Novel cellular immune-potentiating adjuvant

Abstract

The present invention provides a protein having an adjuvant activity of potentiating cellular immunity. More specifically, provided is an adjuvant composition for potentiating cellular immunity, said composition containing a protein having an amino acid sequence selected from SEQ ID NOS: 1-4, or a variant thereof.

Description

Novel cellular immune-enhancing adjuvants

[0001] The present invention relates to adjuvants that enhance cellular immunity.

[0002] Mycobacterium tuberculosis variant bovis BCG (hereinafter simply referred to as BCG), an attenuated strain of bovine tuberculosis, is widely used as a vaccine against human tuberculosis. Because live BCG bacteria are required for its effectiveness as a tuberculosis vaccine, there has long been a theory that proteins actively secreted by live bacteria may be responsible for important immune responses. To confirm this hypothesis, the purification and characterization of proteins secreted by tuberculosis bacteria and BCG have been actively pursued since the 1980s. As a result, various antigenic proteins such as Ag85 complex, "Mycobacterium protein fraction from BCG" (hereinafter referred to as MPB) 64, MPB63, MPB53, MPB70, MPB83, and Apa have been isolated (Non-Patent Documents 1 and 2), and their genes have been cloned one after another (Non-Patent Documents 3 and 4). Methods for obtaining recombinant proteins have been established, and their immune induction capabilities have been investigated in detail. However, much of their functions remain unknown.

[0003] On the other hand, complete Freund's adjuvant (CFA) containing killed Mycobacterium tuberculosis bacteria is widely used in animal experiments as an excellent adjuvant for protein antigens and as an adjuvant for inducing killer T cells for peptide antigens, but it cannot be used in humans due to safety concerns. Therefore, cell wall skeleton (CWS) components, from which proteins and nucleic acids have been removed as much as possible, have been purified from BCG bacteria and developed as anticancer drugs (Non-Patent Documents 5 and 6), but have not yet been put to practical use. Intravesical instillation therapy with live BCG bacteria is being performed in various countries (Non-Patent Document 7), and intratumoral administration of live BCG bacteria to melanoma lesions is being used in the United States (Non-Patent Document 8). In other words, even if cell wall components such as peptidoglycan, lipid components such as mycolic acid, glycolipids such as lipomannan and lipoarabinomannan, and muramyl dipeptide each contain molecules that have the effect of enhancing natural immunity, their anti-cancer effects do not match those of live BCG bacteria, and so live BCG bacteria are currently used.

[0004] Nagai et al. Infect. Immun. 59: 372-382 (1991) Harboe et al. Infect. Immun. 66: 289-296 (1998) Matsuo et al. J. Bacterial. 170: 3847-3854 (1988) Yamaguchi et al. Infect. 283-288 (1989)Miyauchi et al. Drug Discoveries Therapeutics. 6:218-225 (2012)Murata M. Cancer Sci. 99: 1435-1440 (2008)Lim et al. Front. Immunol. 11: Article 615091 (2021)Kremenovic et al. J. Intern. Med. 288:625-640 (2020)

[0005] In recent years, the immune induction ability of BCG has once again come into the spotlight. Not only has it been used as a tuberculosis vaccine (e.g., complete protection against tuberculosis infection by intravenous injection, efficacy by revaccination, etc.) (Darrah et al. Nature. 577 95-102 (2020)), but its off-target effect due to its ability to induce innate immunity has also been reported (Cirovic et al. Cell Host Microbes 28:322-334 (2020)). However, as mentioned above, frequent administration of live BCG bacteria to humans remains difficult from a safety perspective. Therefore, there is a great demand for tuberculosis vaccines and compounds with innate immunity induction ability that can be administered to humans more safely than live BCG bacteria. Furthermore, for example, in immunotherapy using cancer vaccines, adjuvants that enhance cellular immunity are essential, but to date, no excellent adjuvants with the above-mentioned effect have existed. Therefore, there is a great demand for proteins with excellent adjuvant activity and adjuvant compositions containing such proteins. The present invention has been made in view of the above points, and an object of the present invention is to provide a protein having adjuvant activity that enhances cellular immunity.

[0006] The present inventors suspected that the fact that BCG culture filtrate proteins (CFPs: proteins actively secreted by live BCG bacteria) are present in live BCG bacteria but not in BCG cell wall components might explain the difference in the anti-cancer activity between live BCG bacteria and BCG cell wall components. As a result of extensive efforts, they discovered a protein contained in CFP that has adjuvant activity that enhances cellular immunity, leading to the present invention. That is, the present invention comprises the following features:

[0007] [1] An adjuvant composition for enhancing cellular immunity, comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof. [2] The adjuvant composition according to [1], wherein the protein or variant thereof is a protein having an amino acid sequence having at least 90% sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4. [3] The adjuvant composition according to [1] or [2], wherein the protein is derived from an acid-fast bacterium. [4] The adjuvant composition according to [1] or [2], wherein the protein is derived from Mycobacterium tuberculosis or Mycobacterium tuberculosis variant bovis BCG. [5] The adjuvant composition according to any one of [1] to [4], further comprising a pharmaceutically acceptable excipient, buffer, preservative, surfactant, adhesive, pH adjuster and / or isotonicity agent. [6] A vector for expressing a protein or a variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof, the vector having a nucleic acid sequence encoding the protein or a variant thereof. [7] The vector according to [6], wherein the protein or variant thereof is a protein having an amino acid sequence having at least 90% sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4. [8] A recombinant bacterium into which a nucleic acid sequence encoding a protein or a variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof has been introduced, or into which the vector according to [6] or [7] has been introduced. [9] The recombinant bacterium according to [8], wherein the recombinant bacterium is selected from Mycobacterium smegmatis, Mycobacterium tuberculosis variant bovis BCG, Escherichia coli, Bacillus subtilis, Bacillus cereus, and Pichia pastoris.

[10] An adjuvant composition for enhancing cellular immunity, comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof, derived from the recombinant bacterium according to [8] or [9].

[11] A method for producing an adjuvant composition for enhancing cellular immunity, comprising a step of culturing the recombinant bacterium according to [8] or [9].

[12] A vaccine composition comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof, and an immunogen for a vaccine.

[13] The vaccine composition according to

[12] , wherein the protein or variant thereof is a protein having an amino acid sequence having at least 90% sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4.

[14] The vaccine composition according to

[12] or

[13] , wherein the vaccine is a vaccine against cancer.

[15] The vaccine composition according to any one of

[12] to

[14] , wherein the vaccine is a vaccine against one or more selected from malignant melanoma, lung cancer, colorectal cancer, and bladder cancer.

[16] A pharmaceutical composition comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof.

[17] The pharmaceutical composition according to

[16] , wherein the protein or variant thereof is a protein having an amino acid sequence having at least 90% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4.

[18] The pharmaceutical composition according to

[16] or

[17] , for use in inhibiting tumor cell proliferation.

[19] The pharmaceutical composition according to

[18] , comprising the protein expressed in tumor cells or a fragment thereof as an antigen.

[20] The pharmaceutical composition according to any one of

[16] to

[19] , for use in treating cancer.

[21] The pharmaceutical composition according to any one of

[16] to

[20] , further comprising another drug.

[22] The pharmaceutical composition according to any one of

[16] to

[21] , for use in combination with another drug.

[23] Use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof in the manufacture of an adjuvant composition for enhancing cellular immunity.

[24] Use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a mutant thereof in the production of a vaccine composition.

[25] Use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a mutant thereof in the production of a pharmaceutical composition.

[0008] According to the present invention, a protein having adjuvant activity that enhances cellular immunity can be provided. Therefore, the protein can be suitably used in the treatment of diseases, such as cancer and viral infections, for which killer T cells have been shown to play an important role in the protective effect, or in vaccines. Furthermore, since the present invention uses the protein having adjuvant activity, it is not necessary to administer live BCG bacteria, making it superior in terms of safety.

[0009] FIG. 1 shows HPLC chromatograms of MPB63, MPT63, MPB44, MPB53, MPT53, and MPB64 purified in 1-2 of Example 1. FIG. 2-1 shows SDS-PAGE electrophoresis images of CFP, MPB63, MPT63, MPB44, MPB53, MPT53, and MPB64 purified in 1-1 and 1-2 of Example 1. FIG. 2-2 shows Native-PAGE electrophoresis images of CFP, MPB63, MPT63, MPB44, MPB53, MPT53, and MPB64 purified in 1-1 and 1-2 of Example 1. FIG. 3 shows two-dimensional electrophoresis images of CFP purified in 1-1 of Example 1 and the protein purified in 1-2-2. The left figure shows the electrophoresis of a mixture of CFP and the protein purified in 1-2-2, and the right figure shows the electrophoresis of CFP alone. Comparison of the two figures indicates that the protein purified in 1-2-2 is MPB44. Figure 4-1 shows the construction of the mycobacterial expression vector pSOΔBam-6His used in 2-1 of Example 2. Figure 4-2 shows the construction of the MPB63, MPB64, MPB44, and MPB53 secretion expression vectors described in 2-1 of Example 2. Figure 4-3 shows the construction of the plasmid in which the MPB63 and MPB44 genes were introduced into pUC18 described in 2-3 of Example 2. Figure 4-4 shows the construction of the wild-type rMPB63 secretion expression vector described in 2-3 of Example 2. Figure 4-5 shows the construction of the wild-type rMPB44 secretion expression vector described in 2-3 of Example 2. Figure 5-1 shows SDS-PAGE electrophoresis images of recombinant MPB63, recombinant MPB44, recombinant MPB64, and recombinant MPB53 purified in 2-2 of Example 2 and the results of Western blot analysis using an anti-His tag monoclonal antibody, and SDS-PAGE electrophoresis images of wild-type recombinant MPB63 and wild-type recombinant MPB44 purified in 2-4 of Example 2 and the results of Western blot analysis using the respective rabbit polyclonal antibodies. Figure 5-2 shows HPLC chromatograms of recombinant MPB63, recombinant MPB44, recombinant MPB64, and recombinant MPB53 purified in 2-2 of Example 2 and wild-type recombinant MPB63 and wild-type recombinant MPB44 purified in 2-4 of Example 2.Figure 6 shows the results of an in vitro cytokine assay using mouse bone marrow-derived dendritic cells in Example 3. In Figure 6, "non" indicates an untreated group, "OVA / PBS" indicates a control group, and "OVA / CFP," "OVA / MPT63," "MPB44," "MPT53," and "MPB64" indicate groups to which CFP (Reference Example) or the adjuvant of the present invention was added, respectively. Figure 7 shows the results of an OVA-specific killer T cell induction activity test in Example 4. In Figure 7, "OVA / PBS EG7" indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from OVA / PBS-administered mice with EG7 cells (target cells). "OVA / PBS EL4" indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from OVA / PBS-administered mice with EL4 cells (target cells). OVA / CFP EG7 indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from OVA / CFP-administered mice with EG7 cells (target cells). OVA / CFP EL4 indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from OVA / CFP-administered mice with EL4 cells (target cells). The vertical axis indicates the percentage of dead cells among target cells. The horizontal axis indicates the mixing ratio of effector cells to each target cell (effector cells / target cells). Results when MPT63, MPB44, MPB53, MPB64, rMPB63, rMPB44, rMPB53, and rMPB64 were used instead of CFP (Reference Example) are shown in 7-2 to 7-9. Figure 8-1 shows a construction diagram of the PepA protein secretory expression vector pSOΔBam-PepA used in 5-1 of Example 5. Figure 8-2 shows an SDS-PAGE image of the recombinant PepA protein purified in 5-1 of Example 5. Figure 9 shows the results of a test of PepA (MTB32)-specific killer T cell induction activity in Example 5. In Figure 9, PepA / PBS GM10-EL4 shows the proportion of dead cells in target cells obtained by co-culture of effector cells derived from PepA / PBS-administered mice with GM10-EL4 cells (target cells).PepA / PBS EL4 indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from PepA / PBS-administered mice with EL4 cells (target cells). PepA / MPT63 GM10-EL4 indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from PepA / MPT63-administered mice with GM10-EL4 cells (target cells). PepA / MPT63 EL4 indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from PepA / MPT63-administered mice with EL4 cells (target cells). The vertical axis indicates the percentage of dead cells among target cells. The horizontal axis indicates the mixing ratio of effector cells to each target cell (effector cells / target cells). Results when MPB44, MPB53, MPB64, rMPB63, rMPB44, rMPB53, and rMPB64 were used instead of MPT63 are shown in 9-2 to 9-8. Figure 10 shows the results of the melanoma-specific killer T cell induction activity test in Example 6. In Figure 10, B16 lys / PBS B16F10 indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from mice administered B16F10 cell lysate / PBS with B16F10 cells (target cells). B16 lys / PBS EL4 indicates the percentage of dead cells among target cells obtained by co-culture of effector cells derived from mice administered B16F10 cell lysate / PBS with EL4 cells (target cells). B16 lys / CFP B16F10 indicates the percentage of dead cells among target cells obtained by co-culture of B16F10 cell lysate / CFP-administered mouse-derived effector cells with B16F10 cells (target cells). B16 lys / CFP EL4 indicates the percentage of dead cells among target cells obtained by co-culture of B16F10 cell lysate / CFP-administered mouse-derived effector cells with EL4 cells (target cells). The vertical axis indicates the percentage of dead cells among target cells. The horizontal axis indicates the mixing ratio (effector cells / target cells) of effector cells to each target cell. The results when MPT63, MPB44, MPB53, MPB64, rMPB63, rMPB44, rMPB53, and rMPB64 were used instead of CFP (Reference Example) are shown in 10-2 to 10-9.FIG. 11 shows the results of an antitumor activity test (vaccine effect upon vaccination) against EG7 cells in Example 7. In FIG. 11, the vertical axis represents tumor diameter (major diameter × minor diameter), and the horizontal axis represents the number of days after tumor challenge. FIG. 12 shows the results of an antitumor activity test (vaccine effect upon vaccination) against melanoma cells in Example 8. In FIG. 12, the vertical axis represents tumor diameter (major diameter × minor diameter), and the horizontal axis represents the number of days after tumor challenge. FIG. 13 shows the results of an antitumor activity test (vaccine effect upon vaccination) against colon cancer cells in Example 9. In FIG. 13, the vertical axis represents tumor diameter (major diameter × minor diameter), and the horizontal axis represents the number of days after tumor challenge. FIG. 14 shows the results of an antitumor activity test (therapeutic effect) against EG7 cells in Example 10. In FIG. 14, the vertical axis represents tumor diameter (major diameter × minor diameter), and the horizontal axis represents the number of days after tumor challenge.

[0010] <<Adjuvant Composition>> A first aspect of the present invention is an adjuvant composition for enhancing cellular immunity, comprising a protein or a variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4. Another first aspect of the present invention is a protein or a variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4, for use as an adjuvant for enhancing cellular immunity.

[0011] (Protein) The adjuvant composition of the present invention comprises a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof (hereinafter, sometimes referred to as the protein of the present invention). The protein variant is not particularly limited as long as it has adjuvant activity. The presence or absence of adjuvant activity can be easily confirmed by cytokine assays or killer T cell induction activity evaluation tests described below. Among these, the protein or variant thereof is preferably a protein having an amino acid sequence having at least 70% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, more preferably a protein having at least 80% or more sequence identity, and even more preferably a protein having at least 90% or more sequence identity. The protein or variant thereof may be a protein having an amino acid sequence having at least 90% or more, at least 91% or more, at least 92% or more, at least 93% or more, at least 94% or more, at least 95% or more, at least 96% or more, at least 97% or more, at least 98% or more, or at least 99% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4.Among these, the protein or its variant is preferably a protein having an amino acid sequence having at least 90% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, more preferably a protein having an amino acid sequence having at least 93% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, more preferably a protein having at least 95% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, more preferably a protein having at least 97% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, more preferably a protein having at least 99% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, and more preferably a protein having at least 99.5% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, and may have 100% sequence identity. Furthermore, the protein or its variant preferably has at least 70% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, more preferably at least 80% or more sequence identity, and even more preferably at least 90% or more sequence identity. The protein or a variant thereof preferably has at least 90% or more, at least 91% or more, at least 92% or more, at least 93% or more, at least 94% or more, at least 95% or more, at least 96% or more, at least 97% or more, at least 98% or more, or at least 99% or more sequence identity to an amino acid sequence selected from SEQ ID NOs: 1 to 4.Among these, the above-mentioned protein or a variant thereof preferably has at least 90% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, preferably has at least 93% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, preferably has at least 95% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, preferably has at least 97% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, preferably has at least 99% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, preferably has at least 99.5% or more sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4, and may have 100% sequence identity. Furthermore, the protein of the present invention is preferably an isolated protein.

[0012] Examples of proteins having the amino acid sequence of SEQ ID NO: 1 include MPB63 derived from Mycobacterium tuberculosis variant bovis BCG and MPT63 derived from Mycobacterium tuberculosis. Although MPB63 and MPT63 are expressed in different species, their amino acid sequences are identical. Examples of proteins having the amino acid sequence of SEQ ID NO: 2 include MPB44 derived from Mycobacterium tuberculosis variant bovis BCG and MPT44 derived from Mycobacterium tuberculosis. Although MPB44 and MPT44 are expressed in different species, their amino acid sequences are identical. Examples of proteins having the amino acid sequence of SEQ ID NO: 3 include MPB53 derived from Mycobacterium tuberculosis variant bovis BCG and MPT53 derived from Mycobacterium tuberculosis. Although MPB53 and MPT53 are expressed in different species, their amino acid sequences are identical. Examples of proteins having the amino acid sequence of SEQ ID NO: 4 include MPB64 derived from Mycobacterium tuberculosis variant bovis BCG and MPT64 derived from Mycobacterium tuberculosis. Although MPB64 and MPT64 are expressed in different species, their amino acid sequences are identical.

[0013] It has been reported that formulations using a portion of MPB63 peptides have cytotoxicity and anticancer activity (Patent Publication No. 2018-512446). Furthermore, it has been reported that MPB44 enhances anti-tuberculosis immunity (Brooks et al. Infect. Immun 69(4):2714-7(2001)). However, there have been no reports demonstrating or suggesting that MPB63, MPB44, MPB53, and MPB64 function as adjuvants to induce killer T cells against co-administered antigens (e.g., patient-derived cancer antigens). Adjuvants that enhance cellular immunity are essential for immunotherapy using cancer vaccines, for example, but to date, no excellent adjuvants with this effect have existed. The present invention has discovered that the above proteins have excellent adjuvant activity that enhances cellular immunity, which is surprising and unpredictable based on conventional knowledge. Furthermore, because the present invention uses the above proteins with adjuvant activity, it is not necessary to administer live BCG bacteria, making it superior in terms of safety.

