FGFR TYROSINE KINASE INHIBITORS FOR THE TREATMENT OF HIGH-RISK NON-MUSCULAR INVASIVE BLADDER CANCER.

Abstract

This document describes methods for treating high-risk non-muscle-invasive bladder cancer (CVSIM-RA) involving the administration of a fibroblast growth factor receptor (FGFR) inhibitor. It also describes methods for treating intermediate-risk non-muscle-invasive bladder cancer (CVSIM-RI) involving the administration of an FGFR inhibitor.

Description

FGFR TYROSINAKINASE INHIBITORS FOR THE TREATMENT OF HIGH RISK NON-MUSCLE INVASIVE BLADDER CANCER TECHNICAL FIELD Disclosed herein are methods for treating high-risk non-muscle invasive bladder cancer (CVSIM-RA) that comprise administering a fibroblast growth factor receptor (FGFR) inhibitor. Also disclosed are methods of treating intermediate risk non-muscle invasive bladder cancer (CVSIM-RI) that comprise administering an FGFR inhibitor. BACKGROUND OF THE INVENTION Non-muscle invasive bladder cancer (NSCV) is diagnosed in early stages in 70% of patients with bladder cancer (Isharwal S, Konety B. Indian JUro / . 2015;31(4):289296) of which 25 % of patients present with poorly differentiated, low-stage tumors known as high-risk non-muscle invasive bladder cancer (CVSIM-RA). Herr HW, Sogani PC. J Uro! 2001;166(4):1296-1299. CVSIM-RA is associated with high rates of relapse, progression to muscle invasion, and metastasis. Sylvester RJ et a!. Eur Uro! 2006;49:466-477. The treatment failure rate with intravesical bacille Calmette-Guérin (BCG) therapy is high, with relapse seen in approximately 30-40% of patients. Zlotta AR et al. Can Uro / Assoc J. 2009: S199-S205. Erdafitinib, an oral pan-FGFR kinase inhibitor, is approved by the US FDA for the treatment of adult patients with locally advanced or metastatic urothelial carcinoma (mUC) who have susceptible FGFR3 or FGFR2 genetic alterations and who have advanced during or after at least one line of prior platinum-containing chemotherapy (PCC), including within 12 months of adjuvant or neoadjuvant PCC. Loriot Y et al. N Engl J Med. 2019; 381:338348. New cancer treatment methods are needed for patients with CVSIMRA or CVSIM-RI positive for FGFR mutation or fusion, who relapsed after BCG therapy. SUMMARY OF THE INVENTION Described herein are methods of treating CVSIM-RA that comprise, consist of or essentially consist of, for example, administering an FGFR inhibitor, cnRRnn / zznz / E / YiAi in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of approximately 8 mg per day, to a patient diagnosed with CVSIM-RA harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma in situ. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. Described herein are methods of treating CVSIM-RI comprising, consisting of or essentially consisting of, for example, administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of approximately 8 mg per day, to a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma in situ. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RA harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma in situ. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma insitu. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma insitu. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma insitu. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. An FGFR inhibitor is described herein. for use in the treatment of a patient diagnosed with CVSIM-RA harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, in particular where the FGFR inhibitor, in particular erdafitinib, is administered or It will be administered at a dose of approximately 8 mg per day. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma in situ. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, particularly erdafitinib, is or will be administered at a dose of approximately 8 mg per day. In certain embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In further embodiments, BCG therapy is a suitable BCG therapy. In some embodiments, the patient does not respond to BCG therapy. In still other embodiments, the patient has experience with BCG. In certain embodiments, the patient has a papilloma. In further embodiments, the patient has carcinoma in situ. In some embodiments, the patient has not previously received or is not suitable for a cystectomy. In one embodiment, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day. In additional embodiments, such administration of the FGFR inhibitor provides an increase in relapse-free survival over a population of patients with CVSIM-RA who have been administered a placebo. In certain embodiments, such administration of the FGFR inhibitor provides an increase in relapse-free survival relative to a population of patients with CVSIM-RA who have been administered intravesical gemcitabine or intravesical mitomycin C (MMQ / hyperthermic MMC. In some embodiments , the patient shows a complete response to the FGFR inhibitor at approximately 6 months. In some embodiments, said administration of the FGFR inhibitor provides prevention or delay of disease relapse in the non-muscle invasive bladder cancer (CVSIM) population (CVSIM-RA or CVSIM-RI). In certain embodiments, the FGFR2 genetic alteration and / or FGFR3 genetic alteration is an FGFR3 gene mutation, FGFR2 gene fusion, or FGFR3 gene fusion. In some embodiments, the FGFR3 gene mutation is R248C, S249C, G370C, Y373C, or any combination thereof. In further embodiments, the FGFR2 or FGFR3 gene fusion is FGFR3TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2CASP7, or any combination thereof. In some embodiments, said methods or uses further comprise evaluating a biological sample from the patient for the presence of at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3 prior to said administration of the FGFR inhibitor. In certain embodiments, the biological sample is blood, lymphatic fluid, bone marrow, a solid tumor sample, urine, or any combination of these. In certain embodiments, the biological sample is a blood sample. In certain embodiments, the biological sample is a urine sample. In some embodiments, the FGFR inhibitor is erdafitinib. In further embodiments, erdafitinib is administered daily, in particular once a day. In further embodiments, erdafitinib is administered orally. In certain embodiments, erdafitinib is administered orally on a continuous daily dosing schedule. In some embodiments, erdafitinib is administered orally at a dose of about 8 mg once daily. In some embodiments, erdafitinib is administered orally at a dose of about 8 mg once daily on a continuous daily dosing schedule. In additional embodiments, the dose of erdafitinib is increased from 8 mg per day to 9 mg per day after initiating treatment if the patient exhibits a serum phosphate (PO4) level that is less than about 5.5 mg / dL, in particular, The dose of erdafitinib is increased from 8 mg per day to 9 mg per day after starting treatment if the patient has a serum phosphate (PO4) level that is less than approximately 5.5 mg / dL at 14-21 days after start treatment. In certain embodiments, erdafitinib is present in a solid dosage form. In further embodiments, the solid dosage form is a tablet. In some embodiments, in the methods and uses described herein, the FGFR inhibitor, in particular erdafitinib, is administered at a dose of about 6 mg per day. In additional embodiments, erdafitinib is administered at a dose of about 6 mg once daily. In further embodiments, erdafitinib is administered orally. In certain embodiments, erdafitinib is administered orally on a continuous daily dosing schedule. In some embodiments, erdafitinib is administered orally at a dose of about 6 mg once daily. In some embodiments, erdafitinib is administered orally at a dose of about 6 mg once daily on a continuous daily dosing schedule. In additional embodiments, the dose of erdafitinib is increased from 6 mg per day to 8 mg per day after initiating treatment if the patient exhibits a serum phosphate (PO4) level that is less than about 5.5 mg / dL, in particular, The dose of erdafitinib is increased from 6 mg per day to 8 mg per day after starting treatment if the patient has a serum phosphate (PO4) level that is less than approximately 5.5 mg / dL at 14-21 days after start treatment. In certain embodiments, erdafitinib is present in a solid dosage form. In further embodiments, the solid dosage form is a tablet. Also described herein are methods for treating CVSIM-RA comprising (a) evaluating a biological sample from a patient diagnosed with CVSIMRA for the presence of one or more FGFR gene alterations, in particular one or more FGFR2 or FGFR3 alterations; and (b) administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, at a dose of about 8 mg per day at patient if one or more FGFR gene alterations are present in the sample. Also described herein are methods for treating CVSIM-RA comprising (a) evaluating a biological sample from a patient diagnosed with CVSIMRA for the presence of one or more FGFR gene alterations, in particular one or more FGFR2 or FGFR3 alterations; and (b) administering an FGFR inhibitor, in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day, at a dose of about 6 mg per day at patient if one or more FGFR gene alterations are present in the sample. Also described herein are methods for treating CVSIM-RI comprising (a) evaluating a biological sample from a patient diagnosed with CVSIMRI for the presence of one or more FGFR gene alterations, in particular one or more FGFR2 or FGFR3 alterations; and (b) administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, to the patient if one or more FGFR gene alterations. Also described herein are methods for treating CVSIM-RI comprising (a) evaluating a biological sample from a patient diagnosed with CVSIMRI for the presence of one or more FGFR gene alterations, in particular one or more FGFR2 or FGFR3 alterations; and (b) administering an FGFR inhibitor, in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day, to the patient if one or more FGFR gene alterations. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, and where the FGFR inhibitor, in particular erdafitinib, is administered or will be administered after the evaluation of a biological sample from the patient to detect the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more FGFR2 or FGFR3 genetic alterations are present in the sample. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, and where the FGFR inhibitor, in particular erdafitinib, is administered or will be administered after the evaluation of a biological sample from the patient to detect the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more FGFR2 or FGFR3 genetic alterations are present in the sample. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and where the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more are present in the sample FGFR2 or FGFR3 gene alterations. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 6 mg per day; and where the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more are present in the sample FGFR2 or FGFR3 gene alterations. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RI who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, and where the FGFR inhibitor, in particular erdafitinib, is administered or will be administered after the evaluation of a biological sample from the patient to detect the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more FGFR2 or FGFR3 genetic alterations are present in the sample. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RI who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, and where the FGFR inhibitor, in particular erdafitinib, is administered or will be administered after the evaluation of a biological sample from the patient to detect the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more FGFR2 or FGFR3 genetic alterations are present in the sample. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and where the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more are present in the sample FGFR2 or FGFR3 gene alterations. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 6 mg per day; and where the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or FGFR3 gene alterations and whether one or more are present in the sample FGFR2 or FGFR3 gene alterations. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RA who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or FGFR3 gene alterations. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RA who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, in particular erdafitinib, is or will be administered at a dose of approximately 6 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or FGFR3 gene alterations. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or FGFR3 gene alterations. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, in particular erdafitinib, is or will be administered at a dose of approximately 6 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or FGFR3 gene alterations. Additionally, provided herein are methods of treating intermediate risk non-muscle invasive bladder cancer (CVSIM-RI) that comprise, consist of, or consist essentially of, for example, administering an FGFR inhibitor at a dose of approximately 8 mg daily to a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. In certain embodiments, the patient has a papilloma. In some embodiments, the patient has an incomplete transurethral resection. In additional embodiments, the patient shows a complete response to the inhibitor. FGFR at approximately 3 months. Additionally, provided herein are methods for treating intermediate risk non-muscle invasive bladder cancer (CVSIM-RI) that comprise, consist of, or consist essentially of, for example, administering an FGFR inhibitor at a dose of approximately 6 mg daily to a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. In certain embodiments, the patient has a papilloma. In some embodiments, the patient has an incomplete transurethral resection. In additional embodiments, the patient shows a complete response to the FGFR inhibitor at approximately 3 months. In certain embodiments, the FGFR2 genetic alteration and / or FGFR3 genetic alteration is an FGFR3 gene mutation, FGFR2 gene fusion, or FGFR3 gene fusion. In some embodiments, the FGFR3 gene mutation is R248C, S249C, G370C, Y373C, or any combination thereof. In further embodiments, the FGFR2 or FGFR3 gene fusion is FGFR3TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2CASP7, or any combination thereof. In certain embodiments, the FGFR inhibitor is erdafitinib. BRIEF DESCRIPTION OF THE DRAWINGS The summary, as well as the following detailed description, is best understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the disclosed methods or uses, the drawings show exemplary embodiments of the methods or uses; however, the methods or uses are not limited to the specific embodiments disclosed. In the drawings: FIG 1 depicts the study outline for the open-label, multicenter, phase 2 study to evaluate the safety and efficacy of erdafitinib in subjects with CVSIM-RA harboring selected FGFR genetic alterations (FGFR translocations or mutations), who subsequently relapsed. of BCG therapy. Footnote (a) indicates the investigator's choice of intravesical therapy: gemcitabine / mitomycin C (MMC) / hyperthermic MMC. Footnote (b) refers to a 28-day cycle up to two years until patient has disease relapse or progression, intolerable toxicity, withdraws consent. Footnote (c) refers to a 28-day course up to two years in Cohort 1 patients with confirmed high-grade relapse in patients receiving investigator's choice treatment who can transition to erdafitinib treatment. Footnote (d) refers to up to six months of treatment, but interruption if no CR is observed in a period equal to or less than three months. As used in FIG 1, BCG means bacillus Calmette-Guérin; CIS means carcinoma in situ; RC means complete response; ERDA means erdafitinib; FGFR means fibroblast growth factor receptor; RA means high risk; QI means intravesical chemotherapy; RI means intermediate risk; MMC means mitomycin C; CVSIM means non-muscle invasive bladder cancer; SSR means relapse-free survival; and TUR means transurethral resection. FIG 2 depicts the dose titration of erdafitinib from the daily regimen of 6 mg to 8 mg. DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS It is to be appreciated that certain features of the invention that, for clarity, are described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. That is, unless obviously incompatible or specifically excluded, each individual embodiment is deemed to be combinable with any other embodiment or embodiments and such a combination is deemed to be another embodiment. Conversely, various features of the invention that, for brevity, are described in the context of a single embodiment, may also be provided separately or in any subcombination. Finally, although an embodiment can be described as part of a series of steps or part of a more general structure, each of said steps can also be considered an independent embodiment in itself, combinable with others. Certain terminology The transitional expressions comprising, consisting essentially of, and consisting are intended to connote their generally accepted meanings in the patent vernacular; that is, (i) comprising, being synonymous with including, containing or characterized by, being inclusive or open-ended and not excluding additional, unmentioned elements or method steps; (i) which consists of excluding any element, step or component not specified in the claim; and (iii) which essentially consists of limiting the scope of a claim or embodiment to the specified materials or steps and those that do not materially affect the basic and novel characteristic or characteristics of the claimed embodiment or invention. More specifically, basic and novel features refer to the ability of the method or use to provide at least one of the benefits described herein, including, but not limited to, the ability to improve the survivability of the human population in relation to the survivability of the comparative human population described elsewhere in this document. Embodiments described as to the phrase comprising (or their equivalents) also provide, as embodiments, those that are independently described as consisting of and essentially consisting of. When a value is expressed as an approximation by use of the descriptor approximately, the particular value will be understood to form another embodiment. If not otherwise specified, the term approximately means a variance of ±10% of the associated value, but additional embodiments include those in which the variance may be ±5%, ±15%, ±20%, ±25%. % or ±50%, in particular, the term approximately means a variance of ±5% or ±10% of the associated value, more particularly ±5%. When a list is presented, unless otherwise stated, it is to be understood that each individual element of that list, and each combination of that list, is a separate embodiment. For example, a list of embodiments presented as A, B or C is to be interpreted as including embodiments A, B, C, A or B, A or C, B or C or A, B or C. As used herein, the singular forms un, uno / a, and el / la include the plural. The following abbreviations are used throughout the disclosure: FGFR (fibroblast growth factor receptor); FGFR3-TACC3 VI (fusion between genes encoding FGFR3 and transforming acidic superhelix-containing protein 3 variant 1); FGFR3-TACC3 V3 (fusion between genes encoding FGFR3 and transforming acidic superhelix-containing protein 3 variant 3); FGFR3-BAIAP2L1 (fusion between genes encoding FGFR3 and brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 1); FGFR2-BICC1 (fusion between genes encoding FGFR2 and bicaudal C homolog 1); FGFR2-CASP7 (fusion between genes that encode FGFR2 and caspase 7). As used herein, patient is intended to refer to any animal, in particular, mammals. Therefore, the methods or uses are applicable to human and non-human animals, although most preferably humans. The terms patient and subject and human being can be used interchangeably. The terms treat and treatment refer to the treatment of a patient suffering from a health condition and refer to an effect that alleviates the condition by destroying cancer cells, but also to an effect that results in the inhibition of the progression of the condition, and includes a reduction in forward speed, a stop in forward speed, improvement of the condition, and cure of the condition. Treatment is also included as a prophylactic measure (i.e., prophylaxis). Therapeutically effective amount refers to an effective amount, at doses and for periods of time necessary, to achieve a desired therapeutic result. A therapeutically effective amount may vary depending on factors such as the disease state, age, sex and weight of the individual, and the ability of a therapeutic agent or combination of therapeutic agents to elicit a desired response in the individual. Exemplary indicators of an effective therapeutic agent or combination of therapeutic agents include, for example, improved patient well-being. The term dosage refers to information on the amount of the therapeutic agent that the subject will take and the frequency of the number of times the subject takes the therapeutic agent. The term dose refers to the amount of the therapeutic agent to be taken each time. The term cancer as used herein refers to an abnormal growth of cells that tend to proliferate in an uncontrolled manner and, in some cases, metastasize (spread). The terms co-administration or the like, as used herein, encompass the administration of selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered by the same route of administration, or by different routes of administration, or at the same time or at different times. The term pharmaceutical combination as used herein means a product that is the result of the mixture or combination of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term fixed combination means that the active ingredients, for example, erdafitinib and a coagent, are both administered to a patient simultaneously in the form of a single unit or single dosage form. The term "non-fixed combination" means that the active ingredients, for example, erdafitinib and a coagent, are administered to a patient as discrete units or discrete dosage forms, simultaneously, concurrently or sequentially without specific intermediate time limits, where such administration provides safe levels. and effective of the two active ingredients in the human body. The latter also applies to a treatment with polytherapy, for example, the administration of three or more active ingredients. The term continuous daily dosing schedule refers to the administration of a particular therapeutic agent without any pharmacological rest for the particular therapeutic agent. In some embodiments, a continuous daily dosing schedule of a particular therapeutic agent comprises administration of a particular therapeutic agent each day at approximately the same time each day. Relapse-free survival (RFS) is defined as the time from the date of randomization