PLANT FLOWERING CONTROL.

Abstract

The present invention relates to a Vitis sp. plant or part thereof having a reduced level of flower sex polypeptide (FSL) activity compared to a corresponding wild-type Vitis sp. plant or part thereof having an FSL locus genotype that confers a hermaphrodite flower phenotype, wherein said Vitis sp. plant or part thereof comprises an FSL locus comprising a polynucleotide sequence encoding the FSL polypeptide, and wherein the polynucleotide sequence comprises a genetic modification in the region encoding a plant domain with an AT₂-rich zinc-binding sequence (PLATZ) of the FSL polynucleotide in relation to a corresponding polynucleotide sequence of a wild-type Vitis sp. FSL locus allele that confers a hermaphrodite flower phenotype when expressed, whereby the genetic modification causes a male reproductive part of a flower in the Vitis sp. plant to be expressed.or part of it is not functional.

Description

CONTROL OF THE FLOWERING OF PLANTS MA / a / ZUZI / UIOOUO RELATED REQUEST This Application claims priority over Australian Provisional Patent Application No. 2019902304, filed on June 28, 2019, and No. 2019902483, filed on July 12, 2019, the contents of which are incorporated herein in their entirety as reference for all purposes. FIELD OF INVENTION The present disclosure relates to plants and plant parts that have an altered level of flower sex polypeptide (FSL) activity and methods for controlling the flower sex phenotype of the plant based on the altered activity of the FSL polypeptide and / or genotype of the FSL locus. New plants that produce seedless stenospermocarpic and / or parthenocarpic fruits, and methods for producing them, are also provided. BACKGROUND OF THE INVENTION Sex of flowers Wild grapevine plants, sometimes called Vitis sylvestrís, are dioecious, meaning the plants have either male or female flowers. Wild plants flower once they reach the top of the canopy and are exposed to intense light, producing large numbers of small flower clusters (Carmona et al., 2008). The berries produced by the female plants of the wild vine are small and in small clusters. The unisexual flowers produced by Vitis species still possess rudimentary organs of the opposite sex. Cultivated vine plants are hermaphrodites. Commercial vineyards have hermaphroditic flowering plants in which autogamy (self-fertilization) is believed to be the main route of pollination. The sex of flowers is identified by observing physical characteristics, which requires a mature plant that is flowering and even with mature flowers. Male flowers have erect stamens, viable pollen, and a small, poorly developed non-functional carpel. Hermaphrodite flowers have erect stamens, viable pollen, and a functional carpel. The female flower is characterized by a functional carpel and reflected stamens and infertile pollen that does not germinate (Carmona et al., 2008). Dioecious plants with only female flowers are typically of lower commercial value for fruit production, as they require a nearby male or hermaphrodite plant to provide pollen for fruiting (Battilana etal., 2013). Flower types follow a bisexual development pattern during the early stages of floral development, and unisexuality arises through organ abortion in the late stage, when maturity of all floral organs occurs (Pannell, 2017), this It appears to apply to all flowering plants and is postulated to have evolved with the origin of flowers (Chanderbali et al., 2010). Flower sex remains of commercial interest as it can be a problem for reproduction as well as crop production and yield (e.g. seed collection or fruit size, yield of the fruits per plant). In some species, the ratio between female and male flowers has been a cause of poor yield (Mao et al., 2017 in Vernicia fordii (tung oil tree)). Corn (Zea mays), cucumber (Cucumis sativus) and melon (Cucumis meló) are monoecious plants that have been the subject of important studies and developments (Tanurdzic and Banks 2004) to become important crops for human and animal nutrition. Dioecious plants with male and female flowers on separate plants include snowdrop (Silene latifolia), papaya (Carica papaya), hemp (Cannabis sativa) and annual mercurial (Mercurialis annua) (Mao et al., 2017). . The sex of plant flowers can be influenced or manipulated by environmental conditions, genetic mutation, or the application of hormones, so the sexual identity of a plant is considered quantitative (Pannell 2017). In the family Cucurbitaceae, sex expression is controlled by a network of genetic, hormonal and environmental factors. Cucumbers (Cucumis sativus) are one of the crops that have been bred to be gynophilous to increase productivity by producing only female flowers. Sexual expression is thought to be controlled by an F locus, which regulates the expression of female flowers, and an M locus that is thought to regulate the expression of bisexual flowers (Yamasaki et al., 2001). Sexual expression is capable of being modulated by plant hormones, such as ethylene, and environmental stimuli. In watermelon, gynotic (gy), andromonoecious (a), and trimonoecious (tm) loci control the inheritance of sexual forms (Ji et al., 2015). At the genetic level, sex determination of cucumber, melon and watermelon is controlled by combinations of three pairs of genes. Monoecious cucumber is controlled by the 1-aminocyclopropane-1-carboxylate synthase (ACS) gene that is specifically expressed in carpels and is involved in the arrest of stamen development in female flowers (Manzano et al. , 2011). This gene and its family members similarly control flower sex in watermelon by having roles in the rate-limiting enzyme of ethylene biosynthesis (Ji et al., 2016), the loss of function that results in flowers bisexual (CsACSI 1 / CsACS2) or promotion of female flowers (CsACSIG) and interaction with transcription factors (CmWIPI) to influence the plant to express gynotic or hermaphroditic flowers (Jie et al., 2017). MA / a / ZUZI / UIOOUO The ethylene biosynthetic enzyme 1-aminocyclopropane-1-carboxylate synthase (ACS) plays a key role in influencing the expression of female flowers in monoecious, andromonoecious and gynomic cucumber plants (Yamasaki et al., 2000; Yamasaki et al., 2001). CS-ACS2 was found to be only expressed in gynomanous cucumber plants and was responsible for causing the highest levels of ethylene production and was regulated by the F locus (Yamasaki et al., 2001). Ethylene is the main hormone that promotes the development of female flowers in melon and cucumber, while gibberellins have opposite effects in these plants (Yamasaki et al., 2005). In contrast to the feminizing effect in cucurbit species (cucumber, melon and pumpkin), ethylene had a masculinizing effect in watermelon (Manzano et al., 2011). Jie et al (2017) further demonstrate the effects of ethylene, and ethylene competitors gibberellin and silver nitrate, on different genetic backgrounds in watermelon compared to published responses in cucumber. These results suggest that hormonal production and response have a significant interaction and depend on plant genetics, but this remains to be fully elucidated (Jie et al., 2017). Controlling or altering the sex of flowers has practical applications in the reproduction and development of hybrids or populations. Since Peterson and Anhder (1960) reported the masculinizing effect of gibberellin on cucumbers, it has been widely used to maintain gynoetic breeding lines and to produce seeds in all female cucumber cultivars. Such gynectious inbred lines reduce production and development costs, and can maintain or provide improvements in seed yield and quality. Although the determinants of sexual phenotype are diverse, it remains unclear whether changes in the expression of these genes are a cause or consequence of organ sex determination. Therefore, it is necessary to demonstrate whether regulatory genes that are specific to female male development are genes that control sex. In Vitis, hormones can modify the sexual development of flowers, and cytokinins have been shown to play an important role in the process (Negi and Olmo, 1966, 1971; Zhang etal., 2013). In Vitis sp. vines, the location of the flower sex locus in linkage group 2 (LG2) was previously proposed by Dalbo, et al (2000) and Riaz et al (2006) to be located on the chromosome 2 near the genetic marker VviS3. Confirmed in the microvides and picovides population by Chaib etal., (2010). Fetcher et al., (2012) identified VviAPRT, which encodes adenine phosphoribosyltransferase, as the marker to discriminate female from male / hermaphrodite plants. Fetcher et al., (2012) predicted eleven genes and reported that an adenine phosphoribosyltransferase (APRT, now named APRT3) plays a key role in grapevine flower sex determination and its expression is identified with female flowers. However, Coito et al (2017) found that APRT3 distinguished male from female and hermaphrodite plants, proposing a model that includes a third unknown gene. Gibberellin (GA) is considered an ethylene competitor that promotes the production of male flowers and inhibits the development of female flowers in cucumber (Friedlander etal., 1977). Although several candidate genes have been proposed as genetic controllers of flower sex in grapevine, the gene(s) that control flower sex remain unknown. seedless grapes Seedless table grape varieties produce seedless fruits due to stenospermocarpy, in which the flower is fertilized and the seed begins to develop, but stops its development at an early stage (i.e. aborts) leaving only a trace of seed in the fruit. A mutated locus of the Vitis vinifera MADS-box protein 5 (VvMADS5, also known as VviAGLU) gene (in heterozygous or homozygous state) is associated with stenospermocarpy (SDL1) in grapevine. The mutation has a G to T substitution in the 590 bp of the coding sequence that gives rise to an Arg-197Leu substitution and has recently been hypothesized to be associated with the stenospermocarpic seedlessness phenotype (Royo et al., 2018). Although the genetic control of seedless stenospermocarpic grapes that produce a trail of seeds upon pollination is believed to be due to a mutation (SDL1) in the MADS5 gene, the genetic control of parthenocarpic berry development is not known or understood. no seeds on the vines. Microvines The development of dwarf grape plants with a fast flowering phenotype, called microvines, were previously described by the inventors (Boss and Thomas, Nature, 2002) and have a SNP in the grapevine GA-insensitive gene (VvGAU). The single nucleotide difference, from a T to an A, between VvGAU and Vvgail is found in the translated region at position 231. The point mutation present in the VvGAU allele converts a leucine residue of the conserved DELLA domain to histidine. The mutated gene Insensitive to Gibberellic Acid is dominant (both in the heterozygous state (GAI1 / gai1) and in the homozygous state (GAI1 / GAI1) causing a dwarf stature and a rapid flowering phenotype. Reproduction and improvement of the vine For vine improvement, it is necessary to modify and be able to control the sex of the flower for breeding purposes to combine or maintain favorable phenotypic traits. For the reproduction and production of table grapes it is desirable to produce authentic fruits MA / a / ZUZI / UIDOUO seedless parthenocarpics that do not produce seed remains. For urban / indoor agriculture and indoor crops it is desirable to have dwarf table grape selections that can grow at high density and produce fresh seedless fruit. BRIEF DESCRIPTION OF THE INVENTION The present disclosure is based, at least in part, on the inventors' surprising finding that a locus, which has been termed flower sex locus (FSL), is responsible for flower sex in angiosperms, such as grapevine, and that the different genotypes of the FSL locus and the polypeptides that are expressed from it can be used to determine, control and / or select the flower sex phenotype, that is, the female, male or hermaphrodite, respectively. The inventors have characterized the FSL locus, responsible for the development of the male organ, which behaves similarly to Sp in Oberles' 1938 model for determining the sex of flowers, so in a Vitis sp. It is dominant in both males and hermaphrodites. In the female, the locus is recessive and non-functional. The inventors have also demonstrated 100% concordance between female (fsl / fsl) and hermaphrodite (FSL / fsl or FSL / FSL) genotypes in a single nucleotide polymorphism (SNP) within a domain rich in AT sequences and zinc binding (PLATZ) of the FSL locus and the respective vinifera floral sex phenotype. Thus, in a first aspect, the present disclosure provides a plant or part thereof that has an altered level of flower sex polypeptide (FSL) activity compared to a corresponding plant or part thereof that has a genotype of the FSL locus that confers a male or hermaphrodite flower phenotype. In one example, the plant or part thereof has an altered level of FSL polypeptide activity compared to a corresponding plant or part thereof having a genotype of the FSL locus that confers a hermaphroditic flower phenotype. In one example, the genotype of the FSL locus that confers a hermaphrodite flower phenotype comprises a hermaphrodite allele of the FSL locus. In one example, the hermaphroditic allele of the FSL locus encodes an FSL polypeptide comprising an amino acid sequence set forth in SEQ ID NO:1, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical. to the sequence established in SEQ ID NO:1. For example, the FSL polypeptide encoded by the hermaphrodite allele of the FSL locus may comprise an amino acid sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85 %, at least 90%, at least 95% or at least 96% identical to the sequence set forth in SEQ ID NO:1. For example, the FSL polypeptide may comprise an amino acid sequence that is at least 97%, at least 98% or at least 98%. MA / a / ZUZI / UIOOUO less than 99% identical to the sequence set forth in SEQ ID NO:1. In each of the above examples describing exemplary FSL polypeptides comprising amino acid sequences having a level of identity with the sequence set forth in SEQ ID NO: 1, the FSL polypeptides may be orthologs of the FSL polypeptide set forth in SEQ ID NO: :1. In a particular example, the FSL polypeptide comprises an amino acid sequence set forth in SEQ ID NO:1. In one example, the plant or part thereof has an altered level of FSL polypeptide activity compared to a corresponding plant or part thereof that has a genotype of the FSL locus that confers a male flower phenotype. In one example, the genotype of the FSL locus that confers a male flower phenotype comprises a male allele of the FSL locus. In one example, the hermaphroditic allele of the FSL locus encodes an FSL polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 3, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical. to the sequence set forth in SEQ ID NO: 3. For example, the FSL polypeptide of the male allele of the FSL locus may comprise an amino acid sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or at least 96% identical to the sequence set forth in SEQ ID NO: 3. For example, the FSL polypeptide may comprise an amino acid sequence that is at least 97%, at least 98% or at least 99% identical to the sequence set forth in SEQ ID NO: 3. In each of the above examples describing exemplary FSL polypeptides comprising amino acid sequences having a level of identity with the sequence set forth in SEQ ID NO: 3, the FSL polypeptides may be orthologs of the FSL polypeptide set forth in SEQ ID NO: 3. In a particular example, the FSL polypeptide comprises an established amino acid sequence in SEQ ID NO: 3. In one example, the plant or part thereof comprises an FSL locus comprising a polynucleotide sequence encoding the FSL polypeptide, wherein the polynucleotide sequence is modified relative to a corresponding polynucleotide sequence of an allele of the FSL locus that confers a phenotype. male flower or hermaphrodite when expressed. For example, the polynucleotide sequence encoding the FSL polypeptide may be modified relative to a corresponding polynucleotide sequence of a wild hermaphroditic allele of the FSL locus. For example, the polynucleotide sequence encoding the FSL polypeptide can be modified relative to the corresponding polynucleotide sequence of a wild-type male allele of the FSL locus. In some examples, a region of the polynucleotide sequence that encodes a plant domain with an AT-rich and zinc-binding (PLATZ) sequence of the FSL locus MA / a / ZUZI / UIOOUO may be modified, for example, relative to a polynucleotide sequence encoding a corresponding wild-type PLATZ domain. In one example, the polynucleotide sequence encoding the wild PLATZ domain encodes an amino acid sequence set forth from residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1. In one example, the polynucleotide sequence encoding the polypeptide FSL comprises one or more nucleotide additions, deletions or substitutions relative to the corresponding polynucleotide sequence of an allele of the wild FSL locus that confers a male or hermaphroditic floral phenotype when expressed, for example, one or more additions, deletions or substitutions of nucleotides in the sequence that encodes the PLATZ domain. For example, the polynucleotide sequence encoding the FSL polypeptide may comprise one or more (e.g., 1,2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotide additions, deletions or substitutions between positions 153 and 189, such as between positions 155 and 159, relative to the ORF sequence set forth in SEQ ID NO: 6 or 7 (or at one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides deleted between positions 153 and 189. in relation to the ORF sequence set forth in SEQ ID NO: 6 or 7 (or in one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have one or more T's (e.g., T, TT or TTT) deleted between positions 155 and 159 relative to the ORF sequence set forth in SEQ ID NO: 6 or 7 (or one or more T's deleted at one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have one or more Ts (e.g., T, TT or TTT) added between positions 155 and 159 relative to the ORF sequence set forth in SEQ ID NO: 6 or 7 (or one or more T added at one or more corresponding nucleotide positions of the corresponding genomic sequence). In some examples, the polynucleotide sequence encoding the FSL polypeptide has been genetically edited. In some examples, the FSL polypeptide encoded by the modified polynucleotide sequence comprises one or more additions, deletions or substitutions of amino acids relative to the FSL polypeptide encoded by the corresponding allele of the wild-type FSL locus (for example, as a result of one or more additions , deletions or nucleotide substitutions to the coding polynucleotide sequence). For example, the plant or part thereof may comprise an FSL polypeptide comprising one or more additions, deletions or substitutions of amino acids in the PLATZ domain relative to the corresponding amino acid sequence encoded by the corresponding allele of the wild-type FSL locus. In MA / a / ZUZI / UIOOUO As an example, the PLATZ domain encoded by the corresponding allele of the wild-type FSL locus comprises the amino acid sequence set forth from residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1. In some examples , the FSL polypeptide is truncated. In some examples, the FSL polypeptide or a domain thereof, for example, the PLATZ domain, is absent from the plant or a part thereof. In some examples, the plant or part thereof comprises an RNA interference (RNAi) agent that targets a messenger RNA (mRNA) of the FSL locus, thereby reducing the activity of the FSL polypeptide in the plant or part thereof. compared to a corresponding plant or part thereof that does not comprise the RNAi agent. According to the examples in which the plant or part of the plant comprises an RNAi agent, the plant or part thereof can be transfected with and / or have incorporated into its genome a construct to express the RNAi agent, for For example, an expression vector that expresses the RNAi agent. The RNAi agent may be any RNAi agent known in the art or described herein. In one example, the corresponding allele of the wild FSL locus is a hermaphroditic allele of the FSL locus. According to this example, the ORF of the corresponding allele of the wild FSL locus may comprise a polynucleotide sequence set forth in SEQ ID NO: 6, a sequence that is at least 60% identical thereto, or an orthologous sequence thereof. corresponding to the plant species. In one example, the ORF of the corresponding wild FSL locus allele comprises a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence established in SEQ ID NO: 6. In this sense , the sequence set forth in SEQ ID NO: 6 represents the ORF of the hermaphrodite allele of the FSL locus for Vitus vinifera. In a particular example, the ORF of the corresponding allele of the wild FSL locus comprises a sequence set forth in SEQ ID NO: 6. In another example, the corresponding allele of the wild FSL locus is a male allele of the FSL locus. According to this example, the ORF of the corresponding allele of the wild FSL locus may comprise a polynucleotide sequence set forth in SEQ ID NO: 7, a sequence that is at least 60% identical thereto, or an orthologous sequence thereof. corresponding to the plant species. In one example, the ORF of the corresponding wild FSL locus allele comprises a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 6. In each Of the above examples describing an ORF of a corresponding wild FSL locus allele comprising a sequence having a percentage level of identity relative to a sequence set forth in SEQ ID NO: 7, the wild FSL locus allele may be a orthologue of the sequences established in SEQ ID NO: 7. In this sense, the sequence established in SEQ ID NO: 7 represents the ORF of the male allele of the FSL locus for Vitus vinifera. In a particular example, the ORF of the wild FSL locus comprises a sequence set forth in SEQ ID NO: 7. In one example, the corresponding wild-type FSL locus allele comprises a polynucleotide sequence encoding a PLATZ domain comprising an amino acid sequence set forth from residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1 or a sequence of amino acids that are at least 70% identical to it. For example, the corresponding wild FSL locus allele may comprise a sequence encoding a PLATZ domain comprising an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90% , at least 95%, at least 96% identical, at least 97% identical, at least 98% or at least 99% identical to the established amino acid sequence from residue 26 to residue 75 of the established sequence in SEQ ID NO: 1. In a particular example, the corresponding allele of the wild-type FSL locus comprises a sequence encoding a PLATZ domain comprising the amino acid sequence set forth from residue 26 to residue 75 of the sequence set forth in SEQ ID NO: 1. In some examples, the activity of the FSL polypeptide is reduced in the plant or plant part relative to a level of FSL polypeptide activity in a corresponding wild-type plant or part thereof. For example, the activity of the FSL polypeptide in the plant or part of the plant may be reduced by at least 10% relative to the level of activity of the FSL polypeptide in a corresponding wild plant or part thereof. For example, the activity of the FSL polypeptide in the plant or part of the plant may be reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the activity level of the FSL polypeptide in a corresponding wild plant or part thereof . In each of the above examples, the activity of the FSL polypeptide may be reduced relative to a level of activity of the FSL polypeptide in a corresponding plant or part thereof comprising a male or hermaphrodite allele of the FSL locus. For example, the activity of the FSL polypeptide may be reduced relative to a level of activity of the FSL polypeptide in a corresponding hermaphrodite plant or part thereof, or relative to a level of activity of the FSL polypeptide in a corresponding male plant or part thereof. the same. MA / a / ZUZI / UIOOUO In each of the above examples describing a plant or plant part having a reduced level of FSL polypeptide activity, the reduced FSL polypeptide activity may be caused by a corresponding reduction in the expression of the FSL polypeptide relative to a expression level in a corresponding wild plant or part thereof. Alternatively or additionally, the reduced activity of the FSL polypeptide may be caused by a corresponding reduction in the expression of the FSL locus mRNA relative to an expression level in a corresponding wild-type plant or part thereof. In some examples, the activity of the FSL polypeptide is suppressed in the plant or part of the plant. For example, expression of the FSL polypeptide may be completely inhibited or the FSL locus encoding the FSL polypeptide may be deleted in the plant or part thereof. In one example, altered activity of the FSL polypeptide in the plant or part thereof causes a male reproductive part of a flower to be absent or non-functional. For example, a reduction in the activity of the FSL polypeptide as described herein may cause a male reproductive part of a flower or part thereof to be absent or non-functional. In some examples, the male reproductive part of a flower is present but is not functional due to altered, e.g., reduced, activity of the FSL polypeptide. A non-functional male reproductive part of a flower may be underdeveloped due to altered, e.g. reduced, activity of the FSL polypeptide, rendering it non-functional. In some examples, the plant produces flowers that are sterile to humans. The present disclosure also provides a plant or part thereof that has a reduced level of activity of the FSL polypeptide that produces a phenotypically female flower, wherein the level of activity of the FSL polypeptide is reduced compared to a plant or part of the plant which produces a flower comprising functional male reproductive parts. In some examples, the plant or plant part may be a plant or plant part that has an altered level of FSL polypeptide activity as described herein, for example, an altered level of FSL polypeptide activity in relationship to the corresponding plant or plant part comprising a male or hermphrodite allele of the FSL locus. In some examples, the plant or plant part may comprise an FSL locus that is homozygous for a female (f / f) allele that confers a female flower phenotype. In some examples, the genotype of the FSL (f / f) locus does not occur naturally in the plant or part of the plant. The present disclosure also provides a plant or part thereof that produces seedless fruits, said plant comprising (i) a polynucleotide that confers dwarf stature to a plant; and (i) a flower sex locus (FSL) that is homozygous for a female allele (f / f) conferring a female flower phenotype. In one example, the ORF of the female allele of the FSL locus comprises a sequence set forth in SEQ ID NO: 5, or a sequence that has at least 70% identity therewith, provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO: 5 is an A. For example, the ORF of the female allele of the FSL locus may comprise a sequence that has at least 75%, at least 80%, at least 85%, at at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence set forth in SEQ ID NO: 5 provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO: 5 is an A. In some examples, the ORF of the female allele of the FSL locus comprises the sequence set forth in SEQ ID NO: 5. In each of the above examples describing an ORF of a female allele of the FSL locus that has a percentage level of identity with the sequence set forth in SEQ ID NO: 5, the female allele of the FSL locus may be an ortholog of the sequence established in SEQ ID NO: 5 corresponding to the plant species. The present disclosure also provides a plant or part thereof having an altered level of FSL polypeptide activity as described herein, wherein said plant comprises a polynucleotide that confers dwarf stature to the plant. A plant or plant part according to this embodiment produces seedless fruits. In each of the above examples describing plants or parts of plants that produce seedless fruits, the polynucleotide that confers dwarf stature is altered relative to the corresponding wild-type polynucleotide sequence. In one example, the polynucleotide that confers dwarf stature is a variant of the gibberellic acid insensitive gene (GAI1) or a fragment thereof. The variant of the GAI1 gene encodes a variant of the GAI1 protein. In one example, the GAI1 gene variant or fragment thereof that confers dwarf stature to the plant comprises one or more mutations in a region encoding the DELLA domain. For example, one or more mutations in the region encoding the DELLA domain of the GAI1 protein can alter the gibberellic acid (GA) response properties of the plant or plant part. One or more mutations can be selected from amino acid substitutions, deletions or additions. One or more mutations in the DELLA domain may prevent the plant or part of the plant from responding to GA signaling. Accordingly, in some examples, the plant or plant part comprising a variant of the GAI1 gene or a fragment