[0014] The protein of the present invention may be in the form of a fusion protein with another protein or polypeptide, or in the form of a conjugate with another compound. Unless otherwise specified, adjuvant compositions containing the protein of the present invention also encompass embodiments containing the protein of the present invention in the form of a fusion protein with another protein or polypeptide, or in the form of a conjugate with another compound. The same applies to the vaccine compositions and pharmaceutical compositions described below. A fusion protein may be a single protein formed by the integration of a nucleic acid sequence encoding a protein having an amino acid sequence selected from SEQ ID NOS: 1 to 4 or a variant thereof with a nucleic acid sequence encoding another protein or polypeptide, which is transcribed and expressed together. Alternatively, a fusion protein may be formed by linking a protein having an amino acid sequence selected from SEQ ID NOS: 1 to 4 or a variant thereof with another protein or polypeptide, either directly or via a linker. Conjugation methods may include known methods, such as chemical covalent bonding using a cross-linking reagent. In the case of fusion proteins, examples of other proteins or polypeptides include glutathione S-transferase, maltose-binding protein, thioredoxin, histidine tags, and FLAG tags. Among these, histidine tags are preferred. When a cross-linking reagent is used, examples thereof include ovalbumin, bovine serum albumin, keyhole limpet hemocyanin, polyarginine, etc. Among these, ovalbumin and bovine serum albumin are preferred.

[0015] Examples of other compounds that can be conjugated to a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof include DNA, RNA, amino acids, peptides, proteins, lipids, sugar chains, organic compounds (phosphorylated, S-nitrosylated), etc. A conjugate can be formed by binding the other compound to a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof directly or via a linker. The binding method may be any known method, such as an enzymatic reaction, a chemical covalent bond using a crosslinking reagent, or other chemical synthesis.

[0016] The protein of the present invention may be a protein derived from an organism, a protein expressed by introducing a gene expression vector having a nucleic acid sequence encoding the protein into a host, or an artificially synthesized protein. The protein of biological origin is preferably a protein of bacterial origin, more preferably a protein of acid-fast bacterium origin, such as Mycobacterium tuberculosis, Mycobacterium tuberculosis variant bovis BCG, Mycobacterium tuberculosis variant africanum, or Mycobacterium tuberculosis variant microtti. Even more preferably, the protein is derived from Mycobacterium tuberculosis variant microti, Mycobacterium tuberculosis variant caprae, or Mycobacterium tuberculosis variant pinnipedii, and even more preferably, it is derived from Mycobacterium tuberculosis or Mycobacterium tuberculosis variant bovis BCG. Methods for artificially synthesizing the protein of the present invention include solid-phase peptide chemical synthesis and methods using a peptide ligation catalyst. Proteins expressed by introducing a gene expression vector having a nucleic acid sequence encoding the protein into a host include proteins expressed using the recombinant bacteria of the following embodiments. That is, the protein of the present invention may be a protein or a mutant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4 derived from the recombinant bacteria of the following embodiments.Similarly, the adjuvant composition of the present invention may be an adjuvant composition for enhancing cellular immunity, comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 derived from the recombinant bacterium of the following embodiment, or a variant thereof.

[0017] The adjuvant composition or protein of the present invention can be used to enhance cellular immunity. Cellular immunity is an immune mechanism in which cells act as the main effectors to eliminate foreign substances such as pathogens themselves, virus-infected cells, and cancer cells, in contrast to humoral immunity mediated by antibody production. The present invention relates to an immune response mediated by killer T cells, one of the immune mechanisms of cellular immunity. An adjuvant is a substance used for administering together with an antigen to enhance its effect (immunogenicity). When mixed with an antigen and administered, the adjuvant composition or protein of the present invention can enhance the immune response mediated by antigen-specific killer T cells. The adjuvant composition or protein of the present invention can increase the amount of the cytokine IL-2 produced by cytotoxic T cells. This means that antigen information presentation on MHC Class I is enhanced due to enhanced cross-presentation within dendritic cells, and that information is transmitted to CD8 T cells. Furthermore, IL-2 is known to be a cytokine essential for the proliferation of T cells, including CD8 T cells. Therefore, this reaction transmits antigen information to CD8 T cells via dendritic cells, inducing antigen-specific CD8 T cells. It is thought that the induced antigen-specific CD8 T cells then proliferate due to the IL-2 produced by them. Thus, the increase in IL-2 production following co-administration of the adjuvant composition or protein of the present invention with an antigen suggests that the adjuvant composition or protein of the present invention exerts adjuvant activity.

[0018] The proteins of the present invention can be used as adjuvants for cancer therapeutic vaccines by mixing them with various cancer antigen proteins, proteins derived from cancer cells collected from cancer tissues of patients, or cancer cell lysates and administering the mixture to cancer patients. The proteins of the present invention can also be used as adjuvants for preventive vaccines against various viral and bacterial infections in which killer T cells are important for infection prevention. Furthermore, by administering the proteins of the present invention to patients suffering from diseases such as cancer, viral infections, or bacterial infections (preferably together with proteins or fragments thereof that serve as antigens expressed in cancer cells, viruses, or bacteria that cause these diseases), the proteins can enhance (activate) the killer T cell-mediated immune response against the antigens that cause the disease, thereby treating the disease such as cancer or suppressing or delaying its progression.

[0019] (Solvent) The adjuvant composition of the present invention may contain a solvent. When a solvent is contained, the protein of the present invention may be dissolved, suspended, liposomal, or emulsified in the solvent. Examples of the solvent include water for injection, physiological saline, phosphate buffer, oil, etc. When the protein of the present invention is contained in the solvent, there are no particular limitations on its concentration.

[0020] (Other Components) The adjuvant composition of the present invention may contain an excipient, buffer, preservative, surfactant, thickener, pH adjuster, and / or isotonicity agent. Examples of excipients include sucrose, mannose, trehalose, etc. Buffers include phosphoric acid, citric acid, or salts thereof. Preservatives include parahydroxybenzoates. Examples of surfactants include polysorbates and polyoxyethylene alkyl sulfate ester salts. Thickeners include carmellose sodium and carboxyvinyl polymers. pH adjusters include glycine, hydrochloric acid, sodium hydroxide, etc. Isotonicity agents include sodium chloride and glucose. The adjuvant composition of the present invention may contain the above-mentioned protein or a variant thereof as the only component having adjuvant activity. Alternatively, the adjuvant composition of the present invention may contain other components having adjuvant activity. Examples of other adjuvants include aluminum chloride, aluminum hydroxide, aluminum phosphate, etc.

[0021] The adjuvant composition or protein of the present invention may be used in combination with a drug. Examples of drugs include drugs effective for treating or inhibiting the progression of cancer, viral infections, and bacterial infections, as well as preventing infection. Other examples include immune checkpoint inhibitors (nivolumab (drug name: Opdivo) and pembrolizumab (drug name: Keytruda)) and cancer chemotherapy drugs. The adjuvant composition of the present invention can enhance the effectiveness of a drug when used in combination with the drug. The adjuvant composition or protein of the present invention may also be used in combination with an immunogen. Examples of immunogens include those exemplified in the vaccine compositions and pharmaceutical compositions described below. Use of the adjuvant composition or protein of the present invention in combination with an immunogen enhances the cellular immune response to the immunogen in the body, thereby enabling the treatment, prevention, or amelioration of diseases caused by cells, viruses, bacteria, or the like bearing the immunogen, or the delay of their progression. Examples of such diseases include those exemplified in the vaccine compositions and pharmaceutical compositions described below. The adjuvant composition or protein of the present invention may be administered before administration of a drug or immunogen, simultaneously with administration of a drug or immunogen, sequentially before or after administration of a drug or immunogen, or after administration of a drug or immunogen. Examples of administration methods include subcutaneous administration, intramuscular administration, intravenous administration, intradermal administration, nasal administration, inhalation administration, intratumoral administration, and intravesical administration. Among these, intravenous administration, intradermal administration, subcutaneous administration, intratumoral administration, and intravesical administration are preferred. Examples of subjects to which the adjuvant composition or protein of the present invention may be administered include mammals. Among these, humans, dogs, cats, cows, pigs, goats, sheep, and monkeys (non-human primates) are preferred, with humans being particularly preferred.

[0022] <<Expression Vector>> A second aspect of the present invention is an expression vector for a protein or a mutant thereof, the vector having a nucleic acid sequence encoding the protein or a mutant thereof having an amino acid sequence selected from SEQ ID NOS: 1 to 4. Examples of proteins or mutants thereof having an amino acid sequence selected from SEQ ID NOS: 1 to 4 include those described in the first aspect. The vector of the present invention may also contain a nucleic acid sequence encoding a signal peptide. A signal peptide is a peptide that functions to transport proteins through a membrane, is often present at the amino terminus of a protein, and is cleaved during membrane transport. The presence of a signal peptide facilitates protein transport through the cytoplasmic membrane, and in Gram-positive bacteria lacking an outer membrane, more of the protein is secreted into the culture supernatant. Examples of signal peptides include those present at the N-terminus of MPB63, MPB44, MPB53, MPB64, MPB70, MPB59, and MPB32 when bacteria express these proteins. Among these, the signal peptide of MPB63 of SEQ ID NOS: 5 (the sequence from positions 1 to 29 of SEQ ID NOS: 5) is preferably used. The signal peptide is cleaved by signal peptidase after passing through the membrane. Therefore, in bacteria, MPB63, MPB44, MPB53, MPB64, MPB70, MPB59, and MPB32 are expressed in a form (precursor) with a signal peptide at the N-terminus, but the signal peptide portion is cleaved upon passage through the cytoplasmic membrane, resulting in MPB63, MPB44, MPB53, MPB64, MPB70, MPB59, and MPB32. The vector of the present invention may also contain a promoter sequence. Examples of promoters include the hsp60 promoter, MPB70 promoter, Ag85B promoter, and SP2 promoter derived from Mycobacterium smegmatis. Among these, the SP2 promoter derived from Mycobacterium smegmatis is preferably used. The vector of the present invention may also contain a Shine-Dalgarno sequence and a transcription termination signal (terminator). The vector may be a phage vector, a plasmid vector, etc. Among these, it is preferable to use a plasmid vector.Phage vectors include, for example, mycobacteriophages. Plasmid vectors include, for example, those containing the replication origin region of pAL5000, such as pSO246 and pSOΔBam6His. The method for incorporating the nucleic acid sequence encoding the protein into a vector is not particularly limited, and known methods may be used. For example, the gene construct can be incorporated into a vector by ligating the DNA fragments cleaved with a restriction enzyme using DNA ligase. Furthermore, the nucleic acid sequence encoding the protein may be optimized depending on the host into which the vector of the present invention is introduced. For example, the codon usage database (Kazusa DNA Research Institute website) can be referenced as a method for optimization, in order to convert codons to those frequently used in the host.

[0023] <<Recombinant Bacterium>> A third aspect of the present invention is a recombinant bacterium into which a nucleic acid sequence encoding a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof has been introduced, or into which the above-mentioned vector has been introduced. The recombinant bacterium of the present invention has a nucleic acid sequence encoding a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof (preferably the nucleic acid sequence derived from the above-mentioned vector) or the above-mentioned vector artificially introduced therein (by electroporation, transfection, or the like). The above-mentioned nucleic acid sequence or the above-mentioned vector, or a part thereof (which preferably includes the above-mentioned nucleic acid sequence and further includes a signal sequence and / or a promoter sequence, and may also include other components in the vector) may be integrated into the genome of the host bacterium. As long as the recombinant bacterium of the present invention has the above-mentioned nucleic acid sequence or vector introduced therein, it may or may not have a nucleic acid sequence encoding a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 endogenously in its genome, separate from the introduced nucleic acid sequence or the nucleic acid sequence in the introduced vector.The recombinant bacteria of the present invention include Mycobacterium smegmatis, Mycobacterium tuberculosis variant bovis BCG, Escherichia coli, Bacillus subtilis, Bacillus cereus, Pichia pastoris, Mycobacterium avium, Mycobacterium intracellulare, ... Preferably, the bacterial strain is selected from Mycobacterium smegmatis, Mycobacterium tuberculosis variant bovis BCG, Escherichia coli, Bacillus subtilis, Bacillus cereus, Pichia yeast, ... It is more preferable that the recombinant bacterium of the present invention is selected from Mycobacterium pastoris, even more preferably from Mycobacterium smegmatis and Mycobacterium tuberculosis variant bovis BCG, and even more preferably from Mycobacterium smegmatis. It is also preferable that the recombinant bacterium of the present invention is Mycobacterium tuberculosis variant bovis BCG.By using BCG as a recombinant bacterium, proteins with adjuvant activity are overexpressed in the BCG used as a tuberculosis vaccine, thereby enhancing the vaccine effect against tuberculosis compared to BCG not incorporating the protein or vector of the present invention. Therefore, the present invention may be a tuberculosis vaccine composition containing a recombinant Mycobacterium tuberculosis variant bovis BCG bacterium. Alternatively, the present invention may be a recombinant Mycobacterium tuberculosis variant bovis BCG bacterium for use in a tuberculosis vaccine (or for preventing tuberculosis). The components contained in the composition are not particularly limited, and examples include the solvents and other components described above. Other components of the vaccine include those described in the sixth aspect. Methods for introducing the vector into bacteria include, for example, electroporation. Electroporation allows the vector to be introduced into bacteria by creating holes in the bacterial cell wall under high voltage.

[0024] <<Method for Producing Proteins>> A fourth aspect of the present invention is a method for producing a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof, comprising the step of culturing the recombinant bacterium. Examples of the protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof include those similar to those described in the first aspect. The step of culturing the recombinant bacterium may involve culturing the recombinant bacterium on a medium or in a culture solution. The culture time is not particularly limited and may be 8 to 1,440 hours or 24 to 170 hours. The culture temperature is not particularly limited and may be adjusted appropriately depending on the type of bacterium, and may be approximately 20 to 45°C or approximately 35 to 39°C. The medium or culture solution is not particularly limited, and a medium or culture solution suitable for the host bacterium may be used. The production method of the present invention may also include a step of purifying the protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof from the culture filtrate (CFP) obtained after culturing the recombinant bacterium, after culturing the recombinant bacterium. Methods for purifying the protein include salting out, gel filtration column chromatography, ion exchange column chromatography, hydrophobic interaction column chromatography, antibody affinity column chromatography, metal ion chelate affinity column chromatography, etc. By using the production method of the present invention, it is possible to express and purify large amounts of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a mutant thereof.

[0025] <<Method for Producing Adjuvant Composition>> A fifth aspect of the present invention is a method for producing an adjuvant composition for enhancing cellular immunity, comprising the step of culturing the recombinant bacterium. Examples of the protein or variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4 include those described in the first aspect. The step of culturing the recombinant bacterium involves culturing the recombinant bacterium on a medium or in a culture solution. The culture time is not particularly limited, and may be 8 to 1,440 hours or 24 to 170 hours. The culture temperature is not particularly limited, and may be adjusted appropriately depending on the type of bacterium, and may be approximately 20 to 45°C or approximately 35 to 39°C. The medium or culture solution is not particularly limited, and a medium or culture solution suitable for the host bacterium may be used. The production method of the present invention may also include a step of purifying the protein or variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4, preferably from the culture filtrate (CFP) obtained after culturing the recombinant bacterium, after culturing the recombinant bacterium. Methods for purifying the protein include salting out, gel filtration column chromatography, ion exchange column chromatography, hydrophobic interaction column chromatography, antibody affinity column chromatography, and metal ion chelate affinity column chromatography. By using the production method of the present invention, an adjuvant composition containing a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof can be obtained. The production method of the present invention may further comprise, after the purification step, a step of mixing the protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof with one or more selected from solvents, excipients, buffers, preservatives, surfactants, thickeners, pH adjusters, and isotonicity agents. Another fifth aspect of the present invention is a method for producing an adjuvant composition for enhancing cellular immunity, comprising a step of mixing the protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof with one or more selected from solvents, excipients, buffers, preservatives, surfactants, thickeners, pH adjusters, and isotonicity agents. Examples of the protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof include those similar to those described in the first aspect.The method of the present invention may include a step of preparing a protein or a variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4. The method of the present invention may also include a step of purifying the protein or a variant thereof from a bacterial culture filtrate. Examples of bacteria include those described in the first aspect. The method of the present invention may also include a step described in the fourth or fifth aspect.

[0026] <<Vaccine Composition>> A sixth aspect of the present invention is a vaccine composition comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof, and an immunogen for a vaccine. Examples of the protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof include those similar to those in the first aspect.

[0027] The vaccine composition of the present invention can act as a vaccine against various diseases. Among these, the vaccine composition of the present invention can be preferably used as a vaccine against cancer, viral infections, and bacterial infections, more preferably used as a vaccine against cancer, and even more preferably used as a vaccine against one or more selected from malignant melanoma, lung cancer, colon cancer, and bladder cancer.

[0028] There are no particular limitations on the immunogens used in vaccines; any known antigen may be appropriately selected depending on the intended use of the vaccine. Among these, the vaccine composition of the present invention preferably contains an immunogen against cancer, viral infection, or bacterial infection (e.g., a protein or fragment thereof expressed in cancer cells, viruses, or bacteria that cause these diseases, preferably a protein or fragment thereof that is expressed in cancer cells, viruses, or bacteria that cause these diseases but not in normal cells or host cells of the viruses or bacteria). It is more preferable that the vaccine composition of the present invention contains an immunogen against cancer, and even more preferable that the vaccine composition contain an immunogen against one or more cancers selected from malignant melanoma, lung cancer, colon cancer, and bladder cancer. Known examples of such immunogens include TRP2, GP100, and cancer cell lysate. Furthermore, the protein of the present invention functions not as an immunogen but as an adjuvant for enhancing cellular immunity. Therefore, the vaccine composition of the present invention contains a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a mutant thereof as an adjuvant for enhancing cellular immunity. The immunogen contained in the vaccine composition of the present invention is a substance (e.g., a protein) other than a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a mutant thereof.

[0029] (Solvent) The vaccine composition of the present invention may contain a solvent. When a solvent is contained, the protein of the present invention may be dissolved, suspended, liposomal, or emulsified in the solvent. Examples of the solvent include water for injection, physiological saline, phosphate buffer, oil, etc. When the protein of the present invention is contained in the solvent, there are no particular limitations on its concentration.

