reduced Serum Medium. Next, the DNA was added to Lipofectamine 3000 containing Opti-MEM® I Reduced Serum Medium and gently mixed by pipetting. After incubation at room temperature for 15 minutes, the DNA-Lipofectamine 3000 complex was added to the target cells along with complete culture medium by dropping it into different areas of the well. The plate was gently shaken back and forth and side to side to uniformly distribute the DNA-Lipofectamine 3000 complex. After transfection, the cells were incubated in a CO2 tissue culture incubator, and the culture medium was changed 6-8 hours after transfection.

[0322] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells were first washed with PBS before flow cytometry analysis. All flow cytometry was performed using a Miltenyi MACSQuant VYB. A yellow laser (wavelength 561 nm) was used for excitation to detect the mCherry signal, and a 615 / 620 nm emission filter was used. 20,000 events were recorded for each sample, and the data were analyzed using Flowjo V.9.0 software. Cells were first gated in FSC-A and SSC-A plots to remove cell debris. Populations were further plotted in FSC-A and FSC-H plots, surrounding single-cell populations. Finally, the percentage of expressing cells was determined using a bivariate plot between fluorescent signal-expressing and non-expressing cells. The level of expression within each cell was determined using the distribution of expressing cells. Expression analysis was performed at multiple time points.

[0323] Figures 12A–12D show the expression of circular ssDNA constructs in HEK293, HepG2, U2OS, and HEKa cells, respectively. A positive correlation was observed between the percentage of reporter-positive cells (X-axis), normalized to the expression of construct 001 plasmid, and the fluorescence intensity of these cells (Y-axis). These results demonstrate that circular ssDNAs with multiple different sequence elements (Table 5) express the reporter gene (mCherry) with similar expression profiles.

[0324] Example 9: Evaluation of intracellular innate immune response in vitro This example illustrates the effect of circular ssDNA constructs on the innate immune response of cultured cells.

[0325] The experimental constructs were prepared in the same manner as in Examples 1-4 above, and then administered to cells in the same manner as in Example 8 above. qPCR was performed in the cells to determine the RNA levels of the cytokines IFN-β, IL-6, IL-1β, TNF-α, and CXCL10 in the test cells. Briefly, the probe-primer sets used in qPCR were: human IFN-β (forward sequence: CTTGGATTCCTACAAAGAAGCAGC (SEQ ID NO: 41); reverse sequence: TCCTCCTTCTGGAACTGCTGCA) (SEQ ID NO: 42); human IL-6 (forward sequence: AGACAGCCACTCACCTCTTCAG (SEQ ID NO: 43); reverse sequence: TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO: 44)); human IL-1β (forward sequence: CCACAGACCTTCCAGGAGAATG (SEQ ID NO: 45); reverse sequence: GTGCAGTTCAGTGATCGTACAGG (SEQ ID NO: 46)); human TNF-α (forward sequence: CTCTTCTGCCTG) The genes were CTGCACTTTG (SEQ ID NO: 47); reverse sequence: ATGGGCTACAGGCTTGTCACTC (SEQ ID NO: 48); human CXCL10 (forward sequence: GGTGAGAAGAGATGTCTGAATCC (SEQ ID NO: 49); reverse sequence: GTCCATCCTTGGAAGCACTGCA (SEQ ID NO: 50)); human CCL20 (forward sequence: AAGTTGTCTGTGTGCGCAAATCC (SEQ ID NO: 51); reverse sequence: CCATTCCAGAAAAGCCACAGTTTT (SEQ ID NO: 52)); and human GAPDH (forward sequence: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 53); reverse sequence: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 54)). Analysis was performed using the QuantStudio7 Flex Real-time PCR System with SYBR Select Master Mix from Life Technologies Corporation. RNA expression was normalized to GAPDH and expressed as a magnification change compared to the relevant untreated control.