to the date of recurrence of high-risk disease (Ta, TI, or high-grade CIS) or death, whichever is reported first. Patients who are alive and without relapse or whose status is unknown will be censored at the last tumor evaluation. RFS will be evaluated by central histopathological review. cnRRnn / zznz / E / YiAi The term relapse-free survival 2 (RFS2) is defined as the time from the date of randomization to the date of recurrence of high-risk disease at the first subsequent nonsurgical anticancer treatment, or death, whichever is reported first. Participants who are alive and without relapse or whose status is unknown will be censored at the last tumor evaluation. The term time to progression is defined as the time from the date of randomization to the date of the first documented evidence of any progression or death. Patients who are alive and without progression or whose status is unknown will be censored on the date of last tumor evaluation. The term time to disease worsening is defined as the time from the date of randomization to the date of the first documented evidence of a change in therapy indicative of more advanced disease. Patients who are alive and without worsening disease or whose status is unknown will be censored at the last tumor evaluation. The term time to disease worsening can also be defined as the time from the date of randomization to the date of the first documented evidence of cystectomy, change in therapy indicative of more advanced disease (including radiotherapy or systemic chemotherapy). . Patients who are alive and without worsening disease or whose status is unknown will be censored at the last tumor evaluation. The term disease-specific survival is defined as the time from the date of randomization to the date of the participant's death resulting from bladder cancer. Patients who are alive or have unknown vital status will be censored on the date the participant was last known to be alive. Participants whose death results from causes other than bladder cancer will be censored on their dates of death. The term overall survival (OS) is defined as the time from the date of randomization to the date of the participant's death resulting from any cause. Patients who are alive or have unknown vital status will be censored on the date the participant was last known to be alive. The expression complete response (CR) is defined as the disappearance of the marker lesion, with no remnant present and no viable tumor observed in the histopathological examination. The expression partial response (PR) is defined as a decrease of at least 30% in the sum of the diameters of the target lesions, taking as reference the sum of the initial diameters. The term adverse event is any unfavorable medical event that occurs in a participant administered an investigational product, and does not necessarily indicate only events with a clear causal relationship to the relevant investigational product. The term placebo as used herein refers to the administration of a pharmaceutical composition that does not include an FGFR inhibitor. The term randomization as referred to in a clinical trial refers to the moment when the patient is confirmed eligible for the clinical trial and assigned to a treatment arm. The terms kit and article of manufacture are used synonymously. Biological sample refers to any sample from a patient in which cancer cells can be obtained and the detection of a genetic alteration of FGFR is possible. Suitable biological samples include, but are not limited to, blood, lymphatic fluid, bone marrow, a solid tumor sample, or any combination of these. In some embodiments, the biological sample may be formalin-fixed paraffin-embedded (FFPET) tissue. Cmax is the maximum observed analysis concentration. Tmax is the actual sampling time to reach the maximum analyte concentration observed. ABClast is from time zero to the time of the last average analyte concentration (not below the limit of quantitation [DLC]). ABCinfinite is from zero time to infinite time. FGFR genetic alterations Described herein are methods or uses for treating CVSIM-RA that comprise, consist of, or essentially consist of administering an FGFR inhibitor at a dose of approximately 8 mg per day to a patient diagnosed with CVSIM-RA and harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration (i.e., one or more FGFR2 genetic alterations, one or more FGFR3 genetic alterations, or a combination of these). Also described herein are methods or uses for treating CVSIM-RA that comprise, consist of or essentially consist of administering at least one fibroblast growth factor receptor (FGFR) inhibitor at a dose of about 8 mg per day at a patient who has been diagnosed with CVSIM-RA and harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. Further described herein are methods or uses for treating CVSIM-RA that comprise, consist of, or essentially consist of administering two or more fibroblast growth factor receptor (FGFR) inhibitors at a dose of about 8 mg per day at a patient who has been diagnosed with CVSIM-RA and harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. The same method of treatment embodiments applies to the uses described herein. In a cnRRnn / zznz / E / YiAi embodiment, in the methods or uses for treating CVSIM-RA, the FGFR inhibitor is or will be administered at a dose of approximately 6 mg per day. In one embodiment, the FGFR inhibitor is erdafitinib. Described herein are methods or uses for treating CVSIM-RI that comprise, consist of, or essentially consist of administering an FGFR inhibitor at a dose of approximately 8 mg per day to a patient diagnosed with CVSIM-RI and harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration (i.e., one or more FGFR2 genetic alterations, one or more FGFR3 genetic alterations, or a combination of these). Also described herein are methods or uses for treating CVSIM-RI that comprise, consist of or essentially consist of administering at least one fibroblast growth factor receptor (FGFR) inhibitor at a dose of about 8 mg per day at a patient who has been diagnosed with CVSIM-RI and harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. Further described herein are methods or uses for treating CVSIM-RI that comprise, consist of, or essentially consist of administering two or more fibroblast growth factor receptor (FGFR) inhibitors at a dose of about 8 mg per day at a patient who has been diagnosed with CVSIM-RI and harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. The same method of treatment embodiments applies to the uses described herein. In one embodiment, in methods or uses for treating CVSIM-RI, the FGFR inhibitor is or will be administered at a dose of about 6 mg per day. In one embodiment, the FGFR inhibitor is erdafitinib. The fibroblast growth factor (FGF) family of protein tyrosinakinase (PTK) receptors regulates a diverse set of physiological functions including mitogenesis, wound healing, cellular differentiation and angiogenesis, and development. The growth of both normal and malignant cells as well as their proliferation are affected by changes in the local concentration of FGF, extracellular signaling molecules that act as autocrine as well as paracrine factors. Autocrine FGF signaling may be particularly important in the progression of steroid hormone-dependent cancers to a hormone-independent state. FGF and its receptors have a higher level of expression in several tissues and cell lines and overexpression is believed to contribute to the malignant phenotype. Furthermore, several oncogenes are homologs of genes encoding growth factor receptors, and aberrant activation of FGF-dependent signaling is possible in human pancreatic cancer (Knights et al., Pharmacogy and Therapeutics 2010 125:1 ( 105-117); Korc M. et al. Current Cancer Drug Targets 2009 9:5 (639-651)). The two prototypical members are acidic fibroblast growth factor (aFGF or FGF1) and basic fibroblast growth factor (bFGF or FGF2), and to date at least twenty different FGF family members have been identified. The cellular response to FGF is conveyed by four types of fibroblast growth factor receptors (FGFRs), which are high-affinity transmembrane tyrosine kinase proteins numbered 1 to 4 (FGFR1 to FGFR4). In certain embodiments, CVSIM-RA or CVSIM-RI is susceptible to a genetic alteration of FGFR2 and / or a genetic alteration of FGFR3. As used herein, FGFR genetic alteration refers to an alteration in the natural FGFR gene, including, but not limited to, FGFR fusion genes, FGFR mutations, FGFR amplifications, or any combination of these. . The terms variant and alteration are used interchangeably herein. In certain embodiments, the genetic alteration of FGFR2 or FGFR3 is an FGFR gene fusion. FGFR fusion or FGFR gene fusion refers to a gene encoding a portion of FGFR (e.g., FGRF2 or FGFR3) and one of the fusion partners disclosed herein, or a portion thereof, that is created by a translocation between the two genes. The terms fusion and translocation are used interchangeably herein. The presence of one or more of the following FGFR fusion genes in a biological sample from a patient can be determined using the disclosed methods or uses or by methods known to those skilled in the art: FGFR3-TACC3, FGFR3-BAIAP2L1, FGFR2- BICC1, FGFR2-CASP7, or any combination of these. In certain embodiments, FGFR3-TACC3 is FGFR3-TACC3 variant 1 (FGFR3-TACC3 VI) or FGFR3-TACC3 variant 3 (FGFR3-TACC3 V3). Table 1 provides the FGFR fusion genes and the FGFR and fusion partner exons that are fused. The sequences of the individual FGFR fusion genes are reported in Table 4. cnRRnn / zznz / E / YiAi Table 1 Fusion gene FGFR exon Partner exon FGFR2 FGFR2-BICC1 19 3 FGFR2-CASP7 19 4 FGFR3 FGFR3-BAIAP2L1 18 2 FGFR3-TACC3 VI 18 11 FGFR3-TACC3 V3 18 10 Genetic alterations of FGFR include FGFR single nucleotide polymorphism (SNP). FGFR single nucleotide polymorphism (SNP) refers to an FGFR2 or FGFR3 gene in which a single nucleotide differs between individuals. In certain embodiments, the genetic alteration of FGFR2 or FGFR3 is an FGFR3 gene mutation. In particular, FGFR single nucleotide polymorphism (SNP) refers to an FGFR2 gene in which a single nucleotide differs between individuals. The presence of one or more of the following FGFR SNPs in a biological sample from a patient can be determined by methods known to those skilled in the art or methods disclosed in WO 2016 / 048833, FGFR3 R248C, FGFR3 S249C, FGFR3 G370C , FGFR3 Y373C, or any combination of these. The sequences of the FGFR SNPs are provided in Table 2. Table 2 FGFR3 mutant FGFR3 sequence R248C TCGGACCGCGGCAACTACACCTGCGTCGTGGAGAACAAGTTTGGCAGCATCCGGC AGACGTACACGCTGGACGTGCTGGAGÍDGCTCCCCGCACCGGCCCATCCTGCAG GCGGGGCTGCCGGCCAACCAGACGGCGGTGCTGGGCAGCGACGTGGAGTTCCAC TGCAAGGTGTACAGTGACGCACAGCCCCACATCCAGTGGCTCA AGCACGTGGAGG TGAATGGCAGCAAGGTGGGCCCGGACGGCACACCCTACGTTACCGTGCTCA (SEQ ID NO:1) FGFR3 S249C GACCGCGGCAACTACACCTGCGTCGTGGAGAACAAGTTTGGCAGCATCCGGCAGA CGTACACGCTGGACGTGCTGGGTGAGGGCCCTGGGGCGGCGCGGGGGTGGGGGC GGCAGTGGCGGTGGTGGTGAGGGAGGGGGTGGCCCCTGAGCGT CATCTGCCCCC ACAGAGCGCT£G)CCCGCACCGGCCCATCCTGCAGGCGGGGCTGCCGGCCAACCA GACGGCGGTGCTGGGCAGCGACGTGGAGTTCCACTGCAAGGTGTACAGTGACGCA CAGCCCCACATCCAGTGGCTCAAGCACGTGGAGGTGAATGGCAGCAAGGTGGGCC CGGACGGCACACCCTACGTTACCGTGCCTCAAGGTGGGCCACCGTGTGCACGT (SEQ ID NO:2) FGFR3 G370C GCGGGCAATTCTATTGGG1 1 1 1C1CATCACTCTGCGTGGCTGGTGGTGCTGCCAG CCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGÍDGCAGTGTGTATGCAGGCATC CTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGC TCTGCCGCCTGCGCAGCCCCCCCAAGAAAGGCCTGGGCTCCCCCACCGTGC ACAA GATCTCCCGCTTCCCG (SEQ ID NO:3) FGFR3 Y373C* CTAGAGGTTCTCTCCTTGCACAACGTCACCI 1 1GAGGACGCCGGGGAGTACACCT GCCTGGCGGGCAATTCTATTGGGTTTTCTCATCACTCTGCGTGGCTGGTGGTGCT GCCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGT(G)TGCA GGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTG GTGGTGGCGGCTG TGACGCTCTGCCGCCTGCGCAGCCCCCCCAAGAAAGGCCTGGGCTCCCCCACCGT FGFR3 Mutant Sequence GCACAAGATCTCCCGCTTCCCGCTCAAGC (SEQ ID NO:4) The sequences correspond to nucleotides 920-1510 of FGFR3 (Genebank ID # NM_000142.4). Nucleotides in bold and underlined represent the SNP. *Sometimes erroneously referred to as Y375C in the literature. As used herein, FGFR genetic alterations gene panel includes one or more of the FGFR genetic alterations listed above. In some embodiments, the gene panel of FGFR genetic alterations depends on the patient's cancer type. The gene panel of FGFR genetic alterations used in the evaluation step of the disclosed methods is based, in part, on the patient's cancer type. For patients with CVSIM-RA or CVSIM-RI, an appropriate FGFR gene panel of genetic alterations may comprise FGFR3-TACC3 VI, FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, FGFR3 R248C, FGFR3 S249C, FGFR3 G370C or FGFR3 Y373C, or any combination of these. FGFR inhibitors. for use in the methods or uses disclosed FGFR inhibitors suitable for use in the disclosed methods or uses are provided herein. FGFR inhibitors can be used alone or in combination for the treatment methods described herein. In some embodiments, if one or more FGFR genetic alterations are present in the sample, CVSIM-RA or CVSIM-RI can be treated with an FGFR inhibitor disclosed in US Publication No. 2013 / 0072457 Al ( incorporated herein by reference), including any tautomeric or stereochemically isomeric form thereof, and a / V-oxide thereof, a pharmaceutically acceptable salt thereof, or a solvate thereof. In some aspects, for example, CVSIM-RA or CVSIM-RI can be treated with N(3,5-dimethoxyphenyl)- / V-(l-methyllet¡l)- / V-[3-(l -met¡l-l / 7í-pyrazol-4-¡l)qu¡noxal¡n-6-¡l]ethane-l,2-d¡amine (referred to herein as JNJ-42756493 or JNJ493 or erdafitinib), including any tautomeric form thereof, / V-oxides thereof, pharmaceutically acceptable salts thereof or solvates thereof. In some embodiments, the FGFR inhibitor may be the compound of formula (I), also referred to as erdafitinib: cnRRnn / zznz / E / YiAi ΝΗ (I) or a pharmaceutically acceptable salt thereof. In some aspects, the pharmaceutically acceptable salt is an HCl salt. In preferred embodiments, erdafitinib base is used. Erdafitinib (also called ERDA), a once-daily oral pan-FGFR kinase inhibitor, has been approved by the US Food and Drug Administration (FDA) for the treatment of adult patients who have locally advanced UC or mUC that has susceptible FGFR2 or FGFR3 genetic alterations and has progressed during or after at least one line of prior platinum-containing chemotherapy, including within 12 months of adjuvant platinum-containing chemotherapy or neoadjuvant. Loriot Y et al. NEJM. 2019; 381:338-48. Erdafitinib has shown clinical benefits and tolerability in patients with mUC and altered FGFR expressions. Tabernero J, et al. J CUn OncoL 2015;33:3401-3408; Soria J-C, et al. Ann Eleven! 2016;27(Suppl 6):v¡266-vi295. Summary 781PD; Siefker-Radtke AO, et al. ASCO 2018. Abstract 4503; Siefker-Radtke A, et al. ASCO-GU 2018. Summary 450. In some embodiments, CVSIM-RA or CVSIM-RI can be treated with an FGFR inhibitor where the FGFR inhibitor is / V-[5-[2-(3,5-dimethoxyphenyl)et¡l]- 2Aí-p¡razol-3-yl]-4-(3,5diemtilp¡peraz¡n-l-yl)benzam¡da (AZD4547), as described in Gavine, P.R., et a!., AZD4547: An Orally Bioavailable, Potent, and Selective Inhibitor of the Fibroblast Growth Factor Receptor Tyrosine Kinase Family, Cancer Res. April 15, 2012 72; 2045: including, where chemically possible, any tautomeric or stereochemically isomeric form thereof, and a / V-oxide thereof, a pharmaceutically acceptable salt thereof, or a solvate thereof. In some embodiments, CVSIM-RA or CVSIM-RI can be treated with an FGFR inhibitor where the FGFR inhibitor is 3-(2,6-dichloro-3,5-dimethoxyphenyl)-l-{6-[ 4-(4-ethylpiperazin-lyl)phenylamino]pyrimid-4-yl}methylurea (NVP-BGJ398) as described in pub. int. No. WO2006 / 000420: (lili including, where chemically possible, any tautomeric or stereochemically isomeric form thereof, and a / V-oxide thereof, a pharmaceutically acceptable salt thereof, or a solvate thereof. In some embodiments, CVSIM-RA or CVSIM-RI can be treated with an FGFR inhibitor where the FGFR inhibitor is 4-amino-5-fluoro-3-[6-(4-methylpiperazín-l-yl)- l / 7í-benzimidazol2-íl]-l / / -quinolin-2-one (dovitinib) as described in pub. int. No. WO2006 / 127926: including, where chemically possible, any tautomeric or stereochemically isomeric form thereof, and a / V-oxide thereof, a pharmaceutically acceptable salt thereof, or a solvate thereof. In some embodiments, CVSIM-RA or CVSIM-RI can be treated with an FGFR inhibitor where the FGFR inhibitor is 6-(7-((1-am¡noc¡cloprop¡l)methox¡)-6-methox ¡quino¡n-4-¡lox¡)- / Vmethyl-l-naphthamide (AL3810) (lucitanib; E-3810), as described in Bello, E. etal, E-3810 Is a Potent Dual Inhibitor of VEGFR and FGFR that Exerts Antitumor Activity in Multiple Preclinical Models, Cancer Res February 15, 2011 71(A)1396-1405 and in pub. int. No. WO2008 / 112408: Η EITHER. . , Ν . ,Ί Ο' MeO. Ο - Ν ' V -- —' ΝΗ CI including, where chemically possible, any tautomeric or stereochemically isomeric form thereof, and a / V-oxide thereof, a pharmaceutically acceptable salt thereof, or a solvate thereof. In some embodiments, CVSIM-RA or CVSIM-RI can be treated with an FGFR inhibitor where the FGFR inhibitor is pemigatinib (11-(2,6-difluoro-3,5-dimethoxyphenyl)-13-ethyl- 4(morpholín-4-ylmethyl)-5,7,ll,13-tetrazatr¡cyclo[7.4.0.02'6]trideca-l,3,6,8-tetraen-12-one: including, where chemically possible, any tautomeric or stereochemically isomeric form thereof, and a / V-oxide thereof, a pharmaceutically acceptable salt thereof, or a solvate thereof. Additional suitable FGFR inhibitors include BAY1163877 (Bayer), BAY1179470 (Bayer), TAS-120 (Taiho), ARQ087 (ArQuIe), ASP5878 (Astellas), FF284 (Chugai), FP1039 (GSK / FlvePnme), Blueprint, LY- 2874455 (Lilly), RG-7444 (Roche), or any combination of these, including, where chemically possible, any tautomeric or isomeric stereochemical form of these, / V-oxides of these, pharmaceutically acceptable salts of these, or solvates of these. In one embodiment the FGFR inhibitor, generally, and erdafitinib more specifically, is administered as a pharmaceutically acceptable salt. In a preferred embodiment, the FGFR inhibitor, generally, and erdafitinib more specifically, is administered in base form. In one embodiment the FGFR inhibitor, generally, and erdafitinib more specifically, is administered as a pharmaceutically acceptable salt in an amount corresponding to 8 mg base equivalent or corresponding to 9 mg base equivalent. In one embodiment, the FGFR inhibitor generally, and erdafitinib more specifically, is administered as a pharmaceutically acceptable salt in an amount corresponding to 6 mg base equivalent. In one embodiment the FGFR inhibitor, generally, and erdafitinib more specifically, is administered in base form in an amount of 8 mg or 9 mg. In one embodiment the FGFR inhibitor, generally, and erdafitinib more specifically, is administered in base form in an amount of 6 mg. The salts can be prepared, for example, by reacting the FGFR inhibitor, in general, and erdafitinib more specifically, with an appropriate acid in an appropriate solvent. Acid addition salts can be formed with acids, both inorganic and organic. Some examples of acid addition salts include salts formed with an acid selected from the group consisting of acetic, hydrochloric, hydroiodic, phosphoric, nitric, sulfuric, citric, lactic, succinic, maleic, malic, isethionic, fumaric, benzenesulfonic, toluenesulfonic, methanesulfonic (mesylate), ethanesulfonic, naphthalenesulfonic, valeric, acetic, propanoic, butanoic, malonic, glucuronic and lactobionic. Another group of acid addition salts includes salts formed from acetic, adipic, ascorbic, aspartic, citric, DLlactic, fumaric, gluconic, glucuronic, hippuric, hydrochloric, glutamic, DL-malic, methanesulfonic, sebacic, stearic acids. , succinic and tartaric. In one embodiment, the FGFR inhibitor, generally, and erdafitinib more specifically, is administered in the form of a solvate. As used herein, the term solvate refers to a physical association of erdafitinib with one or more solvent molecules. Physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain cases, the solvate may be isolated, for example, when one or more solvent molecules are incorporated into the crystal lattice of the crystalline solid. The term solvate is intended to include both solution-phase and isolable solvates. Some non-limiting examples of solvents that can form solvates include water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid or ethanolamine and the like. Solvates are well known in pharmaceutical chemistry. These may be important to the processes for the preparation of a substance (e.g. in relation to its purification), the storage of the substance (e.g. its stability) and the ease of handling of the substance, and are frequently formed as part of the isolation or purification steps of a chemical synthesis. A person skilled in the art can determine by means of standard and long-used techniques whether a hydrate or other solvate has been formed by the isolation conditions or the purification conditions used to prepare a given compound. Examples of such techniques include thermogravimetric analysis (TGA), differential scanning calorimetry (DSC), X-ray crystallography (e.g., single-crystal X-ray crystallography or X-ray powder diffraction), and NMR solid-state (SS-NMR, also known as magic angle spin NMR or MAS-NMR). Such techniques are part of the expert chemist's standard analytical toolkit just as important as NMR, IR, HPLC, and MS. Alternatively, the skilled person may deliberately form a solvate using crystallization conditions that include an amount of the solvent required for the particular solvate. After this the standard methods described above can be used to establish whether solvates have formed. Also encompassed are any complexes (for example, inclusion complexes or clathrates with compounds such as cyclodextrins or complexes with metals). Additionally, the compound may have one or more polymorphic (crystalline) or amorphous forms. Compounds include compounds with one or more isotopic substitutions, and a reference to a particular element includes within its scope all isotopes of the element. For example, a reference to hydrogen includes within its scope Ή,2H (D) and 3H (T). Similarly, references to carbon and oxygen include within their scope, respectively, 12C, 13C and 14C and 16O and 18O. Isotopes can be radioactive or non-radioactive. In one embodiment, the compounds do not contain radioactive isotopes. Such compounds are preferred for therapeutic use. In another embodiment, however, the compound may contain one or more radioisotopes. Compounds containing such radioisotopes may be useful in a diagnostic context. Treatment methods and uses Described herein are methods of treating CVSIM-RA that comprise, consist of, or essentially consist of administering an FGFR inhibitor at a dose of approximately 8 mg per day to a patient diagnosed with CVSIM-RA harboring the minus a genetic alteration of FGFR2 and / or genetic alteration of FGFR3. Described herein are methods of treating CVSIM-RA that comprise, consist of, or essentially consist of administering an FGFR inhibitor at a dose of approximately 6 mg per day to a patient diagnosed with CVSIM-RA harboring the minus a genetic alteration of FGFR2 and / or genetic alteration of FGFR3. Additionally, provided herein are methods of treating CVSIM-RI that comprise, consist of, or essentially consist of administering an FGFR inhibitor at a dose of about 8 mg per day to a patient diagnosed with CVSIM-RI who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. Additionally, provided herein are methods of treating CVSIM-RI that comprise, consist of, or essentially consist of administering an FGFR inhibitor at a dose of about 6 mg per day to a patient diagnosed with CVSIM-RI who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RA harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RA harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 6 mg per day. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 6 mg per day, for the manufacture of a medicament. for the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 6 mg per day. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RA who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, particularly erdafitinib, is or will be administered at a dose of approximately 8 mg per day. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RA who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, particularly erdafitinib, is or will be administered at a dose of approximately 6 mg per day. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, particularly erdafitinib, is or will be administered at a dose of approximately 8 mg per day. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, particularly erdafitinib, is or will be administered at a dose of approximately 6 mg per day. Such methods and uses also encompass the administration of at least one, two, three or four FGFR inhibitors to a patient diagnosed with NHIMB-RA or CVSIM-RI. In certain embodiments, the patient received at least one therapy prior to administration of said FGFR inhibitor. In further embodiments, the patient received BCG therapy prior to said administration of said FGFR inhibitor. In some embodiments, BCG therapy is a suitable BCG therapy. Minimum requirements for adequate BCG therapy include (1) at least 5 of 6 full doses of an initial induction cycle plus at least 1 maintenance (2 of 3 full weekly doses) over a 6-month period, or (2) at least 5 of 6 full doses of an initial induction cycle plus at least 2 of 6 full doses of a second induction cycle. A full dose of BCG comprises 1 full vial with a minimum of IxlO8colony forming units (CFU). In some embodiments, the patient does not respond to BCG therapy. A patient does not respond to BCG therapy if the patient has one of the following disease relapse states and if the patient received appropriate BCG therapy. Disease relapse states are: (1) persistent or recurrent carcinoma in situ (CIS) alone or with recurrent Ta / Tl disease (non-invasive papillary disease / papilloma invading the subepithelial connective tissue) within 12 months of completion of appropriate BCG therapy, (2) recurrent high-grade Ta / Tl disease within 6 months of completion of appropriate BCG therapy, or (3) high-grade IT at first evaluation of disease after an induction cycle with BCG. In still other embodiments, the patient has experience with BCG. A patient is BCG experienced if the patient has recurrent high-grade Ta / Tl disease within 12 months of completion of BCG therapy and his or her prior BCG therapy is the minimum treatment requirement. The minimum treatment requirement is: (1) at least 5 of 6 full doses of an initial induction course; and (2) at least 5 of 6 full doses of an initial induction cycle plus at least 1 maintenance (2 of 3 weekly doses) over a 6-month period. Half the dose or one-third of the dose is allowed during maintenance. In certain embodiments, the patient has a papilloma. Papillomas can grow from the tissue that lines the inside of an organ and can occur in the bladder, thyroid and breast. In further embodiments, the patient has carcinoma in situ. In certain embodiments, carcinoma in situ refers to a group of abnormal cells that remain in the place where they first formed. In certain embodiments, the patient has stage 0 disease. In some embodiments, the patient has not previously undergone or is not suitable for a cystectomy, that is, surgery to remove all or part of the bladder or to remove a cyst in the body. The determination of suitability may be made, for example, by the responsible physician. In some embodiments, the patient has undergone an incomplete transurethral resection, for example, surgery to remove tissue with a special instrument that is inserted through the urethra. In certain embodiments, such administration of the FGFR inhibitor provides an increase in RFS, time to progression, time to disease worsening, disease-specific survival, OS, RFS rate, RFS2 or CR compared to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In some embodiments, such administration of the FGFR inhibitor provides an increase in RFS relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In some embodiments, such administration of the FGFR inhibitor provides an increase in time to progression relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In some embodiments, such administration of the FGFR inhibitor provides an increase in time to disease worsening relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In certain embodiments, such administration of the FGFR inhibitor provides an increase in disease-specific survival relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In certain embodiments, such administration of the FGFR inhibitor provides an increase in OS relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In certain embodiments, such administration of the FGFR inhibitor provides an increase in the RFS rate relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In certain embodiments, such administration of the FGFR inhibitor provides an increase in RFS2 relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In certain embodiments, such administration of the FGFR inhibitor provides an increase in CR relative to a population of patients with CVSIM-RA or CVSIM-RI who have been administered a placebo. In certain embodiments, the increase in the SSR rate is determined at 6 months. In certain embodiments, the increase in the SSR rate is determined at 12 months. In certain embodiments, the increase in the SSR rate is determined at 24 months. In certain embodiments, the improvement in antitumor activity is over placebo treatment. In certain embodiments, the improvement in antitumor activity is relative to the absence of treatment. In certain embodiments, the improvement in antitumor activity is relative to the reference treatment. In certain embodiments, the improvement in antitumor activity is at the discretion of the investigator. In certain embodiments, the improvement in antitumor activity is with respect to a population of patients with CVSIM-RA or CVSIM-RI who have been administered intravesical gemcitabine. In certain embodiments, the improvement in antitumor activity is with respect to a population of patients with CVSIM-RA or CVSIM-RI who have been administered intravesical hyperthermic mitomycin C (MMC) / MMC. Gemcitabine, which is the active substance in gemcitabine hydrochloride (also known as GEMZAR®), is a nucleoside metabolism inhibitor that can be administered by intravesical instillation, for example, into the bladder through a urinary catheter. Gemcitabine can be administered as a 200 mg single-use vial or a 1 g single-use vial. Gemcitabine'HCI is 2'-deoxy-2',2'-difluorocytinadine monohydrochloride (β isomer). Mitomycin C (also known as MUTAMYCIN®) is a methylazirinopyrroloindoldione-type antineoplastic antibiotic isolated from the bacterium Streptomyces caespitosus and other Streptomyces bacterial species that can be administered by intravesical instillation. Intravesical administration of MMC may optionally be hyperthermic, for example, simultaneous intravesical administration with microwave-induced hyperthermia. To achieve microwave-induced hyperthermia, an applicator can provide hyperthermia to the bladder wall through direct irradiation. In some embodiments, the patient shows a CR to the FGFR inhibitor at approximately 6 months. In some embodiments, the patient shows a CR to the FGFR inhibitor at approximately 3 months. Also provided herein are methods or uses to improve RFS, time to progression, time to disease worsening, disease-specific survival, OS, RFS rate, RFS2 or CR. in a patient diagnosed with CVSIM-RA or CVSIM-RI with respect to a patient diagnosed with CVSIM-RA or CVSIM-RI who has not received treatment with an FGFR inhibitor, comprising, consisting or essentially consisting said method in administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day day or more in particular erdafitinib at a dose of approximately 6 mg per day, to a patient who has been diagnosed with CVSIM-RA or CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, methods or uses are provided herein for improving RFS in a patient diagnosed with CVSIM-RA relative to a patient diagnosed with CVSIM-RA who has not received treatment with an inhibitor. of FGFR, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day or more in particular erdafitinib at a dose of approximately 6 mg per day, to a patient diagnosed with CVSIM-RA or CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, methods or uses are provided herein for improving the time to progression in a patient diagnosed with CVSIM-RA or CVSIM-RI relative to a patient diagnosed with CVSIM-RA or CVSIM-RI who have not received treatment with an FGFR inhibitor, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of approximately 8 mg per day or more particularly erdafitinib at a dose of approximately 6 mg per day, to a patient who has been diagnosed with CVSIM-RA or CVSIM-RI harboring at least a genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, methods or uses are provided herein for improving the time to worsening of disease in a patient diagnosed with CVSIM-RA relative to a patient diagnosed with CVSIM-RA who is not has received treatment with an FGFR inhibitor, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of approximately 8 mg per day or more in particular erdafitinib at a dose of approximately 6 mg per day, to a patient diagnosed with CVSIM-RA or CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, methods or uses are provided herein for improving disease-specific survival in a patient diagnosed with CVSIM-RA or CVSIM-RI relative to a patient diagnosed with CVSIMRA who is not has received treatment with an FGFR inhibitor, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of approximately 8 mg per day or more in particular erdafitinib at a dose of approximately 6 mg per day, to a patient who has been diagnosed with CVSIM-RA harboring at least one FGFR2 genetic alteration and / or alteration FGFR3 genetics.In certain embodiments, methods or uses are provided herein for improving OS in a patient diagnosed with CVSIM-RA or CVSIM-RI relative to a patient diagnosed with CVSIM-RA or CVSIM-RI. who has not received treatment with an FGFR inhibitor, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more in particular erdafitinib at a dose of approximately 8 mg per day or more in particular erdafitinib at a dose of approximately 6 mg per day, to a patient diagnosed with CVSIM-RA or CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, methods or uses are provided herein for improving the RFS rate in a patient diagnosed with CVSIM-RA or CVSIM-RI relative to a patient diagnosed with CVSIM-RA or CVSIM. -RI who have not received treatment with an FGFR inhibitor, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib , more particularly erdafitinib at a dose of approximately 8 mg per day or more particularly erdafitinib at a dose of approximately 6 mg per day, to a patient who has been diagnosed with CVSIM-RA or CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, methods or uses for improving SSR2 in a patient diagnosed with CVSIM-RA or CVSIMRI are provided herein. RA or CVSIM-RI that has not received treatment with an FGFR inhibitor, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of approximately 8 mg per day or more particularly erdafitinib at a dose of approximately 6 mg per day, to a patient who has been diagnosed with CVSIM-RA or CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, methods or uses are provided herein for improving CR in a patient diagnosed with CVSIM-RA or CVSIM-RI relative to a patient diagnosed with CVSIM-RA or CVSIM-RI. who has not received treatment with an FGFR inhibitor, said method comprising administering an FGFR inhibitor, in particular at a dose of about 8 mg per day, or in particular at a dose of about 6 mg per day, in particular erdafitinib, more in particular erdafitinib at a dose of approximately 8 mg per day or more in particular erdafitinib at a dose of approximately 6 mg per day, to a patient diagnosed with CVSIM-RA or CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. In certain embodiments, the improvement is over placebo treatment. In certain embodiments, the improvement in antitumor activity is relative to the absence of treatment. In certain embodiments, the improvement in antitumor activity is relative to the reference treatment. In certain embodiments, the improvement in antitumor activity is at the discretion of the investigator. In certain embodiments, the improvement in antitumor activity is with respect to a population of patients with CVSIM-RA who have been administered intravesical gemcitabine. In certain embodiments, the improvement in antitumor activity is with respect to a population of patients with CVSIM-RA or CVSIM-RI who have been administered intravesical hyperthermic mitomycin C (MMC) / MMC. Evaluation of a sample to detect the presence of one or more FGFR genetic alterations Also described herein are methods of treating CVSIM-RA that comprise, consist of, or essentially consist of (a) evaluating a biological sample from a patient diagnosed with CVSIM-RA for the presence of one or more alterations. fibroblast growth factor receptor (FGFR) genes; and (b) administering an FGFR inhibitor, in particular at a dose of about 8 mg per day or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day. day or more in particular erdafitinib at a dose of approximately 6 mg per day, to the patient if one or more FGFR gene alterations are present in the sample. Also described herein are methods for treating CVSIM-RI that cnRRnn / zznz / E / YiAi comprise (a) evaluating a biological sample from a patient diagnosed with CVSIMRI for the presence of one or more gene alterations of FGFR, in particular one or more alterations of FGFR2 or FGFR3; and (b) administering an FGFR inhibitor, in particular at a dose of about 8 mg per day or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of about 8 mg per day. day or more in particular erdafitinib at a dose of approximately 6 mg per day, to the patient if one or more FGFR gene alterations are present in the sample. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day or in particular at a dose of about 6 mg per day, in particular erdafitinib, more in particular erdafitinib at a dose of approximately 8 mg per day or more in particular erdafitinib at a dose of approximately 6 mg per day, for the manufacture of a medicinal product for the treatment of a patient diagnosed with CVSIM-RA harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, and where the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more gene alterations of FGFR2 or FGFR3 and if one or more genetic alterations of FGFR2 or FGFR3 are present in the sample. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RA who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or 3 gene alterations. In one embodiment, the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of about 6 mg per day. Described herein is the use of an FGFR inhibitor, in particular at a dose of about 8 mg per day or in particular at a dose of about 6 mg per day, in particular erdafitinib, more particularly erdafitinib at a dose of approximately 8 mg per day or more in particular erdafitinib at a dose of approximately 6 mg per day, for the manufacture of a medicinal product for the treatment of a patient diagnosed with CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, and where the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more gene alterations of FGFR2 or FGFR3 and if one or more genetic alterations of FGFR2 or cnRRnn / zznz / E / YiAi are present in the sample FGFR3. Described herein is the use of an FGFR inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with CVSIM-RI harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. , in particular where the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or 3 gene alterations. In one embodiment, the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of about 6 mg per day. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or 3 gene alterations. In one embodiment, the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of about 6 mg per day. Described herein is an FGFR inhibitor for use in the treatment of a patient diagnosed with CVSIM-RI harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, in particular where the inhibitor of FGFR, in particular erdafitinib, is or will be administered at a dose of approximately 8 mg per day; and wherein the FGFR inhibitor, in particular erdafitinib, is or will be administered after evaluation of a biological sample from the patient for the presence of one or more FGFR2 or 3 gene alterations and whether one or more FGFR2 or 3 gene alterations are present in the sample FGFR2 or 3 gene alterations. In one embodiment, the FGFR inhibitor, in particular erdafitinib, is or will be administered at a dose of about 6 mg per day. The following methods for evaluating a biological sample for the presence of one or more FGFR genetic alterations apply equally to any of the treatment methods and uses disclosed above. The disclosed methods are suitable for treating cancer in a patient if one or more FGFR genetic alterations are present in a biological sample from the patient. In some embodiments, the FGFR genetic alteration may be one or more FGFR fusion genes, in particular one or more FGFR2 or FGFR3 fusion genes. In some embodiments, the FGFR genetic cnRRnn / zznz / E / YiAi alteration may be one or more FGFR mutations, particularly one or more FGFR3 mutations. In some embodiments, the FGFR genetic alteration may be one or more FGFR amplifications. In some embodiments, a combination of the one or more FGFR genetic alterations may be present in the patient's biological sample. For example, in some embodiments, the FGFR genetic alterations may be one or more FGFR fusion genes and one or more FGFR mutations. In some embodiments, the FGFR genetic alterations may be one or more FGFR fusion genes and one or more FGFR amplifications. In some embodiments, the FGFR genetic alterations may be one or more FGFR mutations and one or more FGFR amplifications. In still other embodiments, the FGFR genetic alterations may be one or more FGFR fusions, mutations, and amplifications genes. Exemplary FGFR fusion genes are provided in Table 1 and include, but are not limited to: FGFR2-BICC1; FGFR2CASP7; FGFR3-BAIAP2L1; FGFR3-TACC3 VI; FGFR3-TACC3 V3; or a combination of these. Suitable methods for evaluating a biological sample for the presence of one or more FGFR genetic alterations are described in the methods section herein and in WO 2016 / 048833 and US patent application no. Serial No. 16 / 723 975, which are incorporated herein in their entirety. For example, and not intended to be limiting, evaluation of a biological sample for the presence of one or more FGFR genetic alterations may comprise any combination of the following steps: isolating RNA from the biological sample; synthesize cDNA from RNA; and amplify the cDNA (preamplified or non-preamplified). In some embodiments, evaluating a biological sample for the presence of one or more FGFR genetic alterations may comprise: amplifying cDNA from the patient with a pair of primers that bind to and amplify one or more FGFR genetic alterations; and determine whether the one or more FGFR genetic alterations are present in the sample. In some aspects, the cDNA can be preamplified. In some aspects, the evaluation step may comprise isolating RNA from the sample, synthesizing cDNA from the isolated RNA, and preamplifying the cDNA. Primer pairs suitable for performing an amplification step include, among others, those disclosed in WO 2016 / 048833, as exemplified below in Table 3: cnRAnn / zznz / B / YiAi Table 3 Target Forward primer Reverse primer 5'-3' FGFR3-TACC3 VI GACCTGGACCGTGTCCTTACC (SEQ ID NO:5) CTTCCCCAGTTCCAGG1 1L1 1 (SEQ ID NO:6) FGFR3-TACC3 V3 AGGACCTGGACCGTGTCCTT (SEQ ID NO:7) TATAGGTCCGGTGGACAGGG (SEQ ID NO: 8) Target Forward primer Reverse primer 5'-3' FGFR3-BAIAP2L1 CTGGACCGTGTCCTTACCGT (SEQ ID NO:9) GCAGCCCAGGATTGAACTGT (SEQ ID NO: 10) FGFR2-BICC1 TGGATCGAATTCTCACTCTCACA (SEQ ID NO:11) GCCAAGCAATCTGCGTATTTG (SEQ ID NO: 12) FGFR2- CASP7 GCTCTTCAATACAGCCCTGATCA (SEQ ID NO:13) ACTTGGATCGAATTCTCACTCTCA (SEQ ID NO: 14) FGFR2-CCDC6 TGGATCGAATTCTCACTCTCACA (SEQ ID NO:15) GCAAAGCCTGAAI 11ILIIGAAIAA (SEQ ID NO: 16) FGFR3 R248C GCATCCGGCAGACGTACA (SEQ ID NO:1 7) CCCCGCCTGCAGGAT (SEQ ID NO: 18) FGFR3 S249C GCATCCGGCAGACGTACA (SEQ ID NO:19) CCCCGCCTGCAGGAT (SEQ ID NO:20) FGFR3 G370C AGGAGCTGGTGGAGGCTGA (SEQ ID NO:21) CCGTAGCTGAGGATGCCTG (SEQ ID NO:22) FGFR3 Y373C CTGGTGGAGGCTGACGAG (SEQ ID NO:23) ) AGCCCACCCCGTAGCT (SEQ ID NO:24) FGFR3 R248C GTCGTGGAGAACAAGTTTGGC (SEQ ID NO:25) GTCTGGTTGGCCGGCAG (SEQ ID NO:26) FGFR3 S249C GTCGTGGAGAACAAGTTTGGC (SEQ ID NO:27) GTCTGGTTGGCCGGCAG (SEQ ID NO:28) FGFR3 G370C AGGAGCTGG TGGAGGCTGA (SEQ ID NO:29) CCGTAGCTGAGGATGCCTG (SEQ ID NO:30) FGFR3 Y373C GACGAGGCGGGCAGTG (SEQ ID NO:31) GAAGAAGCCCACCCCGTAG (SEQ ID NO:32) The presence of one or more FGFR genetic alterations can be assessed at any appropriate time point including after diagnosis, after tumor resection, after first-line therapy, during clinical treatment, or any combination of these. For example, a biological sample taken from a patient can be analyzed to determine whether a condition or disease, such as cancer, that the patient suffers from or may suffer from is one that is characterized by a genetic abnormality or abnormal protein expression that leads to increased regulation of FGFR levels or activity or sensitization of a pathway to normal FGFR activity, or regulated upregulation of these growth factor signaling pathways such as levels of ligands that are growth factors or activity of ligands which are growth factors or an upregulated biochemical pathway downstream of FGFR activation. Examples of such abnormalities resulting in FGFR signal activation or sensitization include loss of or inhibition of apoptotic pathways, up-regulation of receptors or ligands, or presence of genetic alterations of