[0030] (Other Components) The vaccine composition of the present invention may contain an excipient, a buffer, a preservative, a surfactant, a thickener, a pH adjuster, and / or an isotonicity agent. Examples of excipients include sucrose, mannose, trehalose, etc. Examples of buffers include phosphoric acid, citric acid, or salts thereof. Examples of preservatives include parahydroxybenzoic acid esters, etc. Examples of surfactants include polysorbates, polyoxyethylene alkyl sulfate ester salts, etc. Examples of thickeners include carmellose sodium, carboxyvinyl polymer, etc. Examples of pH adjusters include glycine, hydrochloric acid, sodium hydroxide, etc. Examples of isotonicity agents include sodium chloride, glucose, etc.

[0031] Furthermore, the vaccine composition of the present invention may contain the protein of the present invention as the only adjuvant. Alternatively, the vaccine composition of the present invention may contain an adjuvant other than the protein of the present invention. Examples of other adjuvants include aluminum chloride, aluminum hydroxide, and aluminum phosphate. Methods for administering the vaccine composition of the present invention include subcutaneous administration, intramuscular administration, intravenous administration, intradermal administration, nasal administration, inhalation, intratumoral administration, and intravesical instillation. Among these, intravenous, intradermal, subcutaneous, intratumoral, and intravesical administration are preferred. Examples of subjects for administering the vaccine composition of the present invention include mammals. Among these, humans, dogs, cats, cows, pigs, goats, sheep, and monkeys (non-human primates) are preferred, and humans are particularly preferred.

[0032] <<Pharmaceutical Composition>> A seventh aspect of the present invention is a pharmaceutical composition comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof. Another seventh aspect of the present invention is a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof, for use as a pharmaceutical. Examples of proteins having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or variants thereof include those similar to those in the first aspect.

[0033] The pharmaceutical composition or protein of the present invention can act as a medicine for various diseases. Among these, the pharmaceutical composition or protein of the present invention can be preferably used for the treatment, inhibition of progression, or prevention of cancer, viral infections, and bacterial infections, and is more preferably used for the treatment and inhibition of progression of cancer. Furthermore, the pharmaceutical composition or protein of the present invention can be suitably used for the inhibition of tumor growth, the prevention of viral infections and bacterial infections, and alleviation of symptoms. Among these, it is preferably used for the inhibition of tumor growth. It is believed that the pharmaceutical composition or protein of the present invention can treat various diseases by enhancing cellular immunity (especially immune responses mediated by antigen-specific killer T cells) against the diseases. The pharmaceutical composition of the present invention preferably contains an immunogen against the target disease. There are no particular limitations on the immunogen, and a known antigen may be selected appropriately depending on the application. Among these, the pharmaceutical composition of the present invention preferably contains, as an antigen, a protein or a fragment thereof expressed in tumor cells. Furthermore, the pharmaceutical composition of the present invention preferably comprises an immunogen against cancer, viral infection, or bacterial infection (e.g., a protein or fragment thereof expressed in cancer cells, viruses, or bacteria that cause these diseases, preferably a protein or fragment thereof that is expressed in cancer cells, viruses, or bacteria that cause these diseases but not in normal cells), more preferably an immunogen against cancer, and even more preferably an immunogen against one or more selected from malignant melanoma, lung cancer, colon cancer, and bladder cancer. Known examples of such immunogens include TRP2, GP100, and cancer cell lysate. Furthermore, the protein of the present invention is preferably used (administered) together with an immunogen against the target disease. Examples of immunogens include those listed above. Furthermore, the protein of the present invention functions not as an immunogen but as an adjuvant for enhancing cellular immunity. Therefore, the pharmaceutical composition of the present invention comprises a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof as an adjuvant for enhancing cellular immunity.The immunogen preferably contained in the pharmaceutical composition of the present invention is a substance (protein, etc.) other than a protein or a variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4. By administering the pharmaceutical composition or protein of the present invention together with an immunogen against a target disease, the pharmaceutical composition or protein of the present invention can enhance cellular immunity against the disease and treat the disease.

[0034] (Solvent) The pharmaceutical composition of the present invention may contain a solvent. When a solvent is contained, the protein of the present invention may be dissolved, suspended, liposomal, or emulsified in the solvent. Examples of the solvent include water for injection, physiological saline, phosphate buffer, oil, etc. When the protein of the present invention is contained in the solvent, there are no particular limitations on its concentration.

[0035] (Other Components) The pharmaceutical composition of the present invention may contain an excipient, a buffer, a preservative, a surfactant, a thickener, a pH adjuster, and / or an isotonicity agent. Examples of excipients include sucrose, mannose, trehalose, etc. Examples of buffers include phosphoric acid, citric acid, or salts thereof. Examples of preservatives include parahydroxybenzoic acid esters, etc. Examples of surfactants include polysorbates, polyoxyethylene alkyl sulfate ester salts, etc. Examples of thickeners include carmellose sodium, carboxyvinyl polymer, etc. Examples of pH adjusters include glycine, hydrochloric acid, sodium hydroxide, etc. Examples of isotonicity agents include sodium chloride, glucose, etc.

[0036] The pharmaceutical composition of the present invention may contain a drug other than the protein of the present invention. The drug is not particularly limited and may be appropriately selected depending on the intended medical application. Examples include drugs or their active ingredients that are effective for treating or inhibiting the progression of cancer, viral infections, and bacterial infections, or preventing infection. The pharmaceutical composition of the present invention may also be used in combination with other drugs. Examples of other drugs include drugs that are effective for treating or inhibiting the progression of cancer, viral infections, and bacterial infections, or preventing infection. Other examples include immune checkpoint inhibitors and cancer chemotherapeutic agents. Among these, immune checkpoint inhibitors are preferred. Examples of immune checkpoint inhibitors include those described above. The pharmaceutical composition of the present invention may be administered before the administration of other drugs, simultaneously with the administration of other drugs, sequentially before or after the administration of other drugs, or after the administration of other drugs. Methods of administration of the pharmaceutical composition of the present invention include subcutaneous administration, intramuscular administration, intravenous administration, intradermal administration, nasal administration, inhalation administration, intratumoral administration, and intravesical administration. Among these, intravenous administration, intradermal administration, subcutaneous administration, intratumoral administration, and intravesical administration are preferred, and intravenous administration, intradermal administration, and subcutaneous administration are more preferred. Examples of subjects to which the pharmaceutical composition of the present invention is administered include mammals. Among these, humans, dogs, cats, cows, pigs, goats, sheep, and monkeys (non-human primates) are preferred, and humans are particularly preferred.

[0037] <<Use of Protein>> An eighth aspect of the present invention is the use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof in the production of an adjuvant composition (adjuvant formulation) for enhancing cellular immunity. Examples of proteins having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or variants thereof include those similar to those described in the first aspect. The protein of the present invention can be suitably used in the production of an adjuvant composition for enhancing cellular immunity.

[0038] A ninth aspect of the present invention is the use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a mutant thereof in the production of a vaccine composition (vaccine preparation). Examples of proteins having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or mutants thereof include those similar to those described in the first or sixth aspect. The protein of the present invention can be suitably used in the production of a vaccine composition.

[0039] A tenth aspect of the present invention is the use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof in the production of a pharmaceutical. Examples of proteins having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or variants thereof include those similar to those in the first or seventh aspect. The protein of the present invention can be suitably used in the production of a pharmaceutical (pharmaceutical composition).

[0040] <<Method for preparing proteins and evaluating cellular immune activity>> Specific embodiments of the method for preparing proteins of the present invention and the method for evaluating cellular immune activity are described below. To obtain the proteins of the present invention, first, Mycobacterium tuberculosis variant bovis BCG or Mycobacterium tuberculosis (Mycobacterium tuberculosis) is cultured, and the culture filtrate is concentrated to obtain a protein mixture (culture filtrate protein: CFP). As an example of a method for preparing CFP, after floatation culture in Sauton's medium, the filtrate is sterilized by centrifugation and filtration, and the proteins contained in the filtrate are partially concentrated by ultrafiltration, precipitated with 50% saturated ammonium sulfate, and the ammonium sulfate is removed by dialysis to obtain CFP. Alternatively, CFP can be obtained by concentrating the culture filtrate using an ultrafiltration membrane, but the concentration method is not limited thereto. The obtained CFP is then fractionated and purified using column chromatography or the like to obtain a single protein. CFP can be purified using several types of column chromatography to a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Examples of column chromatography combinations include hydrophobic interaction chromatography → anion exchange chromatography → gel filtration column chromatography, or hydrophobic interaction chromatography → anion exchange chromatography → affinity chromatography using a lectin-binding carrier → anion exchange chromatography → gel filtration column chromatography, but these combinations are not limited to these. Each of the obtained proteins is then evaluated in an in vitro cytokine (interferon-γ, interleukin-2) production assay system to screen for proteins that enhance cytokine production. Proteins that demonstrate enhanced cytokine production are then screened for proteins that enhance cellular immunity using a mouse killer T cell assay system. The amino acid sequences of the proteins obtained as a result of the screening are confirmed. In this manner, MPB63 (MPT63), MPB44, MPB53 (MPT53), and MPB64 proteins can be obtained.

[0041] Alternatively, the MPT63 and MPT53 proteins can be obtained by purification from Mycobacterium tuberculosis culture filtrate according to the method described in Nagai et al. Infect. Immun. 59: 372-382 (1991) (Non-Patent Document 1).

[0042] (Expression and purification of MPB63, MPB44, MPB53, and MPB64 by recombinant bacteria) Genes encoding MPB63, MPB44, MPB53, and MPB64 can be obtained by PCR using primers with known nucleotide sequences and the genomic DNA of BCG or Mycobacterium tuberculosis as a template. They can also be obtained by chemically synthesizing a DNA fragment with a nucleotide sequence deduced from a known amino acid sequence. Alternatively, DNA fragments containing the genes can be detected by Southern blotting using a synthetic DNA probe with a known nucleotide sequence from the genomic DNA of BCG or Mycobacterium tuberculosis, and then cloned into Escherichia coli or the like, followed by colony hybridization to select colonies into which a DNA fragment containing the gene of interest has been cloned.

[0043] To express and secrete the resulting gene in acid-fast bacteria, an expression cassette is inserted into a plasmid such as pSO246 that can replicate in acid-fast bacteria by inserting the open reading frame sequence of the gene downstream of a transcription promoter and Shine-Dalgarno sequence that function in acid-fast bacteria, followed immediately by a transcription terminator. The resulting expression plasmid is then electroporated into acid-fast bacteria such as BCG or M. smegmatis to obtain a transformed bacterium. The transformed bacterium is then cultured in Sauton's medium, and the resulting culture supernatant can be purified by column chromatography or other procedures. Examples of promoters used in expression vectors include, but are not limited to, sequences recognized by acid-fast bacterial RNA polymerases, such as SP2, Ag85B, and hsp60 genes, that initiate transcription. Expression vectors can be plasmids other than pSO246 that can replicate in acid-fast bacteria, as well as bacteriophages. Expression hosts can also be BCG and M. The bacterium is not limited to S. smegmatis, but nontuberculous acid-fast bacilli such as Mycobacterium avium-intracellulare complex and Mycobacterium kansasii can also be used.

[0044] (Verification of CD8-positive T cell activation in vitro) One method for screening CFP and proteins purified from CFP for those capable of activating CD8-positive T cells is to add OVA alone or OVA and a candidate adjuvant protein to a co-culture system of mouse bone marrow-derived dendritic cells and CD8-positive cells derived from splenocytes of OT1 mice (transgenic for the T cell receptor gene of OVA-specific killer T cells) [K. A. Hogquist et al. Cell. 14; 76(1): 17-27 (1994)], and evaluate cytokine production of interferon-γ and interleukin-2 from OVA-specific killer T cells by enzyme-linked immunosorbent assay (ELISA). This method allows the investigation of the effect of enhancing killer T cell induction. Alternatively, the effect of enhancing killer T cell activity can be investigated by using a protein other than OVA for which a killer T cell epitope has been identified, and evaluating cytokine production in a system in which splenocytes from mice immunized with the protein together with CFA are co-cultured with the above-mentioned mouse bone marrow-derived dendritic cells.

[0045] (Verification of killer T cell-inducing activity in vivo) To examine the killer T cell-inducing adjuvant activity in vivo, a candidate adjuvant substance was mixed with OVA, PepA, or B16F10 cell lysate and subcutaneously inoculated into C57BL / 6 mice. Splenocytes were then prepared from the recovered spleens, stimulated with each antigen for a certain period of time, and used as effector cells. The effector cells were then incubated with C57BL / 6 mice in a major histocompatibility complex (Major Histocompatibility Complex) medium. Examples of methods include, but are not limited to, co-culturing EL4 cells (thymic lymphoma cells) that are matched with EL4 cells (MHC) and EG7 cells or GM10 cells (target cells) that have been pulsed with synthetic peptides of the killer T cell epitopes described above, which have been introduced with an OVA gene into the EL4 cells and have expressed OVA protein, and then measuring the number of target cells killed by the induced antigen-specific killer T cells using a flow cytometer. Alternatively, genetically modified bacteria such as BCG that have been engineered to secrete and express a gene for a candidate adjuvant can be administered to animals to examine the effect of enhancing the induction of killer T cells against an antigen protein originally secreted by the bacteria using synthetic peptides of the killer T cell epitopes of the antigen protein.

[0046] (Verification of antitumor effects) In a tumor-bearing mouse model system, various cancer cells capable of growing in syngeneic mice are subcutaneously transplanted into the mice. After administering a mixture of cancer antigen proteins derived from each cancer cell and a candidate adjuvant, the antitumor effects can be verified by measuring the size and weight of the grown cancer tissue. Various cancer cells can be used, including EG7, B16F10 (melanoma), LLC (lung cancer), CMT-93 (colon cancer), CT-26 (colon cancer), Panc 10.05 (pancreatic cancer), and MBT2 (bladder cancer).

[0047] The present invention will be specifically explained below with reference to examples, but the present invention is not limited to these examples.

[0048] Example 1 Purification of MPB63, MPB44, MPB53, and MPB64 from BCG Culture Filtrate (1-1) Preparation of CFP from BCG Culture Filtrate BCG bacteria: M. bovis BCG Tokyo 172 (ATCC35737) was used as a starting material. The BCG bacteria were cultured as a pellicle on the surface of Sauton's liquid medium (medium composition: L-asparagine monohydrate: 4 g / L, magnesium sulfate heptahydrate: 0.5 g / L, dipotassium hydrogen phosphate: 0.5 g / L, citric acid monohydrate: 2.0 g / L, ammonium iron(III) citrate: 0.05 g / L, glycerin: 60.0 g / L, calcium chloride: 7 mg / L, zinc sulfate heptahydrate: 0.7 mg / L, copper(II): 0.28 mg / L, pH 7.0) at 37°C until the early stationary phase. The cultured cells were centrifuged to obtain a culture filtrate. 80 L of the culture filtrate was ultrafiltered using an ultrafiltration membrane (Pelicon cassette, 5 kDa, Merck Millipore), and the resulting captured fraction was then ultrafiltered using an ultrafiltration membrane (Vivaflow 50, 5 kDa, Sartorius) to obtain 40 mL of captured fraction. 40 mL of saturated ammonium sulfate solution was slowly added to the captured fraction, stirred at 9°C for 1 hour, and then allowed to stand at 9°C for 16 hours. This solution was transferred to a centrifuge container and centrifuged at 10,440 x g and 4°C for 30 minutes. The precipitate was washed three times with 50% saturated ammonium sulfate. The resulting precipitate was dissolved in PBS and then dialyzed. The protein concentration was measured using a Pierce BCA Protein Assay Kit (Thermo SCIENTIFIC), and 1.04 g of culture filtrate proteins (CFP) was obtained.

[0049] (1-2) Purification of MPB63, MPB44, MPB53, and MPB64 by column chromatography (1-2-1) Purification of MPB63 and MPT63 Ammonium sulfate was added to a PBS solution of 2 g of CFP to a final concentration of 500 mM, and hydrophobic interaction chromatography (Phenyl Sepharose CL-4B, Cytiva) was performed. Elution was carried out in a five-step stepwise manner using 10 mM Tris-HCl buffer (pH 7.4) to which ammonium sulfate had been added to give concentrations of 500, 200, 100, and 0 mM, and distilled water as eluents. As a fraction containing MPB63, a 500 mM ammonium sulfate fraction was collected, sterilized with a 0.22 μm filter (filter filtration), concentrated using a centrifugal ultrafiltration membrane (Amicon Ultra 10 kDa, Merck), and buffer exchanged with PBS. Next, anion exchange chromatography (Capto DEAE, Cytiva) was performed using a diethylaminoethyl cellulose (DEAE) carrier, and fractionated by a stepwise method using 20 mM Tris-HCl solutions at pH 7.5, 6.0, 5.0, 4.5, 4.0, and 3.0, and the pH 4.0 eluate was used as the MPB63-containing fraction. Further, gel filtration chromatography (Superdex 75, Cytiva) was used to separate the fraction twice using a phosphate solution adjusted to pH 4.0 as the eluent, followed by filter filtration, concentration, and buffer exchange. Finally, the fractions separated by gel filtration chromatography using PBS were filtered and concentrated, and the protein concentration was measured using a Pierce BCA Protein Assay Kit to obtain 0.7 mg of MPB63. MPT63 was purified according to the method described in Nagai et al. Infect. Immun. 59: 372-382 (1991) (Non-Patent Document 1), yielding 49.6 mg of MPT63.

[0050] (1-2-2) Purification of MPB44 Using the same hydrophobic interaction chromatography as in 1-2-1 above, the distilled water eluted fraction was collected, filtered, concentrated, and buffer exchanged. Anion exchange chromatography was then performed using a DEAE carrier, and fractionation was performed using 20 mM Tris-HCl buffer (pH 7.4) to which sodium chloride was added to make a concentration of 20 mM as the eluent. Finally, the fractions separated by gel filtration chromatography using PBS were filtered and concentrated, and the protein concentration was measured using a Pierce BCA Protein Assay Kit, yielding 10.1 mg of a protein believed to be MPB44 (the protein purified in 1-2-2).

[0051] (1-2-3) Purification of MPB53 The 0 mM ammonium sulfate eluted fraction was collected by hydrophobic interaction chromatography as in 1-2-1 above, and then subjected to filter filtration, concentration, and buffer exchange. Anion exchange chromatography was then performed using a DEAE carrier, and fractionation was performed using 20 mM Tris-HCl buffer (pH 7.4) with sodium chloride added to a concentration of 20 mM as the eluent. Finally, the fraction separated by gel filtration chromatography using PBS was filtered and concentrated, and the protein concentration was measured using a Pierce BCA Protein Assay Kit to obtain 1.3 mg of MPB53. Furthermore, MPT53 was purified according to the method described in Nagai et al. Infect. Immun. 59: 372-382 (1991) (Non-Patent Document 1), and 10.0 mg of MPT53 was obtained.