[0326] The expression and immunogenicity of construct 001 (containing the transgene mCherry), generated as circular ssDNA and circular dsDNA and delivered to HEKa cells by lipofection, are shown in Figures 13A–13B and 14A–14E. Circular ssDNA was expressed at lower levels than the same molar concentration ("1x") and equal mass ("2x") of circular dsDNA, as determined by the proportion of mCherry+ cells (Figures 13A–13B). Conversely, as shown in Figures 14A–14E, the same molar concentration and mass of circular ssDNA exhibited significantly lower immunogenicity than circular dsDNA, as evidenced by the reduced production of interferon (i.e., IFN-B) and inflammatory cytokines and chemokines (e.g., IL-6). These results demonstrate the reduced innate immunogenicity of circular ssDNA compared to circular dsDNA.

[0327] Example 10. Preparation of chemically modified circular single-stranded DNA (ssDNA) This example illustrates the preparation and expression profiling of chemically modified circular ssDNA.

[0328] The DNA was cleaved by mixing 4 µg of circular dsDNA and 20 units of Nb.BsrDI (NEB, R0648) in 50 µg of 1×CutSmart buffer (NEB, B6004). The reaction mixture was incubated at 37°C for 30 minutes.

[0329] The DNA was methylated by adding 150 μl of methyltransferase reaction mixture (S-adenosylmethionine to a final concentration of 160 μM and 20 units of EcoGII methyltransferase (NEB, M0603)) to nic DNA in 1×CutSmart buffer. The reaction mixture was incubated at 37°C for 1 hour.

[0330] The DNA was purified using a Zymo DNA purification column as described above. Nick cyclic methylated dsDNA was converted to methylated cyclic ssDNA by combining 4 μg of DNA with 15 units of T7 exonuclease (NEB, M0263) in 50 μl of 1×CutSmart buffer and incubating the reaction at 25°C for 30 minutes. The DNA was purified by gel electrophoresis as described above.

[0331] Figure 15 shows two forms of construct 001: unmodified single-stranded circular DNA, and m6A(N 6 The expression of single-stranded circular DNA with methyladenosine (-methyladenosine) DNA modification was observed. As evidenced by the expression of the mCherry reporter in transfected cells, the chemically modified circular single-stranded DNA retained detectable function. This result indicates that transgene expression from circular ssDNA can be affected by chemical modification.

[0332] Example 11: Computer prediction of DNA secondary structure This example illustrates the modeling of the secondary structure of circular ssDNA.

[0333] The double-stranded regions formed by the ssDNA described herein were determined as described in Lorenz et al. 2011. ViennaRNA Package 2.0. Algorithms for Molecular Biology, Volume 6, Article 26. The double-stranded regions of construct 001 described herein were predicted using the RNAFold web server (http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi). Briefly, the secondary structure of construct 001 was modeled based on minimum free energy using the default "folding algorithm" and "basic options". The default "advanced folding options" were used, except for the selection of the "DNA" and "circular" parameters.

[0334] Figure 16 shows the predicted structure of construct 001 as a circular ssDNA. No double-stranded region exceeding 16 consecutive base pairs was predicted. This result suggests that under physiological conditions, a circular ssDNA construct lacking the double-stranded long region associated with the innate immune response can be generated (see Luecke et al. 2017. EMBO Reports Volume 18, Issue 10:1707-1715).

[0335] Example 12: Purity level of cssDNA construct Circular single-stranded DNA constructs were prepared as described in Examples 1-4. Their levels and purity were determined. Purity was determined using absorbance ratios, particularly A260 / A280 and A230 / A260 (Table 6).

[0336] [Table 6]