receptors or ligands, e.g. PTK variants. Tumors with genetic alterations of FGFR1, FGFR2 or FGFR3 or FGFR4 or up-regulated, in particular, overexpression of FGFR1, or gain-of-function genetic alterations of FGFR2 or FGFR3 may be particularly sensitive to FGFR inhibitors. The methods, approved drug products and uses may further comprise evaluating the presence of one or more FGFR genetic alterations in the biological sample prior to the administration step. Screenings and diagnostic tests are normally performed on a biological sample selected from tumor biopsy samples, blood samples (isolation and enrichment of shed tumor cells), stool biopsies, sputum, chromosome analysis, pleural fluid, peritoneal fluid, jugal smears, biopsy, circulating DNA or urine. In certain embodiments, the biological sample is blood, lymph fluid, bone marrow, a solid tumor sample, or any combination of these. In certain embodiments, the biological sample is a solid tumor sample. In certain embodiments, the biological sample is a blood sample. In certain embodiments, the biological sample is a urine sample. The person skilled in the art knows methods of identification and analysis of genetic alterations and regulated increase of proteins. Selection methods could include, but are not limited to, standard methods such as reverse transcription polymerase chain reaction (RT-PCR) or in situ hybridization such as fluorescence in situ hybridization (FISH). The identification of an individual who carries a genetic alteration in FGFR, in particular, a genetic alteration of FGFR as described herein, may mean that the patient would be particularly suitable for treatment with erdafitinib. Tumors can be preferentially selected based on the presence of an FGFR variant before treatment. The selection process will typically involve direct sequencing, oligonucleotide microarray analysis, or a mutant-specific antibody. Furthermore, diagnosis of the tumor with such a genetic alteration could be made using techniques known to one skilled in the art and as described herein, such as RT-PCR and FISH. Furthermore, genetic alterations of, for example, FGFR, can be identified by direct sequencing of, for example, tumor biopsies using PCR and methods to sequence PCR products directly as described hereinabove. The skilled person will recognize that all of these techniques well known for the detection of overexpression, activation or mutations of the proteins mentioned above could be applicable in the present case cnRRnn / zznz / E / YiAi. In RT-PCR screening, the level of mRNA in the tumor is assessed by creating a cDNA copy of the mRNA followed by amplification of the cDNA by PCR. Those skilled in the art know PCR amplification methods, the selection of primers and conditions for amplification. Nucleic acid manipulations and PCR are carried out by standard methods, as described, for example, in Ausubel, F.M. et al., eds. (2004) Current Protocols in Molecular Biology, John Wiley & Sons Inc., or Innis, M.A. et al., eds. (1990) PCR Protocols: a guide to methods and applications, Academic Press, San Diego. Reactions and manipulations involving nucleic acid techniques are also described in Sambrook et al., (2001), 3rd ed., Molecular Cloning: A Laboratory Manual, Coid Spring Harbor Laboratory Press. Alternatively, a commercially available kit for RT-PCR (e.g., Roche Molecular Biochemicals) or a methodology such as that set forth in US Patents 4,666,828 may be used; 4 683 202; 4 801 531; 5,192,659, 5,272,057, 5,882,864 and 6,218,529 and incorporated herein by reference. An example of an in situ hybridization technique for assessing mRNA expression would be fluorescence hybridization in s / Zz / (FISH) (see Angerer (1987) Meth. EnzymoL, 152: 649). In general, in situ hybridization involves the following main steps: (1) fixation of the tissue to be analyzed; (2) pre-hybridization treatment of the sample to increase the accessibility of the target nucleic acid and to reduce non-specific binding; (3) hybridization of the nucleic acid mixture with the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove nucleic acid fragments not bound in the hybridization and (5) detection of the hybridized nucleic acid fragments. Probes used in these applications are typically labeled, for example, with radioisotopes or fluorescent indicators. Preferred probes are long enough, for example, from about 50, 100 or 200 nucleotides to about 1000 or more nucleotides, to allow specific hybridization with the target nucleic acid or acids under stringent conditions. Standard methods for carrying out FISH are described in Ausubel, F.M. et al., eds. (2004) Current Protocols in Molecular Biology, John Wiley & Sons Inc and Fluorescence In Situ Hybridization: Technical OverView by John M. S. Bartlett in Molecular Diagnosis of Cancer, Methods and Protocols, 2nd ed.; ISBN: 1-59259-760-2; March 2004, pp. 077-088; Series: Methods in Molecular Medicine. Methods for obtaining gene expression profiles are described in (DePrimo et al. (2003), BMC Cancer, 3:3). Briefly, the protocol is as follows: double-stranded cDNA is synthesized from total RNA using a (dT)24 oligomer (SEQ ID NO: 38: tttttttttt tttttttttt tttt) to prime first-strand cDNA synthesis, followed by Second-strand cDNA synthesis with random hexamer primers. The double-stranded cDNA is used as a template for in vitro transcription of cRNA using biotinylated ribonucleotides. The cRNA was chemically cleaved according to protocols described by Affymetrix (Santa Clara, CA, USA), and then hybridized overnight onto human genome arrays. Alternatively, protein products expressed from mRNAs can be assayed by immunohistochemical studies of tumor samples, solid-phase immunoassay with microtiter plates, immunoelectroblotting, two-dimensional SDS-polyacrylamide gel electrophoresis, ELISA, flow cytometry. and other methods known in the art for the detection of specific proteins. Detection methods would include the use of site-specific antibodies. The skilled person will recognize that all of these well-known techniques for the detection of FGFR up-regulation or detection of FGFR variants or mutants could be applicable in the present case. Abnormal levels of proteins such as FGFR can be measured using standard enzymatic assays, for example, the assays described herein. Activation or overexpression could also be detected in a tissue sample, for example, tumor tissue. Measuring tyrosine-kinase activity with an assay such as that from Chemicon International. The tyrosine kinase of interest would be immunoprecipitated from the lysate of the samples and its activity would be measured. Alternative methods for measuring FGFR overexpression or activation including forms thereof include measurement of microvessel density. This can be measured, for example, using the methods described in Orre and Rogers (Int J Cancer (1999), 84(2) 101-8). Testing methods also include the use of markers. Therefore, all of these techniques could also be used to identify tumors particularly suitable for treatment with the compounds of the invention. Erdafitinib is, in particular, useful in the treatment of a patient who has a genetically altered FGFR, in particular, a mutated FGFR. In certain embodiments, CVSIM-RA or CVSIM-RI is susceptible to a genetic alteration of FGFR2 and / or a genetic alteration of FGFR3. In certain embodiments, the genetic alteration of FGFR2 or FGFR3 is an FGFR3 gene mutation or an FGFR2 or FGFR3 gene fusion. In some embodiments, the FGFR3 gene mutation is R248C, S249C, G370C, Y373C, or any combination thereof. In further embodiments, the FGFR2 or FGFR3 gene fusion is FGFR3-TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination thereof. In embodiments, genetic alterations of FGFR2 and / or FGFR3 can be identified using commercially available kits including, but not limited to, a therascreen® FGFR RGQ RT-PCR kit from QIAGEN. Pharmaceutical compositions and routes of administration In view of its useful pharmacological properties, FGFR inhibitor, in general, and erdafitinib more specifically, can be formulated into various dosage forms for administration purposes. In one embodiment the pharmaceutical composition (e.g., formulation) comprises at least one active compound of the invention together with one or more well-known carriers, adjuvants, excipients, diluents, fillers, buffers, stabilizers, preservatives, lubricants or other pharmaceutically acceptable materials. by those skilled in the art and optionally other therapeutic and prophylactic agents. To prepare the pharmaceutical compositions, an effective amount of the FGFR inhibitor, in general, and erdafitinib more specifically, is combined as an active ingredient in intimate admixture with a pharmaceutically acceptable carrier, which carrier can take a wide variety of forms depending on the form of Desired preparation for administration. The pharmaceutical compositions may be in any form suitable for oral, parenteral, topical, intranasal, ophthalmic, otic, rectal, intravaginal or transdermal administration. It is desirable that these pharmaceutical compositions be in a unit dosage form suitable, preferably, for administration orally, rectally, percutaneously or by parenteral injection. For example, in preparing the compositions in an oral dosage form, any of the usual pharmaceutical media can be used such as, for example, water, glycols, oils, alcohols and the like in the case of oral liquid preparations such as suspensions, syrups, elixirs and solutions; or solid carriers such as starches, sugars, kaolin, lubricants, binders, disintegrating agents and the like in the case of powders, pills, capsules and tablets. The pharmaceutical compositions of the invention, in particular, capsules and / or tablets, may include one or more pharmaceutically acceptable excipients (pharmaceutically acceptable carrier) such as disintegrants, diluents, fillers, binders, buffering agents, lubricants, glidants, thickening agents, agents. sweeteners, flavors, colorings, preservatives and the like. Some excipients can perform several functions. Suitable disintegrants are those that have a large expansion coefficient. Examples of these are hydrophilic cross-linked polymers, insoluble or poorly soluble in water such as crospovidone (cross-linked polyvinylpyrrolidone) and croscarmellose sodium (cross-linked sodium carboxymethylcellulose). The amount of disintegrant in the tablets according to the present invention may conveniently range between about 2.5 and about 15% w / w and preferably range between about 2.5 and 7% w / w, in particular, range between about 2.5 and 5% w / w. Because disintegrants by their nature produce sustained release formulations when used in bulk, it is advantageous to dilute them in an inert substance called diluent or filler. Various materials can be used as a diluent or filler. Examples are lactose monohydrate, lactose anhydrous, sucrose, dextrose, mannitol, sorbitol, starch, cellulose (e.g., microcrystalline cellulose (Avicel™), silified microcrystalline cellulose), dibasic calcium phosphate dihydrate or anhydrous, and others known in the art. , and mixtures of these (for example, spray dried mixture of lactose monohydrate (75%) with microcrystalline cellulose (25%) marketed as Microcelac™). Microcrystalline cellulose and mannitol are preferred. The total amount of diluent or filler in the pharmaceutical compositions of the present invention may conveniently range from about 20% to about 95% w / w and preferably ranges from about 55% to about 95% w / w, or between about 70% and approximately 95% w / w, or between approximately 80% and approximately 95% w / w, or between approximately 85% and approximately 95%. Lubricants and fluidizers can be used in the manufacture of certain dosage forms and will usually be used in the production of tablets. Examples of lubricants and slippers are hydrogenated vegetable oils, for example, hydrogenated cottonseed oil, magnesium stearate, stearic acid, sodium lauryl sulfate, magnesium lauryl sulfate, colloidal silica, colloidal anhydrous silica talc, mixtures of these and others known in the art. Magnesium stearate and mixtures of magnesium stearate with colloidal silica are interesting lubricants, with magnesium stearate being preferred. Colloidal anhydrous silica is a preferred slider. If present, the glidants comprise, in general, from 0.2 to 7.0% w / w of the total weight of the composition, in particular, from 0.5 to 1.5% w / w, more particularly, from 1 to 1.5% w / w . If present, lubricants generally comprise 0.2 to 7.0% w / w of the total weight of the composition, in particular, 0.2 to 2% w / w, or 0.5 to 2% w / w, or 0.5 to 1.75% w / w, or 0.5 to 1.5% w / w. Binders may optionally be employed in the pharmaceutical compositions of the present invention. Suitable binders are water-soluble polymers, such as alkylcelluloses such as methylcellulose; hydroxyalkylcelluloses such as hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose and hydroxybutylcellulose; hydroxyalkylalkylcelluloses such as hydroxyethylmethylcellulose and hydroxypropylmethylcellulose; carboxyalkylcelluloses such as carboxymethylcellulose; alkali metal salts of carboxyalkylcelluloses such as sodium carboxymethylcellulose; carboxyalkylalkylcelluloses such as carboxymethylethylcellulose; carboxyalkylcellulose esters; starches; pectins such as sodium carboxymethylamylopectin; chitin derivatives such as chitosan; di-, oligo- and polysaccharides such as trehalose, cyclodextrins and derivatives thereof, alginic acid, ammonium and alkali metal salts thereof, carrageenans, galactomannans, tragacanth, agar agar, gum arabic, guar gum and xanthan gum; polyacrylic acids and their salts; poly(methacrylic acids), the salts and esters thereof, methacrylate copolymers; polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA) and copolymers thereof, for example, PVP-VA. Preferably, the water-soluble polymer is a hydroxyalkylalkylcellulose, such as, for example, hydroxypropylmethylcellulose, for example, hydroxypropylmethylcellulose 15 cps. Other excipients such as coloring agents and pigments may also be added to the compositions of the invention. Coloring agents and pigments include titanium dioxide and food-grade dyes. A coloring agent or pigment is an optional ingredient in the formulation of the invention, but when used the coloring agent may be present in an amount of up to 3.5% w / w based on the total weight of the composition. Flavors are optional in the composition and can be chosen from synthetic flavor oils and natural or aromatic flavoring oils, extracts of leaves, flowers, fruits of plants and so on and combinations of these. These may include cinnamon oil, wintergreen oil, peppermint oils, bay oil, anise oil, eucalyptus, thyme oil. Also useful as flavors are vanilla, citrus oil, including lemon, orange, grape, lime and grapefruit, and fruit essences, including apple, banana, pear, peach, strawberry , raspberry, cherry, plum, pineapple, apricot and so on. The amount of flavor may depend on several factors, including the desired organoleptic effect. Generally, the flavor will be present in an amount between about 0% and about 3% (w / w). Formaldehyde scavengers are compounds that are capable of absorbing formaldehyde. They include compounds comprising a nitrogen center that is reactive with formaldehyde, such that one or more reversible or irreversible bonds are formed between the formaldehyde scavenger and the formaldehyde. For example, the formaldehyde scavenger comprises one or more nitrogen atoms / centers that are reactive with formaldehyde to form a Schiff base amine that is capable of subsequently binding with formaldehyde. For example, the formaldehyde scavenger comprises one or more nitrogen centers that react with formaldehyde to form one or more 5-8 membered cyclic rings. The formaldehyde scavenger preferably comprises one or more amine or amide groups. For example, the formaldehyde scavenger may be an amino acid, an amino sugar, an alpha-amine compound, or a conjugate or derivative thereof, or a mixture thereof. The formaldehyde scavenger may comprise two or more amines and / or amides. Formaldehyde scavengers include, for example, glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, phenylalanine, tyrosine, aspartic acid, glutamic acid, arginine, lysine, ornithine, citrulline, taurine, pyrrolysine, meglumine , histidine, aspartame, proline, tryptophan, citrulline, pyrrolysine, asparagine, glutamine, or a conjugate or mixture of these; or, where possible, pharmaceutically acceptable salts thereof. In one aspect of the invention, the formaldehyde scavenger is meglumine or a pharmaceutically acceptable salt thereof, in particular meglumine base. In one embodiment, in the methods and uses as described herein, erdafitinib is or will be administered as a pharmaceutical composition, in particular, a tablet or a capsule, comprising erdafitinib or a pharmaceutically acceptable salt thereof, in in particular, erdafitinib base; a formaldehyde scavenger, in particular meglumine or a pharmaceutically acceptable salt thereof, in particular meglumine base; and a pharmaceutically acceptable carrier. Another object of the invention is to provide a process of preparing a pharmaceutical composition as described herein, in particular, in the form of a tablet or a capsule, characterized by combining a formaldehyde scavenger, in particular, meglumine, and erdafitinib, a pharmaceutically acceptable salt thereof or a solvate thereof, in particular, erdafitinib base, with a pharmaceutically acceptable carrier and compressing said combination to obtain tablets or filling said combination into capsules. Due to their ease of administration, tablets and capsules represent the most convenient oral unit dosage form, in which case solid pharmaceutical carriers are obviously used. For parenteral compositions, the carrier will typically comprise sterile water, at least in large part, although it may include other ingredients, for example, to promote solubility. Injectable solutions may be prepared, for example, in which the carrier comprises saline, glucose solution or a mixture of saline and glucose. Injectable suspensions can also be prepared, in which case suitable liquid carriers, suspending agents and the like can be used. In compositions suitable for percutaneous administration, the carrier optionally comprises a penetration enhancing agent and / or a suitable wetting agent, optionally combined with suitable additives of any nature in minor proportions, where the additives do not cause any significant detrimental effect on the fur. Such additives may facilitate administration to the skin and / or may be useful in preparing the desired compositions. These compositions can be administered in various ways, for example, as a transdermal patch, as a spot administration, as an ointment. It is especially convenient to formulate the above-mentioned pharmaceutical compositions in unit dosage forms due to their ease of administration and uniformity of dosage. The term unit dosage form, as used in the specification and claims herein, refers to physically discrete units suitable as unit dosages, where each unit contains a predetermined amount of active ingredient, calculated to produce the effect. desired therapeutic, associated with the required pharmaceutical carrier. Examples of such unit dosage forms are tablets (including scored or coated tablets), capsules, lozenges, powder packets, wafers, injectable solutions or suspensions, teaspoons, tablespoons. and the like, as well as segregated multiples of these. It is especially convenient to formulate the above-mentioned pharmaceutical compositions in unit dosage forms due to their ease of administration and uniformity of dosage. Unit dosage form, as used herein, refers to physically discrete units suitable as unit dosages, each unit containing a predetermined amount of the active ingredient, calculated to produce the desired therapeutic effect, which is associated with the pharmaceutical carrier. required. Examples of such unit dosage forms are tablets (including scored or coated tablets), capsules, lozenges, powder packets, wafers, injectable solutions or suspensions, teaspoons, tablespoons and the like, as well as multiples. segregated from these. Tablets and capsules are preferred forms. In certain embodiments, the FGFR inhibitor is present in a solid unit dosage form, and a solid unit dosage form for oral administration. The unit dosage form may contain about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 mg of the FGFR inhibitor per unit dosage form or an amount in a range limited by two of these values, in particular 3, 4 or 5 mg per unit dose. Depending on the mode of administration, the pharmaceutical composition will preferably comprise from 0.05 to 99% by weight, more preferably from 0.1 to 70% by weight, even more preferably from 0.1 to 50% by weight of the compound of the present invention, and from 1 to 50% by weight. 