[0052] (1-2-4) Purification of MPB64 The 200 mM ammonium sulfate eluted fraction was collected by hydrophobic interaction chromatography as in 1-2-1 above, and then subjected to filter filtration, concentration, and buffer exchange. Anion exchange chromatography was then performed using a DEAE carrier, and stepwise fractionation was performed using 20 mM Tris-HCl buffer (pH 7.4) to which sodium chloride was added to make concentrations of 20 and 50 mM as the eluent. The 50 mM sodium chloride fraction was collected as the fraction containing MPB64, and then subjected to filter filtration, concentration, and buffer exchange. Subsequently, fractionation was performed by lectin chromatography using a concanavalin A (ConA)-binding carrier (ConA Sepharose 4B, Cytiva). Fractions not bound to ConA were collected and further fractionated by anion exchange chromatography using a DEAE carrier. Stepwise fractionation was performed using 30 mM Tris-HCl buffer (pH 8.7, 3% methyl cellosolve) with sodium chloride added to concentrations of 50 and 75 mM as the eluent. The 75 mM sodium chloride fraction was collected as the fraction containing MPB64. Finally, the fractions separated by gel filtration chromatography using PBS were filtered and concentrated, and the protein concentration was measured using the Pierce BCA Protein Assay Kit to obtain 21.4 mg of MPB64.

[0053] (1-3) Identification of Purified Proteins (1-3-1) Evaluation by High Performance Liquid Chromatography (HPLC) Each protein sample was prepared so as not to exceed 2.0 mg / mL and analyzed under the following conditions. HPLC conditions: System: ACQUITY UPLC (Waters), column temperature: 40°C, detection wavelength: 220 nm, flow rate: 1.0 mL / min, injection volume: 1 to 10 μL, measurement time: 35 min, mobile phase: 0.1% trifluoroacetic acid in water, gradient of 0.1% trifluoroacetic acid in water:acetonitrile (3:7), column: ACQUITY UPLC Protein BEH C4, 2.1 x 50 mm, 300 Å (Waters). The purity was calculated from the detected peak areas in the resulting chromatogram (Figure 1), and the results were MPB63: 96.3%, MPT63: 96.6%, MPB44: 99.5%, MPB53: 98.1%, MPT53: 96.0%, and MPB64: 97.0%.

[0054] (1-3-2) Evaluation by SDS-PAGE Each protein sample was mixed with an equal volume of sample buffer (Tris SDS β-ME, Cosmo Bio) and heated at 95°C for 5 minutes. After cooling, 5 μg of each protein sample was applied to a gel (Multigel II Mini 15 / 25 (13W), Cosmo Bio) and electrophoresed at 20 mA for 90 minutes. Molecular weight markers of 10 to 100 KDa (SIMASIMA SS1100, Cosmo Bio) were used. The electrophoretic image after staining with Coomassie Brilliant Blue (CBB) is shown in Figure 2-1. Dimers of MPT63 were also detected.

[0055] (1-3-3) Evaluation by Native-PAGE Each protein sample was mixed with an equal volume of sample buffer (Tris-HCl buffer, Cosmo Bio), and 10 μg of each protein sample was applied to a gel (E-T7.5L e-Pagel 7.5% (14W), ATTO) and electrophoresed at 10°C and 20 mA for 60 minutes. The electrophoretic image after CBB staining is shown in Figure 2-2.

[0056] (1-3-4) Evaluation by N-terminal amino acid sequence analysis Each protein sample was mixed with an equal volume of sample buffer and heated at 95°C for 5 minutes. After cooling, 10 μg of each protein sample was applied to four lanes of a gel (Multigel II Mini 15 / 25 (13W), Cosmo Bio Co., Ltd.) and electrophoresed at 20 mA for 90 minutes. After electrophoresis, the gel was transferred to a polyvinylidene fluoride (PVDF) membrane that had been hydrophilized with methanol at 60 mA, 100 V, and 90 minutes. After transfer, the membrane was stained with CBB, and N-terminal amino acid sequence analysis was performed using the Edman degradation method. The amino acid sequence of the five residues from the N-terminus of each purified protein is shown below.

[0057]

[0058] (1-3-5) Evaluation by Two-Dimensional Electrophoresis Based on the analyses of 1-3-1 to 1-3-4, the proteins purified in 1-2-1, 1-2-3, and 1-2-4 were identified as MPB63, MPB53, and MPB64, respectively. On the other hand, the protein purified in 1-2-2 that was thought to be MPB44 could not be conclusively identified as MPB44 by the above method alone, so the following test was further performed. Specifically, MPB44 (also known as Ag85A) has two homologous proteins, MPB59 (also known as Ag85B, α-antigen) and MPB45 (also known as Ag85C), and these proteins are referred to as the Ag85 family [S. D'Souza et al. Infect. Immun. 483-493 (2003)]. Analysis in 1-3-4 confirmed that the protein obtained in 1-2-2 belongs to the Ag85 family (proteins in the Ag85 family share the same amino acid sequence for five residues from the N-terminus). To confirm that this protein is MPB44, we subsequently performed a publicly known identification method using two-dimensional electrophoresis (in which the spot positions of the Ag85 family are identified) [Naito et al. International Journal of Leprosy 208-213 (1998)]. First-dimensional isoelectric focusing was performed according to the Immobiline DryStrip Kit (Cytiva) protocol using 50 μg of CFP as the protein sample and 1.5 μg of the protein obtained in 1-2-2. Second-dimensional SDS-PAGE was performed using a gel (Multigel II Mini 14 / 16 (1W), Cosmo Bio) at 20 mA for 90 minutes. The electrophoresis image after CBB staining is shown in Figure 3. As shown in Figure 3, when a mixture of CFP and the protein obtained in 1-2-2 was electrophoresed as a sample, and a sample containing CFP was electrophoresed as a sample, it was confirmed that the spot corresponding to MPB44 was darker in the former case. From these results, it was confirmed that the protein purified in 1-2-2 was MPB44.

[0059] Example 2 Expression and purification of recombinant MPB63 (rMPB63), recombinant MPB44 (rMPB44), recombinant MPB53 (rMPB53), and recombinant MPB64 (rMPB64) in acid-fast bacteria

[0060] (2-1) Secretory expression of MPB63, MPB44, MPB53, and MPB64 in M. smegmatis and BCG Based on the amino acid sequences of the MPB63 precursor (Accession No.: BAH26234.1: SEQ ID NO: 5), MPB44 precursor (Accession No.: BAH28138.1: SEQ ID NO: 6), MPB53 precursor (Accession No.: BAH27173.1: SEQ ID NO: 7), and MPB64 precursor (Accession No.: BAH26276.1: SEQ ID NO: 8) (including their respective signal peptide portions) obtained from the NCBI Protein Database, the secretory expression of MPB63, MPB44, MPB53, and MPB64 in M. smegmatis and BCG was determined. A gene fragment (SEQ ID NOS: 9-12) was artificially synthesized by adding a restriction enzyme NdeI recognition sequence (CATATG) to the N-terminus of a gene designed using optimal codons for B. smegmatis, and a His tag (six histidine residues) gene, a stop codon, and a restriction enzyme BamHI recognition sequence (GGATCC) downstream of the C-terminus. This gene fragment was then cloned into Escherichia coli pUC57 to prepare plasmids (GenScript). The target genes were excised from these plasmids with NdeI and BamHI to prepare four types of gene fragments.

[0061] Separately, a 4480 bp DNA fragment spanning the KpnI (3713) to BamHI (163) sites of the pSO246-ACE-hupB (Rv2986c)-His6 plasmid (8024 bp, sequence 16 described in the literature) shown in Figure 4 of the prior patent document (JP 2019-208430) was artificially synthesized and ligated with a 72 bp BamHI-KpnI fragment (SEQ ID NO: 13) containing a multicloning site to obtain the pSO246 plasmid, a shuttle vector for E. coli and acid-fast bacteria. This plasmid was digested with BamHI, blunted with the Klenow fragment, and religated to delete the BamHI site. This plasmid was then digested with KpnI to prepare vector DNA. Separately, a 395-bp KpnI fragment (SEQ ID NO: 14) containing the SP2 promoter sequence derived from M. smegmatis [Spratt et al. FEMS Microbiol Lett. 224:139-42 (2003)], a ribosome binding site (SD sequence), an NdeI-BamHI multicloning site, and the terminator region of the Ag85B gene was artificially synthesized and cloned into the KpnI site of pUC18 to obtain the pA717N plasmid. The resulting small fragment was excised by digestion with KpnI to prepare an insert DNA. The vector and insert were ligated to prepare the pSOΔBam6His plasmid (see Figure 4-1). This plasmid was digested with NdeI and BamHI to generate a large fragment, which was then ligated to the four gene fragments described above using a DNA Ligation Kit (Takara Bio Inc.) (see Figure 4-2). E. coli DH5α competent cells (Toyobo Co., Ltd.) were transformed with the resulting fragments, and the target clones were selected on kanamycin-containing LB agar medium.Recombinant plasmids were extracted from the grown colonies using a QIAprep Spin Miniprep Kit (QIAGEN), and the inserts were confirmed by NdeI-BamHI digestion. 0.5 μg of the plasmids were then mixed with 0.1 mL of a bacterial solution of M. smegmatis ATCC607 strain (10% glycerol solution), and the gene was introduced by electroporation using a Gene Pulser (Bio-Rad) (2500 V, 25 μF, 1000 Ω, 0.4 cm gap cuvette). The bacterial solution was mixed with 0.1 mL of Middlebrook 7H9-ADC enrichment medium (Becton Dickinson) and incubated at 37°C for 1.5 hours. The mixture was then plated onto OADC-enriched Middlebrook 7H10 agar medium (Becton Dickinson) (containing 50 μg / mL kanamycin) and incubated at 37°C for 3 days. Grown colonies were picked and transferred to new OADC-containing Middlebrook 7H10 agar medium (containing 50 μg / mL kanamycin) and cultured at 37°C for 2 days. A small amount of the bacterial mass was inoculated into 20 mL of Sauton's medium and cultured statically at 37°C for 7 days. A portion of the supernatant was collected, and the concentrated protein mixture was fractionated by SDS-PAGE, then transferred to a PVDF membrane. The reactivity with the antibody was analyzed by Western blotting using an anti-His tag antibody, and M. smegmatis clones secreting and expressing each of the four MPB proteins were obtained.

[0062] Separately, a bacterial suspension was prepared by suspending the same BCG strain as in 1-1 in 10% glycerol, and 2 μg of each of the pSOΔBam-MPB63, pSOΔBam-MPB44, pSOΔBam-MPB53, and pSOΔBam-MPB64 plasmids was mixed therewith. Transformation was performed by electroporation under the same conditions as above. After culturing at 37°C for 3 weeks, the transformed bacteria were selected and then subcultured on fresh 7H10-OADC agar medium (containing 50 μg / mL of kanamycin) and cultured at 37°C for 2 weeks. A small amount of the grown recombinant bacteria was subjected to float culture in 30 mL of Sauton's medium in the same manner as above. After 8 weeks, the culture supernatant was collected and the bacteria were removed. Proteins were concentrated from 0.1 mL of the supernatant and fractionated by SDS-PAGE. The protein was then analyzed by Western blotting using an anti-His tag antibody as described above to obtain recombinant BCG strains that secrete and express rMPB63, rMPB44, rMPB53, and rMPB64.

[0063] (2-2) Purification of rMPB63, rMPB44, rMPB53, and rMPB64 M. smegmatis strains expressing rMPB63, rMPB44, rMPB53, and rMPB64 were cultured in 20 to 100 mL of Sauton's medium at 37°C for 7 days. Recombinant BCG strains expressing rMPB63, rMPB44, rMPB53, and rMPB64 were cultured in 30 mL of Sauton's medium at 37°C for 4 to 8 weeks. The culture supernatants were sterilized using a 0.45 μm filter (Millex-HV filter, Merck), and the supernatants were directly applied to a HisTrap FF column (Cytiva). Phosphate buffer (binding buffer) was prepared by diluting 8x concentrated phosphate buffer (pH 7.4) from the His Buffer Kit (Cytiva) with distilled water at a 1:7 ratio. The His Trap FF column was washed with 5x the column volume of Milli-Q water and then equilibrated with 5x the column volume of binding buffer. Next, the sterilized culture supernatant was passed through the column, and the column was washed with 15x the column volume of binding buffer. Furthermore, 2M imidazole solution (pH 7.4) from the His Buffer Kit (Cytiva) was mixed with binding buffer at a 1:49 ratio to prepare a 40mM imidazole solution. The column was washed with 40 mM imidazole solution (5 times the column volume). Separately, 2 M imidazole (pH 7.4) and binding buffer from the His Buffer Kit (Cytiva) were mixed at a 1:3 ratio to prepare a 500 mM imidazole solution (Elution Buffer). Five 1 mL aliquots of Elution Buffer were applied to the column to elute each protein bound to the column. A portion of this solution was subjected to SDS-PAGE to confirm purity, and reactivity with anti-His tag antibodies was confirmed by Western blotting as described in 2-1 above (Figure 5-1). Each solution was concentrated and buffer exchanged with PBS using a centrifugal ultrafiltration membrane (Amicon 10K), and then the protein concentration was measured using the Pierce BCA Protein Assay Kit.The yield of each purified protein is shown in the table below.

[0064]

[0065] (2-3) Secretory Expression of Native rMPB63 in M. smegmatis and Secretory Expression of Native rMPB44 in BCG. The small NdeI-BamHI fragment obtained by digesting pSOΔBam-MPB63, which contains the MPB63 gene (SEQ ID NO: 9) with a C-terminal His tag, with NdeI and BamHI was ligated to the large DNA fragment obtained by digesting pUC18 with NdeI and BamHI to obtain the pUC18-MPB63 plasmid (Figure 4-3). This plasmid was digested with NdeI and PpuMI to obtain an approximately 460 bp NdeI-PpuMI fragment, which was then separated by agarose gel electrophoresis. Separately, to insert a DNA fragment from the C-terminal region of the MPB63 gene lacking a His tag into the PpuMI-BamHI site, adapters PB1 (SEQ ID NO: 15) and PB2 (SEQ ID NO: 16) with PpuMI and BamHI cleavage ends were chemically synthesized. Using 100 pmol of each, the 5' hydroxyl group was phosphorylated with T4 polynucleotide kinase, and the enzyme was inactivated by heating at 70°C for 15 minutes, followed by annealing to obtain adapter DNA. The NdeI-PpuMI fragment and adapter DNA were ligated to a vector obtained by cleaving pSOΔBam6His with NdeI and BamHI to obtain the wild-type MPB63 expression plasmid pSOΔBam-nMPB63 (Figure 4-4). This plasmid was introduced into M. smegmatis as described above in (2-1). The resulting recombinant strains were then statically cultured in kanamycin-containing Sauton's medium for 7 days, and the culture supernatant was collected. The supernatant was sterilized by filtration and then purified. Meanwhile, the small NdeI-BamHI fragment obtained by digesting pSOΔBam-MPB44, which contains the MPB44 gene (SEQ ID NO: 10) with a C-terminal His tag, was ligated with the large DNA fragment obtained by digesting pUC18 with NdeI and BamHI to obtain the pUC18-MPB44 plasmid (Figure 4-3). The approximately 180-bp XhoI-ApaI fragment obtained by digesting this plasmid with XhoI and ApaI was separated by agarose gel electrophoresis.Separately, to insert a DNA fragment from the C-terminal region of the MPB44 gene lacking a His tag into the ApaI-BamHI site near the C-terminus of MPB44, adapters APB1 (SEQ ID NO: 17) and APB2 (SEQ ID NO: 18) with ApaI and BamHI cleavage ends were chemically synthesized. Using 100 pmol of each, the 5' hydroxyl groups were phosphorylated with T4 polynucleotide kinase, and the enzyme was inactivated by heating at 70°C for 15 minutes, followed by annealing to obtain adapter DNA. The above-mentioned XhoI-ApaI fragment and adapter DNA were ligated to a vector obtained by cleaving pUC18-MPB44 with XhoI and BamHI to obtain plasmid pUC-nMPB44 containing the native MPB44 gene. This plasmid was digested with NdeI and BamHI to obtain an NdeI-BamHI fragment containing the wild-type MPB44 gene. This fragment was then ligated with a vector obtained by digesting pSOΔBam6His with NdeI and BamHI to obtain the wild-type MPB44 expression plasmid pSOΔBam-nMPB44 (Figure 4-5). This plasmid was introduced into the BCG Tokyo strain in the same manner as in (2-1). The resulting recombinant bacteria were then statically cultured in kanamycin-containing Sauton medium for 30 days, and the culture supernatant was collected. The supernatant was sterilized by filtration and then subjected to purification.

[0066] (2-4) Purification of Native rMPB63 and Native rMPB44 (2-4-1) Purification of Native rMPB63 40 mL of the culture supernatant obtained in 2-3 above was concentrated and buffer exchanged. Anion exchange chromatography was then performed using a DEAE carrier, and fractionation was performed using 30 mM Tris-HCl buffer (pH 8.7, 3% methyl cellosolve) with sodium chloride added to a concentration of 40 mM as the eluent. Finally, the fractions separated by gel filtration chromatography using PBS were filtered and concentrated, and the protein concentration was measured using a Pierce BCA Protein Assay Kit to obtain 4.1 mg of native rMPB63. The protein sample was subjected to SDS-PAGE as in 1-3-2 above, and its reactivity with anti-MPB63 antibody (rabbit IgG antibody derived from rMPB63 obtained in 2-2 above) was confirmed by Western blotting as in 2-1 above (Figure 5-1). (2-4-2) Purification of native rMPB44 240 mL of the culture supernatant obtained in 2-3 above was concentrated and buffer exchanged. Next, anion exchange chromatography was performed using a DEAE carrier, and fractionation was performed using 20 mM Tris-HCl buffer (pH 7.4) with sodium chloride added to a concentration of 20 mM as the eluent. Finally, the fractions separated by gel filtration chromatography using PBS were filtered and concentrated, and the protein concentration was measured using a Pierce BCA Protein Assay Kit to obtain 3.7 mg of native rMPB44. The protein sample was subjected to SDS-PAGE as in 1-3-2 above, and its reactivity with anti-MPB44 antibody (rabbit IgG antibody derived from rMPB44 obtained in 2-2 above) was confirmed by Western blotting as in 2-1 above (Figure 5-1).