[0337] All publications, patents, and patent applications cited herein are incorporated by reference to the same extent that each individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference. In the event of any conflict between the terminology used herein and the terminology used in the incorporated references, the terminology used herein shall prevail. The present invention provides, for example, the following items: (Item 1) A method for producing circular ssDNA, a) Providing (e.g., generating or obtaining) circular dsDNA, wherein the circular dsDNA is i) Lacking plasmid backbone; ii) Lacking a bacterial replication origin; iii) Lacking selectable markers, e.g., antibiotic resistance markers; or iv) Providing (e.g., producing or obtaining) chemically modified products, including, for example, chemical modifications to sugars, chemical modifications to bases, or chemical modifications to nucleic acid backbones; b) Introducing a discontinuity into one strand of the circular dsDNA (for example, contacting the circular dsDNA with a nickeling endonuclease that recognizes a nickeling recognition site in the dsDNA (e.g., Nb.BsrDI, Nb.Bpu10I, or Nt.BspQI) under conditions that allow the nickeling endonuclease to create a cleavage at the site in the dsDNA), thereby generating a dsDNA having a discontinuity; c) The discontinuous dsDNA is brought into contact with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow for the degradation of the nick strand (e.g., complete degradation), This allows for the production of the aforementioned circular ssDNA. A method that includes this. (Item 2) A method for producing circular ssDNA, a) To provide (e.g., generate or obtain) circular dsDNA; b) Contacting the circular dsDNA with a nickeling endonuclease selected from Nb.BsrDI or Nt.BspQI that recognizes a nickeling recognition site in the dsDNA, under conditions that allow the nickeling endonuclease to cleave the site in the dsDNA, thereby generating a nickel dsDNA; c) The nicked dsDNA is brought into contact with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow for the degradation (e.g., complete degradation) of the nicked strand. This allows for the production of the aforementioned circular ssDNA. A method that includes this. (Item 3) A method for producing circular ssDNA, a) To provide (e.g., generate or obtain) circular dsDNA; b) Introducing a discontinuity into one strand of the circular dsDNA (for example, contacting the circular dsDNA with a nickeling endonuclease that recognizes a nickeling recognition site in the dsDNA (e.g., Nb.BsrDI, Nb.Bpu10I, or Nt.BspQI) under conditions that allow the nickeling endonuclease to create a cleavage at the site in the dsDNA), thereby generating a nickel dsDNA having a discontinuity; c) The nicked dsDNA is brought into contact with a T7 exonuclease under conditions that allow for the degradation (e.g., complete degradation) of the nicked strand. This allows for the production of the aforementioned circular ssDNA. A method that includes this. (Item 4) A method for producing circular ssDNA, a) To provide (e.g., generate or obtain) circular dsDNA; b) Introducing a discontinuity into one strand of the circular dsDNA (for example, contacting the circular dsDNA with a nickeling endonuclease that recognizes a nickeling recognition site in the dsDNA (e.g., Nb.BsrDI, Nb.Bpu10I, or Nt.BspQI) under conditions that allow the nickeling endonuclease to create a cleavage at the site in the dsDNA), thereby generating a nickel dsDNA having a discontinuity; c) Contacting the nicked dsDNA with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow for the degradation (e.g., complete degradation) of the nicked strand, thereby producing a circular ssDNA, and d) Perform gel purification of the circular ssDNA. A method that includes this. (Item 5) The aforementioned circular dsDNA i) Lacking plasmid backbone; ii) Lacking a bacterial replication origin; iii) Lacking selectable markers, e.g., antibiotic resistance markers; or iv) The method according to any one of items 2 to 4, comprising chemical modification, for example, chemical modification of a sugar, chemical modification of a base, or chemical modification of a nucleic acid backbone. (Item 6) b) The method according to any one of items 1 and 3 to 5, comprising contacting the circular dsDNA with a nickeling endonuclease selected from Nb.BsrDI or Nt.BspQI that recognizes a nickeling recognition site in the dsDNA, under conditions that allow the nickeling endonuclease to cleave the site in the dsDNA, thereby generating a nickel dsDNA. (Item 7) c) The method according to any one of items 1, 2, and 4-6, wherein the nick dsDNA is brought into contact with a T7 exonuclease under conditions that allow for the degradation (e.g., complete degradation) of the nick strand. (Item 8) d) The method according to any one of items 1-3 and 5-7, further comprising performing gel purification of the circular ssDNA. (Item 9) To generate the aforementioned circular dsDNA, (i) Provide nucleic acids (e.g., plasmids) containing effector sequences; (ii) Performing PCR to amplify a region of the nucleic acid (e.g., plasmid) containing the effector sequence, wherein the PCR includes contacting the plasmid with a first primer containing a first endonuclease recognition site and a second primer containing a second endonuclease recognition site and a nickeling recognition site, wherein the first primer and the second primer are positioned in the plasmid at a location suitable for amplifying the effector sequence (and optionally not amplifying the plasmid backbone), and contacting the plasmid with a DNA-dependent DNA polymerase (e.g., high-fidelity polymerase, e.g., Q5), and applying thermal cycling conditions sufficient to amplify the region of the nucleic acid containing the effector sequence, thereby generating linear dsDNA; (iii) Digesting linear dsDNA with an endonuclease that cleaves the endonuclease