99.95% by weight, more preferably 30 to 99.9% by weight, even more preferably 50 to 99.9% by weight of a pharmaceutically acceptable carrier, all percentages being based on the total weight of the composition. The tablets or capsules of the present invention may further be coated with a film, for example, to improve taste, to facilitate swallowing and to give an elegant appearance. Polymeric film type coating materials are known in the art. Preferred film-type coatings are water-based film-type coatings over solvent-based film-type coatings because the latter may contain more traces of aldehydes. A preferred film coating material is the Opadry® II aqueous film coating system, for example, Opadry® II85F, such as Opadry® II 85F92209. Additional preferred film-type coatings are water-based film-type coatings that protect from ambient moisture, such as Readilycoat® (e.g., Readilycoat® D), AquaPolish® MS, Opadry® amb, Opadry® amb II, which are aqueous film-type coating systems that act as a barrier against moisture. A preferred film coating is Opadry® amb II, a high-performance moisture barrier film coating that is a PVA-based, polyethylene glycol-free, immediate release system. In the tablets according to the invention, the film-like coating in terms of weight preferably represents approximately 4% (w / w) or less of the total weight of the tablet. For capsules according to the present invention, hypromellose (HPMC) capsules are preferred over gelatin capsules. In one aspect of the invention, the pharmaceutical compositions described herein, in particular, in the form of a capsule or a tablet, comprise from 0.5 mg to 20 mg of equivalent of base, or from 2 mg to 20 mg of equivalent of base, or from 0.5 mg to 12 mg base equivalent, or from 2 mg to 12 mg base equivalent, or from 2 mg to 10 mg base equivalent, or from 2 mg to 6 mg base equivalent, or 2 mg base equivalent, 3 mg base equivalent, 4 mg base equivalent, 5 mg base equivalent, 6 mg base equivalent, 7 mg base equivalent, 8 mg base equivalent, 9 mg base equivalent, 10 mg base equivalent, 11 mg base equivalent or 12 mg base equivalent of erdafitinib, a pharmaceutically acceptable salt thereof or a solvate thereof. In particular, the pharmaceutical compositions described herein comprise 3 mg base equivalent, 4 mg base equivalent or 5 mg base equivalent of erdafitinib, a pharmaceutically acceptable salt thereof or a solvate thereof, in particular, 3 mg or 4 mg or 5 mg of erdafitinib base. In one aspect of the invention, the pharmaceutical compositions described herein, in particular, in the form of a capsule or a tablet, comprise from 0.5 mg to 20 mg, or from 2 mg to 20 mg, or from 0.5 mg to 12 mg, or from 2 mg to 12 mg, or from 2 mg to 10 mg, or from 2 mg to 6 mg, or 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg , 10 mg, 11 mg, or 12 mg of erdafitinib base. In particular, the pharmaceutical compositions described herein comprise 3 mg, 4 mg or 5 mg of erdafitinib base. In particular, the pharmaceutical compositions described herein comprise 3 mg, 4 mg or 5 mg of erdafitinib base and from about 0.5 to about 5% w / w, from about 0.5 to about 3% w / w , from about 0.5 to about 2% w / w, from about 0.5 to about 1.5% w / w, or from about 0.5 to about 1% w / w of a formaldehyde scavenger, in particular, meglumine . In particular, the pharmaceutical compositions described herein comprise 3 mg, 4 mg or 5 mg of erdafitinib base and from about 0.5 to about 1.5% w / w or from about 0.5 to about 1% w / w of a formaldehyde scavenger, in particular meglumine. In one aspect of the invention, more than one, for example, two, pharmaceutical cnRRnn / zznz / E / YiAi compositions described herein may be administered in order to obtain a desired dose, for example, a daily dose. For example, for a daily dose of 8 mg erdafitinib base equivalent, 2 tablets or capsules of 4 mg erdafitinib base equivalent each may be administered; or one tablet or capsule of 3 mg base equivalent of erdafitinib and one tablet or capsule of 5 mg base equivalent may be administered. For example, for a daily dose of 9 mg erdafitinib base equivalent, 3 tablets or capsules of 3 mg erdafitinib base equivalent each may be administered; or one tablet or capsule of 4 mg base equivalent of erdafitinib and one tablet or capsule of 5 mg base equivalent may be administered. For example, for a daily dose of 6 mg erdafitinib base equivalent, 2 tablets or capsules of 3 mg erdafitinib base equivalent each may be administered. The amount of formaldehyde scavenger, in particular meglumine, in the pharmaceutical compositions according to the present invention can range from about 0.1 to about 10% w / w, from about 0.1 to about 5% w / w, from about 0.1 and approximately 3% w / w, between approximately 0.1 and approximately 2% w / w, between approximately 0.1 and approximately 1.5% w / w, between approximately 0.1 and approximately 1% w / w, between approximately 0.5 and approximately 5% w / w, between approximately 0.5 and approximately 3% w / w, between approximately 0.5 and approximately 2% w / w, between approximately 0.5 and approximately 1.5% w / w , between approximately 0.5 and approximately 1% w / w. According to particular embodiments, erdafitinib is supplied as 3 mg, 4 mg or 5 mg film-coated tablets for oral administration and contain the following inactive ingredients or equivalents thereof: Tablet core: croscarmellose sodium, magnesium stearate, mannitol, meglumine and microcrystalline cellulose; and film coating: Opadry amb II: Glycerol monocaprylocaprate type I, partially hydrolyzed polyvinyl alcohol, sodium lauryl sulfate, talc, titanium dioxide, yellow iron oxide, red iron oxide (for orange and brown tablets), ferrosoferric oxide / black iron oxide (for brown tablets). Studies examining safety seek to identify any possible adverse effects that may result from exposure to the drug. Efficacy is often measured by determining whether an active pharmaceutical ingredient demonstrates a health benefit over a placebo or other intervention when studied in an appropriate setting, such as a closely controlled clinical trial. The term acceptable with respect to a formulation, composition or ingredient, as used herein, means that the beneficial effects of that formulation, composition or ingredient on the general health of the human being being treated substantially outweigh its harmful effects, to the extent that any exist. All formulations for oral administration are in a dosage form suitable for such administration. Dosage Methods and Treatment Regimens In one aspect, described herein are methods of treating CVSIMRA or CVSIM-RI that comprise, consist of, or essentially consist of administering a therapeutically effective amount of an FGFR inhibitor to a patient diagnosed with CVSIMRA or CVSIM-RI. IR, where the FGFR inhibitor is administered orally. In some embodiments, the FGFR inhibitor, generally, and erdafitinib specifically, is administered daily, in particular, once a day. In some embodiments, the FGFR inhibitor generally and erdafitinib specifically are administered twice daily. In some embodiments, the FGFR inhibitor generally and erdafitinib specifically are administered three times daily. In some embodiments, the FGFR inhibitor generally and erdafitinib specifically are administered four times daily. In some embodiments, the FGFR inhibitor generally and erdafitinib specifically are administered every other day. In some embodiments, the FGFR inhibitor generally and erdafitinib specifically are administered weekly. In some embodiments, the FGFR inhibitor generally and erdafitinib specifically are administered twice weekly. In some embodiments, the FGFR inhibitor generally and erdafitinib specifically are administered every two weeks. In some embodiments, the FGFR inhibitor, generally, and erdafitinib specifically, is administered orally on a continuous daily dosing schedule. In general, doses of the FGFR inhibitor, and erdafitinib specifically, used for the treatment of the diseases or conditions described herein in humans are typically in the range of about 1 to 20 mg per day. In some embodiments, the FGFR inhibitor, and erdafitinib specifically, is administered orally to the human at a dose of about 1 mg per day, about 2 mg per day, about 3 mg per day, about 4 mg per day, about 5 mg per day, approximately 6 mg per day, approximately 7 mg per day, approximately 8 mg per day, approximately 9 mg per day, approximately 10 mg per day, approximately 11 mg per day, approximately 12 mg per day, approximately 13 mg per day, approximately 14 mg per day, approximately 15 mg per day, approximately 16 mg per day, approximately 17 mg per day, approximately 18 mg per day, approximately 19 mg per day or approximately 20 mg per day. In some embodiments, erdafitinib is administered orally. In certain embodiments, erdafitinib is administered orally at a dose of about 8 mg once daily. In additional embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily. In further embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 14 to 21 days after initiation of treatment if: (a) the patient has a serum phosphate level ( PCh) which is less than approximately 5.5 mg / dL at 14-21 days after the start of treatment and administration of 8 mg of erdafitinib once daily did not result in ocular disorder; or (b) administration of erdafitinib 8 mg once daily did not result in a grade 2 or higher adverse reaction. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 14 days after initiation of treatment. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 15 days after initiation of treatment. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 16 days after initiation of treatment. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 17 days after initiation of treatment. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 18 days after initiation of treatment. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 19 days after initiation of treatment. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 20 days after initiation of treatment. In certain embodiments, the dose of erdafitinib is increased from 8 mg once daily to 9 mg once daily at 21 days after initiation of treatment. In one embodiment, erdafitinib is administered at a dose of 8 mg, in particular, 8 mg once a day. In one embodiment, erdafitinib is administered at a dose of 8 mg, in particular, 8 mg once daily, with an option of increasing the dose up to 9 mg depending on serum phosphate levels (for example, phosphate levels serum are <5.5 mg / dL, or are <7 mg / dL or range between 7 mg / dL and <9 mg / dL, inclusive, or are <9 mg / dL), and depending on the observed adverse events related to the treatment. In one embodiment, serum phosphate levels are measured to determine whether or not dose escalation is performed on a day of treatment during the first cycle of treatment with erdafitinib, in particular, on day 14 ± 2 days, plus in particular, on day 14 of erdafitinib administration. In one embodiment, erdafitinib is administered at a dose of 6 mg, in particular 6 mg once a day, in particular on a continuous schedule. In one embodiment, erdafitinib is administered at a dose of 6 mg, in particular, 6 mg once a day. In one embodiment, erdafitinib is administered at a dose of 6 mg, in particular, 6 mg once daily, with an option of increasing the dose up to 8 mg depending on serum phosphate levels (for example, phosphate levels serum are <5.5 mg / dL), and depending on the observed adverse events related to the treatment. In one embodiment, serum phosphate cnRRnn / zznz / E / YiAi levels are measured to determine whether or not dose escalation is performed on a day of treatment at the end of the treatment period of cycle 1, in particular in the day 1 of cycle 2 (C2D1) ± 7 days or on day 1 of cycle 2 (C2D1) ± 3 days, more particularly in C2D1, of erdafitinib administration. In certain embodiments, the dose of erdafitinib is increased from 6 mg once daily to 8 mg once daily at the end of the cycle 1 treatment period, particularly on day 1 of cycle 2 (C2D1) ± 7 days or the day 1 of cycle 2 (C2D1) ± 3 days, more particularly in C2D1. In some embodiments, erdafitinib is administered orally. In certain embodiments, erdafitinib is administered orally at a dose of about 6 mg once daily. In additional embodiments, the dose of erdafitinib is increased from 6 mg once daily to 8 mg once daily. In still other embodiments, the dose of erdafitinib is increased from 6 mg once daily to 8 mg once daily at the end of the treatment period of cycle 1, in particular on day 1 of cycle 2 (C2D1) ± 7 days or on day 1 of cycle 2 (C2D1) ± 3 days, more particularly on C2D1, after initiating treatment if: (a) the patient has a serum phosphate (PO4) level that is less than approximately 5.5 mg / dL at end of the treatment period of cycle 1, in particular on day 1 of cycle 2 (C2D1) ± 7 days or on day 1 of cycle 2 (C2D1) ± 3 days, more particularly in C2D1, after starting treatment and administration of 6 mg erdafitinib once daily did not result in significant toxicity, for example, no ocular disorder; or (b) administration of erdafitinib 6 mg once daily did not result in a grade 2 or higher adverse reaction. In some embodiments, erdafitinib is administered orally. In certain embodiments, erdafitinib is administered orally at a dose of about 6 mg once daily. In other embodiments, erdafitinib continues to be administered orally at a dose of approximately 6 mg once daily at the end of the cycle 1 treatment period, particularly on day 1 of cycle 2 (C2D1) ± 7 days or day 1 of cycle 2 (C2D1) ± 3 days, more particularly in C2D1, after starting treatment if: (a) the patient has a serum phosphate (PO4) level of 5.5 mg / dL to 6.99 mg / dL at the end of the treatment period of cycle 1, in particular on day 1 of cycle 2 (C2D1) ± 7 days or on day 1 of cycle 2 (C2D1) ± 3 days, more particularly in C2D1, after starting treatment and Administration of 6 mg erdafitinib once daily did not result in significant toxicity, for example, no ocular disorder; or (b) administration of erdafitinib 6 mg once daily did not result in a grade 2 or higher adverse reaction. In one embodiment, phosphate intake is restricted to 600-800 mg / day. In some embodiments, erdafitinib is administered orally. In certain embodiments, erdafitinib is administered orally at a dose of about 6 mg once daily. In other embodiments, erdafitinib continues to be administered orally at a dose of approximately 6 mg once daily at the end of the cycle 1 treatment period, particularly on day 1 of cycle 2 (C2D1) ± 7 days or day 1 of cycle 2 (C2D1) ± 3 days, more particularly in C2D1, after starting treatment if: (a) the patient has a serum phosphate level (PO4) > 7 mg / dL at the end of the cycle treatment period 1, in particular on day 1 of cycle 2 (C2D1) ± 7 days or on day 1 of cycle 2 (C2D1) ± 3 days, more particularly in C2D1, after starting treatment, or (b) the presence of other toxicity; and the management of serum phosphate (PCF) toxicity in Table 7 is applied. Table 7: Guidelines for the management of elevated serum phosphate Serum phosphate level Study drug management Symptom management <5.50 mg / dL (<1.75 mmol / L) (Grade 0) Continue treatment with erdafitinib None. 5.50-6.99 mg / dL (1.75-2.24 mmol / L) (Grade 1) Continue treatment with erdafitinib Restrict phosphate intake to 600 - 800 mg / day. 7.00-8.99 mg / dL (2.25-2.90 mmol / L) (Grade 2) Continue treatment with erdafitinib A dose reduction will be implemented for persistent cases of hyperphosphatemia3 (defined as serum phosphate >7 mg / dL over a period of 2 months) 0 if clinically necessary (for example, in the presence of additional adverse events related to hyperphosphatemia or electrolyte disturbances) Restrict phosphate intake to 600 - 800 mg / day. Introduce 800 to 1600 mg TVD of sevelamer with food until phosphate level is <7.0 mg / dL. 9.00-10.00 mg / dL (>2.91-3.20 mmol / L) (Grade 3) Discontinue13 erdafitinib treatment until serum phosphate level returns to <7.0 mg / dL (weekly testing recommended). Restart treatment at the same dose level. A dose reduction will be implemented for persistent hyperphosphatemia3 (defined as serum phosphate >9 mg / dL over a 1-month period) 0 if clinically necessary (e.g. Restrict phosphate intake to 600 - 800 mg / day Up to 1600 mg TVD of sevelamer with food until serum phosphate level is <7.0 mg / dL. presence of additional adverse events related to hyperphosphatemia or electrolyte disturbances) >10.00 mg / dL (>3.20 mmol / L) (Grade 4) Suspend13 treatment with erdafitinib until the serum phosphate level returns to <7.0 mg / dL (recommended weekly tests). Restart treatment at the first reduced dose level. If persistent hyperphosphatemia3 (>10.00 mg / dL) occurs for >2 weeks, erdafitinib should be permanently discontinued. Medical management as clinically appropriate. Significant impairment of baseline renal function or Grade 3 hypocalcemia Erdafitinib should be permanently discontinued. (In situations where the subject has clinical benefit and the investigator and sponsor's medical monitor agree that continuation of treatment is in the best interest of the subject, the drug may be reintroduced at 2 lower dose levels if appropriate Follow other recommendations described above, Section 6.6.2.) Medical management as clinically appropriate. cnRRnn / zznz / E / YiAi Note: These are general guidelines. Responsible clinicians should use clinical judgment and local standard of care to decide how best to manage phosphate elevation. If sevelamer hydrochloride (Renagel®) is not available, the use of other phosphate binders (not containing calcium) based on local reference is recommended, including sevelamer carbonate (Renvela) or lanthanum carbonate (Fosrenol®). Additional information on phosphorus in foods by food class can also be found at www.permanente.net / homepage / kaiser / pdf / 42025.pdf. Additional information on phosphate management and diet can be found on the National Kidney Foundation website (http: / / www.kidney.org / atoz / content / phosphorus.cfm) to. Persistent hyperphosphatemia is considered when there is more than 1 sequential phosphate value above the cut-off value. b. Study drug interruptions for hyperphosphatemia were suggested to last 7 days. TVD=3 times a day cnRAnn / zznz / B / YiAi Table 7 presents guidelines for the clinical management of elevated serum phosphate levels during erdafitinib treatment. Table 8 presents the 6 mg daily dosing schedule (with dose escalation) and dose reductions. Table 8: Dose Schedule and Dose Reductions: 6 mg Daily Dosing (with Dose Escalation) Category With dose increase Initial dose 6 mg Dose increase 8 mg 1st dose reduction 6 mg 2nd dose reduction 5 mg 3rd dose reduction 4 mg 4th dose reduction STOP In one embodiment, the treatment cycle as used herein is a 28-day cycle. In certain embodiments, the treatment cycle is a cycle of 28 days up to two years. In one embodiment, the desired dose is conveniently presented in a single dose or in divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example, in the form of two, three, four or more subdoses at a time. day. In some embodiments, the FGFR inhibitor is conveniently presented in divided doses that are administered simultaneously (or over a short period of time) once a day. In some embodiments, the FGFR inhibitor, generally, and erdafitinib specifically, is conveniently presented in divided doses that are administered in equal portions twice daily. In some embodiments, the FGFR inhibitor, generally, and erdafitinib specifically, is conveniently presented in divided doses that are administered in equal portions three times a day. In some embodiments, the FGFR inhibitor is conveniently presented in divided doses that are administered in equal portions four times a day. In certain embodiments, the desired dose may be administered in 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fractionated unit dosages throughout the day, such that the total amount of FGFR inhibitor , in general, and erdafitinib specifically, delivered by fractionated unit dosages throughout the day to provide total daily dosages. In some embodiments, the amount of the FGFR inhibitor, generally, and erdafitinib specifically, that is administered to the human varies depending on factors such as, but not limited to, the state and severity of the disease or condition, and the identity (e.g. example, weight) of the human, and the particular additional therapeutic agents that are administered (if applicable). In still other embodiments, erdafitinib is not coadministered with strong CYP3A4 inhibitors or inducers or moderate CyP3A4 inducers. In certain embodiments, erdafitinib is not coadministered with strong CYP3A4 inhibitors or inducers or moderate CyP3A4 inducers within 14 days or 5 half-lives before the first dose of study drug. Non-limiting examples of strong CYP3A4 inhibitors include boceprevir, aprepitant, clarithromycin, conivaptan, grape juice, indinavir, lopinavir itraconazole, mibefradil ketoconazole, nefazodone, ritonavir, posaconazole, nelfinavir, saquinavir, conivaptan, telaprevir, boceprevir, telithromycin, clarithromycin, voriconazole, clotrimazole, diltiazem, erythromycin, fluconazole, verapamil and troleandomycin. Non-limiting examples of moderate to potent CYP3A4 inducers include avasimibe, St. John's wort, carbamazepine, efavirenz, phenytoin, etravirine, bosentan, nafcillin, rifampin, modafinil, rifabutin, and barbiturates. Manufacturing Kits / Items For use in the methods or uses described herein, kits and articles of manufacture are also described. Such kits include a container or container that is compartmentalized to receive one or more dosages of the pharmaceutical compositions disclosed herein. Suitable containers include, for example, jars. In one embodiment, the containers are formed from various materials such as glass or plastic. The manufacturing items provided herein contain packaging materials. Packaging materials for use in packaging pharmaceutical products include, for example, U.S. Patent Nos. 5,323,907, 5,052,558, and 5,033,252. Examples of pharmaceutical packaging materials include, but are not limited to , blister packs, bottles, tubes, bags, containers, jars, and any packaging material suitable for a selected formulation and intended mode of administration and treatment. A kit typically includes technical sheets listing the contents and / or instructions for use, and package inserts with instructions for use. A set of instructions will also normally be included. In one embodiment, the data sheet is on or associated with the container. In one embodiment, the data sheet is on a container, when the letters, numbers or other characters that form the data sheet are attached, molded or engraved on the container itself; The data sheet is associated with a container when it is present within a receptacle or carrier that also contains the container, for example, as a package insert. In one embodiment, a technical sheet is used to indicate that the content is to be used for a specific therapeutic application. The data sheet also indicates guidelines for the use of the content, such as in the methods described herein. In certain embodiments, the pharmaceutical compositions are presented in a container or dispensing device containing one or more unit dosage forms containing a compound provided herein. The package, for example, contains a sheet of metal or plastic, such as a blister package. In one embodiment, the container or dispensing device is accompanied by administration instructions. In one embodiment, the container or dispenser is also accompanied by a notice associated with the container in the form prescribed by a government agency that regulates the manufacture, use, or sale of pharmaceutical products, where said notice reflects the authorization of the government agency. form of the drug for veterinary or human administration. Such a note, for example, is the US Food and Drug Administration-authorized SmPC for prescription drugs, or the authorized package insert for the product. In one embodiment, compositions containing a compound provided herein formulated in a pharmaceutically compatible carrier are also prepared, placed in a suitable container, and labeled for the treatment of an indicated condition. Nucieotide sequences of FGFR fusion genes The nucleotide sequences for the FGFR fusion cDNA are provided in Table 4. Underlined sequences correspond to FGFR3 or FGFR2, sequences in black represent fusion partners. cnRAnn / zznz / B / YiAi Table 4 FGFR3-TACC3 VI (2850 base pairs) (SEQ ID NO:33) >ATGGGCGCCCCTGCCTGCGCCCTCGCGCTCTGCGTGGCCGTGGCCATCGTG GCCGGCGCCTCCTCGGAGTCCTTGGGGACGGAGCAGCGCGTCGTGGGGCGAG CGGCAGAAGTCCCGGGCCCAGAGCCCGGCCAGCAGGAGCAGTTGGTCTTCGG CAGCGGGGATGCTGTGGAGCTGAGCTGTCCCCCG CCCGGGGGTGGTCCCATG GGGCCCACTGTCTGGGTCAAGGATGGCACAGGGCTGGTGCCCTCGGAGCGTG TCCTGGTGGGGCCCCAGCGGCTGCAGGTGCTGAATGCCTCCCACGAGGACTCC GGGCCTACAGCTGCCGGCAGCGGCTCACGCAGCGCGTACTGTGCCACTTCAG TGTGCGGGTGACAGACGCTCCATCCTCGGGAGATGACGAAGACGGGAGGAC GAGGCTGAGGACACAGGTG TGGACACAGGGGCCCCTTACTGGACACGGCCCG AGCGGATGGACAAGAAGCTGCTGGCCGTGCCGGCCGCCAACACCGTCCGCTTC CGCTGCCCAGCCGCTGGCAACCCCACTCCCTCCATCTCCTGGCTGAAGAACGG CAGGGAGTTCCGCGGCGAGCACCGCATTGGAGGCATCAAGCTGCGGCATCAGC AGTGGAGCCTGGTCATGGAAAGCGTGGTGCCCTCGGACCGCGGCAACTACACC TGCGTCGTGGAGAACAAG1 1 1GGCAGCATCCGGCAGACGTACACGCTGGACGT GCTGGAGCGCTCCCCGCACCGGCCCATCC