thereof does not respond, or responds poorly, to GA signaling. In one example, the GAI1 protein variant comprises MA / a / ZUZI / UIOOUO a sequence set forth in SEQ ID NO: 8 with a Leu to His substitution at position 38, or a sequence having at least 85%, at least 90%, at least 95 %, at least 96%, at least 97%, at least 98% or at least 99% of the sequence set forth in SEQ ID NO: 8, provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO: 8 is replaced by a larger basic residue, for example, His. In preferred embodiments, the GAI1 protein variant comprises a sequence that is at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, or at least 99.8% identical to the sequence set forth in SEQ ID NO: 8, provided that the Leu of the corresponding DELLA domain at position 38 of SEQ ID NO: 8 is replaced by a larger basic residue, for example, His. In each of the above examples describing a GAI1 protein variant comprising a sequence that has a percentage level of identity relative to the sequence set forth in SEQ ID NO: 8, the GAI1 protein variant may be an ortholog. of the sequence set forth in SEQ ID NO: 8 that comprises a substitution of the Leu in the position corresponding to residue 38 of SEQ ID NO: 8, for example, the substitution with a major basic residue, such as a His. In a particular example, the GAI1 protein variant comprises the sequence set forth in SEQ ID NO: 9. In one example, the GAI1 gene variant or fragment thereof that confers dwarf stature is present in a homozygous state (GAI1 / GAI1). In one of the examples, the GAI1 gene variant or fragment thereof that confers dwarf stature is present in a heterozygous state (GAI1 / Ga¡1). In one example, the DELLA domain is altered, truncated or deleted from the GAI1 gene or fragment thereof, for example, as a result of one or more mutations. In another example, the GAI1 protein or the DELLA domain thereof is silenced, e.g., post-transcriptionally silenced. According to this example, the polynucleotide that confers dwarf stature to the plant may be an RNAi agent targeting an mRNA transcript of the GAI1 protein, for example, that corresponding to the DELLA domain. In each of the above examples, the plant or part of it produces seedless parthenocarpic fruits when the flowers are not pollinated and seed-containing fruits when the flowers are pollinated with viable pollen. In each of the above examples, the plant or part thereof further comprises a polynucleotide that confers stenospermocarpy to the plant or part thereof. In one example, the polynucleotide that confers stenospermocarpy to the plant or part thereof is altered in relation to the corresponding wild gene or wild allele thereof. For example, the polynucleotide that confers stenospermocarpy to the plant or part thereof may comprise one or more mutations in relation to the MA / a / ZUZI / UIOOUO corresponding wild gene or wild allele thereof. One or more mutations can be selected from amino acid substitutions, deletions or additions. In one example, the polynucleotide that confers stenospermocarpy to the plant or part of the plant is a variant of the Vitis vinifera MADS-box protein 5 (VvMADS5) locus. In one example, the VvMADS5 locus encodes a VvMADS5 protein comprising the amino acid sequence set forth in SEQ ID NO: 10, and the variant VvMADS5 protein comprises an Arg substitution at position 197 of the sequence set forth in SEQ ID NO: 10. : 10 with a hydrophobic amino acid, for example, Leu (R197L). In one example, the variant VvMADS5 locus encodes a variant VvMADS5 protein comprising an amino acid sequence set forth in SEQ ID NO: 11, or a sequence that is at least 85%, at least 90%, at least 95% , at least 96%, at least 97%, at least 98%, at least 99% identical to the sequence set forth in SEQ ID NO: 11 provided that the amino acid at position 197 in relation to SEQ ID NOT: 11 is a hydrophobic amino acid, for example, Leu. For example, the VvMADS5 locus variant may encode a VvMADS5 protein variant that comprises an amino acid sequence that is at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 11 provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, e.g. Leu. In each of the above examples describing a variant of the VvMADS5 locus that encodes a variant of the VvMADS5 protein that comprises a sequence that has a percentage level of identity relative to the sequence set forth in SEQ ID NO: 11, the variant of The VvMADS5 protein may be an ortholog of the sequence set forth in SEQ ID NO: 11 comprising a corresponding amino acid substitution at position 197. In one example, the VvMADS5 locus variant encodes a VvMADS5 protein variant comprising the amino acid sequence set forth in SEQ ID NO: 11. In one example, the VvMADS5 locus variant that confers stenospermocarpy is present in a homozygous state. In one example, the VvMADS5 locus variant that confers stenospermocarpy is present in a heterozygous state. In one example, the VvMADS5 locus variant comprises one or more mutations that result in deletion or truncation of the VvMADS5 protein. In another example, the VvMADS5 protein is silenced, e.g., post-transcriptionally silenced. According to this example, the polynucleotide that confers stenospermocarpy to the plant may be an RNAi agent targeting an mRNA transcript encoded by the VvMADS5 locus. IVIA / a / ZUZ l / U I 30U0 The present disclosure also provides a plant or part thereof that produces seedless fruits, said plant comprising: (i) a flower sex locus (FSL) genotype that is heterozygous (FSL / fsl) as described herein, or homozygous for the hermaphroditic FSL locus allele (FSL / FSL) as described in the present document; (i) a polynucleotide that confers dwarf stature to a plant as described herein; and (iii) a polynucleotide that confers stenospermocarpy as described in the document. In each of the above examples describing a plant or part of a plant further comprising a polynucleotide that confers stenospermocarpy, the plant produces seedless parthenocarpic fruits when the flowers are not pollinated and stenospermocarpic fruits when the flowers are pollinated with viable pollen. In one of the examples, the plant described herein is a dioecious plant species. In another example, the plant described herein is a hermaphroditic plant species. In each of the above examples, the plant is preferably a fruit-producing plant, that is, an angiosperm. For example, the plant may be a berry-producing plant, a hesperid-producing plant, a drupe-producing plant, a seed-producing plant, or a pepper-producing plant. In one example, the plant is a berry-producing plant. For example, the plant may be a Vitis sp. For example, a Vitis species selected from the group consisting of: Vitis vinifera, Vitis lambrusca, Vitis rotundifolia, Vitis aestivalis and their hybrids. In one of the examples, Vitis sp. produces table grapes. In another example, Vitis sp. produces wine grapes. In one example, the plant part is a cell, seed, fruit, root, cutting, or spike. Also provided herein is a method of controlling flower sex in a plant, said method comprising altering a level of activity of the FSL polypeptide in the plant or part thereof in comparison to a level of activity of the FSL polypeptide in a plant or corresponding part thereof that has a genotype of the FSL locus that confers a male flower or hermaphrodite phenotype. In one example, the plant or part thereof has an altered level of FSL polypeptide activity compared to a corresponding plant or part thereof that expresses an FSL polypeptide encoded by a wild hermaphroditic allele of the FSL locus. In another example, the plant or part thereof has an altered level of FSL polypeptide activity compared to a plant or part thereof Corresponding MA / a / ZUZI / UIOOUO expressing an FSL polypeptide encoded by a wild-type male allele of the FSL locus. Examples of FSL polypeptides encoded by wild-type hermaphrodite and male alleles of the FSL locus are described herein. In one example, a genotype of the FSL locus that confers a hermaphrodite flower phenotype comprises a hermaphrodite allele of the FSL locus encoding the FSL polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, a biologically active fragment thereof. , or an amino acid sequence that is at least 40% identical to the sequence set forth in SEQ ID NO:1; and a genotype of the FSL locus that confers a male flower phenotype comprises a male allele of the FSL locus encoding the FSL polypeptide comprising an amino acid sequence set forth in SEQ ID NO:3, a biologically active fragment thereof, or a amino acid sequence that is at least 40% identical to the sequence set forth in SEQ ID NO:3. In some examples, a plant or part of a plant having an altered level of FSL polypeptide activity comprises an FSL polypeptide comprising an amino acid sequence set forth in SEQ ID NO:2, a biologically active fragment thereof, or a amino acid sequence that is at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:2. In one example, the method comprises modifying an FSL locus that comprises a polynucleotide sequence encoding the FSL polypeptide or a biologically active fragment thereof. For example, the method may comprise modifying a region of the FSL locus encoding a zinc-binding domain and a plant AT-rich sequence (PLATZ), for example, relative to a corresponding polynucleotide sequence of a hermaphrodite allele. or wild male of the FSL locus that encodes a PLATZ domain. Modification of a region of the FSL locus may comprise the introduction of one or more nucleotide additions, deletions or substitutions in the polynucleotide sequence encoding the FSL polypeptide relative to the corresponding polynucleotide sequence of an allele of the wild-type FSL locus that confers a phenotype. male floral or hermaphrodite when expressed. For example, the polynucleotide sequence encoding the FSL polypeptide can be modified relative to the corresponding polynucleotide sequence of a wild hermaphroditic allele of the FSL locus. For example, the polynucleotide sequence encoding the FSL polypeptide can be modified relative to the corresponding polynucleotide sequence of a wild-type male allele of the FSL locus. In one example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or ΜΛ / a / ZUZ 1 / U1 DOUO more (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) additions, deletions or substitutions of nucleotides between positions 153 and 189, such as between positions 155 and 159, relative to the sequence set forth in SEQ ID NO: 6 or 7 (or at one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides deleted between the positions 153 and 189 in relation to the sequence established in SEQ ID NO: 6 or 7 (or in one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or more Ts (e.g., T, TT, or TTT) deleted between positions 155 and 159 relative to the sequence set forth in SEQ ID NO: 6 or 7 (or one or more T deleted at one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or more Ts (e.g., T, TT or TTT) added between positions 155 and 159 relative to the sequence set forth in SEQ ID NO: 6 or 7 (or one or more T added at one or more corresponding nucleotide positions of the corresponding genomic sequence). In one example, modification of the FSL locus is achieved through gene editing technology. For example, a polynucleotide sequence encoding the FSL polypeptide can be genetically edited using CRISPR, TALON, or ZFN technology, or a combination thereof. In one example, the FSL polypeptide or the biologically active fragment thereof encoded by the modified polynucleotide sequence comprises one or more additions, deletions or substitutions of amino acids relative to the FSL polypeptide encoded by the corresponding allele of the wild-type FSL locus (e.g. as a result of one or more additions, deletions or substitutions of nucleotides in the coding polynucleotide sequence). For example, modification of a polynucleotide at the FSL locus can result in one or more amino acid additions, deletions, or substitutions in the PLATZ domain of the FSL polypeptide relative to the corresponding wild-type amino acid sequence. In some examples, the FSL polypeptide encoded by the modified polynucleotide sequence is truncated. In some examples, the FSL polypeptide or a domain thereof, for example, the PLATZ domain, encoded by the modified polynucleotide sequence is absent from the plant or part thereof. In other examples, the level of activity of the FSL polypeptide in the plant or part thereof is altered by post-transcriptional silencing with an RNA interference (RNAi) agent that targets a messenger RNA (mRNA) of the FSL locus. According to this example, the method may comprise introducing into the plant or part thereof an RNAi agent targeting an mRNA of the FSL locus or an allele thereof. For example, the plant or part thereof may be transfected with and / or have incorporated into its genome a construct for expressing the RNAi agent, for example, an expression vector that expresses the RNAi agent. The RNAi agent may be any RNAi agent known in the art or described herein. In some examples, the polynucleotide sequence of the FSL locus is modified relative to the polynucleotide sequence of a corresponding allele of the wild-type FSL locus. In one example, the corresponding allele of the wild-type FSL locus may be a hermaphroditic allele of the FSL locus. According to this example, the ORF of the corresponding allele of the wild FSL locus may comprise a polynucleotide sequence set forth in SEQ ID NO: 6, a sequence that is at least 60% identical thereto, or an orthologous sequence thereof. corresponding to the plant species. In one example, the ORF of the corresponding wild FSL locus allele comprises a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 6. In a particular example, the ORF of the allele of the corresponding wild FSL locus comprises a sequence set forth in SEQ ID NO: 6. In another example, the corresponding allele of the wild FSL locus may be a male allele of the FSL locus. According to this example, the ORF of the corresponding allele of the wild FSL locus may comprise a polynucleotide sequence set forth in SEQ ID NO: 7, a sequence that is at least 60% identical thereto, or an orthologous sequence thereof. corresponding to the plant species. In one example, the ORF of the corresponding wild FSL locus allele comprises a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 7. In an example In particular, the ORF of the corresponding wild FSL locus allele comprises a sequence set forth in SEQ ID NO: 7. According to the examples of the method of controlling flower sex in a plant as described herein, the activity of the FSL polypeptide is reduced in the plant or part of the plant relative to a level of activity of the FSL polypeptide. in a corresponding wild plant or part thereof. For example, the activity of the FSL polypeptide in the plant or part of the plant may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% relative to the activity level of the FSL polypeptide in a plant or part of the corresponding wild species. In each of the above examples describing a plant or plant part having a reduced level of FSL polypeptide activity upon performance of the method, the reduced FSL polypeptide activity may be caused by a corresponding reduction in expression of the polypeptide. FSL or a reduced activity of the FSL polypeptide or a reduced activity of the polynucleotide encoding the FSL polypeptide. Alternatively or additionally, the reduced activity of the FSL polypeptide may be caused by a corresponding reduction in the expression of the FSL locus mRNA relative to an expression level in a corresponding wild-type plant or part thereof, for example, a corresponding wild-type hermaphroditic plant. or masculine or part of it. In some examples, the activity of the FSL polypeptide is eliminated in the plant or part of the plant after performing the method. For example, expression of the FSL polypeptide can be completely inhibited or the FSL locus encoding the FSL polypeptide can be deleted in the plant or part thereof. In one example, altering the activity of the FSL polypeptide in the plant or part thereof causes a male reproductive part of a flower of the plant to be absent or non-functional. For example, reducing the activity of the FSL polypeptide as described herein may cause a male reproductive part of a plant flower or part thereof to be absent or non-functional. In some examples, reducing the activity of the FSL polypeptide as described herein may render the male reproductive part of a flower non-functional (even if present). A non-functional male reproductive part of a flower may be underdeveloped due to altered, for example reduced, activity of the FSL polypeptide, rendering it non-functional. Consequently, altering the level of the FSL polypeptide in a plant or part thereof can result in a plant or plant part that produces flowers that are phenotypically female or male-sterile. In some examples, the plant or plant part in which the activity of the FSL polypeptide is altered comprises a polynucleotide that confers dwarf stature as described herein. In some examples, the plant or plant part in which the activity of the FSL polypeptide is altered already comprises a polynucleotide that confers dwarf stature. In other examples, the method comprises introducing into the plant or part of the plant the polynucleotide that confers dwarf stature. In some examples, the plant or plant part in which the activity of the FSL polypeptide is altered comprises a polynucleotide that confers stenospermocarpy as follows: MA / a / ZUZI / UIOOUO described in this document. In some examples, the plant or plant part in which the activity of the FSL polypeptide is altered already comprises a polynucleotide that confers stenospermocarpy. In other examples, the method comprises introducing the polynucleotide that confers stenospermocarpy into the plant or part of the plant. In one example, the plant or part of the plant in which the activity of the FSL polypeptide is altered is a dioecious plant species. In another example, the plant or part of the plant in which the activity of the FSL polypeptide is altered is a hermaphroditic plant species. In each of the above examples, the plant in which the activity of the FSL polypeptide is altered is preferably a fruit-producing plant, that is, an angiosperm. For example, the plant may be a berry-producing plant, a hesperid-producing plant, a drupe-producing plant, a seed-producing plant, or a pepper-producing plant. In one example, the plant or part of the plant in which the activity of the FSL polypeptide is altered produces berries. For example, the plant may be a Vitis sp. For example, a Vitis species selected from the group consisting of: Vitis vinifera, Vitis lambrusca, Vitis rotundifolia, Vitis aestivalis and hybrids thereof. In one of the examples, Vitis sp. produces table grapes. In another example, Vitis sp. produces wine grapes. In one example, the plant part is a cell, a seed or part of a seed, a fruit, a root, a cutting or a spike. Also contemplated herein is a method of controlling flower sex in a plant comprising increasing a level of activity of the FSL polypeptide encoded by a male or hermaphrodite allele of the FSL locus in the plant or part thereof, in relation to with a level of activity of the corresponding FSL polypeptide in a corresponding plant or part thereof that has a genotype of the FSL locus that confers a female flower phenotype. In one example, a hermaphrodite allele of the FSL locus encodes an FSL polypeptide comprising an amino acid sequence set forth in SEQ ID NO:1, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical. to the sequence established in SEQ ID NO:1. Other exemplary FSL polypeptides encoded by a hermaphroditic allele of the FSL locus are described and contemplated herein. In a particular example, the hermaphrodite allele of the FSL locus encodes the FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, or a biologically active fragment thereof. In one example, a male allele of the FSL locus encodes an FSL polypeptide comprising an amino acid sequence set forth in SEQ ID NO:3, a fragment biologically active MA / a / ZUZI / UIOOUO thereof, or an amino acid sequence that is at least 40% identical to the sequence set forth in SEQ ID NO:3. Other exemplary FSL polypeptides encoded by a male allele of the FSL locus are described and contemplated herein. In a particular example, the male allele of the FSL locus encodes the FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:3, or a biologically active fragment thereof. In one example, increasing the level of activity of the FSL polypeptide encoded by a male or hermaphrodite allele of the FSL locus in the plant or part thereof confers a floral phenotype in which functional male reproductive parts are present. The present disclosure also provides a method for producing a plant that produces flowers of known sex, said method comprising the steps of: i) cross two parental plants, i) examine one or more plants from the progeny of the cross to determine the genotype at a flower sex locus (FSL), and ii) select a plant from the progeny capable of showing a desired flower sex phenotype based on the genotype of the FSL locus, wherein a genotype of the FSL locus that is homozygous for an allele of the female FSL locus (f / f) confers a female flower phenotype, a genotype of the FSL locus that is heterozygous for an allele of the female FSL locus and an allele of the hermaphroditic FSL locus (f / H) confers a hermaphroditic flower phenotype, a genotype of the FSL locus that is homozygous for an allele of the hermaphroditic FSL locus ( / 7 / / 7 ) confers a hermaphroditic flower phenotype and a genotype of the FSL locus that is heterozygous for one allele of the male FSL locus and one allele of the female FSL locus (M / f) or one allele of the hermaphroditic FSL locus (M / H) confers a phenotype male flower, and a genotype of the FSL locus that is homozygous for an allele of the male FSL locus (M / M) confers a male flower phenotype, thus generating a plant that produces flowers of known sex. The FSL locus sequences, including the sequences of male, female and hermaphroditic FSL locus alleles, are described herein and will be considered applicable mutatis mutandis to any and all examples that describe a method of production of a plant that produces flowers of known sex described herein, unless otherwise indicated. In one example, the method comprises selecting a progeny plant that has a genotype of the FSL locus that is homozygous for an allele of the female FSL locus (f / f) to thereby produce a plant that produces female flowers. In one example, the method comprises selecting a progeny plant having a genotype of the FSL locus that is heterozygous for an allele of the female FSL locus and an allele of the hermaphroditic (f / H) FSL locus or homozygous for an allele of the hermaphroditic FSL locus. (H / H) to thus produce a plant that produces hermaphrodite flowers. In one example, the female allele of the FSL locus has an ORF that comprises a sequence set forth in SEQ ID NO: 5, or a sequence that has at least 70% identity therewith, provided that the nucleotide corresponding to the position 621 of the sequence set forth in SEQ ID NO: 5 is an A. For example, the female allele of the FSL locus may comprise an ORF that comprises a sequence that has at least 75%, at least 80%, at least a 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence set forth in SEQ ID NO: 5 provided that the nucleotide corresponding to position 621 of the sequence set forth in SEQ ID NO: 5 is an A. In some examples, the ORF of the female allele of the FSL locus comprises the sequence set forth in SEQ ID NO: 5. In each of the above examples describing an ORF of a female allele of the FSL locus that has a percentage level of identity with the sequence established in SEQ ID NO: 5, the ORF of the FSL locus may be an ortholog of the established sequence in SEQ ID NO: 5 corresponding to the plant species. In one example, the hermaphroditic allele of the FSL locus has an ORF that comprises a sequence set forth in SEQ ID NO: 6, or a sequence that has at least 70%, at least 75%, at least 80%, at at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with the sequence set forth in SEQ ID NO: 6 provided that the nucleotide corresponding to position 627 of the sequence set forth in SEQ ID NO: 6 is a C. In some examples, the ORF of the hermaphrodite allele of the FSL locus comprises the sequence set forth in SEQ ID NO: 6 . In each of the above examples describing an ORF of a hermaphroditic allele of the FSL locus that has a percentage level of identity with the sequence established in SEQ ID NO: 6, the ORF of the FSL locus may be an ortholog of the established sequence in SEQ ID NO: 6 corresponding to the plant species. The present disclosure also provides a method for producing a plant that produces seedless fruits, said method comprising the steps of: i) crossing two parental plants, where one of the parents comprises an FSL locus that is homozygous for a female allele (f / f) that confers a female flower phenotype, and the other parent comprises a polynucleotide that confers dwarf stature, MA / a / ZUZI / UIOOUO ¡i) select one or more parent plants of the cross to detect the presence or absence of the FSL locus that is homozygous for a female allele (f / f), and the presence or absence of the polynucleotide that confers the dwarf stature, and iii) select a parent plant that comprises the FSL locus that is homozygous for a female allele (f / f) and that comprises the polynucleotide that confers dwarf stature thus producing a plant that produces seedless fruits. The present disclosure also provides a method for producing a plant that produces seedless fruits, said method comprising the steps of: i) crossing two parental plants, where at least one of the parents comprises a) a flower sex locus (FSL) that is homozygous fsl / fsl that confers a female flower phenotype, homozygous (FSL / FSL) or heterozygous or homozygous (FSL / fsl) that confers a hermaphrodite flower phenotype, b) at least one of the parents comprises a polynucleotide that confers dwarf stature, and c) at least one of the parents comprises a polynucleotide that confers stenospermocarpy, i) selection of one or more parent plants of the cross to detect the presence or absence of the FSL locus that is homozygous for a female phenotype (fsl / fsl), homozygous for the hermaphrodite phenotype (FSL / FSL) or heterozygous for a hermaphrodite phenotype (FSL / fsl ), b) the presence or absence of the polynucleotide that confers dwarf stature, and c) the presence or absence of the polynucleotide that confers stenospermocarpy, and i¡) select a parent plant that comprises a) a genotype of the FSL locus that confers a flower phenotype female or hermaphrodite, b) a polynucleotide that confers dwarf stature, and c) the polynucleotide that confers stenospermocarpy, thus producing a plant that produces seedless fruits. A progeny plant comprising (a) a genotype of the FSL locus that confers a hermaphroditic flower phenotype, (b) the polynucleotide that confers dwarf stature, and (c) the polynucleotide that confers stenospermocarpy, produces a stenospermocarpic seedless fruit. A parent plant comprising (a) a genotype of the FSL locus that confers a female flower phenotype, (b) the polynucleotide that confers dwarf stature, and (c) the polynucleotide that confers stenospermocarpy, produces seedless parthenocarpic fruits. The present disclosure also provides a method for producing a plant that produces seedless fruits, said method comprising the steps of: i) crossing two parental plants, where at least one of the parents comprises an FSL locus that is homozygous for a female allele (f / f) that confers the female flower phenotype, at least one of the parents comprises a polynucleotide that confers dwarf stature, and at least one of the parents comprises a polynucleotide that confers stenospermocarpy, i) select one or more parental plants of the cross to detect the presence or absence of the FSL locus that is homozygous for a female allele (f / f), the presence or absence of the polynucleotide that confers dwarf stature, and the presence or absence of the polynucleotide that confers stenospermocarpy, and ¡ü) selecting a parent plant that comprises the FSL locus that is homozygous for a female allele (f / f), the polynucleotide that confers dwarf stature and the polynucleotide that confers stenospermocarpy, thus producing a plant that produces seedless parthenocarpic fruits. The present disclosure also provides a method for producing a plant that produces seedless fruits, said method comprising the steps of: i) crossing two parental plants, where at least one of the parents comprises a polynucleotide that confers dwarf stature, and at least one of the parents comprises a polynucleotide that confers stenospermocarpy, i) select one or more parental plants of the cross to detect the presence or absence of the polynucleotide that confers dwarf stature, and the presence or absence of the polynucleotide that confers stenospermocarpy, and ¡ü) select a parent plant that comprises the polynucleotide that confers dwarf stature and the polynucleotide that confers stenospermocarpy, thus