recognition site (e.g., BsaI, KpnI, or NheI), thereby generating digested linear DNA. (iv) Circularizing the digested linear dsDNA (for example, by contacting the linear digested dsDNA with a ligase, such as T4 ligase); and (v) The method according to any one of items 1 to 8, comprising one or more (e.g., two, three, four, or all) of the following: digesting the remaining linear DNA by contacting the composition containing the digested linear dsDNA with an exonuclease (e.g., T5 exonuclease). (Item 10) The method according to any one of items 1 to 9, comprising one or more purification steps, for example, gel purification or the use of a DNA purification column. (Item 11) The aforementioned purification process, The aforementioned linear dsDNA; The digested linear dsDNA; The aforementioned circular dsDNA; or The aforementioned circular ssDNA The method described in item 10, which is carried out in [location]. (Item 12) The method according to any one of items 1 to 11, which does not include an organic extraction step (e.g., a phenol-chloroform extraction step). (Item 13) c) The method according to any one of items 1 to 12, wherein the nick dsDNA is brought into contact with the exonuclease (e.g., the T7 exonuclease) for 15 to 120 minutes, for example, 20 to 60 minutes, for example, about 30 minutes. (Item 14) The method according to any one of items 1 to 13, wherein introducing a discontinuity in one strand of the circular dsDNA comprises introducing a nick between two adjacent nucleotides. (Item 15) The method according to any one of items 1 to 14, wherein introducing a discontinuity in one strand of the circular dsDNA comprises removing a nucleotide, for example, wherein the nucleotide is uracil. (Item 16) Covalently ring-closed single-stranded DNA (ssDNA) containing effector sequences. A composition (for example, a pharmaceutical composition) containing, a) At least 70%, 80%, 85%, 90%, 95%, 96%, 97%, or 98%, or 99% by mass of the total DNA in the composition is the covalently ring-closed ssDNA; b) At least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% by mass of the total DNA in the composition is of full length; c) 10%, 5%, 4%, 3%, 2%, or less than 1% by mass of DNA in the composition is double-stranded DNA (dsDNA); d) less than 10%, 5%, 4%, 3%, 2%, or 1% by mass of DNA in the composition is linear DNA; or e) Linear ssDNA is present in the composition, with less than 10%, 5%, 4%, 3%, 2%, or 1% by mass of DNA. A composition (e.g., a pharmaceutical composition) that is one or more of the above. (Item 17) Covalently ring-closed single-stranded DNA (ssDNA) containing effector sequences. A composition (for example, a pharmaceutical composition) containing, a) The composition is substantially free of chloroform, for example, does not contain chloroform; b) The composition is substantially free of phenol, for example, does not contain phenol; c) The composition is substantially free of phenol and chloroform, for example, does not contain them; d) The composition is substantially free of organic solvents, for example, does not contain any; or e) A composition (e.g., a pharmaceutical composition) that is substantially free of aromatic organic solvents, for example, one or more of which are not included. (Item 18) Covalently ring-closed single-stranded DNA (ssDNA) containing effector sequences. A composition (for example, a pharmaceutical composition) containing, A composition (e.g., a pharmaceutical composition) in which the ssDNA is produced by a method that does not include a phenol-chloroform extraction step. (Item 19) Covalently ring-closed single-stranded DNA (ssDNA) containing effector sequences. A composition (for example, a pharmaceutical composition) containing, a) The composition is substantially free of exonuclease III (e.g., does not contain it); b) The composition is substantially free of T7 exonuclease (e.g., does not contain); or c) A composition (e.g., a pharmaceutical composition) wherein one or more of the compositions substantially do not contain (e.g., do not contain) T5 exonuclease. (Item 20) A composition (e.g., a pharmaceutical composition) comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg of covalently ring-closed single-stranded DNA (ssDNA) containing an effector sequence. (Item 21) A circular double-stranded DNA containing an effector sequence and at least one modified nucleotide, and Nb.BsrDI or Nt.BspQI A composition containing (for example, a pharmaceutical composition or a manufacturing intermediate). (Item 22) The composition or method according to any one of items 16 to 21, wherein the ssDNA is not placed in a carrier. (Item 23) A composition according to any one of items 16 to 21, further comprising a carrier. (Item 24) The composition according to item 23, wherein the carrier is a lipid-based carrier. (Item 25) The composition according to item 24, wherein the lipid-based carrier is lipid nanoparticles (LNPs). (Item 26) A composition according to any one of items 16 to 22, formulated for unprotected administration. (Item 27) A composition according to any one of items 16 to 26, formulated for parenteral administration. (Item 28) A composition described in any one of items 16 to 26, formulated for topical administration. (Item 29) A composition according to any one of items 16 to 26, substantially free from impurities or by-products selected from the group consisting of endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, DNA fragments or cuts, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes). (Item 30) A method for evaluating a sample of a composition containing ssDNA, comprising determining whether a condition is met, wherein the condition is a) At least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% by mass of the total DNA in the composition is covalently ring-closed ssDNA; b) At least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% by mass of the total DNA in the composition