[0067] HPLC analysis of the recombinant protein was performed in the same manner as in 1-3-1 above, and the purity was calculated from the detected peak area in the resulting chromatogram (Figure 5-2). The results were as follows: rMPB63: 97.4%, rMPB44: 97.5%, rMPB53: 96.5%, rMPB64: 99.7%, rMPB63 (BCG): 100%, rMPB44 (BCG): 99.7%, rMPB53 (BCG): 99.8%, rMPB64 (BCG): 99.9%, native rMPB63 (smegmatis): 98.3%, native rMPB44 (BCG): 99.5%.

[0068] Example 3: Construction of an in vitro cytokine assay system using mouse bone marrow-derived dendritic cells (3-1) Evaluation of the effect of CFP on enhancing activation of OVA-specific CD8-positive T cells (Reference Example) Mouse bone marrow-derived dendritic cells (BMDCs) were obtained by the following method: Bone marrow cells were collected from the bone marrow of C57BL / 6j mice (Japan SLC). After hemolysis, bone marrow cells were cultured at 1 × 10 in dendritic cell induction medium (RPMI 1640 containing 10 ng / mL Granulocyte Macrophage colony-stimulating Factor, 4 ng / mL recombinant mouse interleukin-4, 10% Fetal Bovine Serum (FBS), 1000 U / mL penicillin-streptomycin, and 55 μM 2-mercaptoethanol). 6 The cells were seeded at 1.5-2.0 x 10 cells / mL and cultured for 7 days in a 5% CO environment. On the third day of culture, the floating cells were removed and replaced with the same amount of fresh dendritic cell induction medium. On the sixth day of culture, only non-adherent cells were collected. The collected cells were collected at a density of 1.5-2.0 x 10 6 The cells were adjusted to a density of 1000 cells / mL with dendritic cell induction medium and plated on a Petri dish. Seven days after the start of culture, only the floating cells were collected and used as BMDCs.

[0069] OT1-CD8 T cells were obtained as follows: Spleen cells were collected from the spleen of OT1 mice (transgenic mice that specifically recognize OVA epitopes) (OT1 mice are available from Jackson Laboratory, etc.). The spleen cells were hemolyzed and then purified using EasySep Mouse CD8 +CD8-positive T cells were collected using a T cell isolation kit (Veritas) and designated as OT1-CD8 T cells. + The T cell isolation kit was used according to the instructions in the kit. + T cells were obtained.

[0070] BMDC and CD8 obtained above + Using T cells, an OVA / CFP group, a non-group, and an OVA / PBS group were prepared according to the following procedure. The OVA / CFP group was an adjuvant-added group. The OVA / CFP group was obtained by the following method. BMDCs were cultured at a concentration of 1 x 10 in RPMI medium (RPMI 1640 containing 10% FBS, 1000 U / mL penicillin-streptomycin, and 55 μM 2-mercaptoethanol) supplemented with 10 μg / mL OVA (Sigma-Aldrich) and 200 μg / mL culture filtrate protein (CFP). 6 The solution was adjusted to 2 x 10 cells / mL and seeded at 200 μL / well in a U-bottom 96-well plate (5 wells / group). Culture was performed for 24 hours in a 5% CO2 environment. 45 minutes before the end of culture, mitomycin C was added at 50 μg / mL. After culture, the cells were washed three times with RPMI medium. The resulting BMDCs (BMDCs cultured with OVA and CFP) were 2 x 10 5 OT1-CD8 T cells were cultured at 5 × 10 cells / well in a 96-well plate. 5 The cells were added at 100 μg / well and cultured in a 5% CO 2 environment for 24 hours to obtain samples of the OVA / CFP group.

[0071] The non-group was an untreated group. The non-group was obtained as follows: 1 × 10 BMDCs were cultured in RPMI medium containing neither OVA nor CFP. 6The solution was adjusted to 2 x 10 cells / mL and seeded at 200 μL / well in a U-bottom 96-well plate (5 wells / group). Culture was performed for 24 hours in a 5% CO2 environment. 45 minutes before the end of culture, mitomycin C was added at 50 μg / mL. After culture, the cells were washed three times with RPMI medium. The resulting BMDCs (BMDCs cultured without OVA or CFP) were 2 x 10 5 OT1-CD8 T cells were cultured at 5 × 10 cells / well in a 96-well plate. 5 The cells were added at 1000 cells / well and cultured in a 5% CO 2 environment for 24 hours to obtain a sample of the non-treated group.

[0072] The OVA / PBS group was a control group for comparison with the OVA / BMDC group. The OVA / PBS group was obtained by the following method: 1 × 10 BMDCs were added to RPMI medium containing 10 μg / mL OVA but not CFP. 6 The solution was adjusted to 2 x 10 cells / mL and seeded at 200 μL / well in a U-bottom 96-well plate (5 wells / group). Culture was performed for 24 hours in a 5% CO2 environment. 45 minutes before the end of culture, mitomycin C was added at 50 μg / mL. After culture, the cells were washed three times with RPMI medium. The resulting BMDCs (BMDCs cultured with only OVA added) were 2 x 10 5 OT1-CD8 T cells were cultured at 5 × 10 cells / well in a 96-well plate. 5 The cells were added at 100x the concentration of OVA / PBS in the culture medium at 10x the concentration of OVA / PBS in the culture medium and cultured in a 5% CO 2 atmosphere for 24 hours to obtain samples of the OVA / PBS group.

[0073] After culture, the amount of IL-2 in the sample supernatant from each group was measured using ELISA (Mouse IL-2 Duoset ELISA, R&D Systems). ELISA was performed according to the kit instructions. The amount of IL-2 produced was compared between the control group (OVA / PBS group) and the CFP group (OVA / CFP group). As a result, a significant increase in IL-2 production was observed in the CFP-added group, suggesting an increase in the antigen-presenting ability of BMDCs (Figure 6, 6-1).

[0074] (3-2) Evaluation of the Effect of MPT63 on Enhancement of OVA-Specific CD8+ T Cell Activation BMDCs were obtained in the same manner as in 3-1 above. For the OVA / MPT63 group, culture was performed using RPMI medium supplemented with 10 μg / mL OVA and 12.4 μg / mL MPT63 instead of RPMI medium supplemented with 10 μg / mL OVA and 200 μg / mL CFP, and samples for the OVA / MPT63 group were obtained in the same manner as in 3-1. The amount of IL-2 in the supernatant of each sample after culture was measured using ELISA. As a result, a significant increase in IL-2 production was observed in the MPT63-added group, suggesting an increase in the antigen-presenting ability of BMDCs (6-2 in Figure 6).

[0075] (3-3) Evaluation of the Effect of MPB44 on Enhancement of OVA-Specific CD8+ T Cell Activation BMDCs were obtained in the same manner as in 3-1 above. For the OVA / MPB44 group, culture was performed using RPMI medium supplemented with 10 μg / mL OVA and 6.32 μg / mL MPB44 instead of RPMI medium supplemented with 10 μg / mL OVA and 200 μg / mL CFP, and samples for the OVA / MPB44 group were obtained in the same manner as in 3-1. The amount of IL-2 in the supernatant of each sample after culture was measured using ELISA. As a result, a significant increase in IL-2 production was observed in the MPB44-added group, suggesting an increase in the antigen-presenting ability of BMDCs (6-3 in Figure 6).

[0076] (3-4) Evaluation of the Effect of MPT53 on Enhancement of OVA-Specific CD8+ T Cell Activation BMDCs were obtained in the same manner as in 3-1 above. For the OVA / MPT53 group, culture was performed using RPMI medium supplemented with 10 μg / mL OVA and 5.6 μg / mL MPT53 instead of RPMI medium supplemented with 10 μg / mL OVA and 200 μg / mL CFP, and samples for the OVA / MPT53 group were obtained in the same manner as in 3-1. After culture, the amount of IL-2 in the supernatant of each sample was measured using ELISA. As a result, a significant increase in IL-2 production was observed in the MPT53-added group, suggesting an increase in the antigen-presenting ability of BMDCs (6-4 in Figure 6).

[0077] (3-5) Evaluation of the Effect of MPB64 on Enhancement of OVA-Specific CD8+ T Cell Activation BMDCs were obtained in the same manner as in 3-1 above. For the OVA / MPB64 group, culture was performed using RPMI medium supplemented with 10 μg / mL OVA and 12.4 μg / mL MPB64 instead of RPMI medium supplemented with 10 μg / mL OVA and 200 μg / mL CFP, and samples for the OVA / MPB64 group were obtained in the same manner as in 3-1. The amount of IL-2 in the supernatant of each sample after culture was measured using ELISA. As a result, a significant increase in IL-2 production was observed in the MPB64-added group, suggesting an increase in the antigen-presenting ability of BMDCs (6-5 in Figure 6).

[0078] Example 4 Evaluation of OVA-Specific Killer T Cell Induction Activity in Mice (4-1) Enhancement of OVA-Specific Killer T Cell Induction by CFP (Reference Example) Effector cells were obtained by the following method. C57BL / 6j mice were subcutaneously inoculated into the left flank of mice on days 0 and 10 with 100 μg / mL OVA and 2000 μg / mL CFP-containing PBS at a volume of 100 μL / mouse. Spleen cells were collected from the inoculated mice on day 17. EG7 cells (incubated with 50 μg / mL mitomycin C for 45 minutes, then washed three times before use) were used as antigens. EG7 cells were EL4 cells (thymic lymphoma cells) that were introduced with the OVA gene to express OVA protein (purchased from ATCC). 5 x 10 6 cells / mL inoculated mouse-derived splenocytes and 2.5 × 10 5 The mixture of 100 μg / mL OVA with 100 μL / mL antigen was cultured in RPMI medium under a 5% CO environment for 5 days. After culture, floating cells were collected, and lymphocytes were collected using Lympholyte M Cell Separation Media (Cedarlane Laboratories) to serve as effector cells (OVA / CFP-inoculated group). Lympholyte M Cell Separation Media was treated according to the manufacturer's instructions. The control group received a subcutaneous inoculation of 100 μL / mouse of 100 μg / mL OVA in PBS (instead of OVA and CFP-containing PBS), and cells were then obtained in the same manner as above (OVA / PBS-inoculated group).

[0079] Target cells were obtained as follows. EL4 cells (thymic lymphoma cells, purchased from Public Health England) or EG7 cells (EL4 cells expressing OVA protein by introducing the OVA gene) were cultured in RPMI medium. 2 μM carboxyfluorescein succinimidyl ester (CFSE) was added to the collected cells and incubated at room temperature for 15 minutes. Afterwards, the cells were washed with RPMI medium and cultured at a final cell concentration of 2 × 10 6 The solution was adjusted to 100 cells / mL and heated in a 5% CO2 atmosphere for 30 minutes.

[0080] Cytotoxicity assay was performed using the 7AAD / CFSE Cell-Mediated Cytotoxicity Assay Kit (Cayman Chemical) according to the manufacturer's instructions. Effector cells and target cells were seeded at ratios of 3.125:1, 6.25:1, 12.5:1, and 25:1, and cultured for 3 hours in a 5% CO environment. After culture, the culture supernatant was removed, 7AAD was added, and the cells were incubated for 15 minutes at 4°C in the dark. After washing once with Assay Buffer, the percentage of dead cells in the target cells was measured using a FACSCalibur (BD Biosciences). The proportion of dead cells among target cells at each effector cell to target cell ratio was compared between the control group and the OVA / CFP-vaccinated group. When the proportion of dead cells in the OVA / CFP-vaccinated group at an effector cell to target cell ratio of 25:1 was 1.3 times or more higher than that in the control group, it was determined that antigen-specific killer T cell (cytotoxic T cell, CTL) activity was enhanced. As a result, when EG7 cells expressing OVA protein were used as target cells, the proportion of dead cells among target cells increased as the ratio of effector cells to target cells increased compared to when EL4 cells not expressing OVA protein were used as target cells (Figure 7, 7-1, comparison of the results shown by open and closed triangles, or comparison of the results shown by open and closed circles). This demonstrated that the CTLs contained in the effector cells have antigen (OVA protein)-specific CTL activity. Furthermore, when EG7 cells expressing OVA protein were used, increasing the ratio of effector cells to target cells increased the percentage of dead cells in the OVA / CFP-vaccinated group compared to the control group, suggesting enhanced OVA-specific CTL activity in vivo in mice (compare the results shown by the black circles and black triangles in Figure 7, 7-1). Furthermore, when the ratio of effector cells to target cells was 25:1, the percentage of dead cells in the OVA / CFP-vaccinated group was 2.32-fold higher than that in the control group. This demonstrates that CFP has adjuvant activity that induces cellular immunity.

[0081] (4-2) Enhancement of OVA-Specific Killer T Cell Induction by MPT63 Effector cells were obtained in the same manner as in 4-1 above, except that 110 μg / mL MPT63 was added instead of CFP when inoculating mice with OVA. Target cells were obtained in the same manner as in 4-1 above. Cytotoxicity assays were performed in the same manner as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the rate of dead cells in the OVA / MPT63-inoculated group at an effector / target cell ratio of 25:1 was 2.11-fold higher than that in the control group (7-2 in Figure 7). These results demonstrate that MPT63 has adjuvant activity inducing cellular immunity.

[0082] (4-3) Enhancement of OVA-Specific Killer T Cell Induction by MPB44 Effector cells were obtained by the same method as in 4-1 above, except that 63.2 μg / mL MPB44 was added instead of CFP when inoculating mice with OVA. Target cells were obtained by the same method as in 4-1 above. Cytotoxicity assays were performed by the same method as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the cell death rate in the OVA / MPB44-inoculated group at an effector cell to target cell ratio of 25:1 was 2.19-fold higher than that in the control group (7-3 in Figure 7). This demonstrates that MPB44 has adjuvant activity that induces cellular immunity.

[0083] (4-4) Enhancement of OVA-Specific Killer T Cell Induction by MPB53 Effector cells were obtained by the same method as in 4-1 above, except that 60 μg / mL MPB53 was added instead of CFP when inoculating mice with OVA. Target cells were obtained by the same method as in 4-1 above. Cytotoxicity assays were performed by the same method as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 25:1 in the OVA / MPB53-inoculated group was 2.75-fold higher than that in the control group (7-4 in Figure 7). This demonstrates that MPB53 has adjuvant activity inducing cellular immunity.

[0084] (4-5) Enhancement of OVA-Specific Killer T Cell Induction by MPB64 Effector cells were obtained by the same method as in 4-1 above, except that 100 μg / mL MPB64 was added instead of CFP when inoculating mice with OVA. Target cells were obtained by the same method as in 4-1 above. Cytotoxicity assays were performed by the same method as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the cell death rate in the OVA / MPB64-inoculated group at an effector / target cell ratio of 25:1 was 1.53-fold higher than that in the control group (7-5 ​​in Figure 7). This demonstrates that MPB64 has adjuvant activity that induces cellular immunity.

[0085] (4-6) Enhancement of OVA-Specific Killer T Cell Induction by rMPB63 Effector cells were obtained in the same manner as in 4-1 above, except that 110 μg / mL rMPB63 was added instead of CFP when inoculating mice with OVA. Target cells were obtained in the same manner as in 4-1 above. Cytotoxicity assays were performed in the same manner as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the cell death rate in the OVA / rMPB63-inoculated group at an effector cell to target cell ratio of 25:1 was 2.35-fold higher than that in the control group (7-6 in Figure 7). This demonstrates that rMPB63 has adjuvant activity that induces cellular immunity.

[0086] (4-7) Enhancement of OVA-Specific Killer T Cell Induction by rMPB44 Effector cells were obtained by the same method as in 4-1 above, except that 63.2 μg / mL rMPB44 was added instead of CFP when inoculating mice with OVA. Target cells were obtained by the same method as in 4-1 above. Cytotoxicity assays were performed by the same method as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the cell death rate in the OVA / rMPB44-inoculated group at an effector / target cell ratio of 25:1 was 1.53-fold higher than that in the control group (Figure 7, 7-7). This demonstrates that rMPB44 has adjuvant activity inducing cellular immunity.

[0087] (4-8) Enhancement of OVA-Specific Killer T Cell Induction by rMPB53 Effector cells were obtained in the same manner as in 4-1 above, except that 60 μg / mL rMPB53 was added instead of CFP when inoculating mice with OVA. Target cells were obtained in the same manner as in 4-1 above. Cytotoxicity assays were performed in the same manner as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 25:1 in the OVA / rMPB53-inoculated group was 2.49-fold higher than that in the control group (see 7-8 in Figure 7). This demonstrates that rMPB53 has adjuvant activity inducing cellular immunity.

[0088] (4-9) Enhancement of OVA-Specific Killer T Cell Induction by rMPB64 Effector cells were obtained in the same manner as in 4-1 above, except that 95.6 μg / mL rMPB64 was added instead of CFP when inoculating mice with OVA. Target cells were obtained in the same manner as in 4-1 above. Cytotoxicity assays were performed in the same manner as in 4-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (OVA protein)-specific CTL activity. Furthermore, the cell death rate in the OVA / rMPB64-inoculated group at an effector / target cell ratio of 25:1 was 1.60-fold higher than that in the control group (Figure 7, 7-9). This demonstrates that rMPB64 has adjuvant activity inducing cellular immunity.

[0089] Example 5 Evaluation of PepA (MTB32)-specific killer T cell induction activity in mice (5-1) Expression and purification of recombinant PepA (rPepA) in M. smegmatis A gene encoding the amino acid sequence of BCG-derived PepA (Accession No.: BAH24430.1: SEQ ID NO: 19), with a His tag added to the C-terminus and optimized for codons commonly used in M. smegmatis was chemically synthesized (SEQ ID NO: 20). The PepA gene fragment of approximately 1 kbp was obtained by cleaving a plasmid (GenScript) cloned into the NdeI-BamHI site of pUC57 plasmid with NdeI and BamHI (see FIG. 4A ) and then ligated with a vector DNA fragment (see FIG. 4B ) obtained by cleaving pSOΔBam6His plasmid with NdeI and BamHI. Ligation was performed for 2 hours at 16°C using a Ligation Kit, and Escherichia coli DH5α competent cells (Toyobo Co., Ltd.) were transformed. Kanamycin-resistant recombinant bacteria were selected on LB agar medium containing kanamycin. A recombinant plasmid with the PepA gene fragment correctly inserted was extracted from the recombinant bacteria using a QIAprep Spin Miniprep Kit to obtain the pSOΔBam-PepA plasmid (Figure 8-1). An M. smegmatis solution was prepared using the same method as in 2-1, and 0.5 μg of the pSOΔBam-PepA plasmid was mixed with it. Transformants were then transformed by electroporation under the same conditions as in 2-1. Transformants were selected using the same method as in 2-1, and recombinant M. smegmatis harboring the pSOΔBam-PepA plasmid was obtained.