TGCAGGCGGGGCTGCCGGCCAACC AGACGGCGGTGCTGGGCAGCGACGTGGAGTTCCACTGCAAGGTGTACAGTGA CGCACAGCCCCACATCCAGTGGCTCAAGCACGTGGAGGTGAATGGCAGCAAGG TGGGCCCGGACGGCACACCCTACGTTACCGTGCTCAAGACGGCGGGCGCTAAC ACCACCGACAAGGAGCTAGAGGTTCTCTCCTTGCACAACGTCACCI 1 IGAGGAC GCCGGGGA GTACACCTGCCTGGCGGGCAATTCTATTGGGTTTTCTCATCACTC TGCGTGGCTGGTGGTGCTGCCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAG GCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCI ILI ICCTGTT CATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTGCGCAGCCCCCCCAAGA AAGGCCTGGGCTCCCCCACCGTGCACAAGATCTCCCGCTTC CCGCTCAAGCGA CAGGTGTCCCTGGAGTCCAACGCGTCCATGAGCTCCAACACACCACTGGTGCG CATCGCAAGGCTGTCCTCAGGGGAGGGCCCCACGCTGGCCAATGTCTCCGAGC TCGAGCTGCCTGCCGACCCCAAATGGGAGCTGTCTCGGGCCCGGCTGACCCTG GGCAAGCCCCTTGGGGAGGGCTGCTTCGGCCAGGTGGTCATGGCGGAGGCCA TCGGCATTGACAAGGACCGGGCCG CCAAGCCTGTCACCGTAGCCGTGAAGATG CTGAAAGACGATGCCACTGACAAGGACCTGTCGGACCTGGTGTCTGAGATGGA GATGATGAAGATGATCGGGAAACACAAAAACATCATCAACCTGCTGGGCGCCT GCACGCAGGGCGGGCCCCTGTACGTGCTGGTGGAGTACGCGGCCAAGGGTAA CCTGCGGGAGI 1 1L1GCGGGCGCGGCGGCCCCCGGGCCTGGACTACTCCTT CG ACACCTGCAAGCCGCCCGAGGAGCAGCTCACCTTCAAGGACCTGGTGTCCTGT GCCTACCAGGTGGCCCGGGGCATGGAGTACTTGGCCTCCCAGAAGTGCATCCA CAGGGACCTGGCTGCCCGCAATGTGCTGGTGACCGAGGACAACGTGATGAAGA TCGCAGACTTCGGGCTGGCCCGGGACGTGCACAACCTCGACTACTACAAGAAG ACGACCAACGGCCGGCTGCCCGTGAAGTGGATGGC GCCTGAGGCCIIGI1 IGA CCGAGTCTACACTCACCAGAGTGACGTCTGGTCCI 1 1GGGGTCCTGCTCTGGG AGATCTTCACGCTGGGGGGCTCCCCGTACCCCGGCATCCCTGTGGAGGAGCTC TTCAAGCTGCTGAAGGAGGGCCACCGCATGGACAAGCCCGCCAACTGCACACA CGACCTGTACATGATCATGCGGGAGTGCTGGCATGCCGCGCCCTCCCAGAGGC CCACCTTCAA GCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCC ACCGACGTAAAGGCGACACAGGAGGAGAACCGGGAGCTGAGGAGCAGGTGTG AGGAGCTCCACGGGAAGAACCTGGAACTGGGGAAGATCATGGACAGGTTCGAA GAGGTTGTGTACCAGGCCATGGAGGAAGTTCAGAAGCAGAAGGAALI 1 ICCAA AGCTGAAATCCAGAAAGTTCTAAAAGAAAAAGACCAACTTACCACAGATCTGAA CTCCATGGAGAAGTCCTTCTCCGACCTCTTCAAGCG lili GAGAAACAGAAAGA GGTGATCGAGGGCTACCGCAAGAACGAAGAGTCACTGAAGAAGTGCGTGGAG GATTACCTGGCAAGGATCACCCAGGAGG GCCAGAGGTACCAAGCCCTGAAGGC CCACGCGGAGGAGAAGCTGCAGCTGGCAAACGAGGAGATCGCCCAGGTCCGG AGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCAGGCCAGCCTGAGGAAGGAGC AGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAAGACTAAAGAGAAC GAGGAGCTGACCAGGATCTGCGACGACCTCATCTCCAAGATGGAGAAGATCTG A FGFR3- TACC3 V3 >ATGGGCGCCCCTGCCTGCGCCCTCGCGCTCTGCGTGGCCGTGGCCATCGTG (2955 pairs of GCCGGCGCCTCCTCGGAGTCCTTGGGGACGGAGCAGCGCGTCGTGGGGCGAG bases) CGGCAGAAG1GCCGGGCCCAGAGCGLGGCCAGCAGGAGCAG1 1GG1C1 1CGG (SEQ ID NO:34 CAGCGGGGATGCTGTGGAGCTGAGCTGTCCCC CGCCCGGGGGTGGTCCCATG GGGCCCACTGTCTGGGTCAAGGATGGCACAGGGCTGGTGCCCTCGGAGCGTG TCCTGGTGGGGCCCCAGCGGCTGCAGGTGCTGAATGCCTCCCACGAGGACTCC GGGGCCTACAGCTGCCGGCAGCGGCTCACGCAGCGCGTACTGTGCCACTTCAG TGTGCGGGTGACAGACGCTCCATCCTCGGGAGATGACGAAGACGGGAGGAC GAGGCTGAGGACACAGG TGTGGACACAGGGGCCCCTTACTGGACACGGCCCCG AGCGGATGGACAAGAAGCTGCTGGCCGTGCCGGCCGCCAACACCGTCCGCTTC CGCTGCCCAGCCGCTGGCAACCCCACTCCCTCCATCTCCTGGCTGAAGAACGG CAGGGAGTTCCGCGGCGAGCACCGCATTGGAGGCATCAAGCTGCGGCATCAGC AGTGGAGCCTGGTCATGGAAAGCGTGGTGCCCTCGGACCGCGGCAACTACACC T GCGTCGTGGAGAACAAGTTTGGCAGCATCCGGCAGACGTACACGCTGGACGT GCTGGAGCGCTCCCCGCACCGGCCCATCCTGCAGGCGGGGCTGCCGGCCAACC AGACGGCGGTGCTGGGCAGCGACGTGGAGTTCCACTGCAAGGTGTACAGTGA CGCACAGCCCCACATCCAGTGGCTCAAGCACGTGGAGGTGAATGGCAGCAAGG TGGGCCCGGACGGCACACCCTACGTTACCGTGCTCAAGACGGCGGGCGCTAAC ACCACCGACAAGGAGCTAGAGGTTCTCTCCTTGCACAACGTCACCI 1 IGAGGAC GCCGGGGAGTACACCTGCCTGGCGGCAATTCTATTGGG1 1 1 ILICATCACTC TGCGTGGCTGGTGGTGCTGCCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAG GCGGGCAGTGTGTATGCAGGCAT CCTCAGCTACGGGGTGGGCTTCTTCCTGTT CATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTGCGCAGCCCCCCCAAGA AAGGCCTGGGCTCCCCCACCGTGCACAAGATCTCCCGCTTCCCGCTCAAGCGA CAGGTGTCCCTGGAGTCCAACGCGTCCATGAGCTCCAACACACCACTGGTGCG CatcgcaaggtgTCCTCaggGGGGCCCCCTGGCCTCTCCGGCCCCCCCCGCCCCCCCCCCCCCCCCCCCCCCCCGGGGTGTCTCGGGCCCGCTGCTGGTGGTGGGTGGTGGTGTGTCTG ATGGCGGGCCCCA TCGCATTGACACAAGCCGGCCCCCCTGTCCCGTAGCGTGTGAAGTG CTGAAAGACGTGCCCACTGACACACGCTGTCGGCTGTGTTGTGTGAGGGGA CCT GCACGCAGGGGGGCCCCCTGTTGCTGGTGGTACGGCCCAAGGGTAA TGGTGCCTGT GCCCCAGGGGCCGGGCATGGGTTTGGCCCCCAAGTGCATCCA CAGGGCTGGCTGCCCCCCCCCGCTGTGTGGTGGACGGACGACGACGTGTGAAGAAGA Gactactacaagagaag acgaccaacggcgctgccgtgaaggggcgtgaggcci Igi 1 Iga ccgagtcactcactcaccagtgtgtctggtccc1 1 1gggtcctgTCTGGGGGGGGGGGGGGGTTTCTCTGTGGGGGGGTCCGGGGTACGGTACGGTACCGGTACGTACCGTACCGTAC. CatcctgtgGagGGCTC TTCAAGCTGTGGGGGGCCCGCATGGACACCCCCCCCCCCCCACACACACACA CGACCTGTACATGATGCGGGGGTGTGGCTGCGCCCCCCCCAGGGCCCCCCCGCGCGC GTCCTTACCGTGACGCCCCCCGCCCGCCCCCCCGGTGTCCCGCCCTGGGGGGCCCCCCCTT GTCCCCCGGACCTAGTGGCCTGCTCCGTACCAGGAGCTGGTGGTGGTGGTGGTGGTGGTGTGTGTGTGTGTGA TGAGGGCAGGTGTGGGA GGAGCCACGGGGGAAGAACTGGAACTGGGGAAGATGGGACGGTTTCGAAGG AGGTTGTGTACGGCCATGGGGAGGGGAAGTTCAGAAGCAGAAGGAACI 1 ICCAAA GCTGAAATCCAAAGTTTTTTTTTTTAAAAGAAAAGACCAACTACCTACCACCCCCCCCCCCCCCCCCCC TCCTCTCCCGACC1L1 ICAAGCGI 1 1 GAGAAACAGAAAAGAG GTGTCGGGGCCCCCGCAAGAAGAAGGTCACTGAAGAAGTGCGTGGGGGGGGA TACCTGGCAAGGATCACCGGGGGGGAGGGTACTACCCTGTGGCCCCCCCCCCCCCCCCCCCGGGGGA CaaacgagogatCgCCGGTCCGGG CAAGGCCAGGGGGGGTTGGCCCCCGGGCCCCTGGGGGGAGGCAGGCAGGCAGGGCTCGTCGCTGGGAGAAGGTGGAGGAGAAGAAGTAAAGAGAACGAACGA GGAGCTGTGTGTTGTGTagA cutgacacacacacacacacacacacacacacacacha cutCha cut. GAAGATCTGGA FGFR3-BAIAP2L1> ATGGGCCCCCCCTGCCCCGCGTCTGGGGGCGGGGCCATCGTG (3765 Pares (SEQ ID NO:35) CAGCGGGGATGCTGTGGAGCTGAGCTGTCCCCCGCCCGGGGGTGGTCCCATG GGGCCCACTGTCTGGGTCAAGGATGGCACAGGGCTGGTGCCCTCGGAGCGTG TCCTGGTGGGGCCCCAGCGGCTGCAGGTGCTGAATGCCTCCCACGAGGACTCC GGGGCCTACAGCTGCCGGCAGCGGCTCACGCAGCGCGTACTGTGCCACTTCAG TGTGCGGGTGACAGACGCTCCATCCTCGGGAGATGACGAAGACGGGGAGGAC GAGGCTGAGGACACAGGTGTGGACACAGGGGCCCCTTACT GGACACGGCCCG AGCGGATGGACAAGAAGCTGCTGGCCGTGCCGGCCGCCAACACCGTCCGCTTC CGCTGCCCAGCCGCTGGCAACCCCACTCCCTCCATCTCCTGGCTGAAGAACGG CAGGGAGTTCCGCGGCGAGCACCGCATTGGAGGCATCAAGCTGCGGCATCAGC AGTGGAGCCTGGTCATGGAAAGCGTGGTGCCCTCGGACCGCGGCAACTACACC TGCGTCGTGGAGAACAAG1 1 1 GGCAGCATCCGGCAGACGTACACGCTGGACGT GCTGGAGCGCTCCCCGCACCGGCCCATCCTGCAGGCGGGGCTGCCGGCCAACC AGACGGCGGTGCTGGGCAGCGACGTGGAGTTCCACTGCAAGGTGTACAGTGA CGCACAGCCCCACATCCAGTGGCTCAAGCACGTGGAGGTGAATGGCAGCAAGG TGGGCCCGGACGGCACACCCTACGTTACCGTGCTCAAGTCCTGGATCAGTGAG AGTGTGGA GGCCGACGTGCGCCTCCGCCTGGCCAATGTGTCGGAGCGGGACG GGGGCGAGTACCTCTGTCGAGCCACCAATTTCATAGGCGTGGCCGAGAAGGCC lili GGCTGAGCGTTCACGGGCCCCGAGCAGCCGAGGAGGAGCTGGTGGAGG CTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTT CTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTGCG CAGCC CCCCCAAGAAAGGCCTGGGCTCCCCCACCGTGCACAAGATCTCCCGCTTCCCG CTCAAGCGACAGGTGTCCCTGGAGTCCAACGCGTCCATGAGCTCCAACACACC ACTGGTGCGCATCGCAAGGCTGTCCTCAGGGGAGGGCCCCACGCTGGCCAATG TCTCCGAGCTCGAGCTGCCTGCCGACCCCAAATGGGAGCTGTCTCGGGCCCGG CTGACCCTGGGCAAGCCCCTTGGGGAGGGCT GCTTCGGCCAGGTGGTCATGG CGGAGGCCATCGGCATTGACAAGGACCGGGCCGCCAAGCCTGTCACCGTAGCC GTGAAGATGCTGAAAGACGATGCCACTGACAAGGACCTGTCGGACCTGGTGTC TGAGATGGAGATGATGAAGATGATCGGGAAACACAAAAACATCATCAACCTGC TGGGCGCCTGCACGCAGGGCGGGCCCCTGTACGTGCTGGTGGAGTACGCGGC CAAGGGTAACCTGCGGGAGI 1 ICIGCGGGCGGCGGCCCCCGGGCCTGGAC TACTCCTTCGACACCTGCAAGCCGCCCGAGGAGCAGCTCACCTTCAAGGACCT GGTGTCCTGTGCCTACCAGGTGGCCCGGGGCATGGAGTACTTGGCCTCCCAGA AGTGCATCCACAGGGACCTGGCTGCCCGCAATGTGCTGGTGACCGAGGACAAC GTGATGAAGATCGCAGACTTCGGGCTGGCCCGGGACGTGCACAACCTCGACTA CTACAAG AAGACGACCAACGGCCGGCTGCCCGTGAAGTGGATGGCGCCTGAGG CC1 1G1 1 1GACCGAG1C1 ACAL 1CACCAGAG1GACG1C1GG1CC1 1 1GGGGTC CTGCTCTGGGAGATCTTCACGCTGGGGGGCTCCCCGTACCCCGGCATCCCTGT GGAGGAGCTCTTCAAGCTGCTGAAGGAGGGCCACCGCATGGACAAGCCCGCCA ACTGCACACACGACCTGTACATGATCATGCGGGAGTGCTGGCATGCCGCGCCC TCCCAGAGGCCCACCTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTAC CGTGACGTCCACCGACAATGTTATGGAACAGT TCAATCCTGGGCTGCGAAATT TAATAAACCTGGGGAAAAATTATGAGAAAGCTGTAAACGCTATGATCCTGGCA GGAAAAGCCTACTACGATGGAGTGGCCAAGATCGGTGAGATTGCCACTGGGTC CCCCGTGTCAACTGAACTGGGACATGTCCTCATAGAGATTTCAAGTACCCACAA GAAACTCAACGAGAGTCTTGATGAAAAI 1 1 1AAAAAATTCCACAAAGAGATTAT CCATGAGC TGGAGAAGAAGATAGAACTTGACGTGAAATATATGAACGCAACTC TAAAAAGATACCAAACAGAACACAAGAATAAATTAGAGTCTTTGGAGAAATCCC AAGCTGAGTTGAAGAAGATCAGAAGGAAAAGCCAAGGAAGCCGAAACGCACTC AAATATGAACACAAAGAAATTGAGTATGTGGAGACCGTTACTTCTCGTCAGAGT GAAATCCAGAAATTCATTGCAGATGGTTGCAAAGAGGCTCTGCTT GAAGAGAA GAGGCGCTTCTGCTTTCTGGTTGATAAGCACTGTGGC1 1 1GCAAACCACATACA TTATTATCACTTACAGTCTGCAGAACTACTGAATTCCAAGCTGCCTCGGTGGCA GGAGACCTGTGTTGATGCCATCAAAGTGCCAGAGAAAATCATGAATATGATCG AAGAAATAAAGACCCCAGCCTCTACCCCCGTGTCTGGAACTCCTCAGGCTTCAC CCATGATCGAGAGAAGCA ATGTGGTTAGGAAAGATTACGACACCLl 1 ILIAAAT GCTCACCAAAGATGCCCCCCGCTCCTTCAGGCAGAGCATATACCAGTCCCTTGA TCGATATGTTTAATAACCCAGCCACGGCTGCCCCGAATTCACAAAGGGTAAATA ATTCAACAGGTACTTCCGAAGATCCCAGTTTACAGCGATCAGTTTCGGTTGCAA CGGGACTGAACATGATGAAGAAGCAGAAAGTGAAGACCATCTTCCC GCACACT GCGGGCTCCAACAAGACCTTACTCAGCI 1 1GCACAGGGAGATGTCATCACGCT GCTCATCCCCGAGGAGAAGGATGGCTGGCTCTATGGAGAACACGACGTGTCCA AGGCGAGGGGTTGGTTCCCGTCGTCGTACACGAAGTTGCTGGAAGAAAATGAG ACAGAAGCAGTGACCGTGCCCACGCCAAGCCCCACACCAGTGAGAAGCATCAG CACCGTGAACTTGTCTGAGA ATAGCAGTGTTGTCATCCCCCCACCCGACTT GGAATGCTTGTCCATGGGGGCAGCTGCCGACAGGAGAGCAGATTCGGCCAGG ACGACATCCACC1 1 1AAGGCCCCAGCGTCCAAGCCCGAGACCGCGGCTCCTAAC GATGCCAACGGGACTGCAAAGCCGCC1 1 1 1L1CAGCGGAGAAAALLCC1 1 IGC CACTGTGAAACTCCGCCCGACTGTGACGA ATGATCGCTCGGCACCCATCATTC GATGA FGFR2 -BICC1 (4989 pairs of >ATGGTCAGCTGGGGTCG 1 1 1CA1CTGCCTGGTCGTGGTCACCATGGCAACCT TGTCCCTGGCCCGGCCCTCCTTCAG1 1 1AGTTGAGGATACCACATTAGAGCCA bases) GAAGAGCCACCAACCAAATACCAAATCTCTCAACCAGAAGTGTACGTGGCTGCG (SEQ ID NO:36) CCAGGGGAGTCGCTAGAGGTGCGCTGCCTGTTGAAAGATGCCGCCGTGATCAG TTGGACTAAGGATGGGGTGCACTTGGGGCCCAACAATAGGACAGTGCTTATTG GGGAGTACTTGCAGATAAAGGGCGCCACGCCTAGAGACTCCGGCCTCTATGCT TGTACTG CCAGTAGGACTGTAGACAGTGAAACTTGGTACTTCATGGTGAATGT CACAGATGCCATCTCATCCGGAGATGATGAGGATGACACCGATGGTGCGGAAG ATTTTGTCAGTGAGAACAGTAACAACAAGAGAGCACCATACTGGACCAACACAG AAAAGATGGAAAAGCGGCTCCATGCTGTGCCTGCGGCCAACACTGTCAAGTTT CGCTGCCCAGCCGGGGGGAACCCAATGCCAACCATGCGGTGGCTG AAAAACGG GAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGC ACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACC TGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGT TGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATG CCTCCACAGTGGTCGGAGGAGACGTAGAG TTTGTCTGCAAGGTTTACAGTGAT GCCCAGCCCCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATA CGGGCCCGACGGGCTGCCCTACCTCAAGGTTCTCAAGGCCGCCGGTGTTAACA CCACGGACAAAGAGATTGAGGTTCTCTATATTCGGAATGTAACI 1 1 IGAGGAC GCTGGGGAATATACGTGCTTGGCGGGTAATTCTATTGGGATATCCI 1 ICACTC TG CATGGTTGACAGTTCTGCCAGCGCCTGGAAGAGAAAAGGAGATTACAGCTT CCCCAGACTACCTGGAGATAGCCATTTACTGCATAGGGGTC1 1L1 1AATCGCCT GTATGGTGGTAACAGTCATCCTGTGCCGAATGAAGAACACGACCAAGAAGCCA GACTTCAGCAGCCAGCCGGCTGTGCACAAGCTGACCAAACGTATCCCCCTGCG GAGACAGGTAACAGTTTCGGCTGAGTCCAGCTCC TCCATGAACTCCAACACCCC GCTGGTGAGGATAACAACACGCCTCTCTTCAACGGCAGACACCCCCATGCTGG CAGGGGTCTCCGAGTATGAACTTCCAGAGGACCCAAAAATGGGAG1 1 1CCAAGA GATAAGCTGACACTGGGCAAGCCCCTGGGAGAAGGTTGCTTTGGGCAAGTGGT CATGGCGGAAGCAGTGGGAATTGACAAAGACAAGCCCAAGGAGGCGGTCACCG TGGCCGTGA AGATGTTGAAAGATGATGCCACAGAAAGAACCTTTCTGATCTG GTGTCAGAGATGGAGATGATGAAGATGATTGGGAAACACAAGAATATCATAAA TC1 1C1 1GGAGCCTGCACACAGGATGGGCCTCTCTATGTCATAGTTGAGTATG CCTCTAAAGGCAACCTCCGAGAATACCTCCGAGCCCGGAGGCCACCCGGGATG GAGTACTCCTATGACATTAACCGTGTTCCTGAGGAGCAGATGACCTTCAAGGA CTTGGTGTCATGCACCTACCAGCTGGCCAGAGGCATGGAGTACTTGGCTTCCC AAAAATGTATTCATCGAGATTTAGCAGCCAGAAATG lili GGTAACAGAAAACA ATGTGATGAAAATAGCAGAC1 1 1GGACTCG CCAGAGATATCAACAATATAGACT ATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAA GCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGT GTTAATGTGGGAGATCTTCACI 1 1AGGGGGCTCGCCCTACCCAGGGATTCCCG TGGAGGAACI 1 1 1 1AAGGTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCC AACTGCACCAACGAACT GTACATGATGATGAGGGACTGTTGGCATGCAGTGCC CTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCAC TCTCACAACCAATGAGATCATGGAGGAAACAAATACGCAGATTGCTTGGCCATC AAAACTGAAGATCGGAGCCAAATCCAAGAAAGATCCCCATATTAAGGTTTCTGG AAAGAAAGAAGATGTTAAAGAAGCCAAGGAAATGATCATGTCTGTCTTAGACA C AAAAAGCAATCGAGTCACACTGAAGATGGATG1 1 1CACATACAGAACATTCACA TGTAATCGGCAAAGGTGGCAACAATATTAAAAAAGTGATGGAAGAAACCGGAT GCCATATCCACI 1 1CCAGATTCCAACAGGAATAACCAAGCAGAAAAAAGCAACC AGGTATCTATAGCGGGACAACCAGCAGGAGTAGAATCTGCCCGAGTTAGAATT CGGGAGCTGCTTCC1 1 1GGTGCTGATGTTTGAGCTACCAATTGCTGGAATTCT TCAACCGGTTCCTGATCCTAATTCCCCCTCTATTCAGCATATATCACAAACGTA CAATATTTCAGTATCATTTAAACAGCGTTCCCGAATGTATGGTGCTACTGTCAT AGTACGAGGGTCTCAGAATAACACTAGTGCTGTGAAGGAAGGAACTGCCATGC TGTTAGAACTCTTGCTGGGAGCTTAGCATCAGCTATTCCTGTGAGCACACAAC T AGATATTGCAGCTCAACATCATC1L1 1 1ATGATGGGTCGAAATGGGAGCAACA TCAAACATATCATGCAGAGAACAGGTGCTCAGATCCAC1 1 1CCTGATCCCAGTA ATCCACAAAAGAAATCTACCGTCTACCTCCAGGGCACCATTGAGTCTGTCTGTC TTGCAAGGCAATATCTCATGGGTTGTCTTCCTCTTGTGTTGATGTTTGATATGA AGGAAGAAATTGAAGTA GATCCACAATTCATTGCGCAGTTGATGGAACAGCTT GATGTCTTCATCAGTATTAAACCAAAGCCCAAACAGCCAAGCAAGTCTGTGATT GTGAAAAGTGTTGAGCGAAATGCCTTAAATATGTATGAAGCAAGGAAATGTCT CCTCGGACTTGAAAGCAGTGGGGTTACCATAGCAACCAGTCCATCCCCAGCAT CCTGCCCTGCCGGCCTGGCATGTCCCAGCCTGGATATCTTAGCTTCAGCAGGC CTTGGACT CACTGGACTAGGTCTTTTGGGACCCACCACCTTATCTCTGAACACT TCAACAACCCCAAACTCACTCTTGAATGCTCTTAATAGCTCAGTCAGTCCI 1 IG CAAAGTCCAAGTTCTGGTACACCCAGCCCCACATTATGGGCACCCCCACTTGCT AATACTTCAAGTGCCACAGG1 1 1 1 1L1GCTATACCACACCTTATGATTCCATCT ACTGCCCAAGCCACATTAACTAATAI 1 1 1GTTGTCTGGAGTGCCCACCTATGGG CACACAGCTCCATCTCCCCCTCCTGGCTTGACTCCTGTTGATGTCCATATCAAC AGTATGCAGACCGAAGGCAAAAAAATCTCTGCTGCI 1 1AAATGGACATGCACAG TCTCCAGATATAAAATATGGTGCAATA TCCACTTCATCACTTGGAGAAAAAGTG cnRAnn / zznz / E / YiAi CTGAGTGCAAATCACGGGGATCCGTCCATCCAGACAAGTGGGTCTGAGCAGAC ATCTCCCAAATCAAGCCCCACTGAAGGTTGTAATGATGCTTTTGTTGAAGTAGG CATGCCTCGAAGTCCTTCCCATTCTGGGAATGCTGGTGACTTGAAACAGATGAT GTGTCCCTCCAAGG1 1 1CCTGTGCCAAAAGGCAGACAGTGGAACTATTGCAAG GCACGAAAAACTCACACTTACACAGC ACTGACAGGTTGCTCTCAGACCCTGAAC TGAGTGCTACCGAAAGCCC1 1 1GGCTGACAAGAAGGCTCCAGGGAGTGAGCGC GCTGCAGAGAGGGCAGCAGCTGCCCAGCAAAACTCCGAAAGGGCCCACCTTGC TCCACGGTCATCATATGTCAACATGCAGGCATTTGACTATGAACAGAAGAAGCT ATTAGCCACCAAAGCTATGTTAAAGAAACCAGTGGTGACGGAGGTCAGAAC GC CCACAAATACCTGGAGTGGCCTGGGTTTTTCTAAATCCATGCCAGCTGAAACTA TCAAGGAGTTGAGAAGGGCCAATCATGTGTCCTATAAGCCCACAATGACAACC ACTTATGAGGGCTCATCCATGTCCC1 1 1CACGGTCCAACAGTCGTGAGCACTTG GGAGGTGGAAGCGAATCTGATAACTGGAGAGACCGAAATGGAATTGGACCTGG AAGTCATAGTGAATTTGCAGCTTCT ATTGGCAGCCCTAAGCGTAAACAAAACAA ATCAACGGAACACTATCTCAGCAGTAGCAATTACATGGACTGCATTTCCTCGCT GACAGGAAGCAATGGCTGTAACTTAAATAGCTCTTTCAAAGGTTCTGACCTCCC TGAGCTCTTCAGCAAACTGGGCCTGGGCAAATACACAGATG lili CCAGCAACA AGAGATCGATCTTCAGACATTCCTCACTCTCACAGATCAGGATCTGAAGGAGCT GGGAATA ACTACI 1 1 1GGTGCCAGGAGGAAAATGCTGCTTGCAATTTCAGAAC TAAATAAAAACCGAAGAAAGCTTTTTGAATCGCCAAATGCACGCACCTCTTTCC TGGAAGGTGGAGCGAGTGGAAGGCTACCCCGTCAGTATCACTCAGACATTGCT AGTGTCAGTGGCCGCTGGTAG FGFR2-CASP7 >ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCA ACCT (3213 base pairs TGTCCCTGGCCCGGCCCTCCTTCAG1 1 1AG1 1GAGGA1 ALCALA 1 1AGAGLLA ) GAAGAGCCACCAACCAAATACCAAATCTCTCAACCAGAAGTGTACGTGGCTGCG (SEQ ID NO:37) LLAGGGGAG1LGL1AGAGG1GLGL1GLC1G1 1GAAAGA1GLLGLLG1GA1LAG TTGGACTAAGGATGGGGTGCACTTGGGGCCCAACAATAGGACAGTGCTTATTG GGGAGTACTTGCAGATAAAGGGCGCCACGCCTAGAGACTCCGG CCTCTATGCT TGTACTGCCAGTAGGACTGTAGACAGTGAAACTTGGTACTTCATGGTGAATGT CACAGATGCCATCTCATCCGGAGATGATGAGGATGACACCGATGGTGCGGAAG Al 1 1 1G1CAGTGAGAACAGTAACAACAAGAGAGCACCATACTGGACCAACACAG AAAAGATGGAAAAGCGGCTCCATGCTGTGCCTGCGGCCAACACTGTCAAGTTT CGCTGCCCAGCCGGGG GGAACCCAATGCCAACCATGCGGTGGCTGAAAAACGG GAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGC ACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACC 0ηβΑηη / 77Ω7 / Ε / ΥΙΛΙ TGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGT TGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATG CCTCCACAGTGGTCGGAGGAGACGTAGAGTTTGTCTGCAAGGTTTACAGTGAT GCCCAGCCCCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATA CGGGCCCGACGGGCTGCCCTACCTCAAGGTT CTCAAGGCGCCGGTGTTAACA CCACGGACAAAGAGATTGAGGTTCTCTATATTCGGAATGTAAC lili GAGGAC GCTGGGGAATATACGTGCTGGCGGGTAATTCTATTGGGATATCCI 1 ICACTC TGCATGGTTGACAGTTCTGCCAGCGCCTGGAAGAGAAAAGGAGATTACAGCTT CCCCAGACTACCTGGAGATAGCCATTTACTGCATAGGGGTCTTCTTAATCGCCT GTATGGTGGTAACAGT CATCCTGTGCCGAATGAAGAACACGACCAAGAAGCCA GACTTCAGCAGCCAGCCGGCTGTGCACAAGCTGACCAAACGTATCCCCCTGCG GAGACAGGTAACAGTTTCGGCTGAGTCCAGCTCCTCCATGAACTCCAACACCCC GCTGGTGAGGATAACAACACGCC1L1L1 1CAACGGCAGACACCCCCATGCTGG CAGGGGTCTCCGAGTATGAACTTCCAGAGGACCCAAAATGGGAGT TTCCAAGA GATAAGCTGACACTGGGCAAGCCCCTGGGAGAAGGTTGC1 1 IGGGCAAGTGGT CATGGCGGAAGCAGTGGGAATTGACAAAGACAAGCCCAAGGAGGCGGTCACCG TGGCCGTGAAGATGTTGAAAGATGATGCCACAGAGAAAGACCTTTCTGATCTG GTGTCAGAGATGGAGATGATGAAGATGATTGGGAAACACAAGAATATCATAAA TC1 1L1 1G GAGCCTGCACAGGATGGGCCTCTCTATGTCATAGTTGAGTATG CCTCTAAAGGCAACCTCCGAGAATACCTCCGAGCCCGGAGGCCACCCGGGATG GAGTACTCCTATGACATTAACCGTGTTCCTGAGGAGCAGATGACCTTCAAGGA CTTGGTGTCATGCACCTACCAGCTGGCCAGAGGCATGGAGTACTTGGCTTCCC AAAAATGTATTCATCGAGATTTAGCAGCCAGAAATG lili GGTAACA GAAAACA ATGTGATGAAAATAGCAGAC1 1 1GGACTCGCCAGAGATATCAACAATATAGACT ATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAA GCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGT GTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCG TGGAGGAACI 1 1 1 1AAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCC AACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCC CTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCAC TCTCACAACCAATGAGATGGCAGATGATCAGGGCTGTATTGAAGAGCAGGGGG TTGAGGATTCAGCAAATGAAGATTCAGTGGATGCTAAGCCAGACCGGTC CTCG TTTGTACCGTCCCTCTTCAGTAAGAAGAAGAAAAATGTCACCATGCGATCCATC AAGACCACCCGGGACCGAGTGCCTACATATCAGTACAACATGAA lili GAAAAG CTGGGCAAATGCATCATAATAAACAACAAGAACI 1 1GATAAAGTGACAGGTATG GGCGTTCGAAACGGAACAGACAAAGATGCCGAGGCGCTTCTCAAGTGCTTCCG AAGCCTGGGTTTTGACGTGATTGTCTATAATGACTGCTCTTGTGCCAAGATGC AAGATCTGCTTAAAAAAGCTTCTGAAGAGGACCATACAAATGCCGCCTGCTTCG CCTGCATCCTCTTAAGCCATGGAGAAGAAAATGTAATTTATGGGAAAGATGGT GTCACACCAATAAAGGATTTGACAGCCCACI 1 1AGGGGGGATAGATGCAAAAC CCI 1 1 1AGAGAAACCCAAAC1L1 ILI 1CATTCAGGCTTGCCGAGGGACCGAGCT TGATGATGGCATCCAGGCCGACTCGGGGCCCATCAATGACACAGATGCTAATC CTCGATACAAGATCCCAGTGGAAGCTGACTTCCTCTTCGCCTATTCCACGGTTC CAGGCTATTACTCGTGGAGGAGCCCAGGAAGAGGCTCCTGGTTTGTGCA AGCC CTCTGCTCCATCCTGGAGGAGCACGGAAAAGACCTGGAAATCATGCAGATCCT CACCAGGGTGAATGACAGAGTTGCCAGGCACI 1 1GAGTCTCAGTCTGATGACC CACACTTCCATGAGAAGAAGCAGATCCCCTGTGTGGTCTCCATGCTCACCAAGG AACTCTACTTCAGTCAATAG EXAMPLES These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein. EXAMPLE 1: Sensitivity of bladder cancer cell lines to erdafitinib Cell viability assays were performed to study the efficacy of erdafitinib in vitro. The cell lines shown in Table 5 were used in the MTT or CelITiter-Glo assay, as described below. Both assays measure the metabolic activity of cells but use different reagents for the determination of cell viability. MTT trial Cells were seeded in 96-well culture plates in 180 pL of culture medium recommended by the supplier at a density that ensured continuous log growth during the 4-day incubation period. The cells were incubated for 24 hours in a humidified incubator at 37 °C and with 5% CO2. A range of concentrations of erdafitinib was prepared in culture medium and 20 pL was added to the cells in each well. The cells were incubated for an additional 4 days, after which 25 pL of MTT (5 mg / mL in phosphate-buffered saline) was added to each well. Cells were incubated for 2 h at 37 °C and 5% CO after which the growth medium was removed. The remaining crystals were dissolved in 125 pL of glycine / DMSO buffer and the optical density at 540 nm was determined. Cells incubated without erdafitinib were used as untreated controls and were defined as 100%. The effect of erdafitinib was determined as % of control and IC50 values ​​were determined from dose-response effects curve fitting, as shown in Table 5. CelITiter-Glo assay Cells were seeded in 96-well culture plates in 180 pL of culture medium recommended by the supplier at a density that ensured continuous log growth during the 4-day incubation period. The cells were incubated for 24 hours in a humidified incubator at 37 °C and with 5% CO2. A range of concentrations of 5 erdafitinib was prepared in culture medium and 20 pL was added to the cells in each well. The cells were incubated for an additional 4 days, after which 100 pL of CelITiter-Glo reagent (Promega) was added to each well, the plates were shaken for 5 minutes at 500 rpm, and luminescence was detected using an Envision plate reader ( Perkin Elmer). Cells incubated without erdafitinib were used as untreated controls and were defined as 100%. The effect of erdafitinib was determined as % of control and IC50 values ​​were determined from dose-response effects curve fitting, as shown in Table 5. Table 5: Bladder cancer cell lines: sensitivity to erdafitinib Cell Line FGFR Status Tumor Stage and Grade Cell Viability IC50 (nM) Maximum Cell Viability Effect (O / O) CVSIM Assay Format MGH-U3 FGFR3 Y373C Ta / Tl G1 2.3 32 CelITiter-Glo RT4 FGFR3-TACC3 TI Gl / 2 1.1 65 MTT 97-7 FGFR3 S249C TI G2 / 3 5 32 CelITiter-Glo EJ28 unknown Tía G2 2640 - CelITiter-Glo T24 natural Ta G3 3330 - CelITiter-Glo unclassified UM-UC-1 natural TxG2 0.96 80 MTT UM-UC- 14 FGFR3 S249C TxG4 3.1 80 MTT 639-V natural / R248C? TxG3 >1000 - CelITiter-Glo Cell Line FGFR Status Tumor Stage and Grade Cell Viability CIso (nM) Maximum Cell Viability Effect (%) Assay Format 5637 Natural TxG2 3840 - CelITiter-Glo CLS439 Unknown Tx Gx 6540 - CelITiter-Glo Conclusion Cell viability assays demonstrated that several CVSIM cell lines (MGH-U3, RT4, and 97-7) containing alterations (mutations or fusion) of FGFR3 were sensitive to low nanomolar concentrations of erdafitinib. Two cell lines for which FGFR3 was wild-type (T24) or its status was unknown (EJ28) were not sensitive to erdafitinib. EXAMPLE 2: Open-label, multicenter, phase 2 study (NCT04172675) A non-limiting example of an open-label, multicenter, phase 2 study to evaluate relapse-free survival (RFS) in participants treated with erdafitinib versus investigator's choice, for participants with high-risk non-muscle invasive bladder cancer (NMIBC) who harbor fibroblast growth factor receptor (FGFR) mutations or fusions, and who relapsed after bacillus Calmette-Guerin (BCG) therapy. Aim The primary objective of this study is to evaluate RFS in patients treated with erdafitinib versus investigator's choice of intravesical therapy with gemcitabine / mitomycin C (MMC) / hyperthermic MMC, for patients with CVSIM-RA harboring FGFR mutations or fusions, and who relapsed after BCG therapy. Methods Study Overview Eligible patients will be selected based on the presence of FGFR mutations or fusions and assigned to 1 of 3 cohorts. See FIG 1 for a schematic representation of the study design. Cohort 1 (erdafitinib and active comparator) (n = 240) will include CVSIMRA-only patients with papilloma (absence of carcinoma in situ (CIS)), with disease relapse after BCG therapy and who refuse or are not eligible for cystectomy. Patients may not respond to BCG or have experience with BCG. Cohort 2 (experimental) (n = 20) will include patients with CVSIM-RA, who do not respond to BCG who present with carcinoma / / 7s / 7¿ / (CIS) with or without concurrent papilloma and who refuse or are not suitable for the cystectomy. This cohort is exploratory. Cohort 3 (experimental) (n = 20) will include patients with CVSIM-RI presenting with only papillary disease. No predefined requirement regarding BCG or intravesical chemotherapy. This cohort is exploratory. Patients in Cohort 1 may be randomized in a 2:1 ratio to receive oral erdafitinib or intravesical gemcitabine or intravesical hyperthermic mitomycin C (MMC) / MMC. Participants who are randomized to gemcitabine or hyperthermic MMC / MMC in Cohort 1 and demonstrate relapse as assessed by the investigator's disease will have the opportunity to progress to treatment with erdafitinib. Randomization will be