is of full length; c) 10%, 5%, 4%, 3%, 2%, or less than 1% by mass of DNA in the composition is double-stranded DNA (dsDNA); d) less than 10%, 5%, 4%, 3%, 2%, or 1% by mass of DNA in the composition is linear DNA; e) less than 10%, 5%, 4%, 3%, 2%, or 1% by mass of DNA in the composition is linear ssDNA; f) The composition is substantially free of chloroform, for example, does not contain chloroform; g) The composition is substantially free of phenol, for example, does not contain phenol; h) The composition is substantially free of phenol and chloroform, for example, free of them; i) The composition is substantially free of organic solvents, for example, does not contain any; j) The composition is substantially free of aromatic organic solvents, for example, does not contain any; k) The composition is substantially free of exonuclease III (e.g., does not contain it); l) The composition is substantially free of T7 exonuclease (e.g., does not contain); and / or m) A method wherein the composition is selected from those that are substantially free of (e.g., not free of) T5 exonuclease. (Item 31) The method according to item 30, further comprising, if the above conditions are met, carrying out a downstream processing step in the composition, wherein the downstream processing step is optionally selected from dividing the composition into multiple parts, packaging the composition, labeling the composition, transporting the composition, distributing the composition, storing the composition, or bringing the composition to market. (Item 32) The method according to item 30 or 31, wherein the composition is one of the compositions described in any one of items 16 to 29. (Item 33) The method according to any one of items 30 to 32, wherein the composition is prepared by the method according to any one of items 1 to 15. (Item 34) A method for delivering effects to an effector, comprising administering a composition described in any one of items 16 to 29 to the effector. (Item 35) A method for modulating biological parameters in cells, tissues, or subjects, comprising administering a composition described in any one of items 16 to 29 to the cells, tissues, or subjects. (Item 36) The composition or method according to any one of items 1 to 35, wherein the ssDNA does not form a double-stranded structure longer than 100 base pairs. (Item 37) The composition or method according to any one of items 1 to 36, wherein the ssDNA includes chemical modifications, such as chemical modifications to sugars, chemical modifications to bases, or chemical modifications to the nucleic acid backbone. (Item 38) The composition or method according to any one of items 1 to 37, wherein the ssDNA is not a bacteriophage genome. (Item 39) The composition or method according to any one of items 1 to 38, wherein the ssDNA lacks a bacteriophage packaging site. (Item 40) The composition or method according to any one of items 1 to 39, wherein the ssDNA lacks a bacteriophage replication origin. (Item 41) The composition or method according to any one of items 1 to 40, wherein the ssDNA does not encode a bacteriophage capsid gene. (Item 42) The composition or method according to any one of items 1 to 41, wherein the ssDNA was not generated by rolling circle amplification. (Item 43) The composition or method according to any one of items 1 to 42, wherein the ssDNA is not generated by strand substitution amplification. (Item 44) The composition or method according to any one of items 1 to 43, wherein the ssDNA does not contain a protelomerase target sequence. (Item 45) The composition or method according to any one of items 1 to 44, wherein the ssDNA does not contain a hairpin structure. (Item 46) The composition or method according to any one of items 1 to 45, wherein the ssDNA does not include a first sequence that hybridizes with a second sequence, wherein the first sequence and the second sequence are at least 5 nt in length, and the first sequence and the second sequence are arranged less than 6 nucleotides apart from each other. (Item 47) The composition or method according to any one of items 1 to 46, wherein the ssDNA does not contain double-stranded origin (DSO). (Item 48) The composition or method according to any one of items 1 to 47, wherein the ssDNA further comprises a nuclear targeting sequence (NTS). (Item 49) The composition or method according to any one of items 1 to 48, wherein the ssDNA further comprises a maintenance sequence. (Item 50) The composition according to any one of items 1 to 49, wherein the ssDNA further comprises a second strand motif (SSM). (Item 51) The composition or method according to any one of items 1 to 50, wherein the ssDNA comprises 20 to 20,000 nucleotides. (Item 52) The composition or method according to any one of items 1 to 51, wherein the ssDNA comprises 50 to 50,000 nucleotides. (Item 53) The composition or method according to any one of items 1 to 52, wherein the ssDNA is a sense ssDNA strand. (Item 54) The composition or method according to any one of items 1 to 53, wherein the ssDNA is an antisense ssDNA strand. (Item 55) The composition or method according to any one of items 1 to 54, wherein the chemical modification is a covalent modification selected from 5-formylcytosine, phosphorothioate, 7-methylguanine, and 5-glucosylmethylcytosine. (Item 56) The composition or method according to any one of items 1 to 55, wherein the effector sequence is a therapeutically functional sequence. (Item 57) The composition or method according to item 56, wherein the therapeutically functional sequence is a DNA sequence comprising a DNA aptamer, a DNA zyme, or an allele-specific oligonucleotide (ASO). (Item 58) The composition or method according to item 56, comprising a promoter sequence in which the therapeutically functional sequence is operably ligated to a sequence encoding a therapeutic RNA or polypeptide. (Item 59) The composition or method according