generating a plant that produces seedless parthenocarpic fruits. In each of the above examples describing methods of producing seedless fruits, the method may further comprise iv) backcrossing the progeny selected in II) with plants of the same genotype as one of the parents, but lacking the polynucleotide or the polynucleotides for which the progeny were selected, a sufficient number of times to produce a plant with a majority of the genotype of the parent but comprising the polynucleotide or polynucleotides of interest, and v) selecting a plant from the progeny that has the polynucleotides of interest, preferably where the progeny comprises a hermaphroditic allele of the FSL locus or a female allele of the FSL locus or both, and more preferably where the progeny is homozygous for the female allele of the FSL locus. The female allele of the FSL locus has been previously described herein and will be considered to apply mutatis mutandis to each and every example of the method of production of a plant that produces seedless fruits as described herein, unless otherwise stated. In a particular example, the allele Female MA / a / ZUZI / UIOOUO from the FSL locus has an ORF comprising a sequence set forth in SEQ ID NO: 5. Exemplary polynucleotides that confer dwarf stature and stenospermocarpy, respectively, are described herein and will be applied mutatis mutandis to each and every example of the method of production of a plant that produces seedless fruits as described herein , unless otherwise stated. In a particular example, the polynucleotide that confers dwarf stature is a variant of the GAI1 gene that encodes a variant GAI1 protein comprising a sequence set forth in SEQ ID NO: 9. In a particular example, the polynucleotide that confers stenospermocarpy is a variant of the VvMADS5 locus encoding a variant VvMADS5 protein comprising a sequence set forth in SEQ ID NO: 11. In one example, the plant that produces seedless fruits is a dioecious plant species. In one example, the plant that produces seedless fruits is a hermaphroditic plant species. In one example, the plant that produces seedless fruits is a berry-producing plant, a hesperid-producing plant, a drupe-producing plant, a seed-producing plant, or a pepper-producing plant. In one example, the plant produces seedless berries. For example, the plant may be a Vitis sp. For example, a Vitis species selected from the group consisting of: Vitis vinifera, Vitis lambrusca, Vitis rotundifolia, Vitis aestivalis and their hybrids. In one of the examples, Vitis sp. produces table grapes. In another example, Vitis sp. produces wine grapes. The present disclosure also provides a plant or part thereof produced by the method described herein. In one of the examples, the plant part is a seed or a part of the seed, a fruit, a root, a cutting or a spike. Also provided herein is a fruit produced from a plant described herein. In a particular example, the plant is a Vitis sp. and the fruit is a grape. In one of the examples, the fruit has no seeds. In one of the examples, the fruits are stenospermocarpic without seeds. In one of the examples, the fruits are parthenocarpic without seeds. The present disclosure also provides a method for producing fruit, the method comprising growing a plant as described herein to produce fruit. In one of the examples, the fruit production method further comprises harvesting the fruit produced from the plant. MA / a / ZUZI / UIOOUO In one of the examples, the fruit production method further comprises the processing of the fruit. For example, fruit processing may comprise fruit packaging. For example, fruit processing may involve the production of one or more products from fruit. The present disclosure also provides a product produced from a plant as described herein or a fruit thereof. In one example, the product is a food product, a food ingredient, a beverage product, or a beverage ingredient. The food product may be selected from the group consisting of table grapes, jam, jelly, sultanas and raisins, for example. The food ingredient may be vincotto, verjus, vinegar or grape must syrup (mosto cotto), for example. The beverage product may be wine, grappa, brandy or grape juice, for example. The ingredient of the drink can be wine grapes, table grapes or their juice, for example. In one example, the present disclosure provides an FSL polypeptide as described herein. For example, the FSL polypeptide may comprise an amino acid sequence selected from the group consisting of: a) sequences set forth in SEQ ID NO: 1,2 or 3, or a biologically active fragment of any of them, or b) a sequence of amino acids that are at least 40% identical, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95 % at least 96% at least 97%, at least 98% or at least 99% identical to a sequence set forth in SEQ ID NO: 1, 2 or 3. In another example, the present disclosure provides an isolated nucleic acid molecule comprising a polynucleotide sequence encoding an FSL polypeptide as described herein. For example, the nucleic acid molecule may comprise a) a polynucleotide sequence set forth in SEQ ID NOs: 4, 5, 6 or 7 or a polynucleotide sequence having an ORF set forth in SEQ ID NOs: 4, 5, 6 or 7, b) a polynucleotide sequence that is at least 40% identical, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90 %, at least 95% at least 96% at least 97%, at least 98% or at least 99% identical to a sequence set forth in SEQ ID NO: 4, 5, 6 or 7 or a sequence polynucleotide having an ORF that is at least 40% identical, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% at least 96% at least 97%, at least 98% or at least 99% identical to a sequence set forth in SEQ ID NO: 4, 5, 6 or 7, or c) a sequence polynucleotide that is complementary to a polynucleotide sequence of a) or b). IVIA / a / ZUZ l / U I 0DU0 In one example, the isolated nucleic acid molecule comprises a recombinant polynucleotide. The present disclosure also provides an expression vector comprising the isolated nucleic acid molecule as described herein. In one example, the isolated nucleic acid molecule is operably linked to a promoter. In one example, the expression vector is a plasmid or a virus. The present disclosure also provides a cell isolated from a plant as described herein. The present disclosure also provides a host cell comprising a nucleic acid molecule as described herein or an expression vector comprising the same as described herein. The host cell can be a yeast, a bacteria or a plant cell. The present disclosure also provides a method for determining the flower sex of a plant, said method comprising performing one or more tests on a sample obtained from the plant to determine the genotype of the plant at a flower sex locus (FSL ) and determine the flower sex of a plant based on the genotype of the FSL locus, wherein a plant comprising a genotype of the FSL locus that is homozygous for an allele of the female FSL locus (f / f) will produce flowers that are phenotypically female wherein a plant comprising a genotype of the FSL locus that is heterozygous for an allele of the female FSL locus and an allele of the hermaphroditic (f / H) FSL locus will produce flowers that are phenotypically hermaphrodite where a plant comprising a genotype of the locus FSL that is homozygous for an allele of the hermaphroditic (H / H) FSL locus will produce flowers that are phenotypically hermaphrodite, and wherein a plant comprising a genotype of the FSL locus that is heterozygous for an allele of the female FSL locus and an allele of the female FSL locus Male FSL (f / M) will produce flowers that are phenotypically male. In one example, the female allele of the FSL locus has an ORF that comprises a sequence set forth in SEQ ID NO: 5, or a sequence that has at least 70% identity therewith, provided that the nucleotide corresponding to the position 621 of the sequence set forth in SEQ ID NO: 5 is an A. Exemplary sequences of the female allele of the FSL locus are described herein. In some examples, the female allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO: 5. ΜΛ / a / ZUZ 1 / U1 DOUO In each of the above examples describing a female allele of the FSL locus that has an ORF that has a percentage level of identity with the sequence set forth in SEQ ID NO: 5, the female allele of the FSL locus may be an ortholog of the sequence established in SEQ ID NO: 5 corresponding to the plant species. In one example, the hermaphroditic allele of the FSL locus has an ORF comprising a sequence set forth in SEQ ID NO: 6, or a sequence that has at least 70% identity thereto provided that the nucleotide corresponding to position 627 of the sequence set forth in SEQ ID NO: 6 to be a C. Exemplary sequences of the hermaphrodite allele of the FSL locus are described herein. In some examples, the hermaphroditic allele of the FSL locus has an ORF that comprises the sequence set forth in SEQ ID NO: 6. In each of the above examples describing a hermaphrodite allele of the FSL locus that has an ORF that has a percentage level of identity with the sequence set forth in SEQ ID NO: 6, the hermaphrodite allele of the FSL locus may be an ortholog of the sequence established in SEQ ID NO: 6 corresponding to the plant species. In one example, the male allele of the FSL locus has an ORF comprising a sequence set forth in SEQ ID NO: 7, or a sequence having at least 70% identity thereto provided that the nucleotide corresponding to position 627 of the sequence set forth in SEQ ID NO:7 is a C. Exemplary sequences of the male allele of the FSL locus are described herein. In some examples, the male allele of the FSL locus has an ORF comprising the sequence set forth in SEQ ID NO: 7. In each of the above examples describing that a male allele of the FSL locus has an ORF that has a percentage level of identity with the sequence set forth in SEQ ID NO: 7, the male allele of the FSL locus may be an ortholog of the sequence established in SEQ ID NO: 7 corresponding to the plant species. In one example, the genotype of the plant at the FSL locus is determined by a POR-based assay. Any embodiment hereof shall apply mutatis mutandis to any other embodiment, unless specifically stated otherwise. The scope of the present invention should not be limited to the specific embodiments described herein, which are intended for exemplary purposes only. Functionally equivalent products, compositions and methods are clearly within the scope of the invention, as described herein. Throughout this description, unless specifically indicated otherwise or the context otherwise requires, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be deemed to encompass one and a plurality (i.e., one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter. The invention is described hereinafter by means of the following non-limiting examples and with reference to the accompanying figures. BRIEF DESCRIPTION OF THE FIGURES Figure 1A DNA sequence of the hermaphrodite FSL (H) allele of Cabernet sauvignon; Figure 1B DNA sequence of the female FSL (f) allele of Vitis sp. clone 04C023V0003; Figure 1C DNA sequence of the hermaphrodite FSL (H) allele of Vitis sp. clone 04C023V0006. Figure 1D DNA sequence for the male FSL (M) allele of Vitis sp. clones 04C023V0016. In each of the cases Figure 1A-D, the open reading frame is underlined and the sequence encoding the PLATZ domain is in bold. Figure 2. Multiple sequence alignment of open reading frames (ORFs) for the female allele (SEQ ID NO:5), the hermaphrodite allele (SEQ ID NO:6), and the male allele (SEQ ID NO:7) of the locus. FSL performed with CLUSTAL O (1.2.4). Figure 3A Protein sequence of the hermaphrodite FSL (H) allele of Cabernet sauvignon and Vitis sp. clone 04C023V0006; Figure 3B Protein sequence of the female allele FSL (f) of Vitis sp. clone 04C023V0003; Figure 3C Protein sequence of the hermaphrodite FSL (H) allele of Vitis sp. clone 04C023V0006. In each of the cases Figure 3A-C, the sequence encoding the PLATZ domain is in bold. Figure 4. Phylogenetic tree of the hermaphrodite protein sequence of Vitus vi ni fera. Figure 5A-F. It shows the expression of FSL at stage 1-2 of flower development, determined by the modified E-L system (Coombe (1995)). In situ hybridization was used to localize FSL transcripts in Figure 5A and Figure 5B) male flowers, (Figure 5C and Figure 5D) hermaphrodites, and (Figure 5E and Figure 5F) female flowers. The perianth organs (p) encapsulate the reproductive organs. The red and green arrows point to the anthers and stamen filaments in (Figure 5A). The ovule is marked by the blue arrow. Figure 6. Relative gene expression of FSL in leaves and early flowers measured by RT-qPCR Figure 7. In vitro screening of CRISPR guide RNAs targeting the FSL locus in Vitis vinifera. Guide RNAs designated sgRNAFSI and sgRNAFS4 were selected for CRISPR editing of microvines. Figure 8. Genetic transformation of microvines with CRISPR constructs targeting FSL. MA / a / ZUZI / UIDOUO 184 bp from the start codon and a CT deletion at position 182 bp from the start codon and a 10 bp deletion at position 180 bp from the start codon. The mutations are underlined. The boundary between the exon and intron is shown with an arrow. Figure 18. Alignment of the amino acid sequence for the homozygous mutants of the FSL locus obtained in the CRISPR / Cas9 floral sex lines of the T1 generation obtained for the guide RNAs FS1 and FS4. The alignment shows the effect of the mutations on the protein sequence. LIST OF SEQUENCES SEQ ID NO: 1 is an amino acid sequence corresponding to the hermaphrodite FSL (H) allele of Vitis vinifera. SEQ ID NO: 2 is an amino acid sequence corresponding to the female allele FSL (f) of a variety of Vitis vinifera. SEQ ID NO: 3 is an amino acid sequence corresponding to the male FSL (M) allele of a variety of Vitis vinifera. SEQ ID NO: 4 is an open reading frame (ORF) DNA sequence corresponding to the hermaphrodite FSL (H) allele of Cabernet sauvignon. SEQ ID NO: 5 is an open reading frame (ORF) sequence corresponding to the female FSL (f) allele of a variety of Vitis vinifera. SEQ ID NO: 6 is an open reading frame (ORF) sequence corresponding to the hermaphrodite FSL (H) allele of a variety of Vitis vinifera. SEQ ID NO: 7 is an open reading frame (ORF) sequence corresponding to the male FSL (M) allele of a variety of Vitis vinifera. SEQ ID NO: 8 is an amino acid sequence of the gibberellic acid-insensitive DELLA protein (GAI1) encoded by the GAI1 gene in Vitis vinifera. SEQ ID NO: 9 is an amino acid sequence of the variant of the GAI1 protein that comprises the substitution of Leu for His and which is encoded by the variant of the GAI1 gene in Vitis vinifera. SEQ ID NO: 10 is an amino acid sequence of the MADS-box 5 (VvMADS5) protein encoded by the VvMADS5 gene in Vitis vinifera. SEQ ID NO: 11 is an amino acid sequence of the VvMADS5 protein variant encoded by the VvMADS5 gene variant in Vitis vinifera. SEQ ID NO: 12 is a DNA sequence for a primer designated oligo dT B26. SEQ ID NO: 13 is a DNA sequence for a primer designated CSFS1_CDS_F1. SEQ ID NO: 14 is a DNA sequence for a primer designated FSL RT F1. ΜΛ / a / ZUZ 1 / U1 DOUO SEQ ID NO: 15 is a DNA sequence for a primer designated FSL_RT_R1. SEQ ID NO: 16 is a DNA sequence corresponding to the (sgRNA) designated Guide FS1 (in antisense orientation). SEQ ID NO: 17 is a DNA sequence corresponding to the (sgRNA) designated Guide FS4 (in antisense orientation). SEQ ID NO: 18 is a DNA sequence corresponding to the (sgRNA) designated Guide FS2 (in antisense orientation). SEQ ID NO: 19 is a DNA sequence corresponding to unique guide RNA unique guide RNA unique guide RNA unique guide RNA ΜΛ / a / ZUZ l / U 1 DOUO (sgRNA) designated Guide FS3 (in sense orientation). SEQ ID NO: 20 is a DNA sequence for a primer designated VvSDLFI. SEQ ID NO: 21 is a DNA sequence for a primer designated VvSDLF2. SEQ ID NO: 22 is a DNA sequence for a primer designated VvSDLRev. DETAILED DESCRIPTION OF THE INVENTION General techniques and definitions Unless specifically defined otherwise, all technical and scientific terms used herein will be deemed to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., plant molecular genetics, plant breeding). plants, cell culture, protein chemistry, wine production and biochemistry). Unless otherwise indicated, the recombinant DNA, recombinant protein, cell culture and immunological techniques used in the present disclosure are standard procedures, well known to those skilled in the art. These techniques are described and explained in the literature in sources such as J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Coid Spring Harbor Laboratory Press (1989), T.A. Brown (ed.), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (eds.), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and WileyInterscience (1988, including all updates to the present), Ed Harlow and David Lane (eds.) Antibodies: A Laboratory Manual, Coid Spring Harbor Laboratory, (1988) , and J.E. Coligan et al. (eds.) Current Protocols in Immunology, John Wiley & Sons (including all updates up to the present). Throughout this description, unless the context otherwise requires, the word comprises, or variations such as comprising or understanding, is understood to imply the inclusion of a step or element or whole number or group of steps or elements or integers, but not the exclusion of any other step or element or integer or group of elements or integers. The term and / or, for example, X and / or Y shall be understood as X and Y or Sex of flowers As used here, the term flower refers to the reproductive structure of a flowering plant (an angiosperm). Flowers are usually made up of two parts: the vegetative part, which consists of petals and associated structures in the perianth, and the reproductive or sexual parts. A flower may possess both the male and female reproductive parts (in which case the flower may be hermaphrodite), or it may possess only the male or female reproductive parts, in which case a flower may be either a male flower or a female flower. respectively. The male reproductive part is generally called the stamen and the female reproductive part the pistil. The stamen has two parts: anthers and filaments. Anthers carry pollen and are usually held by a thread-like part called a filament. The pistil has three parts: stigma, style and ovary. The stigma is a sticky structure located on the top of the pistil that traps and retains pollen transferred from the anthers. The style is the tube-shaped structure that supports the stigma and leads to the ovary that contains the ovules. Depending on whether a flower is male, female, or hermaphrodite, it will have only male reproductive parts, only female reproductive parts, or both female and male reproductive parts, respectively. Those skilled in the art will understand that plants can be monoecious, dioecious or hermaphrodite. A monoecious plant means a plant that has the male and female reproductive systems on the same plant, that is, a plant that has some flowers that are female and others that are male. A male flower is a flower that develops a pollen-laden stamen in the absence of a developed pistil, while a female flower is a flower that develops an ovule-bearing pistil in the absence of a developed stamen. On the other hand, a dioecious plant will be understood as a plant in which the male and female reproductive systems occur on separate plants. That is, one of the plants has the male reproductive parts (flowers with a stamen loaded with pollen) and the other plant has the female parts (flowers with a pistil that contains ovules). Flowers that are male or female (as is the case with dioecious and monoecious plants) are also sometimes called imperfect flowers. Hermaphroditic or hermaphroditic plant means a plant that produces flowers containing both male and female reproductive parts (i.e. stamen laden with pollen and pistil with ovules). The MA / a / ZUZI / UIOOUO hermaphrodite plants are largely self-pollinating and are truly bisexual. The flowers of hermaphrodite plants are also sometimes called perfect flowers. As used herein, the term female flower phenotype, phenotypically female flower or the like shall be understood to mean a flower that has only functional female reproductive parts and that exhibits a female flower phenotype. In some examples, a flower exhibiting a female flower phenotype may be a genetically hermaphrodite flower in which the male reproductive parts are non-functional and / or absent, i.e., due to reduced or absent activity of the FSL polypeptide in the plant. According to this example, reduced or absent activity of the FSL polypeptide in the plant prevents or inhibits the development and / or maturation of the male reproductive part of the flower. Genetically hermaphrodite flower means a flower that has a hermaphrodite genotype, that is, HH=hermaphrodite or Hf=hermaphrodite, at the FSL locus. Likewise, a hermaphrodite flower phenotype, hermaphrodite flower phenotype or similar, will be understood as a flower that has functional male and female reproductive parts. It follows that the term male flower phenotype refers to a flower that has only functional male reproductive parts. As used herein, the term controlling the sex of flowers on a plant or the like shall mean controlling or influencing whether a plant develops flowers that are phenotypically male, female, or hermaphrodite. That is, controlling whether a plant will develop flowers with male reproductive parts (stamen loaded with pollen) only, female reproductive parts (pistil with ovules) only, or both. The term flower sex locus (FSL) or FSL locus or FSL gene, as used herein, should be understood as a gene or locus that encodes a polypeptide (referred to herein as FSL polypeptide) that Inventors have shown that it is responsible for flower sex or flower gender in angiosperms. The inventors have characterized female (0 Y hermaphrodite (H) and male (M) alleles of the FSL locus in Vitis vinifera, whose open reading frame (ORF) DNA sequences are set forth in SEQ ID NOs: 5-7 respectively. Reference herein to an FSL locus is therefore intended to encompass the ORFs of the FSL locus allele sequences set forth in SEQ ID NOs: 5-7, as well as the FSL locus sequences that have at least 60% identity with them (for example, that they have at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85 %, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity with the sequence established in the SEQ ID NOs: 5-7). Orthologs of those are also contemplated. MA / a / ZUZI / UIOOUO sequences that correspond to the particular plant species of interest. The term locus (plural loci) will be understood as a specific place or location on a chromosome where a gene, polynucleotide or genetic marker is found. As used herein, the term allele(s) means one or more alternative forms or variants of a gene or polynucleotide sequence at a particular locus, all of which are related to a common trait or characteristic. In a polyploid (e.g. diploid) cell of a plant or part of a plant, one allele is present on each chromosome of a pair of homologous chromosomes at corresponding positions. In the context of the FSL locus, the term allele is used here to define alternative forms of the FSL locus that the inventors have shown to be associated with different flower sex phenotypes. For example, the inventors have characterized female (f) and hermaphrodite (H) and male (M) alleles of the FSL locus in Vitis vinifera, whose ORF DNA sequences are set forth in SEQ ID NOs: 5-7 respectively. Accordingly, reference herein to a female allele of the FSL locus, an allele of the female FSL locus, or the like will be understood to refer to a variant of the FSL locus that is associated with a female flower phenotype. Likewise, reference herein to a hermaphrodite FSL locus allele, hermaphroditic FSL locus allele, hermaphroditic FSL locus allele, hermaphroditic FSL locus allele or the like will be understood to refer to a variant of the FSL locus that is associated with a hermaphrodite floral phenotype. Reference herein to a male allele of the FSL locus, a male allele of the FSL locus or the like will be understood to refer to a variant of the FSL locus that is associated with a male flower phenotype. A genomic form or clone of a gene containing the transcribed region may be interrupted with non-coding sequences called introns or intermediate regions or intermediate sequences, which may be homologous or heterologous with respect to the exons of the gene. An intron, as used here, is a segment of a gene that is transcribed as part of a primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or spliced ​​from the nuclear or primary transcript; therefore, introns are absent in messenger RNA (mRNA). Introns can contain regulatory elements such as enhancers. Exons, as used here, refer to regions of DNA corresponding to RNA sequences that are present in the mature mRNA or in the mature RNA molecule in cases where the RNA molecule is not translated. An mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes a synthetic or fusion molecule that encodes all or part of the proteins of the invention described herein and a nucleotide sequence complementary to any of the above. A gene can be introduced into an appropriate vector for its extrachromosomal maintenance in a cell or, preferably, for its integration into the host genome. By modifying the polynucleotide sequence of the FSL locus in Vitis vinifera and the consequent alteration of the activity of the FSL polypeptide therein, the inventors have discovered that the expression of the FSL locus is essential for the development of the male reproductive organ in the flowers of Vitis vinifera. Specifically, the inventors have shown that a knock out of the FSL locus caused the male reproductive organ of Vitis vinifera flowers to be non-functional, giving rise to a phenotypically female flower. This supports the conclusion that expression of the male or hermaphrodite allele of the FSL locus is necessary for normal development of the male reproductive organ in flowers. In the absence of such expression, or in the absence of an appropriate level of expression, the male reproductive organ will be non-functional or absent, giving rise to a phenotypically female flower. As used herein, a non-functional male reproductive organ or non-functional male reproductive part, or the like, shall be understood as a stamen that is incapable of fertilizing a female reproductive organ (i.e., a pistil) of a flower. In some examples, a stamen is non-functional because it contains non-viable pollen, that is, infertile pollen, and / or because it is reflected and poorly developed. However, other embodiments in which the stamens are not functional are contemplated and are included herein. A flower that possesses non-functional male reproductive parts exhibits male sterility. Based on the finding that the FSL locus and, in particular, the expression of the male or hermaphrodite allele of the FSL locus is necessary for the development of functional male reproductive organs in flowers, the present disclosure contemplates the production and use of plants or parts thereof having an altered level of FSL polypeptide activity compared to a corresponding wild plant or part thereof comprising a wild FSL locus or an allele thereof. Said altered expression can be used to control the sex of flowers by modifying the development of the male reproductive organ or a part of it. The inventors have characterized the polypeptide sequences encoded by the hermaphrodite, female and male alleles for the FSL locus in Vitis sp., which are set forth in SEQ ID NO: 1-3 respectively. Reference herein to an FSL polypeptide is intended to encompass the FSL polypeptide sequences set forth in SEQ ID NO: 1-3, as well as FSL polypeptide sequences having at least 40% identity therewith (e.g. , having at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 96% , or at least 97%, or at least 98% or at least 99% identity with the sequence set forth in SEQ ID Nos: 1-3). Orthologs of those are also considered. MA / a / ZUZI / UIOOUO sequences that correspond to the plant species of interest. In particular examples, the activity of an FSL polypeptide encoded by a male or hermaphrodite allele of the FSL locus may be altered, as these alleles are believed to be necessary for the development of functional male reproductive organs. The term altered level of activity of the FSL polypeptide or the like shall be understood as a level of activity of the FSL polypeptide that is altered (for example, increased or decreased) relative to the level of activity of the FSL polypeptide in a plant or plant part of corresponding comparison comprising a genotype of the FSL locus that confers a male flower or hermaphrodite phenotype. A genotype of the FSL locus that confers a hermaphrodite flower phenotype may comprise a hermaphrodite allele of the FSL locus, for example, a wild hermaphrodite allele of the FSL locus. Likewise, a genotype of the FSL locus that confers a male flower phenotype may comprise a male allele of the FSL locus, for example, a wild male allele of the FSL locus. According to the previous example, an altered level of FSL polypeptide activity may be a level