stratified by tumor stage (Ta vs TI) and type of prior BCG therapy (BCG non-responsive vs BCG experienced). All patients enrolled in Cohorts 2 and 3 will receive treatment with erdafitinib. Erdafitinib will be discontinued in Cohort 2 if no CR is observed within 3 months. Erdafitinib will be discontinued in Cohort 3 if no partial response (PR) or CR is observed within 3 months. For Cohort 2, CR is defined as at least one of the following: 1) negative cystoscopy and negative urine cytology (including atypical); or 2) positive cystoscopy with biopsy-proven benign or low-grade NMIBC and negative cytology. The CR rate at 6 months will be calculated with its exact two-sided 95% CI. For Cohort 3, CR is defined as the disappearance of the marker lesion, with no remnant present and no viable tumor observed on histopathological examination. The CR rate will be calculated with its exact two-sided 95% CI. The follow-up phase will include a 30-day safety follow-up visit, disease assessment follow-up, and survival follow-up. In Cohort 1 (erdafitinib), participants may receive oral erdafitinib starting on Cycle 1, Day 1 until 2 years of treatment have been completed, disease relapse, intolerable toxicity, withdrawal of consent, investigator decision to interrupt treatment or end the study, whichever comes first. Each cycle is 28 days. The dose is 8 mg daily and may be increased up to 9 mg based on phosphate status on Cycle 1, Day 14. Following a protocol modification, the dose will be changed to 6 mg daily with the option to increase dosage up to 8 mg daily based on phosphate level at the end of the cycle 1 treatment period (Cycle 2, Day 1). In Cohort 1 (investigator's choice), gemcitabine will be administered once weekly (2000 mg) for at least 4 induction doses followed by monthly maintenance for at least 6 months. In Cohort 1 (investigator's choice), mitomycin C cnRAnn / zznz / B / YiAi will be administered once weekly (40 mg dose) for at least 4 induction doses followed by monthly maintenance for at least 6 months. In Cohort 2, participants will receive oral erdafitinib starting on Cycle 1, Day 1 until completion of 2 years of treatment, disease relapse, intolerable toxicity, withdrawal of consent, investigator decision to discontinue treatment, or completion of the study, whichever comes first. Each cycle is 28 days. The dose is 8 mg per day and may be increased up to 9 mg based on phosphate level on Cycle 1, Day 14. Following a protocol modification, the dose will be changed to 6 mg per day with the option to increase dosage up to 8 mg daily based on phosphate level at the end of the cycle 1 treatment period (Cycle 2, Day 1). In Cohort 3, participants will receive oral erdafitinib starting on Cycle 1, Day 1 until completion of 2 years of treatment, disease relapse, intolerable toxicity, withdrawal of consent, investigator decision to discontinue treatment, or completion of the study, whichever comes first. Each cycle is 28 days. The dose is 8 mg daily and may be increased up to 9 mg based on phosphate status on Cycle 1, Day 14. Following a protocol modification, the dose will be changed to 6 mg daily with the option to increase dosage up to 8 mg daily based on phosphate level at the end of the cycle 1 treatment period (Cycle 2, Day 1). Inclusion and exclusion criteria The study will enroll patients according to the following inclusion and exclusion criteria at sites in 14 countries, including the United States. Inclusion criteria 1. Age equal to or greater than 18 years; 2. Eastern Cooperative Oncology Group (ECOG) status equal to or less than 1; 3. Urothelial carcinoma of the bladder without muscle invasion, with histologically confirmed relapse with: to. Cohort 1: High-grade papillary disease Ta / Tl lesion; b. Cohort 2: CIS with or without papillary disease; c. Cohort 3: Low-grade Ta / Tl marker lesion (G1-G2); 4. Tumor with one or more predefined genetic alterations of FGFR2 or FGFR3 (including mutations and fusions). 5. Refuses or is unsuitable for cystectomy (Cohorts 1 and 2 only); 6. Signed informed consent form indicating that he or she understands the purpose and procedures required for the study and is willing to participate in the study; 7. A woman of childbearing potential must have a negative pregnancy test (beta hCG [beta human chorionic gonadotropin]) (urine or serum) within 7 days before randomization (Cohort 1) or the first dose of study drug (Cohort 2). and Cohort 3); 8. Adequate bone marrow, liver and kidney function; 9. Participants who do not respond to BCG after adequate therapy to BCG or BCG-experienced without response to BCG: Patients have one of the following relapsed disease states and have received appropriate BCG therapy as defined below: to. Persistent or relapsed CIS alone or with relapsed Ta / Tl disease (papilloma / noninvasive papillary disease / tumor invades subepithelial connective tissue) within 12 months of completion of appropriate BCG therapy (Cohort 2 only); b. High-grade Ta / Tl disease with relapse within 6 months of completion of appropriate BCG therapy; c. High-grade TI at first disease evaluation after a BCG induction cycle. Adequate BCG (minimal treatment requirements) to. At least 5 of 6 full doses of an initial induction cycle plus at least 1 maintenance (2 of 3 full weekly doses) over a 6-month period (a full dose of BCG should comprise 1 full vial with a minimum of 1 x 108 units colony forming (CFU)); either b. At least 5 of 6 full doses of an initial induction cycle plus at least 2 of 6 full doses of a second induction cycle. BCG Experience: Patients have recurrent high-grade Ta / Tl disease within 12 months of completion of BCG therapy and their prior BCG therapy is the minimum treatment requirement as follows: d. At least 5 of 6 complete doses of an initial induction cycle; either and. At least 5 of 6 full doses of an initial induction cycle plus at least 1 maintenance (2 of 3 weekly doses) over a 6-month period. Half the dose or one-third of the dose is allowed during maintenance. Exclusion criteria 1. Histologically confirmed urothelial carcinoma of the bladder with muscle invasion (stage T2 or higher); 2. Histopathology with a microcytic component, pure adenocarcinoma, pure squamous cell carcinoma, or pure squamous CIS of the bladder; 3. Other active malignancies. The only exceptions allowed are: (a) skin cancer treated within the last 24 months that is considered completely cured (b) adequately treated lobular carcinoma in situ (LCIS) and ductal CIS (c) history of localized breast cancer and having received antihormonal agents, or history of localized prostate cancer (NOMO) and receiving androgen deprivation therapy; 4. Previous treatment with an FGFR inhibitor; 5. Major surgery within 4 weeks prior to Cycle 1, Day 1 (C1D1); 6. No recovery from toxicity of previous anticancer therapy; 7. Central serous retinopathy or retinal pigment epithelium detachment of any degree. Study objectives For Cohort 1, the primary objective is to evaluate RFS in patients treated with erdafitinib versus investigator's choice, for patients with high-risk CVSIM harboring FGFR mutations or fusions and who relapsed after BCG therapy. The secondary objective is to evaluate other measures of effectiveness. For Cohort 2, the exploratory objective is to evaluate the efficacy of erdafitinib based on the CR rate at 6 months in patients with high-risk, BCG-unresponsive CVSIM and FGFR mutations or fusions. For Cohort 3, the exploratory objective is to evaluate the efficacy of erdafitinib based on the CR rate for the marker lesion in patients with intermediate-risk CVSIM and FGFR mutations or fusions. Primary v Exploratory Endpoints / Evaluation Criteria For Cohort 1, the primary endpoint is SRH with a time frame of up to 4 years. Secondary endpoints, timelines, and descriptions are provided in Table 6. Table 6: Secondary evaluation criteria Endpoint Time frame Description Time to worsening of disease Up to 4 years Time from date of randomization to date of first documented evidence of cystectomy, change in therapy indicative of more advanced disease (including radiotherapy or systemic chemotherapy) . Participants who are alive and without worsening disease or whose status is unknown will be censored at the last tumor evaluation. Time to advancement Up to 4 years Time from randomization date to Evaluation Criteria Deadline Description date of first documented evidence of any progression or death. Participants who are alive and without progression or whose status is unknown will be censored on the date of last tumor evaluation. Disease-specific survival Up to 4 years Time from the date of randomization to the date of the participant's death resulting from bladder cancer. Participants who are alive or have unknown vital status will be censored on the date the participant was last known to be alive. Participants whose death results from causes other than bladder cancer will be censored on their dates of death. Average survival Up to 4 years Time from the date of randomization to the date of the participant's death resulting from any cause. Participants who are alive or have unknown vital status will be censored on the date the participant was last known to be alive. Relapse-free survival 2 (RFS2) 6, 12, and 24 months RFS is defined as the time from the date of randomization to the date of recurrence of high-risk disease or death, whichever is reported first. Participants who are alive and without relapse or whose status is unknown will be censored at the last tumor evaluation. Relapse-free survival 2 (RFS2) Up to 4 years RFS2 is defined as the time from the date of randomization to the date of recurrence of high-risk disease at the first subsequent nonsurgical anticancer treatment, or death, whichever is reported first. SSR by review Up to 4 years SSR will be evaluated by review cnRAnn / zznz / E / YiAi Evaluation criterion Term Central histopathological description central histopathological. RFS is defined as the time from the date of randomization to the date of recurrence of high-risk disease or death, whichever is reported first. Plasma concentration of erdafitinib Cycle 1 Day 14, Cycle 2 Day 1 (each cycle is 28 days) Plasma concentration of erdafitinib will be reported. Number of participants with adverse events Up to 4 years An adverse event is any unfavorable medical event that occurs in a participant administered an investigational product, and does not necessarily indicate only events with a clear causal relationship to the relevant investigational product. Change from Baseline in Patient's Global Impression of (Cancer) Severity (IGGP) From Baseline to 4 Years The GIGP are single-item questionnaires to assess the patient's global impression of severity. Change from baseline in the patient's global impression of change (cancer) (IGCP) Baseline, Cycle 2 Day 1 and end of treatment (up to 2 years) (each cycle is 28 days) The IGCP are questionnaires of a single item to evaluate a patient's global impression of cancer change. Change from Baseline on the European Organization for Research and Treatment of Cancer Quality of Life Questionnaire From Baseline to 4 Years The EORTC CCV-C30 is a 30-item core questionnaire to assess quality of life. related health outcomes (HRQoL) of participants participating in cancer clinical trials. cnRAnn / zznz / E / YiAi Evaluation Criteria Time Frame Description (EORTC LCC) -C30 Change from Baseline in EORTC LCC Non-Muscle Invasive Bladder Cancer (CVSIM) 24 From Baseline to 4 Years The EORTC LCC-CVSIM24 is a 24-item questionnaire for evaluate HRQoL of participants with superficial (non-muscle invasive) bladder cancer. The questionnaire is designed to complement the CCV-C30. Change from initial conditions in the European quality of life questionnaire, 5 dimensions and 5 levels, (EQ-5D-5L) of the EuroQoI Group. From baseline to 4 years EQ-5D-5L is a standardized measure of health status developed by the EuroQoI Group to provide a simple, generic health measure for clinical and economic evaluation. The EQ5D-5L descriptive system includes the following 5 dimensions: mobility, personal care, usual activities, pain / discomfort, and anxiety / depression. Maximum observed analyte concentration (Cmax) of midazolam and its metabolite (1-OH-midazolam) Predose, Cycle 1 Day 13 (each cycle is 28 days) Cmax is the maximum observed analyte concentration. Time to reach the maximum observed analyte concentration (Tmax) of midazolam and its metabolite (1-OH-midazolam) Predose, Cycle 1 Day 13 (each cycle is 28 days) Tmax is defined as the actual sampling time to reach the maximum analyte concentration observed. Area under the analyte concentration versus time curve (AUC) from time zero to the time of the last measurable analyte concentration of midazolam and its metabolite (1-OH- Predose, Cycle 1 Day 13 (each cycle is 28 days) ABClast is defined as from time zero to the time of the last measurable analyte concentration (not below the limit of quantitation [DLC]). Evaluation criterion Time frame Description midazolam) Area under the curve (AUC) of analyte concentration versus time from time zero to infinite time of midazolam and its metabolite (1-OH-midazolam) Predose, Cycle 1 Day 13 (each cycle is 28 days) AUCinfinite is defined as from time zero to infinite time Maximum observed plasma concentration (Cmax) of metformin Predose, Cycle 1 Day 14 (each cycle is 28 days) Cmax is the maximum observed concentration of analyte Time to reach concentration maximum observed plasma concentration (Tmax) of metformin Predose, Cycle 1 Day 14 (each cycle is 28 days) Tmax is defined as the actual sampling time to reach the maximum observed plasma concentration. Area under the curve (AUC) of analyte concentration versus time from time zero to the time of the last measurable metformin concentration Predose, Cycle 1 Day 14 (each cycle is 28 days) AUClast is defined as from time zero to the time of last measurable analyte concentration (not below the limit of quantification [DLC]) Area under the curve (AUC) of analyte concentration versus time from time zero to infinite time of metformin Predose, Cycle 1 Day 14 ( each cycle is 28 days) ABCinfinito is defined as from time zero to time infinite For Cohort 2, the exploratory endpoint is the CR rate at 6 months. For Cohort 3, the exploratory endpoint is CR rate. Security Assessments Safety assessments will be based on medical review of adverse event reports and the results of vital sign measurements, 12-lead ECG, physical examinations, clinical laboratory tests, ophthalmologic examinations, and other safety assessments from baseline to 30 days after the last dose of study drug. All adverse events, serious adverse events and special reporting situations, whether serious or non-serious, will be reported. The following clauses describe matters of the present invention. 1. A method of treating high-risk non-muscle invasive bladder cancer (CVSIM-RA) comprising a fibroblast growth factor receptor (FGFR) inhibitor at a dose of approximately 6 mg per day to a patient receiving has been diagnosed with CVSIM-RA and harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. 2. The method of clause 1, wherein the patient received bacille Calmette-Guérin (BCG) therapy prior to said administration of said FGFR inhibitor. 3. The method of clause 2, where BCG therapy is an appropriate BCG therapy. 4. The method of clause 2 or 3, where the patient does not respond to BCG therapy. 5. The method of clause 2 or 3, where the patient has experience with BCG. 6. The method of any one of the previous clauses, where the patient has a papilloma. 7. The method of any one of the previous clauses, where the patient has carcinoma in situ. 8. The method of any one of the above clauses, where the patient has not previously undergone or is not suitable for a cystectomy. 9. The method of any one of the previous clauses, wherein said administration of the FGFR inhibitor provides an increase in relapse-free survival compared to a population of patients with CVSIM-RA who have been administered a placebo. 10. The method of any one of clauses 1 to 8, wherein said administration of the FGFR inhibitor provides an increase in relapse-free survival relative to a population of patients with CVSIM-RA who have been administered intravesical gemcitabine or mitomycin Intravesical C (MMC) / hyperthermic MMC. 11. The method of any one of the above clauses, where the patient shows a complete response to the FGFR inhibitor at approximately 6 months. 12. The method of any one of the preceding clauses, wherein the FGFR2 genetic alteration and / or FGFR3 genetic alteration is an FGFR3 gene mutation, FGFR2 gene fusion, or FGFR3 gene fusion. 13. The method of clause 12, where the gene mutation of FGFR3 is R248C, S249C, G370C, Y373C or any combination of these. 14. The method of clause 12, wherein the FGFR2 or FGFR3 gene fusion is FGFR3-TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination of are. 15. The method of any one of the preceding clauses, further comprising evaluating a biological sample from the patient for the presence of at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration prior to said administration of the FGFR inhibitor. 16. The method of clause 15, where the biological sample is blood, lymphatic fluid, bone marrow, a solid tumor sample, or any combination of these. 17. The method of any one of the previous clauses where the FGFR inhibitor is erdafitinib. 18. The method in clause 17, where erdafitinib is administered daily. 19. The method of clause 17 or 18, where erdafitinib is administered orally. 20. The method of any one of clauses 17 to 19, wherein erdafitinib is administered orally on a continuous daily dosing schedule. 21. The method of any one of clauses 17 to 19, wherein erdafitinib is administered at a dose of approximately 6 mg once a day. 22. The method of any one of clauses 17 to 19, where the dose of erdafitinib is increased from 6 mg per day to 8 mg per day after initiating treatment if the patient has a serum phosphate (PO4) level that is less than approximately 5.5 mg / dL. 23. The method of any one of clauses 17 to 22, wherein erdafitinib is administered in a solid pharmaceutical form. 24. The method of clause 23, where the solid dosage form is a tablet. 25. A method to treat high-risk non-muscle invasive bladder cancer (CVSIM-RA): (a) evaluate a biological sample from a patient diagnosed with CVSIMRA for the presence of one or more fibroblast growth factor receptor (FGFR) gene alterations; and (b) administering a fibroblast growth factor receptor (FGFR) inhibitor at a dose of approximately 6 mg per day to the patient if one or more FGFR gene alterations are present in the sample. 26. A method of treating intermediate risk non-muscle invasive bladder cancer (CVSIM-RI) comprising a cnRAnn / zznz / B / YiAi fibroblast growth factor receptor (FGFR) inhibitor at a dose of approximately 6 mg daily. day to a patient who has been diagnosed with CVSIM-RI and who harbors at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3. 27. The method of clause 26, where the patient has a papilloma. 28. The method of clauses 26 or 27, where the patient has undergone an incomplete transurethral resection. 29. The method of any one of clauses 26 to 18, where the patient shows a complete response to the FGFR inhibitor at approximately 3 months. 30. The method of any one of clauses 26 to 29, wherein the genetic alteration of FGFR2 and / or genetic alteration of FGFR3 is an FGFR3 gene mutation, FGFR2 gene fusion or FGFR3 gene fusion. 31. The method of clause 30, where the FGFR3 gene mutation is R248C, S249C, G370C, Y373C or any combination thereof. 32. The method of clause 30, wherein the FGFR2 or FGFR3 gene fusion is FGFR3-TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination of are. 33. The method of any one of clauses 26 to 32, wherein the FGFR inhibitor is erdafitinib. 34. A fibroblast growth factor receptor (FGFR) inhibitor for use in the treatment of high-risk non-muscle invasive bladder cancer (CVSIM-RA) in a patient harboring at least one genetic alteration of FGFR2 and / or or genetic alteration of FGFR3, where the FGFR inhibitor must be administered at a dose of approximately 6 mg per day. 35. A fibroblast growth factor receptor (FGFR) inhibitor for use in the treatment of intermediate-risk non-muscle invasive bladder cancer (CVSIM-RI) in a patient harboring at least one genetic alteration of FGFR2 and / or or genetic alteration of FGFR3, where the FGFR inhibitor must be administered at a dose of approximately 6 mg per day. 36. The use of a fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a drug for the treatment of a patient diagnosed with high-risk non-muscle invasive bladder cancer (CVSIM-RA) harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, where the FGFR inhibitor should be administered at a dose of approximately 6 mg per day. 37. The use of a fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a drug for the treatment of a patient diagnosed with intermediate risk non-muscle invasive bladder cancer (CVSIM-RI) harboring at least one genetic alteration of FGFR2 and / or genetic alteration of FGFR3, where the FGFR inhibitor should be administered at a dose of approximately 6 mg per day. 38. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of clauses 34 to 37, where the patient received therapy with bacillus Calmette-Guérin (BCG) before said administration of said FGFR inhibitor. 39. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of clause 38, wherein the BCG therapy is a BCG therapy appropriate. 40. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor from clause 38 or 39, where the patient does not respond to therapy with BCG. 41. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor from clause 38 or 39, where the patient has experience with BCG. 42. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of clauses 34 to 41, where the patient has a papilloma. 43. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of clauses 34 to 42, where the patient has carcinoma in situ. 44. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of claims 34 to 43, wherein the patient does not have previously undergone or are not suitable for a cystectomy. 45. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of clauses 34 to 44, wherein the genetic alteration of FGFR2 and / or genetic alteration of FGFR3 is an FGFR3 gene mutation, FGFR2 gene fusion or FGFR3 gene fusion. 46. ​​A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of clause 45, wherein the FGFR3 gene mutation is R248C, S249C , G370C, Y373C, or any combination of these. 47. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of clause 45, wherein the gene fusion of FGFR2 or FGFR3 is FGFR3 -TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination of these. 48. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of clauses 34 to 47, wherein the inhibitor FGFR is erdafitinib. The examples and embodiments described herein are for illustrative purposes only and various modifications or changes occurring to those skilled in the art should be included within the spirit and scope of this application and the scope of the appended claims.