to item 58, wherein the promoter sequence is operably ligated to a sequence encoding a therapeutic RNA selected from the group consisting of tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA. (Item 60) The composition or method according to item 58, wherein the promoter sequence is operably linked to a sequence encoding a therapeutic polypeptide selected from the group consisting of transcription factors; chromatin remodeling factors; antigens; hormones; enzymes (nucleases, e.g., endonucleases, e.g., nuclease elements of the CRISPR system, e.g., Cas9, dCas9, Cas9-nickase, Cpf / Cas12a, etc.); Crispr linkages, e.g., base editors or prime editors; mobile genetic factor proteins (e.g., transposases, retrotransposases, recombinases, integrases); gene writers; polymerases; methylases; demethylases; acetylases; deacetylases; kinases; phosphatases; ligases; dubiquitinases; integrases; recombinases; topoisomerases; gyrases; helicases; lysosomal acid hydrolases; antibodies; receptor ligands; receptors; coagulation factors; membrane proteins; mitochondrial proteins; nucleoproteins; centinin; darpin; and adnectin. (Item 61) The composition or method according to any one of items 1 to 60, wherein the ssDNA comprises a second effector sequence that is the same as or different from the first effector sequence. (Item 62) LNPs containing single-stranded DNA (ssDNA) A pharmaceutical preparation containing the ssDNA, (a) Encoding therapeutic proteins, (b) Covalently closed ring, (c) Does not form a double-stranded structure longer than 100 base pairs, (d) exceeding 200 nucleotides in length, (e) Does not contain protelomerase target sequences; Herein, the pharmaceutical preparation is a pharmaceutical preparation that substantially does not contain linear DNA and proteins. (Item 63) The pharmaceutical preparation described in item 62, wherein the ssDNA does not form a double-stranded structure longer than 40 base pairs. (Item 64) The pharmaceutical formulation according to item 62 or 63, wherein the ssDNA comprises a promoter sequence operably linked to a sequence encoding the therapeutic polypeptide. (Item 65) A pharmaceutical preparation according to any one of items 62 to 64, wherein the therapeutic protein is selected from the group consisting of transcription factors, chromatin remodeling factors, antigens, peptides, hormones, enzymes, antibodies, receptor ligands, receptors, coagulation factors, and membrane proteins. (Item 66) A pharmaceutical preparation according to any one of items 62 to 65, wherein the ssDNA lacks one or both of a bacteriophage packaging site and / or a bacteriophage replication origin, or the ssDNA does not encode a bacteriophage capsid gene. (Item 67) A pharmaceutical preparation according to any one of items 62 to 66, wherein the ssDNA was not generated by rolling circle amplification. (Item 68) A pharmaceutical preparation according to any one of items 62 to 67, wherein the ssDNA was not generated by strand substitution amplification. (Item 69) A pharmaceutical preparation according to any one of items 62 to 68, wherein the ssDNA has a GC content of 30-40%, 40-50%, 50-60%, or 60-70%. (Item 70) A pharmaceutical preparation according to any one of items 62 to 69, wherein the ssDNA further comprises a nuclear targeting sequence (NTS). (Item 71) A pharmaceutical preparation according to any one of items 62 to 70, wherein the ssDNA further comprises a maintenance sequence. (Item 72) A pharmaceutical preparation according to any one of items 62 to 71, wherein the ssDNA further comprises a second strand motif (SSM). (Item 73) A pharmaceutical preparation according to any one of items 62 to 72, wherein the ssDNA contains 200 to 3,000 nucleotides. (Item 74) A pharmaceutical preparation according to any one of items 62 to 73, wherein the ssDNA contains 500 to 2,000 nucleotides. (Item 75) A pharmaceutical preparation according to any one of items 62 to 74, wherein the ssDNA is a sense ssDNA strand. (Item 76) A pharmaceutical preparation according to any one of items 62 to 74, wherein the ssDNA is an antisense ssDNA strand. (Item 77) A pharmaceutical preparation according to any one of items 62 to 76, wherein the ssDNA comprises at least one nucleotide modification. (Item 78) The pharmaceutical preparation according to item 77, wherein the nucleotide modification is 5-formylcytosine. (Item 79) A pharmaceutical preparation formulated for parenteral administration, as described in any one of items 62 to 78. (Item 80) A pharmaceutical preparation formulated for local administration, as described in any one of items 62 to 78. (Item 81) A pharmaceutical preparation described in any one of items 62 to 80, which substantially does not contain one or more of the following: endotoxins, mononucleotides, modified mononucleotides, or double-stranded DNA. (Item 82) A method for delivering therapeutic proteins, comprising administering a pharmaceutical preparation described in any one of items 62 to 81 to the subject. (Item 83) The method described in item 82, which does not result in the substantial integration of the ssDNA into the target genome. (Item 84) LNPs containing single-stranded DNA (ssDNA) A pharmaceutical preparation containing the ssDNA, (a) Includes an effects pedal array, (b) Covalently closed ring, (c) Does not form a double-stranded structure longer than 40 base pairs, (d) exceeding 200 nucleotides in length, (e) A pharmaceutical formulation that does not contain a protelomerase target sequence. (Item 85) A method for delivering a therapeutic protein to a target, comprising administering a pharmaceutical formulation containing single-stranded DNA (ssDNA) to the target, wherein the ssDNA is (a) Includes an effects pedal array, (b) Covalently closed ring, (c) Does not form a double-stranded structure longer than 40 base pairs, (d) exceeding 200 nucleotides in length, (e) A method that does not include a protelomerase target sequence.