of FSL polypeptide activity that is altered relative to the activity of an FSL polypeptide encoded by a hermaphroditic or male allele of the FSL locus. In one example, the altered level of FSL polypeptide activity is a decrease in FSL polypeptide activity relative to the level of FSL polypeptide activity in a corresponding comparison plant or plant part. In another example, the altered level of FSL polypeptide activity is an absence of FSL polypeptide activity in the corresponding comparison plant or part of the plant. Altering the level of activity of the FSL polypeptide in the plant or part of the plant can be achieved by modifying a polynucleotide within the FSL locus relative to a corresponding polynucleotide sequence of a wild allele of the FSL locus, for example, relative to a sequence of polynucleotides corresponding to a wild male or hermaphrodite allele of the FSL locus. In an example, a polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or more (e.g., 1,2, 3, 4, 5, 6, 7, 8, 9, 10 or more) additions, deletions or nucleotide substitutions between positions 153 and 189, such as between positions 155 and 159, relative to the sequence set forth in SEQ ID NO: 6 or 7 (or at one or more corresponding nucleotide positions of the corresponding genomic sequence ). For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides deleted between the positions 153 and 189 in relation to the sequence established in SEQ ID NO: 6 or 7 (or in one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or more Ts (e.g., T, TT, or TTT) deleted between positions 155 and 159 relative to the sequence set forth in SEQ ID NO: 6 or 7 (or in one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, the polynucleotide sequence encoding the FSL polypeptide may have an ORF comprising one or more Ts (e.g., T, TT or TTT) added between positions 155 and 159 relative to the sequence set forth in SEQ ID NO: 6 or 7 (or in one or more corresponding nucleotide positions of the corresponding genomic sequence). For example, a polynucleotide encoding an FSL polypeptide may be modified such that the open reading frame is interrupted by a stop codon as a result of one or more mutations (e.g., nucleotide substitutions, deletions, or additions). According to this example, the modification may result in a non-functional FSL polypeptide. In another example, a polynucleotide encoding an FSL polypeptide can be modified to be more similar to a female allele of the FSL locus. In this regard, the inventors have determined that a variant of the FSL polypeptide encoded by the female allele of the FSL locus and comprising an amino acid sequence set forth in SEQ ID NO:2, results in a loss of male function, i.e. , male reproductive parts do not develop in a flower of a plant or part of the plant in which this variant of the FSL polypeptide is expressed. Relative to the FSL polypeptides encoded by the corresponding hermaphrodite and male alleles of the FSL locus (set forth in SEQ ID NOs: 1 and 3 respectively), this FSL polypeptide variant (referred to herein as the female FSL polypeptide) confers a loss of function. masculine. In certain embodiments, FSL polypeptide variants that confer male loss of function do not comprise a methionine (M) at a position corresponding to amino acid number 138 of the sequence set forth in SEQ ID NO:2. In other embodiments, FSL polypeptide variants that confer male loss of function comprise one or more or all of the amino acids at a position corresponding to positions 79, 120, 145, 166, 195, 200, 226, 232 of the established sequence. in SEQ ID NO:1. Accordingly, altering the level of activity of the FSL polypeptide in the plant or part of the plant can be achieved by modifying a polynucleotide encoding the FSL polypeptide to achieve a loss of male function as described herein. Methods for modifying a polynucleotide sequence (e.g., CRISPR, BEAD and ZFN) are described in the art and herein. In another embodiment, altering an activity level of the FSL polypeptide in the plant or part of the plant can be achieved by altering the expression level (e.g., increasing or decreasing an expression level) of the FSL polypeptide. For example, the activity of the FSL polypeptide can be altered by changes in the abundance of a MA / a / ZUZI / UIOOUO FSL polypeptide expressed in the plant or part of the plant. For example, the level of expression of the FSL polypeptide can be modulated by altering the number of copies per cell of the FSL locus or the allele thereof that encodes the FSL polypeptide. This can be achieved by introducing a synthetic genetic construct comprising the coding sequence and a transcriptional control element that is operably connected to it and that is functional in the cell. A plurality of transformants can be selected and screened for those with a favorable level of FSL polypeptide activity and / or expression specificity arising from the influences of endogenous sequences in the vicinity of the integration site of the synthetic construct. A favorable level and pattern of expression of the synthetic construct are those that result in a substantial modification of the FSL phenotype or another phenotype. Alternatively, a population of mutagenic seeds or a population of plants from a breeding program can be screened for individual lines with altered FSL polypeptide activity or other phenotype associated with flower sex. In another embodiment, altering a level of activity of the FSL polypeptide in the plant or part of the plant can be achieved by modifying the level of a transcription product of the FSL locus. For example, an RNA interference (RNAi) agent would be used to target an mRNA of the FSL locus, thereby reducing the activity of the FSL polypeptide in the plant or part thereof compared to a corresponding wild-type plant or part thereof. . In another embodiment, altering an activity level of the FSL polypeptide in the plant or plant part can be achieved by modifying an interaction of the FSL polypeptide with one or more binding partners thereof, for example, a DNA binding partner or of the protein that participates in a transcription process. As described herein, altering the activity of an FSL polypeptide may comprise reducing the level of activity. For example, reducing the level of activity of the FSL polypeptide may comprise reducing the expression of the FSL polypeptide, including the level of expression of the functional or biologically active FSL polypeptide. For example, the activity of the FSL polypeptide in the plant or part of the plant may be reduced by at least 10% relative to a level of activity of the FSL polypeptide in a corresponding plant or part thereof comprising an FSL locus genotype. that confers a male or hermaphrodite flower phenotype. For example, the activity of the FSL polypeptide in the plant or part of the plant may be reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% in relation to an activity level of the FSL polypeptide in a plant or part thereof corresponding to comprises a genotype of the FSL locus that confers a flower phenotype MA / a / ZUZI / UIOOUO male or hermaphrodite. In some examples, altering the activity of the FSL polypeptide may comprise complete inhibition of the FSL polypeptide or preventing expression of the FSL polypeptide by deletion of the FSL locus or an allele thereof. The inventors have identified that the FSL locus encodes a domain rich in plant AT's and zinc-binding or PLATZ sequences. The PLATZ superfamily of transcription factors has been found to exist only in plants and are likely transcription factors. Prior to the present disclosure, PLATZ proteins had not been identified as being involved in flower sex determination. In fact, the precise function of PLATZ proteins in plants remains poorly understood. In studies of Vitis vinifera, Díaz-Riquelman (2014) found that the PLATZ family of transcription factors was upregulated in tendrils, which is hypothesized to be related to cell differentiation that occurs during tendril development. . The present inventors have identified a PLATZ domain in the FSL polypeptides of Vitis vinifera at positions 26 to 75 of the sequences established in SEQ ID NO: 1 and 3, and at positions 24 to 73 of the sequence established in SEQ ID NO: 2. This domain is conserved in each of the female, hermaphroditic, and male Vitus vinifera alleles at the polypeptide level (i.e., 100% identity). The PLATZ domain appears to be essential for the activity of the FSL polypeptide and its role in the development of the male reproductive organ. On this basis, altering the activity of the FSL polypeptide in a plant or a plant part to control flower sex may involve modification of the polynucleotide sequence encoding the PLATZ domain, or post-transcriptional silencing of the FSL transcript. FSL mRNA using an RNAi agent targeting a region of the transcript corresponding to the PLATZ domain. Altered activity of the FSL polypeptide in the plant or part thereof, for example, a reduction in the activity of the FSL polypeptide as described herein, can cause a male reproductive part of a flower of the plant to be absent or not be functional. In some examples, the male reproductive part of a flower may be absent due to altered, e.g., reduced, activity of the FSL polypeptide. In some examples, the male reproductive part of a flower may be absent due to altered, e.g., reduced, activity of the FSL polypeptide resulting from one or more mutations in the polynucleotide sequence of the FSL locus or an allele thereof encoding the FSL polypeptide. In other examples, the male reproductive part of a flower may be present but not functional due to altered, e.g., reduced, activity of the FSL polypeptide. A non-functional male reproductive part of a flower may be underdeveloped due to altered, for example reduced, activity of the FSL polypeptide, rendering it non-functional. In some examples, a plant or part MA / a / ZUZI / UIOOUO of the plant in which the level of the FSL polypeptide is altered, for example, reduced, produces flowers that are male sterile. The inventors have also identified a specific missense mutation SNP in a region of the FSL locus encoding a PLATZ domain that shows 100% concordance between the genotype, i.e., male flowers (FSL / fsl or FSL / FSL), flowers female (fsl / fsl) or hermaphroditic flowers (FSL / fsl or FSL / FSL), and the flower sex phenotype in Vitis vinifera. As used here, the SNP may be referred to as the flower sex SNP. In the female allele of the FSL locus, the flower sex SNP is located at position 621 of the ORF sequence set forth in SEQ ID NO: 5 and comprises an A. In the hermaphrodite allele of the FSL locus, the SNP is located at position 627 of the ORF sequence set forth in SEQ ID NO: 6 and comprises a C. The present inventors contemplate the use of this flower sex SNP to determine the genotype of the FSL locus of a plant or plant part and thus predict its flower sex phenotype, for example, even before a plant or plant part is mature enough to produce flowers. This SNP may be part of a diagnostic method or test to determine the sex of a plant flower or plant part, as described herein. For example, a female allele of the FSL locus (or a similar term) may have an ORF that comprises a sequence set forth in SEQ ID NO: 5, or a sequence that has at least 70% identity therewith (e.g. , having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97% , or at least 98% or at least 99% identity with the sequence established in SEQ ID NO: 5), provided that the nucleotide position corresponding to position 621 of the ORF sequence established in SEQ ID NO: 5 be an A. For example, a hermaphroditic allele of the FSL locus or a male allele of the FSL locus (or similar terms) may have an ORF that comprises a sequence set forth in SEQ ID NO: 6, or a sequence that has at least one 70% identity with it (for example, having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity with the sequence established in SEQ ID NO: 5), provided that the nucleotide position corresponding to position 627 of the ORF sequence set forth in SEQ ID NO: 6 is a C. By determining the genotype of a plant or plant part at the flower sex SNP within the FSL locus (using standard molecular techniques), one can predict or determine the sex of the flower. As indicated herein, the terms FSL locus, FSL locus alleles and FSL polypeptides are intended to encompass orthologous FSL locus sequences, orthologous FSL allelic sequences (including orthologs of the male FSL allelic sequences, MA / a / ZUZI / UIOOUO female and hermaphrodite) and FSL polypeptide sequences orthologous to those exemplified for Vitis sp. The orthologs will preferably correspond to the specific plant species that is produced. Orthologous genes, loci, alleles or polypeptides are homologs that have diverged following a speciation event. Although sequence variations may arise between orthologous genes, loci, alleles, or polypeptides once two species have diverged, orthologs may maintain the same or substantially the same function as that of the ancestral gene, loci, allele, or polypeptide from which they evolved. . Therefore, orthologous FSL locus sequences, including male, female and hermaphroditic alleles thereof, will be understood to include FSL locus sequences derived from plant species other than Vitis vinifera that have common ancestry to the sequences established in SEQ ID NOs: 4-7 and that perform the same or similar function in the respective plant species. Likewise, orthologous FSL polypeptides will be understood to include FSL polypeptide sequences derived from plant species other than Vitis vinifera that have common ancestry with the sequences set forth in SEQ ID NOs: 1-3 and that perform the same function. similar in the respective plant species. The term wild type is generally understood as a typical or common form of a gene, loci, allele, polypeptide or phenotype that occurs in an organism (or within a given population) in nature. Unless specifically stated otherwise, the term wild type shall be understood to have its usual meaning. However, in the context of the FSL locus, the term wildtype is used here to delineate between the natural or unmodified forms of the FSL locus alleles and the modified or altered counterparts of the disclosure. In this regard, the inventors have shown that there are sex-specific alleles of the FSL locus, that is, a male-specific allele of the FSL locus, a female-specific allele of the FSL locus and a hermaphrodite-specific allele of the FSL locus. To distinguish between the natural or unmodified forms of the respective sex-specific alleles of the FSL locus and the modified or altered counterparts of the disclosure, the term wild type has also been used to denote the respective natural or unmodified allelic forms. Accordingly, as used herein, the term wild male FSL locus allele, wild male FSL locus allele or the like shall be understood to refer to the naturally occurring or unmodified male allele of the FSL locus. Likewise, the term wild-type female FSL locus allele, wild-type female allele of the FSL locus or the like used herein shall be understood to refer to the wild-type or unmodified female allele of the FSL locus. Likewise, the term wild hermaphrodite FSL locus allele, wild hermaphrodite FSL locus allele or the like used herein shall be understood to refer to the wild-type or unmodified hermaphrodite allele of the FSL locus. MA / a / ZUZI / UIOOUO According to an example in which the plant species is Vítis vinifera, the wild alleles for female, hermaphrodite and male may have ORFs comprising the sequences set forth in SEQ ID NOs: 5-7, respectively. However, it will be understood that the sequences of the female, hermaphrodite and male alleles of the FSL locus may vary within a particular species (e.g. variation between different populations) as well as between species (e.g. orthologs). Accordingly, it will be appreciated that reference to wild type in the context of female, hermaphrodite and male alleles of the FSL locus may also encompass ORF sequences that are at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequences established in SEQ ID NOs: 5-7, respectively. The inventors have also found that sex-specific alleles of the FSL locus encode FSL polypeptides with variable sequences. Accordingly, reference here to the term wild-type in the context of FSL polypeptides refers to the wild-type or unmodified FSL polypeptide variant encoded by the wild-type hermaphroditic, female, and male alleles of the FSL locus, respectively, as described herein. According to an example in which the plant species is Vítis vinifera, the FSL polypeptides encoded by the wild hermaphrodite, female and male alleles of the FSL locus may comprise the sequences set forth in SEQ ID NOs: 1-3, respectively. However, as with the FSL locus and sex-specific alleles thereof, it will be understood that the FSL polypeptide sequences encoded by the wild, female, and male hermaphrodite alleles of the FSL locus may vary within a particular species (e.g. , variation between different populations), as well as between different species (for example, orthologs of FSL polypeptides). Accordingly, it will be appreciated that reference to the FSL polypeptide sequences encoded by the wild-type, female and male hermaphroditic alleles of the FSL locus (collectively wild-type FSL polypeptides) may also encompass sequences that are at least 50%, at least 60% , at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97, at least 98%, at least 99% identical to the amino acid sequences established in SEQ ID NOs: 1-3, respectively. The term wild, as used in the context of a plant or part thereof of the disclosure, will be understood as a plant or part of the plant in which the FSL locus or the FSL polypeptide has not been modified, i.e. , a plant or plant part comprising the FSL locus or an allele thereof as it occurs in nature in that plant species. Terms such as modifying, modifying, modifies or the like, used herein in the context of modifying the FSL locus or an allele thereof, shall be understood as the introduction of one or more physical changes in the sequence of the FSL locus or of an allele thereof, including nucleotide substitutions, additions and / or deletions, in relation to a reference FSL locus sequence, for example, the sequence of a wild male or a hermaphroditic allele of the FSL locus. Exemplary modifications are described herein. Modification of the sequence of the FSL locus can be achieved using any means known in the art to modify nucleic acids, including, for example, random and site-directed mutagenesis, transgene expression, CRISPR, TALON and / or ZFN technologies as described. described in the art or herein. One or more changes in the sequence of the FSL locus or an allele thereof preferably results in one or more changes in the amino acid sequence of the FSL polypeptide encoded thereby, for example, one or more additions, deletions or substitutions of amino acids relative to the FSL polypeptide sequence encoded by the corresponding unmodified FSL locus sequence or an allele thereof. Accordingly, the altered level of activity of the FSL polypeptide can be achieved by introducing one or more changes in the sequence of the FSL locus or an allele thereof. Preferably, the activity of the FSL polypeptide is reduced or abolished by modifying the sequence of the FSL locus or an allele thereof and the corresponding FSL polypeptide encoded thereby. However, in some alternative examples, the activity of the FSL polypeptide can be increased by modifying the sequence of the FSL locus or an allele thereof, for example, by introducing one or more instances of a male allele or a hermaphroditic allele of the FSL locus into a plant or part of the plant using recombinant methods. As used herein, the term heterozygous refers to the presence of different alleles (forms of a given gene) at a particular gene locus. Thus, reference to a heterozygote refers to an individual diploid or polyploid plant cell or to a plant that has different alleles (forms of a given gene) present at at least one locus. As used here, the term homozygous refers to the presence of identical alleles at one or more loci on homologous chromosome segments. Therefore, reference here to a homozygote refers to an individual plant cell or a plant that has the same alleles at one or more loci. As used herein, the term a parent plant capable of exhibiting a desired flower sex phenotype on the basis of the FSL locus genotype will be understood as progeny having a FSL locus genotype that confers a phenotype of the FSL locus. sex of the flower of interest. In some examples, a parent plant capable of exhibiting a desired flower sex phenotype based on the genotype of the FSL locus is MA / a / ZUZI / UIOOUO actually exhibiting the phenotype of the sex of the flower of interest, that is, the parent plant is in flower or a flower is in a stage of development. In other examples, a parent plant capable of exhibiting a desired flower sex phenotype based on the genotype of the FSL locus is not in flower, for example, at the time of a sectioning stage. This may be because the parent plant is immature and not yet capable of producing flowers, or because the environmental conditions are not conducive to flowering. Without seeds Herein, the term fruit refers to a seed-bearing structure developed from the ovary of angiosperm flowers, usually following fertilization with viable pollen. The term seed, as used herein, encompasses both mature seed and developing seed that is produced after fertilization and before seed dormancy is established and before harvest. The term seedless, as used here in the context of fruits, may refer to the complete absence of hard seeds in the (ripe) fruit (i.e., seedless as a result of parthenocarpy) and / or to a reduction significant reduction in the total number of seeds (i.e. reduced seed) and / or to an arrest of seed development in the early stages (e.g. as a result of stenospermocarpy), so that there is a significant reduction in the eventual number of seeds. fully developed seeds, where a significant reduction refers to a reduction of at least 40% of the wild type, preferably a reduction of at least 50%, 60%, 70%, 80%, 90%, 95% or 98% , more preferably a 100% reduction of the wild type (i.e. completely seedless). Stenospermocarpic seed deficiency occurs through a biological process whereby a flower is fertilized and the seed begins to develop, but seed development is interrupted at an early stage leaving a trail of seed in the fruit. Therefore, the term seedless, as used here, encompasses a phenotype in which the fruit contains a trace of seed or one or more soft seeds that are remains of the undeveloped aborted seed. dwarf height The present disclosure provides new plants or parts of plants that produce seedless fruits, wherein the plants or parts of plants have altered, for example, reduced, the activity of the FSL polypeptide as described herein, and a polynucleotide that confers dwarf stature. The present disclosure provides novel plants or plant parts that produce seedless fruits, wherein the plants or plant parts comprise an FSL locus that is homozygous for the female allele of the FSL locus (f / f) as described herein , and a polynucleotide that confers dwarf stature. Plants or plant parts that are homozygous for the female allele of the FSL locus (f / f) can be identified using the flower sex SNP as described herein. As mentioned herein, a dwarf plant will be understood to be an individual plant or a plant variety of a particular species that is shorter in height relative to the average (normal) height for the particular species. Therefore, dwarf stature is short stature. The literature is replete with information on dwarf plant development, including the genes and means of achieving dwarf stature. Any polynucleotide known in the art to confer dwarf stature to a plant is contemplated herein. In one example, the polynucleotide that confers dwarf stature to the plant is altered relative to the corresponding wild or naturally occurring polynucleotide sequence. The development of a dwarf vine with a fast flowering phenotype, called microvines, has been previously described by the inventors (Boss and Thomas, (2002) Nature, 416(6883):847-850). The previously reported microvine phenotype is based on a variant of the gibberellic acid insensitive gene (VvGAH) comprising a SNP (T to A mutation) in the translated region at position 231 of the normal VvGAH gene. . The point mutation present in the variant VvGAH gene converts a leucine residue of the conserved DELLA domain into histidine, thus altering the gibberellic acid (GA) response properties of the plant. The GAI1 gene variant causes a dwarf stature and rapid flowering phenotype when present in a heterozygous (GAH / gail) or homozygous (gail / gaH) state. Accordingly, in some examples, reference herein to a mutated or similar gibberellic acid insensitive gene (GA11) in the context of a plant, or plant progeny, propagative material or fruit thereof, of the disclosure will be understood as a mutated GAI1 gene variant that confers dwarf stature and a rapid flowering phenotype as previously described in Boss and Thomas (2002), the full content of which is incorporated herein by reference, or another mutated GAI1 gene variant that similarly prevents that the GAI1 protein responds to GA signaling. In one example, the polynucleotide that confers dwarf stature is a variant of the GAI1 gene or a fragment thereof. The GAI1 gene variant may encode a variant of the GAI1 protein. In one example, the GAI1 gene variant or fragment thereof comprises one or more mutations in a region encoding the DELLA domain. For example, one or more mutations in the region encoding the DELLA domain of the GAI1 protein can alter the GA-responsive properties of the plant or plant part, for example, as in MA / a / ZUZI / UIOOUO microvid. For example, one or more mutations in the DELLA domain may prevent the plant or part of the plant from responding to GA signaling. Accordingly, in some examples, the plant or plant part comprising a variant of the GAI1 gene or a fragment thereof does not respond, or responds poorly, to GA signaling. One or more mutations can be selected from amino acid substitutions, deletions or additions. In an example, the GAI1 protein variant may comprise a sequence set forth in SEQ ID NO: 8 with a Leu to His substitution at position 38 thereof, or a sequence having at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 98% identity, or at least 99% identity with the sequence established in the SEQ ID NO: 8, provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO: 8 is replaced by a larger basic residue, for example, His. In one example, the GAI1 variant protein comprises a sequence that is at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99, 5%, at least 99.6%, at least 99.7%, or at least 99.8% identical to the sequence set forth in SEQ ID NO: 8, provided that the Leu of the DELLA domain corresponding to the position 38 of SEQ ID NO: 8 is replaced by a larger basic residue, for example, His. The GAI1 protein variant may comprise the sequence set forth in SEQ ID NO: 9. According to this example, the plant or part of the plant may be a microvine as described in Boss and Thomas, (2002) Nature, 416 (6883):847-850 having an altered level of FSL polypeptide activity as described herein. In other examples, the DELLA domain may be altered, truncated, or completely deleted from the GAI1 gene or fragment thereof, for example, as a result of one or more mutations. The result of one or more mutations is preferably a non-functional GAI1 gene. The polynucleotide that confers the dwarf state, for example, the GAI1 gene variant or fragment thereof, may be present in a homozygous (GAI1 / GAI1) or heterozygous (GAI1 / Gai1) state. Also contemplated is a plant or plant part in which the GAI1 protein or the DELLA domain thereof is silenced, for example, post-transcriptionally silenced using an RNAi agent. According to this example, the polynucleotide that confers dwarf stature to the plant may be an RNAi agent targeting an mRNA transcript of the GAI1 protein, for example, such as that corresponding to the DELLA domain. RNAi agents are described herein. In each of the above examples describing a plant or part of a plant having an altered level of FSL polypeptide activity and a polynucleotide that confers dwarf stature, the plant or part thereof can produce parthenocarpic fruits. IVIA / a / ZUZ l / U I ODUO seedless when the flowers are not pollinated and fruit containing seeds when the flowers are pollinated with viable pollen. Stenospermocarpy The present disclosure also contemplates new plants and plant parts that produce seedless fruits, wherein said plant or plant parts comprise: an altered, e.g., reduced, level of FSL polypeptide activity as described herein; a polynucleotide that confers dwarf stature as described herein; and a polynucleotide that confers stenospermocarpy. The present disclosure also contemplates new plants and plant parts that produce seedless fruits, wherein said plant or plant parts comprise: an FSL locus that is homozygous for the female allele of the FSL locus (f / f) as described in the present