[0090] A small amount of the resulting recombinant bacteria was cultured in Sauton's medium as in 2-2. The culture supernatant was collected and sterilized, and then purified using a His Trap FF column as in 2-2. The 8x concentrated phosphate buffer (pH 7.4) in the His Buffer Kit (Cytiva) was diluted 1:7 with Milli-Q water to prepare a phosphate buffer (binding buffer) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) to prevent autolysis of the serine protease PepA. Furthermore, 1 mM PMSF was added to 40 mM imidazole solution and 500 mM imidazole solution, each prepared in the same manner as in 2-2, to prepare a washing buffer and an elution buffer. An eluate containing rPepA protein was obtained by the same column procedure as in 2-2. This solution was then dialyzed twice for 2 hours against 1 L of PBS at 4°C using a dialysis membrane (Slide-A-Lyzer Dialysis Cassette; Thermo Scientific), followed by dialysis against 3 L of PBS for 2 days. The PBS was then replaced with another 1 L solution and dialyzed twice for 2 hours each to completely remove the imidazole used for elution. Finally, the protein concentration was measured using the Pierce BCA Protein Assay Kit, and 2.87 mg of rPepA was obtained from 80 mL of culture filtrate. A photograph of the SDS-PAGE of the purified rPepA protein is shown in Figure 8-2.

[0091] (5-2) Enhancement of rPepA-Specific Killer T Cell Induction by MPT63 Effector cells were prepared according to the method described in 4-1, except that 100 μg / mL rPepA was used instead of OVA as the antigen inoculated into mice, and 110 μg / mL MPT63 was used instead of CFP. The resulting mixture was inoculated in PBS at a volume of 100 μL per mouse. The recovered splenocytes were cultured in RPMI medium supplemented with 10 μg / mL PepA peptide (GM10 GAPINSATAM) and obtained in the same manner as in 4-1 above (PepA / MPT63-inoculated group). The control group received a subcutaneous inoculation of 100 μg / mL rPepA-containing PBS (instead of PepA and MPT63-containing PBS) at a volume of 100 μL per mouse, followed by cell collection in the same manner as above (PepA / PBS-inoculated group). Target cells were obtained as follows. EL4 cells were cultured in RPMI medium supplemented with 2 μg / mL GM10 under a 5% CO2 environment for 90 minutes (GM10-EL4). EL4 cells without GM10 were also cultured in RPMI medium under a 5% CO2 environment for 90 minutes (EL4). After culturing, each type of cell was washed three times, and 2 μM CFSE was added. The cells were then obtained in the same manner as in 4-1 above. Cytotoxicity assays were performed in the same manner as in 4-1 above, seeding effector cells to target cells at ratios of 6.25:1, 12.5:1, 25:1, and 50:1. Antigen-specific cytotoxic T cell (CTL) activity was determined to be enhanced when the cell death rate at an effector cell to target cell ratio of 50:1 was 1.3-fold or more that of the control group. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (PepA)-specific CTL activity. Furthermore, the cell death rate at an effector cell to target cell ratio of 50:1 in the rPepA / MPT63-vaccinated group was 1.63-fold that of the control group (Figure 9, 9-1). This suggests that the rPepA / MPT63-vaccinated group enhanced PepA-specific CTL activity in vivo in mice.

[0092] (5-3) Enhancement of PepA-Specific Killer T Cell Induction by MPB44 Effector cells were obtained in the same manner as in 5-2 above, except that 63.2 μg / mL MPB44 was added instead of MPT63 when inoculating mice with rPepA. Target cells were obtained in the same manner as in 5-2 above. Cytotoxicity assays were performed in the same manner as in 5-2 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (PepA)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 50:1 was 2.63-fold higher in the rPepA / MPB44-inoculated group than in the control group (Figure 9, 9-2). This suggests that the rPepA / MPB44-inoculated group enhanced PepA-specific CTL activity in vivo in mice.

[0093] (5-4) Enhancement of PepA-Specific Killer T Cell Induction by MPB53 Effector cells were obtained in the same manner as in 5-2 above, except that 60 μg / mL MPB53 was added instead of MPT63 when inoculating mice with rPepA. Target cells were obtained in the same manner as in 5-2 above. Cytotoxicity assays were performed in the same manner as in 5-2 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (PepA)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 50:1 was 4.74-fold higher in the rPepA / MPB53-inoculated group than in the control group (Figure 9, 9-3). This suggests that the rPepA / MPB53-inoculated group enhanced PepA-specific CTL activity in vivo in mice.

[0094] (5-5) Enhancement of PepA-Specific Killer T Cell Induction by MPB64 Effector cells were obtained in the same manner as in 5-2 above, except that 95.6 μg / mL MPB64 was added instead of MPT63 when inoculating mice with rPepA. Target cells were obtained in the same manner as in 5-2 above. Cytotoxicity assays were performed in the same manner as in 5-2 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (PepA)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 50:1 was 2.73-fold higher in the rPepA / MPB64-inoculated group than in the control group (Figure 9, 9-4). This suggests that the rPepA / MPB64-inoculated group enhanced PepA-specific CTL activity in vivo in mice.

[0095] (5-6) Enhancement of PepA-Specific Killer T Cell Induction by rMPB63 Effector cells were obtained in the same manner as in 5-2 above, except that 110 μg / mL rMPB63 was added instead of MPT63 when inoculating mice with PepA. Target cells were obtained in the same manner as in 5-2 above. Cytotoxicity assays were performed in the same manner as in 5-2 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (PepA)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 50:1 was 1.99-fold higher in the rPepA / rMPB63-inoculated group than in the control group (Figure 9, 9-5). This suggests that the rPepA / rMPB63-inoculated group enhanced PepA-specific CTL activity in vivo in mice.

[0096] (5-7) Enhancement of PepA-specific killer T cell induction by rMPB44 Effector cells were obtained in the same manner as in 5-2 above, except that 63.2 μg / mL rMPB44 was added instead of MPT63 when inoculating mice with rPepA. Target cells were obtained in the same manner as in 5-2 above. Cytotoxicity assays were performed in the same manner as in 5-2 above. The results demonstrated that the CTLs contained in the effector cells had antigen (PepA)-specific CTL activity. Furthermore, the rate of dead cells at an effector cell to target cell ratio of 50:1 was 1.59-fold higher in the rPepA / rMPB44-inoculated group than in the control group (9-6 in Figure 9). This suggests that the rPepA / rMPB44 inoculated group enhanced PepA-specific CTL activity in vivo in mice.

[0097] (5-8) Enhancement of PepA-Specific Killer T Cell Induction by rMPB53 Effector cells were obtained in the same manner as in 5-2 above, except that 60 μg / mL rMPB53 was added instead of MPT63 when inoculating mice with rPepA. Target cells were obtained in the same manner as in 5-2 above. Cytotoxicity assays were performed in the same manner as in 5-2 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (PepA)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 50:1 was 2.11-fold higher in the rPepA / rMPB53-inoculated group than in the control group (Figure 9, 9-7). This suggests that the rPepA / rMPB53-inoculated group enhanced PepA-specific CTL activity in vivo in mice.

[0098] (5-9) Enhancement of PepA-specific killer T cell induction by rMPB64 Effector cells were obtained in the same manner as in 5-2 above, except that 95.6 μg / mL rMPB64 was added instead of MPT63 when inoculating mice with rPepA. Target cells were obtained in the same manner as in 5-2 above. Cytotoxicity assays were performed in the same manner as in 5-2 above. The results demonstrated that the CTLs contained in the effector cells had antigen (PepA)-specific CTL activity. Furthermore, the rate of dead cells at an effector cell to target cell ratio of 50:1 in the rPepA / rMPB64-inoculated group was 1.63-fold higher than that in the control group (Figure 9, 9-8). This suggests that the rPepA / rMPB64-inoculated group enhanced PepA-specific CTL activity in vivo in mice.

[0099] Example 6 Evaluation of Melanoma-Specific Killer T Cell Induction Activity in Mice (6-1) Enhancement of Melanoma-Specific Killer T Cell Induction by CFP (Reference Example) B16F10 cell lysate used as an antigen was obtained in the following manner. B16F10 cells (mouse melanoma cells, purchased from ATCC) were cultured in DMEM medium (DMEM containing 10% FBS, 1000 U / mL penicillin-streptomycin, and 55 μM 2-mercaptoethanol) in a 5% CO environment. The proliferated B16F10 cells were collected and washed three times with PBS to obtain 1 x 10 cells. 8 The solution was adjusted to 100 cells (viable cell count + dead cell count) / mL and then frozen and stored at -80°C. The frozen B16F10 cell solution was thawed on ice within one week before use in the experiment and disrupted by sonication. Sonication (Bioruptor UCD-250, Cosmo Bio) was performed at Level M for 10 minutes (30 seconds of sonication followed by 30 seconds of no treatment, repeated), followed by treatment in ice water twice. After sonication, the solution was centrifuged at 14,000 x g and 4°C for 15 minutes, and the supernatant was collected and used as the B16F10 cell lysate.

[0100] Effector cells were prepared according to the method described in 4-1, except that 100 μL (1 × 10 B16F10 cells) was used as the antigen to inoculate the mice instead of OVA. 7Mice were inoculated with 100 μL / mouse of PBS containing 2000 μg / mL B16F10 cell lysate (lysate equivalent to 1000 μg / mL of cells) and 2000 μg / mL CFP. The collected splenocytes were cultured in RPMI medium supplemented with 10 μg / mL TRP2 (B16F10 antigen) peptide (SVYDFFVWL) and obtained in the same manner as in 4-1 above (B16 lys / CFP-inoculated group). The control group received a subcutaneous inoculation of 100 μL / mouse of PBS containing 100 μL / mL B16F10 cell lysate (instead of B16F10 cell lysate and CFP-containing PBS), and cells were then obtained in the same manner as above (B16 lys / PBS-inoculated group). Target cells were obtained in the following manner. B16F10 cells were cultured in DMEM medium, and EL4 cells were cultured in RPMI medium under a 5% CO environment. The grown cells were collected, and target cells were obtained using the same method as in 4-1 above. For the cytotoxicity assay, effector cells were seeded at ratios of 6.25:1, 12.5:1, 25:1, and 50:1 to obtain target cells, and the assay was performed using the same method as in 4-1 above. When the effector cell / target cell ratio was 50:1, the percentage of dead cells was 1.3-fold or more higher than that of the control group, antigen-specific cytotoxic T cell (CTL) activity was determined to be enhanced. The results demonstrated that the CTLs contained in the effector cells had antigen (B16F10 cell)-specific CTL activity, and furthermore, when the effector cell to target cell ratio was 50:1, the rate of dead cells in the B16F10 cell lysate / CFP-inoculated group was 1.73 times that of the control group (Fig. 10, 10-1). This suggests that the B16F10 cell lysate / CFP-inoculated group enhances B16F10 cell-specific CTL activity in vivo in mice.

[0101] (6-2) Enhancement of Melanoma-Specific Killer T Cell Induction by MPT63 B16F10 cell lysate was obtained in the same manner as in 6-1 above. Effector cells were obtained in the same manner as in 6-1 above, except that 110 μg / mL MPT63 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (B16F10 cell)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 50:1 in the B16F10 cell lysate / MPT63-inoculated group was 1.68-fold higher than that in the control group (Fig. 10, 10-2). This suggests that the B16F10 cell lysate / MPT63 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0102] (6-3) Enhancement of Melanoma-Specific Killer T Cell Induction by MPB44 B16F10 cell lysate was obtained in the same manner as in 6-1 above. Effector cells were obtained in the same manner as in 6-1 above, except that 63.2 μg / mL MPB44 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (B16F10 cell)-specific CTL activity. Furthermore, the cell death rate at an effector / target cell ratio of 50:1 in the B16F10 cell lysate / MPB44 inoculated group was 1.86-fold higher than that in the control group (Fig. 10, 10-3). This suggests that the B16F10 cell lysate / MPB44 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0103] (6-4) Enhancement of melanoma-specific killer T cell induction by MPB53 Effector cells were obtained in the same manner as in 6-1 above, except that 60 μg / mL MPB53 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells exhibited antigen (B16F10 cell)-specific CTL activity. Furthermore, the cell death rate in the B16F10 cell lysate / MPB53-inoculated group at an effector cell to target cell ratio of 50:1 was 1.42-fold higher than that in the control group (Fig. 10, 10-4). This suggests that the B16F10 cell lysate / MPB53 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0104] (6-5) Enhancement of melanoma-specific killer T cell induction by MPB64 Effector cells were obtained in the same manner as in 6-1 above, except that 95.6 μg / mL MPB64 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells had antigen (B16F10 cell)-specific CTL activity. Furthermore, the rate of dead cells at an effector cell to target cell ratio of 50:1 in the B16F10 cell lysate / MPB64 inoculated group was 1.39-fold higher than that in the control group (Fig. 10, 10-5). This suggests that the B16F10 cell lysate / MPB64 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0105] (6-6) Enhancement of melanoma-specific killer T cell induction by rMPB63 Effector cells were obtained in the same manner as in 6-1 above, except that 110 μg / mL rMPB63 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells had antigen (B16F10 cell)-specific CTL activity. Furthermore, the rate of dead cells at an effector cell to target cell ratio of 50:1 in the B16F10 cell lysate / rMPB63 inoculated group was 1.61-fold higher than that in the control group (Fig. 10, 10-6). This suggests that the B16F10 cell lysate / rMPB63 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0106] (6-7) Enhancement of melanoma-specific killer T cell induction by rMPB44 Effector cells were obtained in the same manner as in 6-1 above, except that 63.2 μg / mL rMPB44 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells had antigen (B16F10 cell)-specific CTL activity. Furthermore, the rate of dead cells at an effector cell to target cell ratio of 50:1 in the B16F10 cell lysate / rMPB44 inoculated group was 1.68-fold higher than that in the control group (10-7 in Figure 10). This suggests that the B16F10 cell lysate / rMPB44 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0107] (6-8) Enhancement of melanoma-specific killer T cell induction by rMPB53 Effector cells were obtained in the same manner as in 6-1 above, except that 60 μg / mL rMPB53 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells had antigen (B16F10 cell)-specific CTL activity. Furthermore, the rate of dead cells at an effector cell to target cell ratio of 50:1 in the B16F10 cell lysate / rMPB53 inoculated group was 1.62-fold higher than that in the control group (10-8 in Figure 10). This suggests that the B16F10 cell lysate / rMPB53 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0108] (6-9) Enhancement of melanoma-specific killer T cell induction by rMPB64 Effector cells were obtained in the same manner as in 6-1 above, except that 95.6 μg / mL rMPB64 was added instead of CFP when B16F10 cell lysate was inoculated into mice. Target cells were obtained in the same manner as in 6-1 above. Cytotoxicity assays were performed in the same manner as in 6-1 above. The results demonstrated that the CTLs contained in the effector cells had antigen (B16F10 cell)-specific CTL activity. Furthermore, the rate of dead cells at an effector cell to target cell ratio of 50:1 in the B16F10 cell lysate / rMPB64 inoculated group was 1.77-fold higher than that in the control group (Fig. 10, 10-9). This suggests that the B16F10 cell lysate / rMPB64 inoculation group enhanced B16F10 cell-specific CTL activity in vivo in mice.

[0109] Example 7 Evaluation of EG7 Tumor Growth Inhibitory Activity (7-1) Evaluation of EG7 Tumor Growth Inhibitory Activity of CFP in Mice (Vaccine, Reference Example) C57BL / 6j mice were subcutaneously inoculated with 100 μg / mL OVA and 2000 μg / mL CFP-containing PBS at a volume of 100 μL / mouse on days 0 and 10. On day 17, 1×10 EG7 cells (cells expressing OVA protein by introducing the OVA gene into EL4 cells (thymic lymphoma cells)) were injected into the left flank of the mice other than the OVA inoculation site. 6 EG7 cells were administered intradermally at a dose of 100 μg / mL CFP per animal. Tumor diameter and body weight were measured over time up to 21 days after administration. The control group was administered OVA alone (without administration of 2000 μg / mL CFP-containing PBS). As a humane endpoint, a weight loss of 10% or more within one week was considered death and mice were euthanized by overanesthesia. As a result, a decrease in tumor diameter was observed in the OVA / CFP-vaccinated group compared to the control group, suggesting that the antitumor activity was enhanced by administering CFP simultaneously with the antigen (Figure 11, 11-1).

[0110] (7-2) Evaluation of the inhibitory activity of MPT63 on EG7 tumor growth in mice (vaccine) When mice were inoculated with OVA, 110 μg / mL MPT63 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / MPT63 inoculation group compared with the control group, suggesting that simultaneous inoculation with MPT63 enhances the antitumor activity (Fig. 11, 11-2).

[0111] (7-3) Evaluation of the inhibitory activity of MPB44 on EG7 tumor growth in mice (vaccine) When OVA was inoculated into mice, 63.2 μg / mL MPB44 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / MPB44 inoculation group compared with the control group, suggesting that simultaneous inoculation with MPB44 enhances the antitumor activity (Fig. 11, 11-3).

[0112] (7-4) Evaluation of the inhibitory activity of MPB53 on EG7 tumor growth in mice (vaccine) When OVA was inoculated into mice, 60 μg / mL MPB53 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / MPB53 inoculation group compared with the control group, suggesting that simultaneous inoculation with MPB53 enhances antitumor activity (Fig. 11, 11-4).

[0113] (7-5) Evaluation of the inhibitory activity of MPB64 on EG7 tumor growth in mice (vaccine) When OVA was inoculated into mice, 95.6 μg / mL MPB64 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / MPB64 inoculated group compared with the control group, suggesting that simultaneous inoculation with MPB64 enhances the antitumor activity (Fig. 11, 11-5).

[0114] (7-6) Evaluation of EG7 tumor growth inhibitory activity of rMPB63 in mice (vaccine) When OVA was inoculated into mice, 110 μg / mL rMPB63 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / rMPB63 inoculation group compared to the control group, suggesting that simultaneous inoculation with rMPB63 enhances antitumor activity (Fig. 11, 11-6).

[0115] (7-7) Evaluation of rMPB44's inhibitory activity against EG7 tumor growth in mice (vaccine) When OVA was inoculated into mice, 63.2 μg / mL rMPB44 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / rMPB44 inoculation group compared with the control group, suggesting that simultaneous inoculation with rMPB44 enhances the antitumor activity (11-7 in Figure 11).