Claims

1. A pharmaceutical formulation comprising lipid nanoparticles (LNPs) containing single-stranded DNA (ssDNA), wherein the ssDNA is (a) A therapeutic protein that codes for only one protein, (b) Covalently ring-closed, (c) Does not form a double-stranded structure longer than 40 base pairs, (d) at least 200 nucleotides in length, (e) Does not contain protelomerase target sequences; (f) Lacking a bacteriophage replication origin; Here, (i) At least 95% by mass of the total DNA in the composition is the covalently ring-closed ssDNA, (ii) The pharmaceutical preparation does not contain polypeptides, (iii) A pharmaceutical formulation in which the therapeutic protein is expressed when the ssDNA is introduced into a target cell.

2. A pharmaceutical preparation containing LNPs that include single-stranded DNA (ssDNA), wherein the ssDNA is (a) A therapeutic protein that codes for only one protein, (b) Covalently ring-closed, (c) Does not form a double-stranded structure longer than 100 base pairs, (d) at least 200 nucleotides in length, (e) Does not contain protelomerase target sequences; (f) Lacking a bacteriophage replication origin; Here, (i) At least 95% by mass of the total DNA in the composition is the covalently ring-closed ssDNA, (ii) The pharmaceutical preparation does not contain viral proteins, (iii) A pharmaceutical formulation in which the therapeutic protein is expressed when the ssDNA is introduced into a target cell.