document; a polynucleotide that confers dwarf stature as described herein; and a polynucleotide that confers stenospermocarpy. Stenospermocarpy is the biological mechanism that produces the absence of seeds in some fruits, especially in many table grapes. In seedless stenospermocarpic fruits, normal pollination and fertilization are still necessary to ensure that the fruit sets, that is, continues to develop on the plant; However, subsequent abortion of the embryo that began to grow after fertilization leads to a nearly seedless condition. The remains of the undeveloped seed are visible in the fruit. Seedless table grape varieties produce seedless fruits due to stenospermocarpy, in which the flower is fertilized and the seed begins to develop, but stops its development at an early stage leaving a trail of seed in the fruit. In some examples, fruits produced from plants or plant parts of the present disclosure are seedless and have a seedless phenotype consistent with that exhibited by fruits produced from fertilized female ovules of stenospermocarpic plants. Often, stenospermocarpic fruits may contain one or more soft seeds that are the remains of the arrested fertilized seed. Unlike stenospermocarpy, parthenocarpy. Parthenocarpy is generally understood in the art, and should also be understood in connection with the present disclosure, to describe the development of fruits without fertilization of the female ovule. Parthenocarpy literally means virgin fruit. Since the pollination process is not required to produce fruit, no seeds develop. In this sense, parthenocarpic fruits have a true absence of seeds. Any polynucleotide known in the art to confer stenospermocarpy to plants is contemplated herein. In some example, the polynucleotide that confers stenospermocarpy to the plant or a part thereof may be altered in relation to MA / a / ZUZI / UIOOUO with the corresponding wild-type or naturally occurring gene. In a particular example, the polynucleotide that confers stenospermocarpy to the plant or part thereof is a variant of the Vitis vinifera MADS-box protein 5 (VvMADS5) locus. The variant or mutated VvMADS5 locus (also known as VviAGLU) is known to be associated with the stenospermocarpy (SDL1) phenotype in Vitus sp. when present in a heterozygous or homozygous state. Mutation in this VvMADS5 variant results in a G to T substitution at position 590 bp of the coding sequence resulting in an Arg197Leu substitution (Royo et al., 2018). Accordingly, reference herein to a stenospermocarpy-associated mutated VvMADS5 gene, variant VvMADS5 locus or the like will be understood to encompass the mutant VvMADS5 gene described in Royo et al., (2018), the full contents of which are incorporated herein. document by reference. In one example, the polynucleotide that confers stenospermocarpy is a variant of the VvMADS5 locus. The VvMADS5 locus encoding the VvMADS5 protein (i.e., the endogenous or non-variant protein) may comprise the amino acid sequence set forth in SEQ ID NO: 10, and the variant VvMADS5 protein may comprise an Arg substitution at position 197 of the sequence set forth in SEQ ID NO: 10 with a hydrophobic amino acid, for example, Leu (R197L). In one example, the variant VvMADS5 locus encodes a variant VvMADS5 protein comprising an amino acid sequence set forth in SEQ ID NO: 11, or a sequence that has at least 80% identity therewith (e.g., having at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 99% identity with the sequence set forth in SEQ ID NO: 11) provided that the amino acid at position 197 with respect to SEQ ID NO: 11 is a hydrophobic amino acid, for example, Leu. For example, the VvMADS5 locus variant may encode a VvMADS5 protein variant that comprises an amino acid sequence that is at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 11 provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, e.g. Leu. In a particular example, the variant VvMADS5 locus encodes a variant VvMADS5 protein comprising the amino acid sequence set forth in SEQ ID NO: 11, for example, as described in Royo et al., 2018. In other examples, the VvMADS5 protein is truncated or completely eliminated from the plant or plant part, for example, as a result of one or more mutations in the VvMADS5 locus. Preferably, one or more mutations result in a non-functional VvMADS5 protein. The polynucleotide that confers stenospermocarpy, for example, the VvMADS5 locus variant encoding the VvMADS5 protein variant described herein, may be present in a homozygous or heterozygous state. In another example, the VvMADS5 protein is silenced, e.g., post-transcriptionally silenced. According to this example, the polynucleotide that confers stenospermocarpy to the plant may be an RNAi agent targeting an mRNA transcript encoded by the VvMADS5 locus. In each of the above examples describing a plant or part of a plant further comprising a polynucleotide that confers stenospermocarpy, the plant produces seedless parthenocarpic fruits when the flowers are unpollinated and stenospermocarpic fruits when the flowers are pollinated with viable pollen. Polypeptides As used herein, the term FSL polypeptide will be understood as a polypeptide encoded by the FSL locus or an allele thereof as described herein, the activity of which has been demonstrated by the inventors to be responsible for the sex of flowers Specifically, the inventors have demonstrated that the FSL polypeptide encoded by the male and hermaphrodite alleles of the FSL locus is responsible for the development of the male reproductive organ of flowers. As used herein, the term FSL polypeptide generally refers to a family of proteins that share a high level of primary sequence identity with the polypeptide sequences set forth in SEQ ID NO: 1-3, e.g., sequences FSL polypeptides that have at least 40% identity with the sequences set forth in SEQ ID NO: 1-3 (for example, having at least 50%, or at least 60%, and preferably at least 70% , or at least 80%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity with the sequence established in SEQ ID NO: 1-3). Orthologs of those sequences that correspond to the particular plant species of interest are also considered. The present inventors have determined that the altered activity level of certain variants of the FSL polypeptide family, when expressed in a plant, cause an altered floral sex phenotype. An example of a variant comprises an amino acid sequence provided as SEQ ID NO:2, encoded by the female allele of the FSL locus. Relative to the FSL polypeptides encoded by the corresponding hermaphrodite and male alleles of the FSL locus (set forth in SEQ ID NO: 1 and 3 respectively), this variant of the FSL polypeptide (referred to herein as the female FSL polypeptide) confers a loss of male function, that is, a functional male reproductive part does not develop in the flower. In certain embodiments, variants of the FSL polypeptide that confer a loss of male function do not comprise a methionine (M) at a position corresponding to amino acid number 138 of the sequence set forth in SEQ ID NO:2. In other embodiments, FSL polypeptide variants that confer male loss of function comprise one or more or all of the amino acids at a position corresponding to positions 79, 120, 145, 166, 195, 200, 226, 232 of the established sequence. in SEQ ID NO:1. In particular examples, the activity of an FSL polypeptide encoded by a male or hermaphrodite allele of the FSL locus can be altered to confer loss of male function by modifying one or more of the amino acids as described herein, as it is believed that These alleles are necessary for the development of functional male reproductive organs. The inventors have identified that the FSL polypeptide includes a binding domain for sequences rich in AT's and zinc or PLATZ. It has been discovered that the PLATZ superfamily of transcription factors only exists in plants and is likely to be transcription factors. Prior to the present disclosure, PLATZ proteins had not been identified as being involved in flower sex determination. The present inventors have identified a PLATZ domain in the FSL polypeptides of Vitis vinifera at positions 26 to 75 of the sequences established in SEQ ID NO: 1 and 3, and at positions 24 to 73 of the sequence established in SEQ ID NO: 2. As such, reference herein to a PLATZ domain is intended to encompass the amino acid sequences set forth from position 26 to 75 of the sequences set forth in SEQ ID NOs: 1 and 3, and position 24 to 73. of the sequence established in SEQ ID NO: 2, as well as the PLATZ domains of the FSL polypeptides that have at least 40% identity with said sequences (for example, having at least 80%, or at least 90 %, or at least 95%, or at least 96%, or at least 97%, or at least 98% or at least 99% identity with the PLATZ domains within the sequence established in the SEQ ID NOs: 1-3). Orthologues of these sequences that correspond to the plant species of interest are also considered. In some examples, one or more mutations may be introduced into the PLATZ domain of the FSL polypeptide to alter the activity of the FSL polypeptide, for example, to confer a loss of male function. Reference herein to a variant GAI1 protein shall be taken to mean a protein or polypeptide encoded by a variant of the GAI1 gene or fragment thereof comprising one or more mutations, such as in a region encoding the DELLA domain, as described in This document. One or more mutations in the region encoding the DELLA domain of the GAI1 protein preferentially alter the GA-responsive properties of a plant or plant part expressing the GAI1 protein variant. One or more mutations can be selected from amino acid substitutions, deletions or additions. Exemplary variant GAI1 proteins include, but are not limited to, those polypeptides that comprise a sequence set forth in SEQ ID NO: 8 with a MA / a / ZUZI / UIOOUO substitution of Leu to His at position 38 thereof, or a sequence having at least 80% identity therewith (e.g. having at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 98% identity, or at least 99% of identity with the sequence established in SEQ ID NO: 8) provided that the Leu of the DELLA domain corresponding to position 38 of SEQ ID NO: 8 is replaced by a larger basic residue, for example, His. In preferred examples, the GAI1 protein variant comprises a sequence that is at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, or at least 99.8% identical to the sequence set forth in SEQ ID NO: 8, provided that the Leu of the corresponding DELLA domain at position 38 of SEQ ID NO: 8 is replaced by a larger basic residue, for example, His. One of the preferred variants of the GAI1 protein may comprise the sequence set forth in SEQ ID NO: 9. Reference herein to a variant VvMADS5 protein shall be understood as any protein or polypeptide encoded by a variant VvMADS5 locus or a fragment thereof, provided that the polypeptide differs in sequence from the wild-type or naturally occurring VvMADS5 protein. Exemplary variant VvMADS5 proteins include, but are not limited to, those polypeptides that comprise an amino acid sequence set forth in SEQ ID NO: 11, or a sequence that has at least 80% identity therewith (e.g., that has at least 85% identity, or at least 90% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 99 % identity with the sequence set forth in SEQ ID NO: 11) provided that the amino acid at position 197 with respect to SEQ ID NO: 11 is a hydrophobic amino acid, for example, Leu. For example, the VvMADS5 locus variant may encode a VvMADS5 protein variant that comprises an amino acid sequence that is at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 11 provided that the amino acid at position 197 relative to SEQ ID NO: 11 is a hydrophobic amino acid, e.g. Leu. A preferred variant of the VvMADS5 protein comprises the amino acid sequence set forth in SEQ ID NO: 11, for example, as described in Royo etal., 2018. As used herein, a biologically active fragment of an FSL polypeptide is a portion of an FSL polypeptide of the invention that maintains the activity of a full-length FSL polypeptide. Biologically active fragments, as used herein, exclude the full-length polypeptide. The biologically active fragments can be portions of any size as long as MA / a / ZUZI / UIOOUO that maintain the defined activity. In one example, a biologically active fragment of the FSL polypeptide is the PLATZ domain. Preferably, the biologically active fragment maintains at least 10% of the activity of the full-length polypeptide. The terms polypeptide and protein are generally used interchangeably herein. A polypeptide or class of polypeptides can be defined by the degree of identity (% identity) of its amino acid sequence with a reference amino acid sequence, or by having a greater % identity with one reference amino acid sequence than with another. . The % identity of a polypeptide with respect to a reference amino acid sequence is usually determined by GAP analysis (Needleman and Wunsch, 1970; GCG program) with the parameters of a gap creation penalty = 5, and an extension penalty of gaps=0.3. The query sequence is at least 100 amino acids long and GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences in a region of at least 250 amino acids. Even more preferably, GAP analysis aligns two sequences along their entire length, and the degree of identity is determined over the entire length of the reference sequence. The polypeptide or class of polypeptides may have the same enzymatic activity as the reference polypeptide, or a different activity, or lack thereof. Preferably, the FSL polypeptide, whose activity is altered according to the present disclosure, has an activity that is at least 10% less (e.g., at least 20% less, or at least 30% less, or at least 40% less, or at least 50% less, or at least 60% less, or at least 70% less, or at least 80% less, or at least 90% less) than the activity of the polypeptide Reference FSL (e.g., an FSL polypeptide encoded by a wild-type allele of the FSL locus as described herein). In some examples, the altered level of FSL polypeptide activity means an absence of FSL activity. As used herein, a biologically active fragment is a portion of a polypeptide of the invention that maintains a defined activity of a full-length reference polypeptide. Biologically active fragments, as used herein, exclude the full-length polypeptide. Biologically active fragments can be portions of any size as long as they maintain the defined activity. With respect to a defined polypeptide or enzyme, it will be appreciated that % identity figures greater than those provided herein will encompass preferred embodiments. Thus, when applicable, in light of the minimum figures of % of MA / a / ZUZI / UIOOUO identity, it is preferred that the polypeptide / enzyme comprises an amino acid sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93% , more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the corresponding SEQ ID NO. Amino acid sequence mutants of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes in a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletions, insertions and substitutions can be made to arrive at the final construct, provided that the final polypeptide product possesses the desired characteristics. Mutant (altered or variant) polypeptides can be prepared by any technique known in the art, for example, using directed evolution or rational design strategies (see below). Products derived from mutated / altered DNA can be readily examined using the techniques described in the art and herein to determine whether they possess FSL polypeptide activity and influence the development of flowers of the male reproductive parts. In the design of amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on the characteristic(s) to be modified. Mutation sites can be modified individually or in series, for example, (1) substituting first with conserved amino acid selections and then with more radical selections depending on the results obtained, (2) deleting the target residue, or (3) inserting other residues. adjacent to the located site. Deletions of amino acid sequences generally range between 1 and 15 residues, more preferably between 1 and 10 residues and typically between 1 and 5 contiguous residues. Substitution mutants have at least one amino acid residue in the polypeptide removed and a different residue inserted in its place. Sites of greatest interest for substitutive mutagenesis to inactivate enzymes include sites identified as active site(s). Other sites of interest are those in which certain residues obtained from several strains or species are identical. These positions may be important for biological activity. These sites, especially those that fall within a sequence of at least three other identically conserved sites, are preferably replaced in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of exemplary substitutions. MA / a / ZUZI / UIOOUO Table 1. Exemplary substitutions Original residue Exemplary substitutions Ala (A) val; leu; you; gly Arg (R) lys Asn (N) gln; his Asp (D) glu Cys (C) ser Gln (Q) asn; his Glu (E) asp Giy (G) pro, ala His (H) asn; gln lle(l) leu; val; wing Leu (L) ile; val; met; to the; phe Lys (K) arg Met (M) leu; phe Phe (F)leu; val; ala Pro (P) giy Ser(S) thr Thr (T) ser Trp (W) tyr Tyr (Y) trp; phe Val (V) ¡le; leu; met; phe, wing In a preferred embodiment, a mutant / variant polypeptide has only, or no more than, one or two or three or four amino acid changes when compared to a naturally occurring polypeptide. Mutants with the desired activity can be designed using standard procedures in the art, such as by performing random mutagenesis, targeted mutagenesis or saturation mutagenesis on known genes of interest, or by subjecting different genes to a mixture of DNA. Also contemplated are FSL polypeptides of the disclosure, for example, that have altered FSL activity, that have been differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, binding to an antibody molecule or other cellular ligand, etc. Such polypeptides can be post-translationally modified in a cell, for example, through phosphorylation, which can modulate their activity. These modifications may serve to increase the stability and / or bioactivity of the FSL polypeptides of the invention. Polynucleotides The terms polynucleotide and nucleic acid are used interchangeably. They refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides, or analogues thereof. A polynucleotide of the invention may be of genomic, cDNA, semisynthetic or synthetic, double-stranded or single-stranded origin and, by virtue of its origin or manipulation (1) is not associated with all or part of a polynucleotide with the that is associated in nature, (2) is linked to a polynucleotide other than the one that is linked in nature, or (3) does not occur in nature. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, cDNA, polynucleotides recombinants, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, chimeric DNA from any sequence, nucleic acid probes and primers. For use in vitro, a polynucleotide may comprise nucleotides modified, for example, by conjugation with a labeling component. As used herein, an isolated polynucleotide refers to a polynucleotide that has been separated from the polynucleotide sequences with which it associates or binds in its native state, or to a non-natural polynucleotide. As used herein, the term gene should be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the transcribed region and, if translated, the protein coding region, of a structural gene, and includes the sequences adjacent to the coding region at both the 5' and 3' ends over a distance of at least about 2 Kb at each end and that participate in the expression of the gene. In this regard, the gene includes control signals such as promoters, MA / a / ZUZI / UIDOUO enhancers, termination and / or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals, in which case the gene is called a chimeric gene. Sequences located 5' from the coding region of the protein and that are present in the mRNA are called 5' untranslated sequences. Sequences located 3' or downstream of the protein coding region and present in the mRNA are called 3' untranslated sequences. The term gene encompasses both the cDNA and the genomic forms of a gene. A genomic form or clone of a gene contains the coding region that may be interrupted with non-coding sequences called introns, intermediate regions, or intermediate sequences. Introns are segments of a gene that are transcribed into nuclear RNA (nRNA). Introns can contain regulatory elements, such as enhancers. Introns are removed or spliced ​​from the nuclear or primary transcript; therefore, introns are absent in the mRNA transcript. A gene containing at least one intron may be subject to variable splicing, giving rise to alternative mRNAs from a single transcribed gene and, therefore, to polypeptide variants. A gene in its native state or a chimeric gene may lack introns. mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes a synthetic or fusion molecule that encodes all or part of the proteins of the invention described herein and a nucleotide sequence complementary to any of the above. As used herein, chimeric DNA refers to any DNA molecule that does not occur naturally in nature; also referred to herein as DNA construct or genetic construct. Typically, a chimeric DNA comprises regulatory and transcribed or protein-coding sequences that do not occur naturally together in nature. Accordingly, chimeric DNA may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature. The open reading frame may or may not be linked to its natural upstream and downstream regulatory elements. The open reading frame can be incorporated, for example, into the plant genome, in an unnatural location, or into a replicon or vector where it is not found naturally, such as a bacterial plasmid or a viral vector. The term chimeric DNA is not limited to DNA molecules that are replicable in a host, but includes DNA capable of being ligated into a replicon by, for example, specific adapter sequences. The term genetically modified, genetic modification, modified (in the context of a nucleic acid sequence) and its variations, is a broader term that includes the introduction of a gene into a cell by transformation or transduction, the mutation of a gene in a cell and the genetic alteration or modulation of the regulation of a gene in a cell, or the progeny of any cell modified as described above. A recombinant polynucleotide of the invention refers to a nucleic acid molecule that has been constructed or modified by artificial recombinant methods. The recombinant polynucleotide may be present in a plant cell or part thereof in an altered amount or expressed at an altered rate (e.g., in the case of mRNA) compared to its native state. In one embodiment, the polynucleotide is endogenous to the plant or part thereof and its expression is altered by recombinant means, for example, an exogenous control sequence is introduced upstream of an endogenous gene of interest to allow the transformed plant or part of it expresses the polypeptide encoded by the gene, or a deletion is created in a gene of interest by ZFN, Talen or CRISPR methods. A recombinant polynucleotide of the invention includes polynucleotides that have not been separated from other components of the cell-based or cell-free expression system in which it is present, and polynucleotides produced in said cell-based or cell-free systems that are subsequently purified away from at least some other components. The polynucleotide may be a contiguous stretch of nucleotides or comprise two or more contiguous stretches of nucleotides from different sources (natural and / or synthetic origin) joined together to form a single polynucleotide. Typically, such chimeric polynucleotides comprise at least one open reading frame encoding a polypeptide of the invention operatively linked to a promoter suitable for driving transcription of the open reading frame in a cell of interest. Furthermore, the term exogenous in the context of a polynucleotide (nucleic acid) refers to the polynucleotide when it is present in a cell that does not naturally comprise the polynucleotide. The cell may be a cell comprising a non-endogenous polynucleotide that results in an altered amount of production of the encoded polypeptide, for example, an exogenous polynucleotide that increases the expression of an endogenous polypeptide, or a cell that in its native state does not produce the polypeptide. Increased production of a polypeptide of the invention is also referred to herein as overexpression. With respect to the defined polynucleotides, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence that is at least 60%, more preferably at least 65%, more preferably at least 70% , more preferably at least 75%, more preferably at least 80%, more MA / a / ZUZI / UIOOUO preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1 %, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8% , and even more preferably at least 99.9% identical to that corresponding to SEQ ID NO. A polynucleotide of, or useful for, the present disclosure may selectively hybridize, under stringent conditions, to a polynucleotide defined herein. As used herein, stringent conditions are those that: (1) employ during hybridization a denaturing agent such as formamide, for example, 50% (v / v) formamide with 0.1% (w / v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (2) use 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution , sonicated salmon sperm DNA (50 g / ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS, and / or (3) employ a low ionic strength and a high temperature for washing, for example, 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% SDS at 50°C. The polynucleotides of the invention may possess, compared to natural molecules, one or more mutations that are deletions, insertions or substitutions of nucleotide residues. Polynucleotides having mutations relative to a reference sequence may be natural (i.e., isolated from a natural source) or synthetic (e.g., by performing site-directed mutagenesis or shuffling DNA into nucleic acid as described in the present document). Nucleic acid constructs The present disclosure includes nucleic acid constructs comprising the polynucleotides useful for the preparation of plants and plant parts of the invention, and vectors and host cells containing them, methods of their production and use, and uses thereof. The present disclosure relates to elements that are operably connected or linked. Operably connected or operably linked and the like refer to a linking of polynucleotide elements in a functional relationship. Typically, operably connected nucleic acid sequences are contiguously linked MA / a / ZUZI / UIOOUO and, when necessary to join two protein-coding regions, they are contiguous and in reading frame. A coding sequence is operably connected to another coding sequence when RNA polymerase transcribes the two coding sequences into a single RNA, which if translated does so into a single polypeptide that has amino acids derived from both coding sequences. The coding sequences do not need to be contiguous with each other, as long as the expressed sequences are ultimately processed to produce the desired protein. As used herein, the term cis-acting sequence, cis-acting element or cis-regulatory region or regulatory region or a similar term shall be understood as any nucleotide sequence that, when properly positioned and connected in relation to with an expressed genetic sequence, it is capable of regulating, at least in part, the expression of the genetic sequence. Those skilled in the art will know that a cis-regulatory region may be capable of activating, silencing, enhancing, repressing or otherwise altering the expression level and / or cell type specificity and / or developmental specificity of a sequence. genetics at the transcriptional or post-transcriptional level. In preferred embodiments, the cis-acting sequence is an activating sequence that enhances or stimulates the expression of an expressible genetic sequence. Operably connecting a promoter or enhancer element to a transcribed polynucleotide means placing the transcribed polynucleotide (e.g., a protein-coding polynucleotide or other transcript) under the regulatory control of a promoter, which then controls transcription of that polynucleotide. In the construction of heterologous promoter / structural gene combinations, it is generally preferred to place a promoter or a variant thereof at a distance from the transcription start site of the transcribed polynucleotide that is approximately the same as the distance between that promoter and the region. protein coding that controls in its natural environment; that is, the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, the preferred position of a regulatory sequence element (e.g., an operator, enhancer, etc.) with respect to a transcriptional polynucleotide to be placed under its control is defined by the position of the element in its natural environment. ; that is, the genes from which it is derived. Promoter or promoter sequence, as used herein, refers to a region of a gene, generally upstream (5') of the RNA coding region, that controls the initiation and level of transcription in the cell of interest. A promoter includes the transcription regulatory sequences of a classical genomic gene, such as the TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., upstream activator sequences, enhancers and IVIA / a / ZUZ I / U I OOUO silencers) that alter gene expression in response to developmental and / or environmental stimuli, or in a tissue- or cell-type-specific manner. A promoter is usually, but not necessarily (for example, some Pol III promoters), located upstream of a structural gene whose expression it regulates. Furthermore, the regulatory elements that make up a promoter are usually located less than 2 Kb from the transcription start site of the gene. Promoters may contain additional specific regulatory elements, located more distal to the start site to further enhance expression in a cell, and / or to alter the timing or induction of expression of a structural gene to which it is operatively connected. . Constitutive promoter refers to a promoter that directs the expression of an operatively linked transcribed sequence in many or all tissues of an organism such as a plant. The term constitutive, as used herein, does not necessarily indicate that a gene is expressed at the same level in all cell types, but rather that the gene is expressed in a wide range of cell types, although often some level variation can be detected. In a preferred embodiment, if a constitutive promoter is used, it results in high levels of mRNA transcribed from the exogenous polynucleotide, such that the level of a specific NAC transcription factor that is produced in at least a part of the plant is at least 5 times or 10 times or 15 times or 20 times higher compared to an isogenic wheat plant lacking the exogenous polynucleotide. Non-limiting methods for evaluating promoter activity are disclosed by Medberry et al. (1992, 1993), Sambrook et al. (1989, supra) and US 5,164,316. Examples of constitutive promoters that can give rise to these levels of mRNA production include, but are not limited to, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO99 / 43838 and US 6,072,050; the CaMV 35S core promoter (Odell et al., 1985) or its improved versions; rice actin (McEIroy et al., 1990); ubiquitin (Christensen et al., 1989 and 1992); pEMU (Last et al., 1991); MAS (Velten et al., 1984); ALS promoter (US 5,659,026), and the like. Other constituent promoters include, for example, those discussed in US 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611. Selective expression, as used herein, refers to expression almost exclusively in specific organs of, for example, the plant, such as, for example, ovule, sperm, ovum, pollen, stamen, anthers, endosperm, embryo, leaves or root. In a preferred embodiment, a promoter is selectively or preferentially expressed in the flowers or flower parts of a grapevine plant. Selective expression can therefore be contrasted with constitutive expression, which refers to expression in many or all tissues of a plant under most or all conditions experienced by the plant. Selective expression can also result in compartmentalization of the products of gene expression into specific plant tissues, organs, or developmental stages. Compartmentalization into specific subcellular locations such as the plastid, cytosol, vacuole or apoplastic space can be achieved by inclusion in the structure of the gene product of appropriate signals, for example, a signal peptide, for transport to the required cellular compartment, or in the case of semiautonomous organelles (plastids and mitochondria) by integrating the transgene with appropriate regulatory sequences directly into the genome of the organelle. A tissue-specific promoter or organ-specific promoter is a promoter that is preferentially expressed in one tissue or organ relative to many other tissues or organs, preferably most, if not all, of the other tissues or organs of, e.g. a plant. Typically, the promoter is expressed at a level 10 times higher in the specific tissue or organ than in other tissues or organs. Inducible promoters selectively express an operable DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example, by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical and / or developmental signals. Inducible or regulated promoters include, for example, promoters regulated by light, heat, stress, infection or drought, phytohormones, wounds or chemicals such as ethanol, jasmonate, salicylic acid or saphenes. . As used herein, a plant stress-inducible promoter is any inducible promoter that is functional in a wheat plant, and therefore this term is not limited to promoters derived from a plant. Inducible promoters suitable for use in the expression of the nucleic acids described above in a plant include promoters that are induced by physiological or environmental conditions that trigger or are associated with flowering. Suitable inducible promoters are known in the art and are contemplated herein. Other cis-acting sequences that may be employed include transcriptional and / or translational enhancers. Enhancer regions are well known to those skilled in the art, and may include an ATG translation start codon and adjacent sequences. When included, the start codon must be in frame with the reading frame of the coding sequence relative to the external or exogenous polynucleotide to ensure translation of the entire sequence if it is to be translated. The translation start regions can come from the transcriptional start region or from an external or exogenous polynucleotide. The sequence may also come from the promoter source selected for MA / a / ZUZI / UIOOUO boost transcription, and can be specifically modified to increase mRNA translation. The nucleic acid construct of the present disclosure may comprise a 3' untranslated sequence of about 50 to 1,000 nucleotide base pairs that may include a transcription termination sequence. A 3' untranslated sequence may contain a transcription termination signal which may or may not include a polyadenylation signal and any other regulatory signal capable of effecting mRNA processing. A polyadenylation signal serves to add stretches of polyadenylic acid to the 3' end of an mRNA precursor. Polyadenylation signals are usually recognized by the presence of homology with the canonical 5' AATAAA-3' form, although variations are not uncommon. Transcription termination sequences that do not include a polyadenylation signal include the terminators for Poly or Pollll RNA polymerase, which comprise a signal of four or more thymidines. Examples of suitable 3' untranslated sequences are 3' untranslated transcribed regions containing a polyadenylation signal from an octopine synthase (oes) gene or the nopaline synthase (nos) gene of Agrobacterium tumefaciens (Bevan et al. , 1983). Suitable 3' untranslated sequences can also be derived from plant genes such as the ñbulase-1,5bisphosphate carboxylase (ssRUBISCO) gene, although other 3' elements known to those skilled in the art can also be used. As the DNA sequence inserted between the transcription start site and the beginning of the coding sequence, that is, the 5' untranslated leader (5'UTR) sequence, can influence gene expression if it is translated in addition to transcribed, a particular leader sequence can also be used. Suitable leader sequences include those comprising sequences selected to direct optimal expression of the external or endogenous DNA sequence. For example, such leader sequences include a preferred sequence that can increase or maintain the stability of the mRNA and prevent inappropriate initiation of translation, as for example described by Joshi (1987). Polynucleotides to reduce gene expression An altered level of FSL polypeptide activity according to the present disclosure can also be achieved by post-transcriptional silencing of messenger RNA (mRNA) transcribed from the FSL locus using RNA interference (RNAi). The term RNA interference or RNAi generally refers to RNA-dependent silencing of gene expression initiated by double-stranded RNA (dsRNA) molecules in the cytoplasm of a cell. The dRNA molecule reduces or inhibits the transcription products of a target nucleic acid sequence, thereby silencing the gene or reducing its expression. A double-stranded RNA or dsRNA refers to an RNA molecule that has a MA / a / ZUZI / UIOOUO duplex structure and comprising an antisense sequence or guide strand and a sense sequence or passenger strand that have a similar length to each other. The antisense and cognate sense sequences may be on a single RNA strand or on separate RNA strands. The antisense sequence will be substantially complementary to a target sequence, which, in the present case, is a region of the FSL polypeptide transcript. Various RNAi technologies known in the art can be used to alter the activity of the FSL polypeptide. The altered activity of the FSL polypeptide can be determined in relation to a level of activity of the FSL polypeptide in a corresponding wild-type plant or in a part thereof in which no modification of the sequence of the FSL locus or the product has occurred. expression. RNA interference RNA interference (RNAi) is particularly useful for specifically reducing the expression of a gene, resulting in reduced production of a particular protein if the gene encodes a protein. Without wishing to be limited to theory, Waterhouse et al. (1998) have provided a model of the mechanism by which dsRNA (duplex RNA) can be used to reduce protein production. This technology is based on the presence of dsRNA molecules that contain a sequence essentially identical to the mRNA of the gene of interest or a part of it. Conveniently, the dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and antisense sequences are flanked by an unrelated sequence that allows the sense and antisense sequences to hybridize to form the molecule. dsRNA with the unrelated sequence forming a loop structure. The design and production of suitable dsRNA molecules is well within the ability of one skilled in the art, particularly given Waterhouse et al. (1998), Smith et al. (2000), WO 99 / 32619, WO 99 / 53050, WO 99 / 49029 and WO 01 / 34815. In one example, a DNA is introduced that directs the synthesis of a double-stranded RNA product or products, at least in part, with homology to the target gene to be inactivated, such as, for example, an FSL locus. Therefore, DNA comprises sense and antisense sequences that, when transcribed into RNA, can hybridize to form the double-stranded RNA region. In one embodiment of the disclosure, the sense and antisense sequences are separated by a sword region comprising an intron that, when transcribed into RNA, is spliced. This arrangement has been shown to result in increased efficiency of gene silencing (Smith et al., 2000). The double-stranded region may comprise one or two RNA molecules, transcribed from one or two DNA regions. The presence of the double-stranded molecule is believed to trigger a response from an endogenous system that destroys both the double-stranded RNA and the MA / a / ZUZI / UIOOUO transcribed from RNA homologous to the target gene, effectively reducing or eliminating the activity of the target gene. The length of the hybridizing sense and antisense sequences should each be at least 19 contiguous nucleotides, preferably at least 50 contiguous nucleotides, more preferably at least 100 or at least 200 contiguous nucleotides. Typically, a sequence of 100-1000 nucleotides corresponding to a region of the target gene's mRNA is used. The complete sequence corresponding to the entire gene transcript can be used. The degree of identity of the sense sequence with the target transcript (and therefore also the identity of the antisense sequence with the complement of the target transcript) must be at least 85%, at least 90% or 95%. 100%. The RNA molecule may, of course, comprise unrelated sequences that may function to stabilize the molecule. The RNA molecule can be expressed under the control of an RNA polymerase II or RNA polymerase III promoter. Examples of the latter are tRNA or snRNA promoters. Preferred small interfering RNA (siRNA) molecules comprise a nucleotide sequence that is identical to about 19-25 contiguous nucleotides of the target mRNA. Preferably, the siRNA sequence starts with the AA dinucleotide, comprises a GC content of about 30-70% (preferably, 30-60%, more preferably 40-60% and more preferably about 45%-55%), and does not have a high percentage identity with any non-target nucleotide sequence in the genome of the organism into which it is to be introduced, for example, as determined by the standard BLAST search. microRNA MicroRNAs (abbreviated miRNAs) are generally non-coding RNA molecules of 19-25 nucleotides (commonly about 20-24 nucleotides in plants) that are derived from larger precursors that form imperfect stem-loop structures. miRNAs bind to complementary sequences in target messenger RNA (mRNA) transcripts, often resulting in translational repression or degradation of the target and gene silencing. Artificial miRNAs (amiRNAs) based on natural miRNAs can be designed to reduce the expression of any gene of interest, as is well known in the art. In plant cells, miRNA precursor molecules are thought to be largely processed in the nucleus. The pri-miRNA (which contains one or more local double-stranded or hairpin regions, as well as the usual 5' cap and polyadenylated tail of an mRNA) is processed into a shorter miRNA precursor molecule that also includes a loop of stem or fold structure and is called pre-miRNA.” In the MA / a / ZUZI / UIOOUO plants, the pre-m¡RNAs are cleaved by different DICER-type enzymes (DCL), giving rise to a m¡RNA:m¡RNA* duplex. Before being transported out of the nucleus, these duplexes are methylated. In the cytoplasm, the miRNA strand of the m¡RNA:m¡RNA duplex is selectively incorporated into an active RNA-induced silencing complex (RISC) for target recognition. RISC complexes contain a particular subset of Argonaut proteins that exert sequence-specific gene repression (see, for example, Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005). Cosuppression Genes can suppress the expression of related endogenous genes and / or transgenes already present in the genome, a phenomenon called homology-dependent gene silencing. Most cases of homology-dependent gene silencing fall into two classes: those that operate at the level of transgene transcription, and those that operate post-transcriptionally. Homology-dependent posttranscriptional gene silencing (i.e., cosuppression) describes the loss of expression of a transgene and related endogenous or viral genes in transgenic plants. Cosuppression usually, but not always, occurs when transgenes are abundant, and is generally thought to be triggered at the level of mRNA processing, localization, and / or degradation. There are several models to explain how cosuppression works (see Taylor, 1997). Cosuppression involves the introduction of an extra copy of a gene or a fragment thereof into a plant in the sense orientation with respect to a promoter for its expression. The size of the sense fragment, its correspondence with the regions of the target gene and its degree of sequence identity with the target gene can be determined by those skilled in the art. In some cases, the extra copy of the gene sequence interferes with the expression of the plant's target gene. Reference is made to WO 97 / 20936 and EP 0465572 for methods of implementing co-suppression approaches. Antisense polynucleotides The term antisense polynucleotide refers to a DNA or RNA molecule that is complementary to at least a portion of a specific mRNA molecule encoding an endogenous polypeptide and that is capable of interfering with a post-transcriptional event such as mRNA translation. The use of antisense methods is well known in the art (see, for example, G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999)). The use of antisense techniques in plants has been reviewed by Bourque (1995) and Sénior (1998). Bourque (1995) lists a large number of examples of how antisense sequences have been used in plant systems as a method of gene inactivation. Bourque too MA / a / ZUZI / UIOOUO states that it may not be necessary to achieve 100% inhibition of any enzyme activity, as partial inhibition is more than likely to produce a measurable change in the system. Senior (1998) states that antisense methods are now a well-established technique for manipulating gene expression. In one embodiment, the antisense polynucleotide is hybridized under physiological conditions, that is, the antisense polynucleotide (which is fully or partially single-stranded) is at least capable of forming a double-stranded polynucleotide with the mRNA encoding an endogenous polypeptide, for example, an mRNA of the FSL polypeptide (e.g., corresponding to an ORF sequence set forth in SEQ ID NO: 5-7 or a sequence having a level of percent identity therewith as described herein), an mRNA of the GAI1 protein (e.g., corresponding to a sequence set forth in SEQ ID NO: 8 or 9 or a sequence having a level of percent identity therewith as described herein) and / or an mRNA of the VvMADS5 protein (e.g. For example, corresponding to a sequence set forth in SEQ ID NO: 10 or 11 or a sequence having a level of percent identity therewith as described herein), under normal conditions in a cell. Antisense molecules may include sequences that correspond to structural genes or to sequences that effect control over gene expression or the splicing event. For example, the antisense sequence may correspond to the target coding region of the endogenous gene, or to the 5'-untranslated region (UTR) or to the 3'-UTR or to a combination of these. It may be complementary in part to the intron sequences, which can be spliced ​​during or after transcription, preferably only to the exon sequences of the target gene. In view of the greater overall divergence of UTRs, targeting these regions provides greater specificity of gene inhibition. The length of the antisense sequence should be at least 19 contiguous nucleotides, preferably at least 50 nucleotides, and more preferably at least 100, 200, 500 or 750 nucleotides. The full-length sequence complementary to the entire gene transcript can be used. The length is preferably 100 to 750 nucleotides. The degree of identity of the antisense sequence with the target transcript should be at least 90% and more preferably 95 to 100%. The antisense RNA molecule may, of course, include unrelated sequences that may function to stabilize the molecule. Recombinant vectors One embodiment of the present disclosure includes a recombinant vector, which comprises at least one polynucleotide defined herein and is capable of introducing the polynucleotide into a host cell. Recombinant vectors include dominant selectable marker. Such plant expression vectors may also contain a promoter regulatory region (e.g., a regulatory region that controls inducible or constitutive, environmentally or developmentally regulated, or cell or tissue-specific expression), a site of transcription initiation, a ribosome binding site, a transcription termination site and / or a polyadenylation signal. Several constitutive promoters have been described that are active in plant cells. Promoters suitable for constitutive expression in plants are known in the art and have been previously described herein. For the purposes of expression in source tissues of the plant such as, for example, in flowers and reproductive parts thereof, buds, fruits, root or stem, it may be preferred that the promoters used in the present disclosure have relatively high expression in these specific tissues. To do this, you can choose between a series of gene promoters with tissue or cell-specific expression, or with enhanced expression. Examples of such promoters are found in the literature and will be known to one skilled in the art. The term operatively linked, as used herein, refers to a functional relationship between two or more nucleic acid segments (e.g., DNA). Typically, it refers to the functional relationship of a transcriptional regulatory element (promoter) with a transcribed sequence. For example, a promoter is operably linked to a coding sequence of a polynucleotide defined herein, if it stimulates or modulates transcription of the coding sequence in an appropriate cell. Generally, transcriptional regulatory elements of the promoter that are operatively linked to a transcribed sequence are physically contiguous to the transcribed sequence, that is, they are cis-acting. However, some transcriptional regulatory elements, such as enhancers, do not have to be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance. When multiple promoters are present, each promoter may be independently the same or different. Recombinant vectors may also contain one or more signal segments to allow an expressed polypeptide defined herein to be retained in the endoplasmic reticulum (ER) of the cell, or transferred to a plastid, and / or contain fusion sequences that lead to the expression of nucleic acid molecules as fusion proteins. Examples of suitable signaling segments include any signaling segment capable of directing the secretion or localization of a polypeptide defined herein. To facilitate the identification of the transformants, the recombinant vector desirably comprises a selectable or screenable marker gene. By marker gene we mean MA / a / ZUZI / UIOOUO a gene that imparts a different phenotype to cells that express the marker gene and, therefore, allows these transformed cells to be distinguished from those that do not have the marker. A selectable marker gene confers a trait that can be selected for based on resistance to a selective agent (for example, a herbicide or an antibiotic). A selectable marker gene (or reporter gene) confers a trait that can be identified by observation or assay, that is, by screening (e.g., β-glucuronidase, luciferase, GFP, or other enzymatic activity that is not present in non-cellular cells). transformed). Exemplary selectable markers for selection of plant transformants include, among others, a hyg gene encoding resistance to hygromycin B; a neomycin phosphotransferase (nptll) gene that confers resistance to kanamycin, paromomycin; a rat liver glutathione-S-transferase gene that confers resistance to glutathione-derived herbicides as, for example, described in EP 256223; a glutamine synthetase gene that confers, upon overexpression, resistance to glutamine synthetase inhibitors, such as phosphinothricin, as described, for example, in WO 87 / 05327 an acetyltransferase gene from Streptomyces viridochromogenes that confers resistance to the selective agent phosphinothricin such as, for example, that described in EP 275957; a gene encoding a 5enolshikimate-3-phosphate synthase (EPSPS) that confers tolerance to N-phosphonomethylglycine, such as that described by Hinchee et al. (1988); a bar gene that confers resistance against bialaphos, such as that described in WO91 / 02071; a nitrilase gene such as bxn from Klebsiella ozaenae that confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene that confers resistance to methotrexate (Thillet et al., 1988); an acetolactate synthase (ALS) mutant gene that confers resistance to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals (EP 154.204); an anthranilate synthase mutant gene that confers resistance to 5-methyltryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide. The 5' untranslated leader sequence may be derived from the promoter selected to express the polynucleotide of the present disclosure, or may be heterologous with respect to the coding region of the enzyme to be produced, and may be specifically modified if desired to increase translation of the mRNA. For a review of optimization of transgene expression, see Koziel et al. (nineteen ninety six). The 5' untranslated regions can also be obtained from plant viral RNAs (tobacco mosaic virus, tobacco etching virus, corn dwarf mosaic virus, alfalfa mosaic virus, among others) from suitable eukaryotic genes. , from plant genes (leader of the chlorophyll a / b binding protein gene of wheat and corn), or from a synthetic genetic sequence. The present disclosure is not limited to constructions where the untranslated region is derived from the MA / a / ZUZI / UIOOUO 5' untranslated sequence accompanying the promoter sequence. The leader sequence could also be derived from an unrelated promoter or coding sequence. Leader sequences useful in the context of the present invention comprise the maize Hsp70 leader (US 5,362,865 and US 5,859,347), and the TMV omega element. Transcription termination is carried out by a 3' untranslated DNA sequence operably linked in the expression vector to the polynucleotide of interest. The 3' untranslated region of a recombinant DNA molecule contains a polyadenylation signal that functions in plants to cause the addition of adenylated nucleotides to the 3' end of the RNA. The 3' untranslated region can be obtained from several genes that are expressed in plant cells. The 3' untranslated region of nopaline synthase, the 3' untranslated region of the pea Rubisco small subunit gene, the 3' untranslated region of the soybean 7S seed storage protein gene are used. commonly in this capacity. The 3' transcribed and untranslated regions containing the polyadenylate signal of the Agrobacterium tumor-inducing (Ti) plasmid genes are also suitable. Recombinant DNA technologies can be used to improve the expression of a transformed polynucleotide by manipulating, for example, the efficiency with which the resulting transcripts are translated by optimizing codons according to the host cell species or removing destabilizing sequences. the transcribed, and the efficiency of post-translational modifications. Preferably, the recombinant vector is stably incorporated into the genome of the cell, such as the plant cell. Accordingly, the recombinant vector may comprise appropriate elements that allow incorporation of the vector into the genome, or into a chromosome of the cell. Agrobacterium-mediated transfer is a widely applicable system for the introduction of genes into plant cells because DNA can be introduced into entire plant tissues, thus avoiding the need to regenerate an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrative vectors to introduce DNA into plant cells is well known in the art (see, for example, US 5,177,010, US 5,104,310, US 5,004,863, US 5,159,135). Furthermore, T-DNA integration is a relatively precise process that results in few rearrangements. The region of DNA to be transferred is defined by the boundary sequences, and the intermediate DNA is usually inserted into the plant genome. Agrobacterium transformation vectors are capable of replicating in both E. coli and Agrobacterium, which allows convenient manipulations such as those described (Klee et ai., Plant DNA Infectious Agents, Hohn and Schell, (eds.), SpringerΜΛ / a / ZUZ 1 / U1 DOUO Verlag, New York, (1985): 179-203). A genetically modified plant formed by Agrobacterium transformation methods usually contains a single genetic locus on one chromosome. These genetically modified plants can be called hemizygous for the added gene or genetic variant. A genetically modified plant that is homozygous for the added gene or gene variant is preferred; that is, a genetically modified plant containing two added genes, one at the same locus on each chromosome of a pair of chromosomes. A homozygous genetically modified plant can be obtained by sexually mating (selfing) an independently segregating genetically modified plant containing a single gene or added genetic variant, germinating some of the seeds produced and analyzing the resulting plants for the gene of interest. It should also be understood that two different genetically modified plants can also be mated / crossed to produce offspring containing two independently segregating genes or variants of introduced genes. Selfing of appropriate progeny can produce plants that are homozygous for both genes or variants of introduced genes. Backcrossing with a parent plant and backcrossing with another plant are also contemplated, as well as vegetative propagation. In Fehr, Breeding Methods for Cultivar Development, J. Wilcox (ed.) American Society of Agronomy, Madison Wis. (1987). The transformation of plant protoplasts can be achieved by methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation and combinations of these treatments. The application of these systems to different plant varieties depends on the regeneration capacity of that specific plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura etal., 1985; Toriyama etal., 1986; Abdullah etal., 1986). Other methods of cellular transformation may also be used including, but not limited to, introducing polynucleotides such as DNA into plants by direct transfer to pollen, by direct injection of polynucleotides such as DNA into the reproductive organs of a plant, or by direct injection. of polynucleotides such as DNA into the cells of immature embryos, followed by rehydration of dissected embryos. The regeneration, development and