Claims

1. The use of a fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a drug to treat high-risk non-muscle-invasive bladder cancer (HMI-IC), wherein the (FGFR) inhibitor is adapted to be administered at a dose of approximately 6 mg daily to a patient who has been diagnosed with HMI-IC and who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration.

2. The use as claimed in claim 1, wherein the patient received Bacillus Calmette-Guérin (BCG) therapy prior to said administration of said FGFR inhibitor.

3. The use as claimed in claim 2, wherein BCG therapy is suitable BCG therapy.

4. Use as claimed in claim 2 or 3, wherein the patient does not respond to BCG therapy.

5. Use as claimed in claim 2 or 3, where the patient has experience with BCG.

6. The use as claimed in any of the preceding claims, wherein the patient has a papilloma.

7. The use as claimed in any of the preceding claims, wherein the patient has carcinoma in situ.

8. Use as claimed in any of the preceding claims, wherein the patient has not previously undergone or is not suitable for a cystectomy.

9. The use as claimed in any of the preceding claims, wherein said administration of the FGFR inhibitor provides an increase in relapse-free survival compared to a population of patients with ARVC who have been administered a placebo.

10. The use as claimed in any of claims 1 to 8, wherein said administration of the FGFR inhibitor provides an increase in relapse-free survival compared to a population of patients with AR-MISCVD who have been administered intravesical gemcitabine or intravesical mitomycin C (MMC) / hyperthermic MMC.

11. Use as claimed in any of the preceding claims, wherein the patient shows a complete response to the FGFR inhibitor at approximately 6 months.

12. The use as claimed in any of the preceding claims, wherein the genetic alteration of FGFR2 and / or genetic alteration of FGFR3 is a gene mutation of FGFR3, gene fusion of FGFR2 or gene fusion of FGFR3.

13. The use as claimed in claim 12, wherein the FGFR3 gene mutation is R248C, S249C, G370C, Y373C or any combination thereof.

14. The method of claim 12, wherein the gene fusion of FGFR2 or FGFR3 is FGFR3-TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination thereof.

15. The use as claimed in any of the preceding claims, wherein the use further comprises evaluating a biological sample from the patient to detect the presence of at least one FGFR2 and / or FGFR3 genetic alteration prior to said administration of the FGFR inhibitor.

16. The use as claimed in claim 15, wherein the biological sample is blood, lymphatic fluid, bone marrow, a solid tumor sample, or any combination thereof.

17. The use as claimed in any of the preceding claims wherein the FGFR inhibitor is erdafitinib.

18. The use as claimed in claim 17, wherein erdafitinib is adapted to be administered daily.

19. The use as claimed in claim 17 or 18, wherein erdafitinib is adapted to be administered orally.

20. The use as claimed in any of claims 17 to 19, wherein erdafitinib is adapted to be administered orally on a continuous daily dosing program.

21. The use as claimed in any of claims 17 to 19, wherein erdafitinib is adapted to be administered at a dose of approximately 6 mg once daily.

22. The use as claimed in any of claims 17 to 21, wherein erdafitinib is adapted to be administered in a solid pharmaceutical form.

23. The use as claimed in claim 22, wherein the solid pharmaceutical form is a tablet.

24. The use of a fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a drug for treating high-risk non-muscle-invasive bladder cancer (HMIBC-RA), wherein the use comprises: (a) screening a biological sample from a patient diagnosed with HMIBC-RA for the presence of one or more fibroblast growth factor receptor (FGFR) gene alterations; and (b) wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg daily to the patient if one or more FGFR gene alterations are present in the sample.

25. The use of a fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a drug to treat intermediate-risk non-muscle-invasive bladder cancer (IMVS-RI) wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg daily to a patient who has been diagnosed with IMVS-RI and who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration.

26. The use as claimed in claim 25, where the patient has a papilloma.

27. Use as claimed in claim 25 or 26, wherein the patient has undergone incomplete transurethral resection.

28. Use as claimed in any of claims 25 to 27, wherein the patient shows a complete response to the FGFR inhibitor at approximately 3 months.

29. The use as claimed in any of claims 25 to 28, wherein the genetic alteration of FGFR2 and / or genetic alteration of FGFR3 is a gene mutation of FGFR3, gene fusion of FGFR2 or gene fusion of FGFR3.

30. The use as claimed in claim 29, wherein the FGFR3 gene mutation is R248C, S249C, G370C, Y373C or any combination thereof.

31. The use as claimed in claim 29, wherein the gene fusion of FGFR2 or FGFR3 is FGFR3-TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination thereof.

32. The use as claimed in any of claims 25 to 31, wherein the FGFR inhibitor is erdafitinib.

33. A fibroblast growth factor receptor (FGFR) inhibitor for use in the treatment of high-risk non-muscle-invasive bladder cancer (HMI-RA) in a patient harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg daily.

34. A fibroblast growth factor receptor (FGFR) inhibitor for use in the treatment of intermediate-risk non-muscle-invasive bladder cancer (IVN-IR) in a patient harboring at least one FGFR2 genetic alteration and / or an FGFR3 genetic alteration, wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg daily. cnRAnn / zznz / B / YiAi 35. The use of a fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a medicament for the treatment of a patient diagnosed with high-risk non-muscle-invasive bladder cancer (HMI-RA) harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg per day.

36. The use of a fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a medicinal product for the treatment of a patient diagnosed with intermediate-risk non-muscle-invasive bladder cancer (IM-IVBC) harboring at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration, wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg per day.

37. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of claims 33 to 36, wherein the patient received Bacillus Calmette-Guérin (BCG) therapy prior to said administration of said FGFR inhibitor.

38. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of claim 37, wherein BCG therapy is suitable BCG therapy.

39. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of claim 37 or 38, wherein the patient does not respond to BCG therapy.

40. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of claim 37 or 38, wherein the patient is BCG experienced.

41. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of claims 33 to 40, wherein the patient has a papilloma.

42. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of claims 33 to 41, wherein the patient has carcinoma in situ.

43. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of claims 33 to 42, wherein the patient has not previously undergone or is not suitable for a cystectomy.

44. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of claims 33 to 43, wherein the genetic alteration of FGFR2 and / or genetic alteration of cnRRnn / zznz / E / YiAi FGFR3 is a gene mutation of FGFR3, gene fusion of FGFR2 or gene fusion of FGFR3.

45. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of claim 44, wherein the FGFR3 gene mutation is R248C, S249C, G370C, Y373C, or any combination thereof.

46. ​​A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of claim 44, wherein the gene fusion of FGFR2 or FGFR3 is FGFR3-TACC3, in particular FGFR3TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination thereof.

47. A fibroblast growth factor receptor (FGFR) inhibitor for use or the use of a fibroblast growth factor receptor (FGFR) inhibitor of any one of claims 33 to 46, wherein the FGFR inhibitor is erdafitinib.

48. A fibroblast growth factor receptor (FGFR) inhibitor for use in the treatment of high-risk non-muscle-invasive bladder cancer (HMI-IC), wherein the (FGFR) inhibitor is adapted to be administered at a dose of approximately 6 mg daily to a patient who has been diagnosed with HMI-IC and who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration.

49. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 48, further characterized in that the patient received Bacillus Calmette-Guérin (BCG) therapy prior to said administration of said FGFR inhibitor.

50. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 49, further characterized in that BCG therapy is a suitable BCG therapy.

51. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 49 or 50, further characterized in that the patient does not respond to BCG therapy.

52. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 49 or 50, further characterized in that the patient has experience with BCG.

53. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 52, further characterized in that the patient has a papilloma.

54. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 43, further characterized in that the patient has carcinoma in situ.

55. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 54, further characterized in that the patient has not previously undergone or is not eligible for a cystectomy.

56. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 55, further characterized in that said administration of the FGFR inhibitor provides an increase in relapse-free survival compared to a population of patients with ARVC who have been administered a placebo.

57. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 55, further characterized in that said administration of the FGFR inhibitor provides an increase in relapse-free survival compared to a population of patients with AR-MISCVD who have been administered intravesical gemcitabine or intravesical mitomycin C (MMC) / hyperthermic MMC.

58. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 57, further characterized in that the patient shows a complete response to the FGFR inhibitor at approximately 6 months.

59. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 58, further characterized in that the genetic alteration of FGFR2 and / or genetic alteration of FGFR3 is a gene mutation of FGFR3, gene fusion of FGFR2 or gene fusion of FGFR3.

60. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 59, further characterized in that the FGFR3 gene mutation is R248C, S249C, G370C, Y373C or any combination thereof.

61. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 59, further characterized in that the gene fusion of FGFR2 or FGFR3 is FGFR3-TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination thereof.

62. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 61, further characterized in that the use further comprises evaluating a biological sample from the patient to detect the presence of at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration prior to said administration of the FGFR inhibitor.

63. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 62, further characterized in that the biological sample is blood, lymphatic fluid, bone marrow, a solid tumor sample, or any combination thereof. cnRAnn / zznz / B / YiAi 64. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 48 to 63, further characterized in that the FGFR inhibitor is erdafitinib.

65. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 64, further characterized in that erdafitinib is adapted to be administered daily.

66. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 64 or 65, further characterized in that erdafitinib is adapted to be administered orally.

67. The fibroblast growth factor receptor (FGFR) inhibitor according to claims 64 to 66, further characterized in that erdafitinib is adapted to be administered orally in a continuous daily dosing program.

68. The fibroblast growth factor receptor (FGFR) inhibitor according to claims 64 to 66, further characterized in that erdafitinib is adapted to be administered at a dose of approximately 6 mg once daily.

69. The fibroblast growth factor receptor (FGFR) inhibitor according to claims 64 to 68, further characterized in that erdafitinib is adapted to be administered in a solid pharmaceutical form.

70. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 69, further characterized in that the solid pharmaceutical form is a tablet.

71. A fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a drug for treating high-risk non-muscle-invasive bladder cancer (HMI-IC), wherein the use comprises: (a) screening a biological sample from a patient diagnosed with HMI-IC to detect the presence of one or more fibroblast growth factor receptor (FGFR) gene alterations; and (b) wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg daily to the patient if one or more FGFR gene alterations are present in the sample.

72. A fibroblast growth factor receptor (FGFR) inhibitor for the manufacture of a drug to treat intermediate-risk non-muscle-invasive bladder cancer (IMVS-RI) wherein the FGFR inhibitor is adapted to be administered at a dose of approximately 6 mg daily to a patient who has been diagnosed with IMVS-RI and who harbors at least one FGFR2 genetic alteration and / or FGFR3 genetic alteration.

73. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 72, further characterized in that the patient has a papilloma.

74. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 72 or 73, further characterized in that the patient has undergone an incomplete transurethral resection.

75. The fibroblast growth factor receptor (FGFR) inhibitor according to claims 72 to 74, further characterized in that the patient shows a complete response to the FGFR inhibitor at approximately 3 months.

76. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 72 to 75, further characterized in that the genetic alteration of FGFR2 and / or genetic alteration of FGFR3 is a gene mutation of FGFR3, gene fusion of FGFR2 or gene fusion of FGFR3.

77. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 76, further characterized in that the FGFR3 gene mutation is R248C, S249C, G370C, Y373C or any combination thereof.

78. The fibroblast growth factor receptor (FGFR) inhibitor according to claim 76, further characterized in that the gene fusion of FGFR2 or FGFR3 is FGFR3-TACC3, in particular FGFR3-TACC3 VI or FGFR3-TACC3 V3, FGFR3-BAIAP2L1, FGFR2-BICC1, FGFR2-CASP7, or any combination thereof.

79. The fibroblast growth factor receptor (FGFR) inhibitor according to any of claims 72 to 78, further characterized in that the FGFR inhibitor is erdafitinib.