[0116] (7-8) Evaluation of rMPB53's inhibitory activity against EG7 tumor growth in mice (vaccine) When OVA was inoculated into mice, 60 μg / mL rMPB53 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / rMPB53 inoculation group compared with the control group, suggesting that simultaneous inoculation with rMPB53 enhances antitumor activity (Fig. 11, 11-8).

[0117] (7-9) Evaluation of EG7 tumor growth inhibitory activity of rMPB64 in mice (vaccine) When OVA was inoculated into mice, 95.6 μg / mL rMPB64 was added instead of CFP, and the group was compared with the control group in the same manner as in 7-1 above. As a result, the OVA / rMPB64 inoculated group was equivalent to the control group (11-9 in Figure 11).

[0118] Example 8 Evaluation of tumor growth inhibitory activity of B16F10 melanoma cells (effectiveness as a vaccine) (8-1) Evaluation of B16F10 tumor growth inhibitory activity of CFP in mice (vaccine, reference example) The B16F10 cell lysate used as an antigen was obtained in the same manner as in 6-1 above. Instead of OVA, 100 μL (1 × 10 7 The cells were inoculated in the same manner as in 7-1 above using a B16F10 cell lysate at 1 × 10 cells / mL. 5 The tumor diameter was reduced in the B16F10 cell lysate / CFP inoculation group compared with the control group, suggesting that the antitumor activity was enhanced by simultaneous inoculation with CFP (Fig. 12, 12-1).

[0119] (8-2) Evaluation of the inhibitory activity of MPT63 on B16F10 tumor growth in mice (vaccine) A comparative study was conducted using the same method as in 8-1 above, except that 110 μg / mL MPT63 was inoculated instead of CFP when inoculating B16F10 cell lysate. As a result, a decrease in tumor diameter was observed in the B16F10 cell lysate / MPT63 inoculation group compared to the control group, suggesting that simultaneous inoculation of MPT63 enhances antitumor activity (Fig. 12, 12-2).

[0120] (8-3) Evaluation of the inhibitory activity of MPB44 on B16F10 tumor growth in mice (vaccine) A comparative study was carried out using the same method as in 8-1 above, except that 63.2 μg / mL MPB44 was inoculated instead of CFP when B16F10 cell lysate was inoculated. As a result, a decrease in tumor diameter was observed in the B16F10 cell lysate / MPB44 inoculation group compared to the control group, suggesting that simultaneous inoculation of MPB44 enhances antitumor activity (Fig. 12, 12-3).

[0121] (8-4) Evaluation of the inhibitory activity of MPB53 on B16F10 tumor growth in mice (vaccine) A comparative study was carried out using the same method as in 8-1 above, except that 60 μg / mL MPB53 was inoculated instead of CFP when inoculating B16F10 cell lysate. As a result, a decrease in tumor diameter was observed in the B16F10 cell lysate / MPB53 inoculation group compared to the control group, suggesting that simultaneous inoculation of MPB53 enhances antitumor activity (Fig. 12, 12-4).

[0122] (8-5) Evaluation of the inhibitory activity of MPB64 on B16F10 tumor growth in mice (vaccine) A comparative study was carried out using the same method as in 8-1 above, except that 95.6 μg / mL MPB64 was inoculated instead of CFP when inoculating B16F10 cell lysate. As a result, a decrease in tumor diameter was observed in the B16F10 cell lysate / MPB64 inoculation group compared to the control group, suggesting that simultaneous inoculation of MPB64 enhances antitumor activity (Fig. 12, 12-5).

[0123] (8-6) Evaluation of the inhibitory activity of rMPB44 on B16F10 tumor growth in mice (vaccine) A comparative study was carried out using the same method as in 8-1 above, except that 63.2 μg / mL rMPB44 was inoculated instead of CFP when B16F10 cell lysate was inoculated. As a result, a decrease in tumor diameter was observed in the B16F10 cell lysate / rMPB44 inoculation group compared to the control group, suggesting that simultaneous inoculation with rMPB44 enhances antitumor activity (Fig. 12, 12-6).

[0124] (8-7) Evaluation of the inhibitory activity of rMPB53 on B16F10 tumor growth in mice (vaccine) A comparative study was carried out using the same method as in 8-1 above, except that 60 μg / mL rMPB53 was inoculated instead of CFP when inoculating B16F10 cell lysate. As a result, a decrease in tumor diameter was observed in the B16F10 cell lysate / rMPB53 inoculation group compared to the control group, suggesting that simultaneous inoculation of rMPB53 enhances antitumor activity (Fig. 12, 12-7).

[0125] (8-8) Evaluation of the inhibitory activity of rMPB64 on B16F10 tumor growth in mice (vaccine) A comparative study was carried out using the same method as in 8-1 above, except that 95.6 μg / mL rMPB64 was inoculated instead of CFP when B16F10 cell lysate was inoculated. As a result, a decrease in tumor diameter was observed in the B16F10 cell lysate / rMPB64 inoculation group compared to the control group, suggesting that simultaneous inoculation of rMPB64 enhances antitumor activity (Fig. 12, 12-8).

[0126] Example 9 Evaluation of tumor growth inhibitory activity of Colon-26 colon cancer cells (effectiveness as a vaccine) (9-1) Evaluation of the inhibitory activity of CFP on Colon-26 cell growth in mice (vaccine, reference example) A Colon-26 cell lysate used as an antigen was obtained in the following manner. Colon-26 cells (mouse colon cancer cells, purchased from the Medical Cell Resource Center, Institute for Medical Science, Aging and Cancer, Tohoku University) were cultured in RPMI medium under a 5% CO environment. A lysate of the proliferated Colon-26 cells was obtained in the same manner as in 6-1 above. Instead of OVA, 100 μL (1 × 10 7Colon-26 cells were inoculated at 2.5 × 10 cells / mL in the same manner as in 7-1 above. 5 The tumor diameter was reduced in the Colon-26 cell lysate / CFP inoculation group compared with the control group, suggesting that the antitumor activity was enhanced by simultaneous inoculation with CFP (Fig. 13, 13-1).

[0127] (9-2) Evaluation of Colon-26 cell proliferation inhibitory activity of native rMPB63 in mice (vaccine) A comparative study was conducted using the same method as in 9-1 above, except that 110 μg / mL native rMPB63 was inoculated instead of CFP when Colon-26 cell lysate was inoculated. As a result, a decrease in tumor diameter was observed in the Colon-26 cell lysate / native rMPB63 inoculation group compared to the control group, suggesting that simultaneous inoculation of native rMPB63 enhances antitumor activity (Figure 13, 13-2).

[0128] (9-3) Evaluation of Colon-26 cell proliferation inhibitory activity of native rMPB44 in mice (vaccine) A comparative study was conducted using the same method as in 9-1 above, except that 63.2 μg / mL native rMPB44 was inoculated instead of CFP when Colon-26 cell lysate was inoculated. As a result, a decrease in tumor diameter was observed in the Colon-26 cell lysate / native rMPB44 inoculation group compared to the control group, suggesting that simultaneous inoculation of native rMPB44 enhances antitumor activity (Fig. 13, 13-3).

[0129] (9-4) Evaluation of the inhibitory activity of rMPB53 on Colon-26 cell proliferation in mice (vaccine) A comparative study was conducted using the same method as in 9-1 above, except that 60 μg / mL rMPB53 was inoculated instead of CFP when Colon-26 cell lysate was inoculated. As a result, a decrease in tumor diameter was observed in the Colon-26 cell lysate / rMPB53 inoculation group compared to the control group, suggesting that simultaneous inoculation of rMPB53 enhances antitumor activity (Figure 13, 13-4).

[0130] (9-5) Evaluation of the Colon-26 cell proliferation inhibitory activity of rMPB64 in mice (vaccine) A comparative study was conducted using the same method as in 9-1 above, except that 95.6 μg / mL rMPB64 was inoculated instead of CFP when Colon-26 cell lysate was inoculated. As a result, a decrease in tumor diameter was observed in the Colon-26 cell lysate / rMPB64 inoculation group compared to the control group, suggesting that simultaneous inoculation of rMPB64 enhances antitumor activity (Figure 13, 13-5).

[0131] Example 10 Evaluation of tumor growth inhibitory activity of EG7 cells (effect as a therapeutic agent) (10-1) Evaluation of EG7 tumor growth inhibitory activity of CFP in mice (therapeutic agent, reference example) 1 x 10 EG7 cells (cells expressing OVA protein by introducing the OVA gene into EL4 cells (thymic lymphoma cells)) were placed in the left flank of a C57BL / 6j mouse. 6 Mice were intradermally administered 100 μg / mL OVA and 2000 μg / mL CFP-containing PBS at a dose of 100 μL / mouse. On days 7, 10, 14, 17, 21, and 24 after intradermal administration, 100 μL / mouse of PBS containing 100 μg / mL OVA and 2000 μg / mL CFP was subcutaneously inoculated near the tumor. Tumor diameter and body weight were measured over time until 28 days after EG7 cell administration. A group administered OVA alone was used as a control group for comparison. As a humane endpoint, a weight loss of 10% or more within one week was considered death and mice were euthanized by overanesthesia. As a result, tumor diameter was reduced in the OVA / CFP-inoculated group compared to the control group, suggesting that co-inoculation of CFP with the antigen enhances antitumor activity (Figure 14, 14-1).

[0132] (10-2) Evaluation of the inhibitory activity of MPB44 on EG7 tumor growth in mice (therapeutic drug) When OVA was inoculated into mice, 63.2 μg / mL MPB44 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / MPB44 inoculated group compared with the control group, suggesting that simultaneous inoculation with MPB44 enhances the antitumor activity (14-2 in Figure 14).

[0133] (10-3) Evaluation of the inhibitory activity of MPB53 on EG7 tumor growth in mice (therapeutic drug) When OVA was inoculated into mice, 60 μg / mL MPB53 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / MPB53 inoculation group compared with the control group, suggesting that simultaneous inoculation with MPB53 enhances the antitumor activity (14-3 in Figure 14).

[0134] (10-4) Evaluation of the inhibitory activity of MPB64 on EG7 tumor growth in mice (therapeutic drug) When OVA was inoculated into mice, 95.6 μg / mL MPB64 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / MPB64 inoculated group compared with the control group, suggesting that simultaneous inoculation with MPB64 enhances the antitumor activity (14-4 in Figure 14).

[0135] (10-5) Evaluation of EG7 tumor growth inhibitory activity of rMPB63 in mice (therapeutic drug) When OVA was inoculated into mice, 110 μg / mL rMPB63 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / rMPB63 inoculated group compared to the control group, suggesting that simultaneous inoculation with rMPB63 enhances antitumor activity (14-5 in Figure 14).

[0136] (10-6) Evaluation of EG7 tumor growth inhibitory activity of rMPB44 in mice (therapeutic drug) When OVA was inoculated into mice, 63.2 μg / mL rMPB44 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / rMPB44 inoculated group compared to the control group, suggesting that simultaneous inoculation with rMPB44 enhances antitumor activity (14-6 in Figure 14).

[0137] (10-7) Evaluation of EG7 tumor growth inhibitory activity of rMPB53 in mice (therapeutic drug) When OVA was inoculated into mice, 60 μg / mL rMPB53 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / rMPB53 inoculated group compared with the control group, suggesting that simultaneous inoculation with rMPB53 enhances antitumor activity (14-7 in Figure 14).

[0138] (10-8) Evaluation of rMPB64's inhibitory activity against EG7 tumor growth in mice (therapeutic drug) When OVA was inoculated into mice, 95.6 μg / mL rMPB64 was added instead of CFP, and the results were compared with a control group in the same manner as in 7-1 above. As a result, a decrease in tumor diameter was observed in the OVA / rMPB64 inoculated group compared with the control group, suggesting that simultaneous inoculation with rMPB64 enhances the antitumor activity (14-8 in Figure 14).

[0139] According to the present invention, a protein having adjuvant activity that enhances cellular immunity can be provided, and therefore the present invention is extremely useful industrially.

[0140] [Sequence Information] The nucleic acid or amino acid sequences of SEQ ID NOs: 1 to 20 are shown below. The amino acid sequences of proteins are written in three-letter code. SEQ ID NO: 1: Amino acid sequence of MPB63 Ala Tyr Pro Ile Thr Gly Lys Leu Gly Ser Glu Leu Thr Met Thr Asp Thr Val Gly Gln Val Val Leu Gly Trp Lys Val Ser Asp Leu Lys Ser Ser Thr Ala Val Ile Pro Gly Tyr Pro Val Ala Gly Gln Val Trp Glu Ala Thr Ala Thr Val Asn Ala Ile Arg Gly Ser Val Thr Pro Ala Val Ser Gln Phe Asn Ala Arg Thr Ala Asp Gly Ile Asn Tyr Arg Val Leu Trp Gln Ala Ala Gly Pro Asp Thr Ile Ser Gly Ala Thr Ile Pro Gln Gly Glu Gln Ser Thr Gly Lys Ile Tyr Phe Asp Val Thr Gly Pro Ser Pro Thr Ile Val Ala Met Asn Asn Gly Met Glu Asp Leu Leu Ile Trp Glu Pro

[0141] Accession Number 2: Amino Acid Sequence of MPB44 Phe Ser Arg Pro Gly Leu Pro Val Glu Tyr Leu Gln Val Pro Ser Pro Ser Met Gly Arg Asp Ile Lys Val Gln Phe Gln Ser Gly Gly Ala Asn Ser Pro Ala Leu Tyr Leu Leu Asp Gly Leu Arg Ala Gln Asp Asp Phe Ser Gly Trp Asp Ile Asn Thr Pro Ala Phe Glu Trp Tyr Asp Gln Ser Gly Leu Ser Val Val Met Pro Val Gly Gly Gln Ser Ser Phe Tyr Ser Asp Trp Tyr Gln Pro Ala Cys Gly Lys Ala Gly Cys Gln Thr Tyr Lys Trp Glu Thr Phe Leu Thr Ser Glu Leu Pro Gly Trp Leu Gln Ala Asn Arg His Val Lys Pro Thr Gly Ser Ala Val Val Gly Leu Ser Met Ala Ala Ser Ser Ala Leu Thr Leu Ala Ile Tyr His Pro Gln Gln Phe Val Tyr Ala Gly Ala Met Ser Gly Leu Leu Asp Pro Ser Gln Ala Met Gly Pro Thr Leu Ile Gly Leu Ala Met Gly Asp Ala Gly Gly Tyr Lys Ala Ser Asp Met Trp Gly Pro Lys Glu Asp Pro Ala Trp Gln Arg Asn Asp Pro Leu Leu Asn Val Gly Lys Leu Ile Ala Asn Asn Thr Arg Val Trp Val Tyr Cys Gly Asn Gly Lys Pro Ser Asp Leu Gly Gly Asn Asn Leu Pro Ala Lys Phe Leu Glu Gly Phe Val Arg Thr Ser Asn Ile Lys Phe Gln Asp Ala Tyr AsnAla Gly Gly Gly His Asn Gly Val Phe Asp Phe Pro Asp Ser Gly Thr His Ser Trp Glu Tyr Trp Gly Ala Gln Leu Asn Ala Met Lys Pro Asp Leu Gln Arg Ala Leu Gly Ala Thr Pro Asn Thr Gly Pro Ala Pro Gln Gly Ala

[0142] SEQ ID NO: 3: Amino acid sequence of MPB53 Ala Asp Glu Arg Leu Gln Phe Thr Ala Thr Thr Leu Ser Gly Ala Pro Phe Asp Gly Ala Ser Leu Gln Gly Lys Pro Ala Val Leu Trp Phe Trp Thr Pro Trp Cys Pro Phe Cys Asn Ala Glu Ala Pro Ser Leu Ser Gln Val Ala Ala Ala Asn Pro Ala Val Thr Phe Val Gly Ile Ala Thr Arg Ala Asp Val Gly Ala Met Gln Ser Phe Val Ser Lys Tyr Asn Leu Asn Phe Thr Asn Leu Asn Asp Ala Asp Gly Val Ile Trp Ala Arg Tyr Asn Val Pro Trp Gln Pro Ala Phe Val Phe Tyr Arg Ala Asp Gly Thr Ser Thr Phe Val Asn Asn Pro Thr Ala Ala Met Ser Gln Asp Glu Leu Ser Gly Arg Val Ala Ala Leu Thr Ser

[0143] Sequence number 4: MP64 amino acid sequence Ala Pro Lys Thr Tyr Cys Glu Glu Leu Lys Gly Thr Asp Thr Gly Gln Ala Cys Gln Ile Gln Met Ser Asp Pro Ala Tyr Asn Ile Asn Ile Ser Leu Pro Ser Tyr Tyr Pro Asp Gln Lys Ser Leu Glu Asn Tyr Ile Ala Gln Thr Arg Asp Lys Phe Leu Ser Ala Ala Thr Ser Ser Thr Pro Arg Glu Ala Pro Tyr Glu Leu Asn Ile Thr Ser Ala Thr Tyr Gln Ser Ala Ile Pro Pro Arg Gly Thr Gln Ala Val Val Leu Lys Val Tyr Gln Asn Ala Gly Gly Thr His Pro Thr Thr Tyr Lys Ala Phe Asp Trp Asp Gln Ala Tyr Arg Lys Pro Ile Thr Tyr Asp Thr Leu Trp Gln Ala Asp Thr Asp Pro Leu Pro Val Val Phe Pro Ile Val Gln Gly Glu Leu Ser Lys Gln Thr Gly Gln Gln Val Ser Ile Ala Pro Asn Ala Gly Leu Asp Pro Val Asn Tyr Gln Asn Phe Ala Val Thr Asn Asp Gly Val Ile Phe Phe Asn Pro Gly Glu Leu Leu Pro Glu Ala Ala Gly Pro Thr Gln Val Leu Val Pro Arg Ser Ala Ile Asp Ser Met Leu Ala

[0144] Accession number 5: Amino acid sequence of MPB63 precursor Met Lys Leu Thr Thr Met Ile Lys Thr Ala Val Ala Val Val Ala Met Ala Ala Ile Ala Thr Phe Ala Ala Pro Val Ala Leu Ala Ala Tyr Pro Ile Thr Gly Lys Leu Gly Ser Glu Leu Thr Met Thr Asp Thr Val Gly Gln Val Val Leu Gly Trp Lys Val Ser Asp Leu Lys Ser Ser Thr Ala Val Ile Pro Gly Tyr Pro Val Ala Gly Gln Val Trp Glu Ala Thr Ala Thr Val Asn Ala Ile Arg Gly Ser Val Thr Pro Ala Val Ser Gln Phe Asn Ala Arg Thr Ala Asp Gly Ile Asn Tyr Arg Val Leu Trp Gln Ala Ala Gly Pro Asp Thr Ile Ser Gly Ala Thr Ile Pro Gln Gly Glu Gln Ser Thr Gly Lys Ile Tyr Phe Asp Val Thr Gly Pro Ser Pro Thr Ile Val Ala Met Asn Asn Gly Met Glu Asp Leu Leu Ile Trp Glu Pro