3. A pharmaceutical preparation containing LNPs that include single-stranded DNA (ssDNA), wherein the ssDNA is (a) Encoding therapeutic proteins, (b) Covalently ring-closed, (c) Does not form a double-stranded structure longer than 100 base pairs, (d) at least 200 nucleotides in length, (e) Does not contain protelomerase target sequences; (f) Lacking a bacteriophage replication origin; Here, (i) At least 95% by mass of the total DNA in the composition is the covalently ring-closed ssDNA, (ii) The pharmaceutical preparation does not contain polypeptides, (iii) When the ssDNA is introduced into the target cell, the therapeutic protein is expressed, (iv) A pharmaceutical preparation in which the ssDNA does not encode a viral protein.

4. A pharmaceutical preparation containing LNPs that include single-stranded DNA (ssDNA), wherein the ssDNA is (a) Encoding therapeutic proteins, (b) Covalently ring-closed, (c) It does not contain an intramolecular complementary region longer than 100 base pairs, or does not form a double-stranded structure longer than 100 base pairs. (d) at least 200 nucleotides in length, (e) Does not contain protelomerase target sequences; (f) Lacking a bacteriophage replication origin; Here, (i) At least 95% by mass of the total DNA in the composition is the covalently ring-closed ssDNA, (ii) A pharmaceutical preparation that does not contain viral proteins.

5. The pharmaceutical formulation according to any one of claims 1 to 4, wherein the ssDNA lacks a bacteriophage packaging site.

6. The pharmaceutical formulation according to any one of claims 1 to 4, wherein the ssDNA includes a promoter sequence that is operably linked to a sequence encoding the therapeutic protein.

7. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the therapeutic protein is selected from the group consisting of transcription factors, chromatin remodeling factors, antigens, peptides, hormones, enzymes, antibodies, receptor ligands, receptors, coagulation factors, and membrane proteins.

8. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the ssDNA has a GC content of 30-40%, 40-50%, 50-60%, or 60-70%.

9. The pharmaceutical formulation according to any one of claims 1 to 4, wherein the ssDNA further comprises a nuclear targeting sequence (NTS).

10. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the ssDNA further comprises a maintenance sequence.

11. The pharmaceutical formulation according to any one of claims 1 to 4, wherein the ssDNA further comprises a second strand motif (SSM).

12. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the ssDNA comprises 200 to 3,000 nucleotides.

13. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the ssDNA comprises 500 to 2,000 nucleotides.

14. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the ssDNA is a sense ssDNA strand.

15. The pharmaceutical formulation according to any one of claims 1 to 4, wherein the ssDNA comprises at least one nucleotide modification.

16. The pharmaceutical formulation according to claim 15, wherein the nucleotide modification is 5-formylcytosine.

17. A pharmaceutical preparation according to any one of claims 1 to 4, formulated for parenteral administration.

18. A pharmaceutical preparation according to any one of claims 1 to 4, formulated for local administration.

19. A pharmaceutical preparation according to any one of claims 1 to 4, which does not contain one or more of endotoxins, mononucleotides, modified mononucleotides, and double-stranded DNA.

20. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the ssDNA does not encode a bacteriophage capsid gene.

21. A pharmaceutical formulation according to any one of claims 1 to 4 for use in a method of delivering the therapeutic protein to a target, wherein the method comprises administering the pharmaceutical formulation to the target.

22. Use of a pharmaceutical preparation according to any one of claims 1 to 4 in the manufacture of a drug for delivering the aforementioned therapeutic protein.

23. A pharmaceutical formulation for use according to claim 21, wherein the method does not result in substantial integration of the ssDNA into the target genome.

24. The pharmaceutical formulation according to claim 7, wherein the antibody is a monoclonal antibody, a Fab fragment, or a single-stranded Fv.

25. The pharmaceutical preparation according to any one of claims 1 to 4, wherein the ssDNA includes an EBV oriP site.

Images