cultivation of plants from individual protoplasts or from several transformed explants are well known in the art (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)). This regeneration and growth process typically includes the steps of selecting transformed cells, culturing those individualized cells through the usual stages of MA / a / ZUZI / UIOOUO embryonic development until the rooted seedling stage. Transgenic embryos and seeds regenerate in a similar way. The resulting rooted transgenic sprouts are then planted in an appropriate plant growth medium, such as soil. To confirm the presence of genetic material introduced into cells and plants, polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those skilled in the art. Expression products of the introduced gene or gene variant can be detected in several ways, depending on the nature of the product, and include Western blot and enzymatic assay. A particularly useful way to quantify protein expression and detect replication in different plant tissues is to use a reporter gene, such as GUS. Once transgenic plants are obtained, they can be grown to produce tissues or plant parts that have the desired phenotype. The plant tissue or plant parts can be harvested, and / or the seed collected. The seed can serve as a source for growing additional plants with tissues or parts that have the desired characteristics. Cells The present disclosure also provides a recombinant cell comprising a host cell transformed with one or more recombinant molecules as defined herein, or progenitor cells thereof. The transformation of a nucleic acid molecule into a cell can be carried out by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell can remain single-celled or can grow into a tissue, organ, or multicellular organism. The transformed nucleic acid molecules can remain extrachromosomal or integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell so that their ability to express is preserved. Preferred host cells are plant cells, more preferably vine zone cells. The present disclosure also provides a plant cell that has been isolated from a plant or part of a plant of the disclosure. For example, a cell isolated from a plant or plant part that has an altered level of FSL polypeptide activity as described herein. For example, a cell isolated from a plant or part of the plant that produces seedless fruits as described herein. In some examples, the cell is cultured. Plants and plant parts The term plant, when used as a noun, refers to whole plants, while the term plant part or plant part (in the context of a plant) refers to a plant cell and its progeny, a a plurality of plant cells, to a structure that is present at any stage of development of a plant, or to a plant tissue. Such structures include, but are not limited to, leaves, stems, cuttings and spikes, flowers, fruits, nuts, roots, seeds, seed coat, embryos. The term plant tissue includes the differentiated and undifferentiated tissues of plants, including those present in leaves, stems, flowers, fruits, nuts, roots, seeds, for example, embryonic tissue, endosperm, dermal tissue (e.g. epidermis, periderm), vascular tissue (e.g. xylem, phloem), or soil tissue (comprising parenchyma, collenchyma and / or sclerenchyma cells), as well as cells in culture (e.g. individual, protoplasts, callus, embryos, etc.). The plant tissue can be in plant, in organ culture, in tissue culture or in cell culture. As used herein, the term progeny refers to the immediate generation and all subsequent generations of offspring produced from a parent, for example, a second, third or subsequent generation of offspring. As used here, the term plant includes all species of flowering plants, i.e. angiosperms. In one of the examples, the plant described here is a dioecious plant. In another example, the plant described here is a hermaphrodite plant. For example, the plant may be a berry-producing plant, a hesperid-producing plant, a drupe-producing plant, a seed-producing plant, or a pepper-producing plant. Exemplary fruit-producing plants within each of these broad fruit categories are known in the art and are contemplated herein. Plants contemplated for use in the practice of the present disclosure include both monocots and dicots. Target plants include, but are not limited to, the following cereals (e.g., wheat, barley, rye, oats, rice, corn, sorghum and related crops); grapes; beet (sugar beet and fodder beet); pome fruits, stone fruits and soft fruits (apples, pears, plums, peaches, almonds, cherries, strawberries, raspberries and blackberries) legumes (beans, lentils, peas, soybeans); oilseed plants (rapeseed or other brassicas, mustard, poppy, olives, sunflower, safflower, flax, coconut, castor bean, cocoa, peanuts) cucumber plants (pumpkins, cucumbers, melons); fiber plants (cotton, flax, hemp, jute); citrus fruits (oranges, lemons, grapefruits, tangerines); vegetables (spinach, lettuce, asparagus, cabbage, carrots, onions, tomatoes, potatoes, paprika); lauraceae (avocados, cinnamon, camphor); or plants like corn, MA / a / ZUZI / UIOOUO tobacco, nuts, coffee, sugar cane, tea, grapevines, hops, grass, bananas and natural rubber plants, as well as ornamental plants (flowers, shrubs, broadleaf trees and evergreen trees, such as conifers). In a particular example, the plant is a berry-producing plant. For example, the plant may be a Vitis sp. for example, a Vitis species selected from the group consisting of: Vitis vinifera, Vitis lambrusca, Vitis rotundifolia, Vitis aestivalis, Vitus riperia and their hybrids. In one example, Vitis sp produces table grapes. In another example, Vitis sp. produces wine grapes. Vitis rotundifolia is also known as Muscadinia rotundifolia and includes other Muscadinia species. Production method of plants and plant parts There are many techniques known in the art that can be used to produce plants with an altered level of FSL polypeptide activity, as described herein, including plants and plant parts that produce seedless fruits, as described in herein, including, but not limited to, TILLING, zinc finger nuclease (ZFN), TAL effector nuclease (TALEN), and clustered regularly interspaced short palindromic repeats (CRISPR). TILLING The plants of the disclosure can be produced through the process known as TILLING (Targeting Induced Local Lesions IN Genomes). In a first step, introduced mutations, such as novel single base pair changes, are induced in a population of plants by treating seeds (or pollen) with a chemical mutagen and then advancing the plants to a generation in which mutations will be stably inherited. DNA is extracted and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time. For a TILLING assay, PCR primers are designed to specifically amplify a single target gene of interest. Specificity is especially important if the target is a member of a gene family or part of a polyploid genome. Dye-labeled primers can then be used to amplify the PCR products from a pool of DNA from multiple individuals. These PCR products are denatured and realigned to allow the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e. several plants in the population are likely to carry the same polymorphism) and induced SNPs (i.e. It is likely that only some individual plants have the mutation). Following heteroduplex formation, the use of an endonuclease, such as Cel I, that recognizes and cleaves mismatched DNA is the key to discovering new SNPs within a TILLING population. Using this approach, many thousands of plants can be screened to identify any individual with a single base change, as well as small insertions or deletions (1-30 bp) in any gene or specific region of the genome. The genomic fragments analyzed can have a size between 0.3 and 1.6 kb. With 8-fold pooling and 96 lanes per assay, this combination allows up to one million base pairs of genomic DNA to be analyzed per assay, making TILLING a high-throughput technique. TILLING is described in more detail in Slade and Knauf (2005) and Henikoff et al., (2004). In addition to enabling efficient mutation detection, TILLING high-throughput screening technology is ideal for the detection of natural polymorphisms. Therefore, interrogating an unknown homologous DNA by heteroduplex to a known sequence reveals the number and position of polymorphic sites. Both nucleotide changes and small insertions and deletions are identified, including at least some repeat number polymorphisms. This has been called Ecotilling (Comal etal., 2004). Each SNP is recorded by its approximate position within a few nucleotides. Thus, each haplotype can be archived based on its mobility. Sequencing data can be obtained with relatively little incremental effort using aliquots of the same amplified DNA that is used for the mismatch elimination assay. The left or right sequencing primer for a single reaction is chosen for its proximity to the polymorphism. The Sequencher software performs a multiple alignment and discovers the base change, which in each case confirmed the gel band. In ecotyping, plaques containing ecotypic DNA can be examined instead of pools of DNA from mutagenic plants. Since detection is performed on gels with near-base pair resolution and background patterns are uniform across all lanes, bands that are identical in size can be paired, thus discovering and genotyping SNPs in a single passed. POR products used for screening can be subjected to DNA sequencing. Genome editing by site-specific nucleases Genome editing uses engineered nucleases composed of sequence-specific DNA binding domains fused to a non-specific DNA cutting module. These chimeric nucleases allow efficient and precise genetic modifications by inducing double-strand breaks in DNA that stimulate endogenous cellular DNA repair mechanisms to repair the induced break. These mechanisms include, for example, non-homologous end joining (NHEJ), prone to ΜΛ / a / ZUZ l / U 1 DOUO errors, and homology directed repair (HDR). In the presence of a donor plasmid with extended homology arms, HDR can lead to the introduction of one or several transgenes to correct or replace existing genes. In the absence of a donor plasmid, NHEJ-mediated repair produces small target insertion or deletion mutations that cause gene disruption. Engineered nucleases useful in the methods of the present invention include zinc finger nucleases (ZFN) and transcription activator type effector nucleases (TAL). Typically, genes encoding nucleases are introduced into cells using plasmid DNA, viral vectors, or in vitro transcribed mRNA. The use of fluorescent reporter vectors also allows the enrichment of cells modified by ZFN and TALEN. As an alternative to ZFN gene delivery systems, cells can be contacted with purified ZFN proteins that are able to cross cell membranes and induce disruption of endogenous genes. Complex genomes often contain multiple copies of sequences identical or highly homologous to the intended DNA target, which can lead to off-target activity and cellular toxicity. To address this, structure-based (Miller et al., 2007; Szczepek et al., 2007) and selection-based approaches (Doyon et al., 2011; Guo et al., 2010) can be used to generate ZFN heterodimers. and improved TALENs with optimized cutting specificity and reduced toxicity. A zinc finger nuclease (ZFN) comprises a DNA binding domain and a DNA cleavage domain, wherein the DNA binding domain is composed of at least one zinc finger and is operably linked to a cleavage domain. of DNA. The zinc finger DNA binding domain is located at the N terminus of the protein and the DNA cleavage domain is located at the C terminus of the protein. A ZFN must have at least one zinc finger. In a preferred embodiment, a ZFN would have at least three zinc fingers to have sufficient specificity to be useful for targeted genetic recombination in a host cell or organism. Typically, a ZFN with more than three zinc fingers would have progressively higher specificity with each additional zinc finger. Zinc finger mastery can be derived from any class or type of zinc finger. In a particular embodiment, the zinc finger domain comprises the C¡S2H¡s2 type of zinc finger which is very generally represented, for example, by the zinc finger transcription factors TFIIIA or Sp1. In a preferred embodiment, the zinc finger domain comprises three zinc fingers of the CÍS2H¡S2 type. The DNA recognition and / or binding specificity of a ZFN can be altered to achieve targeted genetic recombination at any chosen site in cellular DNA. Said modification can be carried out by known molecular biology and / or chemical synthesis techniques (see, for example, Bibikova et al., 2002). The DNA cleavage domain of ZFN is derived from a class of non-specific DNA cleavage domains, for example the DNA cleavage domain of a type II restriction enzyme such as Fokl (Kim et al., 1996). . Other useful endonucleases may include, for example, Hhal, Hindlll, Nod, BbvCI, EcoRI, Bgll and Alwl. A linker, if present, between the cleavage and recognition domains of the ZFN comprises a sequence of amino acid residues selected so that the resulting linker is flexible. Or, to achieve maximum target site specificity, linkerless constructs are made. A linkerless construct has a strong preference for binding and then cleavage between recognition sites that are 6 bp apart. However, with linker lengths between 0 and 18 amino acids, ZFN-mediated cleavage occurs between recognition sites that are between 5 and 35 bp. For a given linker length, there will be a limit on the distance between recognition sites that is consistent with both binding and dimerization. (Bibikova et al., 2001). In a preferred embodiment, there is no linker between the cleavage and recognition domains, and the target locus comprises two nine-nucleotide recognition sites in inverted orientation with respect to each other, separated by a six-nucleotide spacer. To direct recombination or genetic mutation according to a preferred embodiment of the present invention, two 9 bp zinc finger DNA recognition sequences must be identified in the host DNA. These recognition sites will be in an inverted orientation with respect to each other and separated by about 6 bp of DNA. ZFNs are then generated by designing and producing combinations of zinc fingers that bind DNA specifically at the target locus, and then linking the zinc fingers to a DNA cleavage domain. The activity of ZFNs can be enhanced by using transient hypothermic culture conditions to increase nuclease expression levels (Doyon et al., 2010) and codistribution of site-specific nucleases with DNA end-processing enzymes (Certo etal., 2012). The specificity of ZFN-mediated genome editing can be improved by using zinc finger nicases (ZFNickases) that stimulate HDR without activating the error-prone NHEJ repair pathway (Kim et al., 2012; Wang et al. ., 2012; Ramírez etal., 2012; McConnell Smith et al., 2009). A transcription activator-like (TAL) effector nuclease (TALEN) comprises a TAL effector DNA-binding domain and an endonuclease domain. TAL effectors are proteins from plant pathogenic bacteria that are injected by the pathogen into the plant cell, where they travel to the nucleus and function as transcription factors to activate plant-specific genes. The primary amino acid sequence of a TAL effector dictates the nucleotide sequence to which it binds. Therefore, target sites for TAL effectors can be predicted, and TAL effectors can be designed and generated in order to bind to particular nucleotide sequences. Fused to the nucleic acid sequences encoding the TAL effector are sequences encoding a nuclease or a portion of a nuclease, typically a non-specific cleavage domain of a type II restriction endonuclease such as Fokl (Kim et al., 1996). Other useful endonucleases may include, for example, Hhal, Hindlll, Nod, BbvCI, EcoRI, Bgll and AlwL. The fact that some endonucleases (e.g., Fokl) only function as dimers can be exploited to improve the target specificity of the TAL effector. For example, in some cases, each Fokl monomer can fuse with a TAL effector sequence that recognizes a different DNA target sequence, and only when the two recognition sites are close, the inactive monomers join together to create a functional enzyme. By requiring DNA binding to activate the nuclease, a highly site-specific restriction enzyme can be created. A sequence-specific TALEN can recognize a particular sequence within a preselected target nucleotide sequence present in a cell. Thus, in some embodiments, a target nucleotide sequence may be scanned for nuclease recognition sites, and a particular nuclease may be selected based on the target sequence. In other cases, a TALEN can be designed to target a specific cellular sequence. Genome editing by RNA-guided programmatic DNA endonucleases Unlike the site-specific nucleases described above, the clustered interspaced short palindromic repeats (CRISPR) / Cas system offers an alternative to ZFNs and TALENs to induce selective genetic alterations . CRISPR systems rely on CRISPR RNA (crRNA) and transactivating chimeric RNA (tracrRNA) for sequence-specific silencing of invading foreign DNA. There are three types of CRISPR / Cas systems: In type II systems, Cas9 acts as an RNA-guided DNA endonuclease that cuts DNA by recognizing the crRNA target. CRISPR RNA pairs with tracrRNA to form a two-RNA structure that guides the Cas9 endonuclease to complementary DNA sites for cleavage. The CRISPR system can be portable in plant cells by co-delivering plasmids that express the Cas endonuclease and the necessary components of the crRNA, as described in the art and herein. The Cas endonuclease can be converted into a nicase to provide additional control over the DNA repair mechanism (Cong et al., 2013). CRISPR loci are a distinct class of short interspersed sequence repeats (SSRs) that were first recognized in E. col! (Ishino et al., 1987; Nakata et al., 1989). Similar interspersed SSRs have been identified in Haloferax medíterranei, Streptococcus pyogenes, Anabaena and Mycobactenum tuberculosis (Groenen etal., 1993; Hoe etal., 1999; Masepohl etal., 1996; Mojica etal., 1995). Common structural features of CRISPR loci are described in Jansen et al. (2002) as (i) the presence of multiple short direct repeats, which show no or very little sequence variation within a given locus; (i) the presence of non-repetitive sword sequences among repeats of similar size; (iii) the presence of a common leader sequence of a few hundred base pairs in most species harboring multiple CRISPR loci; (iv) the absence of long open reading frames within the locus; and (v) the presence of one or more cas genes. CRISPRs are typically short, partially palindromic sequences of 24-40 bp containing internal and terminal inverted repeats of up to 11 bp. Although isolated elements have been detected, they are generally arranged in groups (up to about 20 or more per genome) of repeat units spaced by unique intervening sequences of 2058 bp. CRISPRs are generally homogeneous within a given genome, with most of them being identical. However, there are examples of heterogeneity in, for example, the Archaea (Mojica etal., 2000). As used herein, the term cas gene refers to one or more cas genes that are generally associated with or close to flanking CRISPR loci. A comprehensive review of the Cas family of proteins is presented in Haft et al. (2005). The most commonly adopted CRISPR-Cas systems in eukaryotic work use a Cas9 effector protein typically using RNA-guided Streptococcus pyogenes Cas9 or a sequence variant optimized in multiple plant species ( Luo et al., 2016 ). Cas, as used here, includes Cas9, Casi2 enzymes (e.g., Casi2a, Casi2b, Cas12f, Cpf1, C2c1, C2c3), and other CRISPR-Cas systems, such as Casi 3 RNA-guided RNAs. Nicasas CRISPR-Cas II systems use a Cas9 nuclease with two enzymatic cleavage domains: a RuvC domain and a HNH domain. Mutations have been shown to alter double-strand cleavage to single-strand cleavage and give rise to a technological variant called nicase or nuclease-inactivated Cas9. RuvC subdomain cuts the chain MA / a / ZUZI / UIOOUO non-complementary DNA and the HNH subdomain cuts the DNA strand complementary to the gRNA. The inactivated Cas9 nicase or nuclease retains gRNA-directed DNA binding capacity. Mutations in subdomains are known in the art, for example, the S.pyogenes Cas9 nuclease with a D10A mutation or an H840A mutation. Editing or modification of genome bases Base editors have been created by fusing a deaminase with a Cas9 domain (WO 2018 / 086623). Through fusion, deaminase can take advantage of the gRNA-directed sequence orientation to perform targeted conversion of cytidine (C) to uracil (U) by deamination of cytidine in DNA. The cell's mismatch repair mechanisms then replace the U with a T. Suitable cytidine deaminases may include APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, and CDA1. Furthermore, the Cas9-deaminase fusion may be a mutated Cas9 with nicase activity to generate a single-strand break. It has been suggested that the nicase protein was potentially more efficient in promoting homology-directed repair (Luo et al., 2016). Conventional Plant Growing Methods In addition to the methods described above, the plants of the present disclosure can also be produced using conventional plant breeding techniques known in the art. Such methods generally involve crossing parental lines that have known polynucleotides or genes, including specific variants thereof, that confer particular traits, and screening the progeny produced by the crosses to identify progeny that have particular combinations of polynucleotides or genes. of interest and / or showing particular phenotype(s) of interest. Screening of progeny may be based on phenotype and / or molecular characterization using molecular techniques known in the art. In some examples, conventional breeding methods involve subsequent backcrossing with the parental lines to achieve a particular genotypic status in one or more polynucleotides or genes. Conventional plant breeding techniques are well known in the art and are contemplated herein to produce plants that produce flowers of known sex and / or to produce plants that produce seedless fruits, as described herein. Fruits and products thereof Also provided herein are fruits produced from a plant described herein. The fruits may not have seeds. Preferably, the fruits are stenospermocarpic and seedless. More preferably, the fruits are seedless parthenocarpic. According to an example in which the plant from which the fruit is obtained is a MA / a / ZUZI / UIOOUO Vitis sp., the fruit will be grapes, for example, seedless grapes. In one example, the grapes are seedless table grapes. The fruits of the present disclosure can be produced by growing a plant as described herein under conditions and for a period sufficient for the plant to flower and produce fruits. In some examples, the fruits can be harvested from the plant. However, in other examples it may be desired to leave the fruit on the plant (for example, for sale in a nursery). In some examples, the method further comprises processing the fruit. For example, fruit processing may comprise packaging the fruit and / or producing one or more products (e.g., one or more food or beverage products or ingredients) from the fruit. The present disclosure also provides a product produced from a plant as described herein or a fruit thereof. In one of the examples, the product is a food product, a food ingredient, a beverage product, or a beverage ingredient. The food product may be selected from the group consisting of table grapes, jam, jelly, sultanas and raisins, for example. The food ingredient may be vincotto, verjus, vinegar or grape must syrup (mosto cotto), for example. The beverage product may be wine, grappa, brandy or grape juice, for example. The ingredient of the drink can be wine grapes, table grapes or their juice, for example. EXAMPLES EXAMPLE 1: MATERIALS AND METHODS Microvine Plant Lines Microvine plants were grown in greenhouses or growth rooms with 16-hour days at 25-30°C and nights at 20-25°C at the CSIRO Urrbrae Centre, Adelaide, Australia. The plants were kept in pots, watered daily and given slow release fertilizer at regular intervals. The microvine genotypes studied had male flowers (FSL / fsl), female flowers (fsl / fsl) or hermaphroditic flowers (FSL / FSL or FSL / fsl). Several microvine lines with different flower types were studied and examples include 03C003V0060 (L1 Pinot Meunier progeny / H). Microvine lines with male flowers were obtained by crossing the Richter 110 (M / f) vine rootstock with the female microvine line 00C001V0008 (f / f). Flower sex phenotyping was carried out by morphological scoring using the descriptors of the OIV n° 151 (http: / / www.oiv.int / ) Genomic DNA was extracted from microvine leaves using the DNAeasy Plant Mini Kit (Qiagen 69106). MA / a / ZUZI / UIOOUO Cloning of male, hermaphrodite and female alleles To obtain the coding DNA sequence and the translated protein sequence, total RNA was extracted using the Spectrum Plant Total RNA Kit Cat # STRN250 (Sigma) according to the manufacturer's instructions from floral stages 1-2 of the modified E-L system. A description of the modified E-L system can be found in B. G. Coombe's article 'Adoption of a System for identifying grapevine growth stages' (1995) Aust. J. Grape and Wine Res. 1:104-110. Total RNA was extracted from the plant edited with the FSL gene (FSL knockout), from the male plant 03C003V0016 (self-crossing progeny of L1 Pinot Meunier x Richter 110), from the female plant 04C023V0003 (progeny of Grenache x L1 Pinot Meunier). and from the homozygous hermaphrodite 04C023V0006 (progeny of Grenache x L1 Pinot Meunier). First-strand cDNA was generated using the Superscript IV First-Strand Synthesis System Cat #18091050 (Invitrogen) following the manufacturer's instructions and using the oligo dT B26 5'-GACTCGAGTCGACATCGATTTTTTTTTTTTT-3' (SEQ ID NO: 12). Coding sequences were amplified from cDNA by standard PCR techniques using MyTaq™ HS Red Mix from Bioline catalog # BIO-25047 following the manufacturer's instructions for a reaction volume of 20μΙ and 2μΙ of template. The PCR reaction conditions were 95°C for 3 minutes for initial denaturation and then 35 cycles of 95°C 30 seconds, 58°C 30 seconds, 72°C 1 minute and 40 seconds. There was a final extension incubation at 72°C for 10 minutes. The primers used for amplification were B26 and CSFS1_CDS_F1 5-CAG TGC CAG TTT TGC AGG C-3' (SEQ ID NO: 13) with primers designed from the Cabernet Sauvignon cDNA H sequence of Example 2. The products of PCR were cloned for sequencing using the Qiagen PCR cloning kit, catalog 231124, according to the manufacturer's instructions. FSL expression in flowering phase 1-2 in hermaphrodite and female lines FSL gene expression was measured from first-strand cDNA by RT-qPCR. First-strand cDNA and gene-specific primers were designed for the 3 prime region of each allele. The primers used were FSLRTF1 5'-ACGCCCGGTGGAATAAACAGG-3' (SEQ ID NO: 14); and FSL_RT_R1 5'-TCT CCT TTC TCC ATC CCT AAT TGA-3' (SEQ ID NO: 15). The LightCycler 480 SYBR Green 1 Master 2x concentration cat # 04 887 352 001 (Roche) was used at a 1X concentration for the RT-qPCR assay together with gene-specific primers, 10 pMol per reaction (1 μΙ of a 10 μΜ stock). and 3 μΙ of first-strand cDNA in a reaction volume of 15 μΙ. PCR amplification was performed on a RotorGene RG-3000 (Corbett research), at 95°C for 10 minutes and then 50 cycles of 95°C 20 seconds, 58°C 20 seconds, 72°C 20 seconds and then one step final 72°C for 5 minutes. Standard curves, melting curves, and Ct values ​​were generated for each gene and for each cDNA sample using Rotor-Gene 3000 software (Corbett Research). Ct values ​​were normalized using the reference gene, ubiquitin, to determine the level of relative gene expression in each sample using the comparative relative quantification method described in the Qiagen brochure Critical Factors For Successful RealTime PCR (https: / / www .qene-quantification.de / qiaqen-qpcr-sample-assay-tech-quide2010.pdf). Pollen germination assay Flower anthers were collected on single-cavity slides and allowed to dry for 5 min to release pollen. Pollen was collected in a germination solution (0.5M sucrose, 100mg / mL boric acid and 300mg / L calcium nitrate pH 5.4) and incubated overnight on an inverted slide in a humidified container at 28 degrees Celsius in the dark. Pollen germination was assessed at 20X magnification by differential interference contrast (DIC) bright-field microscopy. Genetic transformation of homozygous hermaphrodite (H / H) 04C023V0006 with the FSL gene editing vector The binary vector pCLB1301NH containing the cas9-sgRNA gene editing cassette was inserted into the homozygous hermaphrodite 04C023V0006 by Agrobacterium-mediated transformation. The complete method is described in Locco et al., (2001) and transgenic plants regenerated using the method described in Chaib, J et.al., (2010) Plant Journal, 62(6):1083-1092. The design of the gene editing vector is described in more detail in Example 6. Development of inbred vine lines and reproduction The production of homozygous lines that differ in both flower height and sex is desirable