[0145] Accession number 6: Amino acid sequence of MPB44 precursor Met Gln Leu Val Asp Arg Val Arg Gly Ala Val Thr Gly Met Ser Arg Arg Leu Val Val Gly Ala Val Gly Ala Ala Leu Val Ser Gly Leu Val Gly Ala Val Gly Gly Thr Ala Thr Ala Gly Ala Phe Ser Arg Pro Gly Leu Pro Val Glu Tyr Leu Gln Val Pro Ser Pro Ser Met Gly Arg Asp Ile Lys Val Gln Phe Gln Ser Gly Gly Ala Asn Ser Pro Ala Leu Tyr Leu Leu Asp Gly Leu Arg Ala Gln Asp Asp Phe Ser Gly Trp Asp Ile Asn Thr Pro Ala Phe Glu Trp Tyr Asp Gln Ser Gly Leu Ser Val Val Met Pro Val Gly Gly Gln Ser Ser Phe Tyr Ser Asp Trp Tyr Gln Pro Ala Cys Gly Lys Ala Gly Cys Gln Thr Tyr Lys Trp Glu Thr Phe Leu Thr Ser Glu Leu Pro Gly Trp Leu Gln Ala Asn Arg His Val Lys Pro Thr Gly Ser Ala Val Val Gly Leu Ser Met Ala Ala Ser Ser Ala Leu Thr Leu Ala Ile Tyr His Pro Gln Gln Phe Val Tyr Ala Gly Ala Met Ser Gly Leu Leu Asp Pro Ser Gln Ala Met Gly Pro Thr Leu Ile Gly Leu Ala Met Gly Asp Ala Gly Gly Tyr Lys Ala Ser Asp Met Trp Gly Pro Lys Glu Asp Pro Ala Trp Gln Arg Asn Asp Pro Leu Leu Asn Val Gly Lys Leu IleAla Asn Asn Thr Arg Val Trp Val Tyr Cys Gly Asn Gly Lys Pro Ser Asp Leu Gly Gly Asn Asn Leu Pro Ala Lys Phe Leu Glu Gly Phe Val Arg Thr Ser Asn Ile Lys Phe Gln Asp Ala Tyr Asn Ala Gly Gly Gly His Asn Gly Val Phe Asp Phe Pro Asp Ser Gly Thr His Ser Trp Glu Tyr Trp Gly Ala Gln Leu Asn Ala Met Lys Pro Asp Leu Gln Arg Ala Leu Gly Ala Thr Pro Asn Thr Gly Pro Ala Pro Gln Gly Ala

[0146] Accession Number 7: Amino Acid Sequence of MPB53 Precursor Met Ser Leu Arg Leu Val Ser Pro Ile Lys Ala Phe Ala Asp Gly Ile Val Ala Val Ala Ile Ala Val Val Leu Met Phe Gly Leu Ala Asn Thr Pro Arg Ala Val Ala Ala Asp Glu Arg Leu Gln Phe Thr Ala Thr Thr Leu Ser Gly Ala Pro Phe Asp Gly Ala Ser Leu Gln Gly Lys Pro Ala Val Leu Trp Phe Trp Thr Pro Trp Cys Pro Phe Cys Asn Ala Glu Ala Pro Ser Leu Ser Gln Val Ala Ala Ala Asn Pro Ala Val Thr Phe Val Gly Ile Ala Thr Arg Ala Asp Val Gly Ala Met Gln Ser Phe Val Ser Lys Tyr Asn Leu Asn Phe Thr Asn Leu Asn Asp Ala Asp Gly Val Ile Trp Ala Arg Tyr Asn Val Pro Trp Gln Pro Ala Phe Val Phe Tyr Arg Ala Asp Gly Thr Ser Thr Phe Val Asn Asn Pro Thr Ala Ala Met Ser Gln Asp Glu Leu Ser Gly Arg Val Ala Ala Leu Thr Ser

[0147] Sequence number 8: Amino acid sequence of MP64 precursor Met Arg Ile Lys Ile Phe Met Leu Val Thr Ala Val Leu Leu Cys Cys Ser Gly Val Ala Thr Ala Ala Pro Lys Thr Tyr Cys Glu Glu Leu Lys Gly Thr Asp Thr Gly Gln Ala Cys Gln Ile Gln Met Ser Asp Pro Ala Tyr Asn Ile Asn Ile Ser Leu Pro Ser Tyr Tyr Pro Asp Gln Lys Ser Leu Glu Asn Tyr Ile Ala Gln Thr Arg Asp Lys Phe Leu Ser Ala Ala Thr Ser Ser Thr Pro Arg Glu Ala Pro Tyr Glu Leu Asn Ile Thr Ser Ala Thr Tyr Gln Ser Ala Ile Pro Pro Arg Gly Thr Gln Ala Val Leu Lys Val Tyr Gln Asn Ala Gly Gly Thr His Pro Thr Thr Tyr Lys Ala Phe Asp Trp Asp Gln Ala Tyr Arg Lys Pro Ile Thr Tyr Asp Thr Leu Trp Gln Ala Asp Thr Asp Pro Leu Pro Val Val Phe Pro Ile Val Gln Gly Glu Leu Ser Lys Gln Thr Gly Gln Gln Val Ser Ile Ala Pro Asn Ala Gly Leu Asp Pro Val Asn Tyr Gln Asn Phe Ala Val Thr Asn Asp Gly Val Ile Phe Phe Phe Asn Pro Gly Glu Leu Leu Pro Glu Ala Ala Gly Pro Thr Gln Val Leu Val Pro Arg Ser Ala Ile Asp Ser Met Leu Ala

[0148] Accession number 9: Nucleotide sequence of the MPB63 precursor synthesis gene CATATGAAGCTGACCACCATGATCAAGACCGCCGTCGCCGTCGTCGCCATGGCCGCCATCGCCACGTTCGCCGCCCCCGTCGCCCTCGCCGCCTACCCGATCACCGGCAAGCTGGGCTCGGAGCTGACCATGACCGACACCGTGGGCCAGGTGGTCCTGGGCTGGAAGGTGTCGGACCTGAAGTCGTCGACCGCGGTGATCCCGGGCTACCCGGTGGCCGGCCAGGTCTGGGAGGCCACCGCCACCGTCAACGCCATCCGCGGCTCGGTGACCCCGGCCGTGTCGCAGTTCAACGCCCGCACCGCCGACGGCATCAACTACCGCGTGCTGTGGCAGGCGGCCGGCCCGGACACCATCTCGGGCGCCACCATCCCGCAGGGCGAGCAGTCGACCGGCAAGATCTACTTCGACGTGACCGGCCCGTCGCCGACCATCGTCGCGATGAACAACGGCATGGAGGACCTGCTGATCTGGGAGCCGCACCACCACCACCACCACTGAGGATCC 1-6: NdeI site 481-498: His tag 499-501: Stop codon 502-507: BamHI site

[0149]

[0150] Accession No. 11: Nucleotide sequence of MPB53 precursor synthesis gene CATATGTCGCTGCGGCTGGTCTCCCCCATCAAGGCGTTCGCGGACGGCATCGTGGCGGTCGCCATCGCGGTGGTGCTCATGTTCGGCCTCGCGAACACCCCGCGCGCGGTGGCGGCCGACGAGCGCCTGCAGTTCACCGCGACCACCCTGTCGGGCGCCCCGTTCGACGGCGCCTCGCTGCAGGGCAAGCCGGCGGTCCTGTGGTTCTGGACCCCGTGGTGCCCGTTCTGCAACGCCGAGGCCCCGTCGCTGTCGCAGGTGGCGGCCGCCAACCCGGCGGTGACCTTCGTGGGCATCGCCACCCGCGCGGACGTGGGCGCCATGCAGTCGTTCGTCTCGAAGTACAACCTGAACTTCACCAACCTGAACGACGCCGACGGCGTGATCTGGGCCCGCTACAACGTCCCGTGGCAGCCGGCCTTCGTGTTCTACCGCGCGGACGGCACCTCGACCTTCGTGAACAACCCGACCGCGGCCATGTCGCAGGACGAGCTGTCGGGCCGGGTCGCCGCCCTCACGAGCCACCACCACCACCACCACTGAGGATCC 1-6: NdeI site 523-540: His tag 541-543 Stop codon 544-549: BamHI site

[0151] Accession No. 12: Nucleotide sequence of MPB64 precursor synthesis gene CATATGCGCTCGTTCTCCGTGGCGGCGTTCGCGGCGGCCCTGGTGCTGGCGGGCCCGGCGGGCGCGGCGGCGGCGGCGCCCAAGGACTACTGCGCGGACCTGAAGGGCGCCAACACCGGCCAGACCTGCCAGATCCAGATGGCGGACCCGGGCTACAACGTGGACATCTCGTTCCCGGCCAACTACCCGGACGAGCAGCCGGTCGCCGACTTCATCTCGAAGCAGCGCGACGACTTCCTGAACGCGGCCAAGTCGTCGGCCCCGCGCGACCAGCCGTACCAGCTGACCATCACCTCGGCCAAGTACGGCTCGGCCATCCCGCCGCGCGGCACCGAGGCCGTGGTCCTGAAGGTGGTCCAGAACACCGGCGCGGGCCCGCACACCACCTACAAGTCGTTCAACTGGGACCAGGCGTACCGCAAGGAGATCGTGTGGACCGCGGCCGCGGACGACAAGAAGAACACCCCGCTGTGGCGCGTGGACGACCCGCTGGCCACCGTGGCCCCGATCGTCCAGTCGGAGCTGCAGAAGCAGACCGCACCGCCGGCCAACCCGAACCAGCCGGCACCGCCGGCGAACCAGCCGGCCTCGCCGACCCCGACCGCACCGCCGGTGACCGTCGCCTCGGCGGCCGCGTACGACCCGGCGAACTACCAGTCGTTCGCCATCACCAACGACGGCGTGATCTTCTTCTTCGACCAGGGCCGCCTGCTGCCGGACTCGGCCGGCGCGCCGCAGGTCCTCGTCCCCCGCTCCGCCATCGACCCCATGCTCGCCCACCACCACCACCACCACTGAGGATCC 1-6: NdeI site 778-795: His tag 796-798: Stop codon 799-804: BamHI site

[0152] SEQ ID NO: 13: DNA base sequence of the multicloning site GGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACC 1-6: BamHI site (underlined) 67-72: KpnI site (underlined)

[0153] SEQ ID NO: 14: Nucleotide sequence of KpnI DNA fragment containing from SP2 promoter to Ag85B terminator GGTACCATGCAGGTGGCGCGCCGCGGCCTCACCAACGCGATTGTGAGCTATCTCGAGGACAACGGGTCAGGGCGACGTGAGTAACCAGTAACCGGGTTGTGACCTCCCTTGGTAGCGGCATTTCCGCTACCAACAAGTAGGCTGTTGCATATCCCCGTGTGTACGACCAGCACGGCATACTCTAGAAGGAGAAGTACATATGGCGGCCGCACTCGAGCACCACCACCACCACCACCACTGAGGATCCTCGCGCAACGGTTGCCGCTACTGGGCTTGACGGCAAGACGCCGTACAGTAGTGTGTTCGGCACCTTGAACGCTGGTCCGCCATGTTCAACGAGCCGGTCTACCTGCCCGCACCGAACAAGCTGGTGACATCGACCCATGCGGTGCGGTACC 1-6: KpnI site (underlined) 27-180: SP2 promoter region 187-194: SD sequence 197-244: NdeI-BamHI multicloning site 255-389: Ag85B terminator region 390-395: KpnI site (underlined)

[0154] SEQ ID NO: 15: Base sequence of adapter PB1 GACCTGCTGATCTGGGAGCCGTGAG

[0155] SEQ ID NO: 16: Base sequence of adapter PB2 GATCCTCACGGCTCCCAGATCAGCAG

[0156] SEQ ID NO: 17: Base sequence of adapter APB1 CGCGCCCCAGGGCGCCTAGG

[0157] SEQ ID NO: 18: Base sequence of adapter APB2 GATCCCTAGGCGCCCTGGGGCGCGGGCC

[0158] Accession Number 19: Amino Acid Sequence of PepA Precursor Protein Met Ser Asn Ser Arg Arg Arg Ser Leu Arg Trp Ser Trp Leu Leu Ser Val Leu Ala Ala Val Gly Leu Gly Leu Ala Thr Ala Pro Ala Gln Ala Ala Pro Pro Ala Leu Ser Gln Asp Arg Phe Ala Asp Phe Pro Ala Leu Pro Leu Asp Pro Ser Ala Met Val Ala Gln Val Gly Pro Gln Val Val Asn Ile Asn Thr Lys Leu Gly Tyr Asn Asn Ala Val Gly Ala Gly Thr Gly Ile Val Ile Asp Pro Asn Gly Val Val Leu Thr Asn Asn His Val Ile Ala Gly Ala Thr Asp Ile Asn Ala Phe Ser Val Gly Ser Gly Gln Thr Tyr Gly Val Asp Val Val Gly Tyr Asp Arg Thr Gln Asp Val Ala Val Leu Gln Leu Arg Gly Ala Gly Gly Leu Pro Ser Ala Ala Ile Gly Gly Gly Val Ala Val Gly Glu Pro Val Val Ala Met Gly Asn Ser Gly Gly Gln Gly Gly Thr Pro Arg Ala Val Pro Gly Arg Val Val Ala Leu Gly Gln Thr Val Gln Ala Ser Asp Ser Leu Thr Gly Ala Glu Glu Thr Leu Asn Gly Leu Ile Gln Phe Asp Ala Ala Ile Gln Pro Gly Asp Ser Gly Gly Pro Val Val Asn Gly Leu Gly Gln Val Val Gly Met Asn Thr Ala Ala Ser Asp Asn Phe Gln Leu Ser Gln Gly Gly Gln Gly Phe Ala Ile Pro IleGly Gln Ala Met Ala Ile Ala Gly Gln Ile Arg Ser Gly Gly Gly Ser Pro Thr Val His Ile Gly Pro Thr Ala Phe Leu Gly Leu Gly Val Val Asp Asn Asn Gly Asn Gly Ala Arg Val Gln Arg Val Val Gly Ser Ala Pro Ala Ala Ser Leu Gly Ile Ser Thr Gly Asp Val Ile Thr Ala Val Asp Gly Ala Pro Ile Asn Ser Ala Thr Ala Met Ala Asp Ala Leu Asn Gly His His Pro Gly Asp Val Ile Ser Val Thr Trp Gln Thr Lys Ser Gly Gly Thr Arg Thr Gly Asn Val Thr Leu Ala Glu Gly Pro Pro Ala

[0159]

Claims

1. An adjuvant composition for enhancing cellular immunity, comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4, or a variant thereof.

2. The adjuvant composition according to claim 1, wherein the protein or its variant is a protein having an amino acid sequence that has at least 90% sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4.

3. The adjuvant composition according to claim 1 or 2, wherein the protein is a protein derived from mycobacteria.

4. The adjuvant composition according to claim 1 or 2, wherein the protein is a protein derived from Mycobacterium tuberculosis or Mycobacterium tuberculosis variant bovis BCG.

5. The adjuvant composition according to claim 1 or 2, further comprising pharmaceutically acceptable excipients, buffers, preservatives, surfactants, adhesives, pH adjusters and / or isotonic agents.

6. An adjuvant composition for enhancing cellular immunity, comprising a protein or a variant thereof derived from a recombinant bacterium into which a nucleic acid sequence encoding a protein or a variant thereof having an amino acid sequence selected from SEQ ID NOs: 1 to 4 has been introduced.

7. The adjuvant composition according to claim 6, wherein the recombinant bacteria are selected from Mycobacterium smegmatis, Mycobacterium tuberculosis variant bovis BCG, Escherichia coli, Bacillus subtilis, Bacillus cereus, and Pichia pastoris.

8. A method for producing an adjuvant composition for enhancing cellular immunity, comprising the step of culturing recombinant bacteria into which a nucleic acid sequence encoding a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4 or a variant thereof has been introduced.

9. The method for producing the adjuvant composition according to claim 8, wherein the recombinant bacteria are selected from Mycobacterium smegmatis, Mycobacterium tuberculosis variant bovis BCG, Escherichia coli, Bacillus subtilis, Bacillus cereus, and Pichia pastoris.

10. A vaccine composition comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4, or a variant thereof, as an adjuvant for enhancing cellular immunity, and also comprising a vaccine immunoantigen.

11. The vaccine composition according to claim 10, wherein the protein or its variant is a protein having an amino acid sequence that has at least 90% sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4.

12. The vaccine composition according to claim 10 or 11, wherein the vaccine is a vaccine against cancer.

13. The vaccine composition according to claim 10 or 11, wherein the vaccine is a vaccine against one or more cancers selected from malignant melanoma, lung cancer, colorectal cancer, and bladder cancer.

14. A pharmaceutical composition comprising a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4, or a variant thereof, as an adjuvant for enhancing cellular immunity.

15. The pharmaceutical composition according to claim 14, wherein the protein or its variant is a protein having an amino acid sequence that has at least 90% sequence identity with an amino acid sequence selected from SEQ ID NOs: 1 to 4.

16. A pharmaceutical composition according to claim 14 or 15 for use in inhibiting the proliferation of tumor cells.

17. The pharmaceutical composition according to claim 16, comprising a protein or fragment thereof expressed in the tumor cells as an antigen.

18. A pharmaceutical composition according to claim 14 or 15 for use in the treatment of cancer.

19. The pharmaceutical composition according to claim 14 or 15, further comprising other agents.

20. A pharmaceutical composition according to claim 14 or 15, to be used in combination with other drugs.

21. Use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4, or a variant thereof, in the manufacture of an adjuvant composition for enhancing cellular immunity.

22. Use of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4, or a variant thereof, as an adjuvant to enhance cellular immunity in the manufacture of a vaccine composition.

23. Use as an adjuvant in the manufacture of a pharmaceutical composition for enhancing cellular immunity of a protein having an amino acid sequence selected from SEQ ID NOs: 1 to 4, or a variant thereof.