to improve the future breeding efficiency of microvines and normal-height vines. Identification of the FSL gene and sequences for selection will allow breeders to screen out female plants at the seedling stage. To achieve this, successive inbreeding was carried out by selfing, maintaining a heterozygous state at the two loci for height (VvGAI1 / Vvga¡1) and flower sex (FSL / fsl). The original mutant microvine L1 Pinot Meunier was used as the female parent and the flowers were emasculated to receive pollen from Cabernet Sauvignon or Riesling or another desired cross, as male parents. Progeny populations were germinated from seeds collected after soaking for 12 hours in fresh 0.5M H2O2, rinsed in sterile water and transferred to sterile 2.6 mM GA (gibberellic acid) for overnight incubation, before rinse them again in sterile water and seal them MA / a / ZUZI / UIOOUO wet. Seeds were stored at 4°C for approximately 3 weeks, scarified, incubated again in GA for 18 h, and transferred to a Petri dish lined with sterile filter paper. The seeds were kept at 25°C under lights and after germination, they were transferred to pots and kept in a growth chamber or greenhouse with 16h per day at 25-30°C and 20-25°C in the evening. evening. Segregation of the height allele resulted in 50% progeny with dwarf stature. The FSL locus followed the expected 1:1 segregation ratio of an FSL / fslx fsl / fsl cross. Individuals were isolated from microvines for each population and grown in a greenhouse. The vines can be grown at high density 34 microvines per m2. EXAMPLE 2: CLONING OF THE HERMAPHRODITE SEXUAL LOCUS THROUGH GENETIC MAPPING AND CLONING AND SEQUENCING OF THE MALE, FEMALE AND HERMAPHRODITE ALLELES Through genetic mapping, inventors have identified a gene believed to be responsible for flower sex in grapevines. The inventors have named it the flower sex gene (FSL). Sequencing of this locus identified single nucleotide polymorphisms (SNP) between the male (M), female (f), and hermaphrodite (H) alleles of FSL. A SNP marker for this gene has been used to genotype plants for the H and f alleles and there is a 100% match between genotype and phenotype. A full-length Cabernet Sauvignon H cDNA was sequenced from a flower cDNA library produced at the CSIRO using standard molecular methods. The cDNA library was made from immature inflorescences at stage 12 of the modified E-L system. The tissues were collected from plants grown in the field. A description of the modified E-L system can be found in the article by B. G. Coombe (1995) Aust. J. Grape and Wine Res., 1:104110. The Cabernet Sauvignon FSL cDNA is set forth in Figure 1A and SEQ ID NO: 1. Using the cloning methods described in Example 1, to isolate FSL from the male, females and hermaphrodites of genotypes 03C003V0016 and 04C023V003 and 04C023V0006 were isolated. These are shown in Figures 1B-D, respectively, and set forth in SEQ ID NOs: 2-4, respectively. An alignment of the open reading frames (ORFs) for the female, hermaphrodite and male alleles of the FSL locus (SEQ ID NOs: 5-7 respectively) is presented in Figure 2. EXAMPLE 3: PROTEIN SEQUENCES AND BLAST ANALYSIS Protein sequences were obtained from the cDNA sequences and blast analysis was performed for the protein and cDNA sequences. The sequences of the MA / a / ZUZI / UIOOUO protein are shown in Figure 3A-C and in SEQ ID NOs: 5-7. These alignments predicted the presence of a PLATZ (plant AT-rich sequence and zinc binding) domain (Nagano et al., (2001) Nucleic Acids Res. 29(20):4097-4105). The region predicted for the PLATZ (Zinc finger Box) domain is highlighted in yellow for both the cDNA sequences (Figures 1A-D) and the amino acid sequences (Figures 3A-C). The online tool PROSITE (Sigrist, C.J.A., (2009) Nucleic Acids Research, 38:161-166)) was used to identify the region in each case. As evident from the sequences, there are no differences in the amino acid sequence between the different alleles, however, there is a C to T substitution within the cDNA sequence of the female allele (in bold) that gives rise to a sense mutation GAC->GAT both encode aspartic acid (see Figures 1B-D). A phylogenetic tree was also created for the hermaphrodite protein sequence (Figure 3). Most of the hits corresponded to uncharacterized sequences with no known function. The protein sequence alignments and hits obtained for the phylogenetic tree support the conclusion that the FSL gene contains a PLATZ domain and is likely to be a transcription factor. The PLATZ transcription factor superfamily has been found to only exist in plants and its involvement in flower sex determination has not been identified so far. In fact, the precise function of PLATZ proteins in plants remains poorly understood and there are indications that they may function in response to stress (So etal, (2015) POJ, 8(6):479-484. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no orthologous sequences have been found outside the plant kingdom. Multiple alignments between these orthologous proteins show that several cysteine ​​and histidine residues are invariant, suggesting that these proteins are a new class of zinc-dependent DNA-binding proteins (Nagano et al., 2001). EXAMPLE 4: EXPRESSION OF THE FLOWER SEX GENE (FSL) IN VINE FLOWERS To better understand the role of FSL in flower sex description, mRNA in situ hybridization was performed to identify the floral organs and tissues where this gene is transcribed. A digoxigenin-labeled 711 bp probe was synthesized from the FSL gene (54-765 bp of the sequence set forth in SEQ ID NO: 4). Analysis of the 711 bp probe indicated that this probe is specific for hybridization to FSL transcripts. To determine the expression pattern of FSL, flowers in a young and immature state (flowers not separated from each other) were used. In situ hybridization was performed according to the MA / a / ZUZI / UIOOUO methodologies described in Jackson, D. P. (1992) In-situ hybridisation in plants. In: Molecular Plant Pathology: A Practice! Approach. Practical Approach Series, 1 (85). Oxford University Press and https: / / www.its.caltech.edu / ~plantlab / protocols / insitu.pdf. The results of mRNA in situ hybridization showed that FSL was expressed in the filament and anthers of stamens, as well as in the ovule of male flowers (Figure 5A and B). In hermaphrodite flowers, expression was detected in the stamen filaments and in the ovule (Figure 5C and D). Compared with male flowers, FSL expression appeared to be reduced in the anthers of hermaphrodite flowers. In male and hermaphrodite flowers, FSL expression was not detected in the perianth organs (Figure 5A-D). As female flowers are expected to display a non-functional FSL phenotype, little or no expression was observed in anthers and stamen filaments (Figure 5E-F). Interestingly, FSL appears to be expressed in the egg (Figure 5E). Taken together, these results show that FSL is mainly expressed in the stamens of male and hermaphroditic flowers and that expression of this gene is absent in female flowers in which the male reproductive organs are not functional. Real-time PCR analyzes were also carried out on cDNA obtained from early developing leaves and flowers, stages 1-2, when the flowers are still compact and tightly closed, to determine the FSL expression pattern using the described method. in Example 1. As can be seen from Figure 6, FSL expression is highest in the V6 homozygous hermaphrodite (H / H) and is very low in the V3 female (f / f), supporting the finding of that FSL participates in flower sex determination through normal stamen development. The results of this experiment indicate that the f allele was expressed in flowers 27-fold less than the H allele. These data indicate that FSL is downregulated to produce the female flower phenotype. EXAMPLE 5: GENE EDITING TO CONVERT VINE FLOWERS FROM HERMAPHRODITE TO FEMALE Methods and Results CRISPR / Cas9-mediated mutations were introduced within the putative PLATZ domain of the FSL gene with the aim of producing an FSL knockout microvine plant to determine the function of the gene in flowering. The CRISPR / Cas9 vector had spCas9 directly followed by the sgRNA crRNA:tracRNA (Jinek et al., (2012) Science, 337(6096): 816-821). SpCas9 was codon optimized for Vitis vinifera to optimize translation efficiency. All possible 20 bp guide RNAs for FSL were identified using the online tool Benchling (https: / / benchling.com). Guide RNAs falling within the putative PLATZ domain were selected and screened for in vitro cleavage with CAS9 and template DNA using the Guide-it sgRNA In Vitro Transcription and Screening Systems catalog #632639 (Takara Bio USA, Inc.) . Two guide RNAs were selected and named sgRNAFSI and sgRNAFS4 (Figure 7). The CRISPR / Cas9-sgRNA cassette was synthesized by Genscript (https: / / www.genscript.com / ) and cloned into the binary vector pCLB1301NH for transformation using the general methodology described in Example 1. The sgRNA sequences used were those following - Guide FS1 (in antisense orientation):GGCGGTGAGGGAGCAAACAG (SEQ ID NO: 16) - Guide FS4 (in antisense orientation):AGGGGTGCACCTGTAGAAGG (SEQ ID NO: 17) - Guide FS2 (in antisense orientation):GTCTTGCAAGCTTCTCGC (SEQ ID NO: 18) - FS3 Guide (in sense orientation):GCAGCAGCGTCTGTACCT (SEQ ID NO: 19) The genetic transformation of microvitae is illustrated in Figure 8. The transgenic seedlings resulting from the TO generation were checked for gene editing by Sanger amplicon sequencing and more than 62% of the plants had edits in the predicted region of FSL. Some plants were further analyzed with Next Gen sequencing to determine mutation type, position and frequency. TO plants with high mutation frequency around the predicted location were selected to be crossed for the T1 generation. The TO generation was also phenotyped for flower sex using the method described in Example 1. Two sgRNAFSI-edited plants developed female flowers in which the stamens were mirrored and the pollen was infertile, as determined by a germination assay. of pollen described in Example 1. Figure 9 shows the floral phenotypes of the original hermaphrodite plant and the FSL knock out plant. The position of the mutation type and the frequency of the mutations in the FSL knock out plant were determined by Amplicon NextGen sequencing. The mutation frequency around the guide sequence was 98% in both the genomic DNA samples from the leaves and flowers, which implies that both alleles have been mutated by gene editing and that the mutation can be transmitted to the T1 generation. Figure 10 shows that the type and position of the most common mutation is a T insertion or a T deletion at base 16 of the guide sequence. The edits resulting from a T insertion or a T deletion correspond to positions 155 and 159 relative to the sequence established in SEQ ID NO: 6 or 7. Alignment of the predicted amino acid sequences for the FSL knockout and the H allele show that the knockout produced a missense mutation in which protein synthesis is aborted prematurely due to a stop codon (Figure 11). MA / a / ZUZI / UIOOUO Discussion The conversion from hermaphrodite to female flower by gene editing of FSL within the microvine strongly supports the conclusion that FSL is involved in the development of the male organ, corroborating the findings of Example 4. The mutations introduced by gene editing gave rise to a non-functional truncated protein, thus preventing the development of male reproductive organs and giving rise to the female flower phenotype. Therefore, the present disclosure provides a novel method and general approach for converting hermaphrodite flowering plants to female flowering plants. Such methods and approaches may be useful in selective breeding strategies for male sterility. EXAMPLE 6: DWARF FEMALE VINES WITH PARTHENOCARPIC FRUITS WITHOUT SEEDS Based on the discovery that the FSL gene is responsible for flower sex in vines, inventors developed dwarf plants that flower quickly and produce seedless fruits and a method for producing them. Microvine cultivation conditions and seed reproduction and germination protocols were described in Chaib et al, 2010. Plants were grown in a greenhouse in Waite, South Australia. This was achieved by combining two genes in a single plant 1) the mutated gene insensitive to gibberellic acid in a heterozygous (GAI1 / ga¡1) or homozygous (GAI1 / GAI1) state that causes a phenotype of dwarf stature and rapid flowering; and 2) the female FSL locus (f / f in the homozygous state). Populations were visually phenotyped for plant height and berry color. Plants that had the above genetic profile were then tested by artificially pollinating some of the female microvine inflorescences at the time of anthesis with viable pollen from a genotype such as Riesling, and leaving others unpollinated. Inflorescences were marked with paper tags indicating the name of the pollen donor and the date of pollination. The pollinated inflorescences were allowed to grow in clusters and the fruits were harvested and sectioned to observe the development of the seeds (if any) about 3 months after pollination. Hard seeds were found in sections of berries that developed from pollinated flowers in the female microvar, but no seeds were found in berries that developed from unpollinated flowers (Figure 12A and B). Normal female vines produce flowers that do not develop any fruit when unpollinated, but fruits are produced when those flowers are cross-pollinated with pollen from male or hermaphrodite plants. In contrast, female microvines MA / a / ZUZI / UIOOUO developed here have been shown to produce berries that are generally seedless unless cross-pollination occurs. Thus, the dwarfing gene in combination with the FSL f / f genotype produces seedless fruits in the absence of pollination, but produces viable hard seeds when the flowers are pollinated with viable pollen. EXAMPLE 7: DWARF FEMALE VINES WITH PARTHENOCARPI AND STENOSPERMOCARPIC FRUITS WITHOUT SEEDS Based on the results of Example 6, the inventors developed dwarf plants that flower rapidly and produce seedless fruits even after pollination with viable pollen and methods for producing them. This was achieved by combining three genes in a single plant: 1) the mutated gene insensitive to gibberellic acid, either in a heterozygous (GAI1 / ga¡1) or homozygous (GAI1 / GAI1) state, which causes a height phenotype dwarf and fast flowering; 2) the female FSL locus (f / f in the homozygous state) and 3) the mutated locus of the Vitis vinifera MADS-box protein 5 (VvMADS5) gene (in the heterozygous or homozygous state) which is associated with stenospermocarpy (SDL1) in the vine VvMADS5 had been previously isolated and the sequence deposited in the GenBank database (GenBank: AF373604.1; Boss ef aL, (2002) J. Plant Sel., 162(6):887-895. This gene has been identified as a key gene associated with seedlessness in several subsequent publications and is also known as VviAGL11. Briefly, pollen was collected in vials from seedless grape varieties during anthesis, dried in the oven at 42°C overnight, and stored in the freezer at −80°C until use. The seedless varieties initially chosen were Crimson Seedless, Ruby Seedless, Black Gem Currant and MS-03-48- 44. Subsequently, pollen from varieties such as Fantasy seedless (FRESNO B 36- 27 X FRESNO C 78- 68) has also been used. and Summer Royal (FRESNO A 69- 190 x FRESNO C 20- 149) to produce dwarf female vines with seedless parthenocarpic and stenospermocarpic fruits. When the caps began to fall on the inflorescences of the female microvine plants, all the caps were gently removed and the pollen of the selected seedless varieties was brushed on the stigmas of the flowers of the dwarf female microvines developed in the example 6. Inflorescences were marked with paper labels indicating the name of the pollen donor and the date of pollination. Pollination was repeated for one or two days to cover all late-developing flowers. The fruits were harvested and the seeds were extracted about 3 months after pollination. The seeds were germinated and the segregating progeny were grown in pots in the greenhouse. When inflorescences developed into these segregating progeny, the plants were crossed with viable pollen from a test variety, such as Riesling, to MA / a / ZUZI / UIOOUO confirm the seedless phenotype of the progeny and identify and select truly seedless plants. A seedlessness marker test was also developed to confirm that plants displaying a truly seedless phenotype had the VvMADS5 genotype. Briefly, primers were developed to isolate genomic regions of VvMADS5 with SNPS from seedless varieties such as Crimson Seedless and Ruby Seedless and Sultana seedless monococci by PCR. Primers were then designed to enable genotyping of the seedless varieties using the KASPTM assay following the Guide for Running KASPTM Genotyping Reactions on Roche LC480 Series Instruments from LGC Biosearch Technologies. One of the primer sets (below) successfully identified the seedlessness SNP and linked it to the phenotype. This marker is called SDL1. Primers used: VvSDLF1:GAAGGTGACCAAGTTCATGCTATCCAGGCATTAGTTTCTCG (SEQ ID NO: 20) VvSDLF2:GAAGGTCGGAGTCAACGGATTATCCAGGCATTAGTTTCTCT (SEQ ID NO: 21) VvSDLRev:AAGTGGTAGCCTGTGGAT (SEQ ID NO: 22) There are scenarios where the inflorescences of female microvines may be pollinated by airborne pollen from other vines, in which case the berries may develop hard seeds. Therefore, it is important to develop truly seedless microvines that do not form hard seeds after pollination to account for circumstances where flowers are unintentionally pollinated by airborne pollen. The present inventors have achieved this by introducing the mutated VvMADS5 stenospermocarpy locus into female microvines comprising the GAI1 dwarfism mutant gene in combination with the female FSL (f / f) locus. These plants produce seedless fruits even after pollination. When all three genes are combined, a dwarf vine is produced that has sterile pollen and produces seedless fruits with or without fertilization. Genotyping with the seedlessness marker confirmed the mutated locus of the VvMADS5 gene. The phenotype has also been verified by artificially pollinating some inflorescences of several female microvines at the time of anthesis, with viable pollen from a genotype such as Riesling. Inflorescences were marked with paper labels with the name of the pollen donor and the date of pollination. The pollinated inflorescences were allowed to grow in clusters and the fruits were harvested and sectioned to observe the development of seeds (if any) about 3 months after pollination. The absence of parthenocarpic seeds was evident in berries that developed from unfertilized flowers (Figure 13A). The absence of stenospermocarpic seeds was evident in berries that developed from pollinated flowers, that is, only remains of soft seeds that normally do not germinate were observed (Figure 13B). EXAMPLE 8: DWARF HERMAPHRODITE VINES WITH STENOSPERMOCARPIC SEEDLESS FRUITS The inventors also developed new dwarf hermaphrodite plants that flower rapidly and produce seedless fruits even after pollination with viable pollen, and methods for producing them. The plants and the method combine two genes: 1) the mutated gene insensitive to gibberellic acid (in heterozygous (GAI1 / ga¡1) or homozygous (GAI1 / GAI1) state that causes a dwarf stature and a fast flowering phenotype; and 2 ) the mutated locus of the VvMADS5 gene (in heterozygous or homozygous state) that is associated with stenospermocarpy (SDL1) in grapevine. When cap shedding began on the inflorescences of the female microvine plants, all caps were gently removed and pollen from selected seedless varieties (as in Example 7) was brushed onto the stigmas of the flowers. Inflorescences were marked with paper tags showing the name of the pollen donor and the date of pollination. Pollination was repeated for one or two days to cover all late-developing flowers. The fruits were harvested and the seeds were extracted about 3 months after pollination. The seeds were germinated and the segregating progeny were grown in pots in the greenhouse. Genotyping with the seedless marker (described in Example 7) was used to confirm the mutated VvMADS5 gene locus in plants that produced hermaphrodite flowers and developed to produce seedless berries. Sections of berries from hermaphrodite microvines confirmed that plants that were genotyped to be seedless stenospermocarpic using the SDL marker and that contained the mutated VvMADS5 locus were seedless or had only soft seed remains, while other hermaphrodite plants had seeds. hard brown (Figure 14A and B). Hermaphrodite microvines exhibit the typical hermaphrodite phenotype for flowers and develop hard seeds in the berries. By introducing the mutated VvMADSS locus into the hermaphrodite background (either through conventional breeding or recombinant DNA techniques), hermaphrodite microvine plants with seedless berries have been produced. Seedless hermaphrodites are important for the table grape market and also for future breeding work to introduce seedlessness into other grape genotypes. MA / a / ZUZI / UIOOUO EXAMPLE 9: OTHER NOVEL COMBINATIONS Female and hermaphrodite microvines have been bred with new combinations of berry flesh color (red flesh trait of the Dunkelfelder grape variety) and berry flavor (muscat flavor of the Muscat Gordo Blanco and Frontignac grape varieties white; cotton candy flavor from the Muscadinia-MS27-31 hybrid). In this way, a selection of microvines has been developed that can provide year-round fruit production to suit different palates and tastes. EXAMPLE 10: PRODUCTION AND ANALYSIS OF GRAPE BERRY JUICE Berry juice from several microvine lines, as exemplified here, was analyzed using a black-berry seedless microvine (15C018V0005), a seedless white-berry hermaphrodite line (15C018V0058), and a seeded muscat-flavored hermaphrodite ( 17C001V0006). The analyzes were carried out with the OenofossTM analyzer to measure degrees Brix (TSS), following the manufacturer's instructions. The berries were crushed in a sterile plastic bag and 2 mL of wort was transferred to a 2 mL Eppendorf tube and centrifuged for 1 minute at 13,000 rpm. Approximately 0.6 mL of the supernatant was analyzed with an OenofossTM analyzer to determine Brix (TSS) and check sample pH, total acidity, volatile acidity, alpha amino nitrogen, ammonia, tartaric acid, melic acid. and density. The results are presented in Table 2. EXAMPLE 11: WINE PRODUCTION FROM MICROVID BERRIES Wine was made on a small scale from fruits produced from a seedless hermaphrodite microvine (15C018V0058) and a seeded hermaphrodite (17C001V0006). 2 kg of grape bunches were transferred to a press seal bag (305mm x 405mm 50um) with a tablespoon of dry ice and 1.2 mL of 100 mg / mL PMS solution (based on 50 ppm for 60% juice recovery. ). The berries were squeezed until all the berries were broken up and free juice was visible. The juice was strained through a kitchen sieve and centrifuged for 2 minutes at 1489 rcf to remove solids. 500 mL of juice was removed from the centrifuge bottle and transferred to a 500 mL Schott flask with a silicon airlock and sampling septum. The juice was adjusted to temperature for 1-2 hours before adding the yeast, DAP and PVPP. The juice was inoculated with 10 mL of an overnight yeast culture (Maurivin PDM Yeast), 1 mL of a DAP stock of 476 mg / mL (200 ppm of nitrogen assimilated by the YAN yeast) and 1 mL of PVPP of 130mg / mL (260 ppm PVPP). The juice was fermented at 18°C ​​with 2 minutes of stirring at 100 rpm every two hours. Total sugars were measured every 24 hours. When the sugars reached 2.5 g / L, the wine was transferred to a transparent wine bottle using a siphon device under argon pressure with 500 pL of 1 mg / mL copper sulfate and 500 pL of PMS (100 mg / L). mL) and allowed to rest for 7 days at 4°C. The headspace was minimized by filling to the top with marbles. After cold settling, the wine was filtered through a 0.45 pm autoclaved groundwater filter (Air-Met FTH-45) using argon gas to push it into a combination of 200 mL, 100 mL, and 50 mL amber bottles. mL (Cospak). The bottles were closed with Tampertell cellophane caps (Cospak) and then sealed with wax. Analysis of the finished wine was performed for each wine sample of the grape variety using the Foss OenofossTM analyzer according to the manufacturer's instructions. OenoFoss measurements for wine Briefly, approximately 1 mL of wine was collected during vinification and transferred to a 2 mL Eppendorf tube and centrifuged for 1 minute at 13,000 rpm. Approximately 0.6 mL of the supernatant was analyzed with an OenofossTM analyzer for ethanol, pH, total acidity, volatile acidity, melic acid, wine density, and glucose / fructose. The results of the wine analysis using OenoFossTM are presented in Table 3. Discussion: The berries were picked before they were fully ripe, so the sugar levels were not optimal for the development of alcohol. The resulting wine had an alcohol content below the detectable level of 8% by OenFoss. However, the experiment successfully demonstrated that the strong muscat flavor was present in the wine prepared from the muscat-flavored microvine line 17C001V0006. The seeded berries are likely to be useful for white wine production, which currently requires removal of the seeds due to flavor problems arising from the naturally high phenolic content of the seeds. The high phenol content can be extracted from the wine during the fermentation process, so the absence of seeds can improve the quality of the wine. Skin contact white wine, the processing of white wine fermented with the skin, allows the wine to develop while the skin is still present, unlike conventional white wine production which crushes the grapes by recovering the pressed juice in a fermentation vessel, resulting in the loss of color pigments, phenols and tannins. Red wine requires skin contact and maceration for the development of color, flavor and texture. ω σι ω ο ΙΌ σι ΙΌ Table 2. OenoFoss values ​​for different characteristics of table grape must from a sample of grapes from microvines. Values ​​come from randomly selected berry samples from each line picked at around 17-18 BRIX measured with a pocket refractometer. Phenotype Plant ID / PH Line Total titratable acid (g / L) Melic acid (g / L) Tartaric acid (g / L) TSS Density Volatile acids (g / L) Yeast assimilable N (YAN)(mg / L) Nitrogen alpha amino (mg / L) Gluconic acid W Ammonia (mg / L) Female, Black berry, seedless 15C018V0005 3.4491 9.591 5.055 5.273 18.564 1.1 0.0518 528.636 361.76 0.6 203.5091 Hermaphrodite White berry, seedless 15C018V0058 3.73 9.2 5.7 4.2 14.6 1.1 0.12 577.6 425.5 0.4 185.5 Muscat flavor hermaphrodite, hard seeded 17C001V0006 3.32 9.925 4.65 7.425 15.875 1.1 0.0325 294.775 184.18 0 134.9 Table 3. OenoFoss analysis of small-scale wine samples prepared from selected microvine grapes ό Microvine line Phenotype Ethanol % pH Titratable acid (g / L) Malic acid (g / L) Glucose / Fructose Volatile acids (g / L) Density 15C018V0058 Hermaphrodite, white berry, seedless -999 3.2 9 10.5 4.6 1.6 0.19 0.9971 17C001V0006 Muscat flavor hermaphrodite, hard seeded -999 3.5 1 8.8 4.8 2.5 0.15 0.9963 EXAMPLE 12: GENOTYPICAL AND PHENOTYPICAL EVALUATION OF HOMOZYGOTIC T1 VViFSL MUTANTS GENERATED BY GENE EDITING Position of the guide sequences in VviFSL Two guide RNA sequences, FS1 and FS4, were designed into the second exon of VviFSL. These were chosen based on the presence of PAM sequences, their Benchling on target and off target score and the ability to form the CRISPR / Cas9 complex and cleave the template DNA in vitro (data not shown). Figure 15 shows the CRISPR / Cas9 vector and the cloning position of the guide RNA. Generation and genotyping of Ti plants Several TO plants edited by the FS1 and FS4 guides were chosen to self-cross and obtain T1 progeny, in order to determine the inheritance patterns of the mutations and obtain homozygous T1 mutants. TO lines were selected for the generation of T1 progeny based on the frequency of the mutation. Self-crossing was performed and seeds were germinated as described in Chaib et al., 2010. Roots of germinated embryos were genotyped by Sangerde amplicon sequencing (according to Example 5). Embryos were scored as homozygous for a mutation, heterozygous or non-mutated homozygous and transferred to SM medium for two weeks for seedling formation and then potted in soil (BioGro soil mix purchased from Van Schaiks in Mt Gambier , South Australia) and transferred to a greenhouse or growth room for flower development for 4 months. The greenhouse temperature was set at 25°C for the day and 20°C for the night and was watered twice a day for 5 minutes. The temperature of the growth room was set at 25°C, the humidity at 85°C and the 16-hour day and night cycle bulbs of 400W (420kWh / 1000h) white light. The plants were watered once a day for 5 minutes. Analysis of the first generation of T0 transgenic plants for gene editing Fifteen GFP positive plants for both FS1 and FS4, which were analyzed for CRISPR / Cas9 gene editing, showed an alteration of the Sanger sequence of amplicons around the guide sequence. Nextgen sequencing analysis of these amplicons showed that the gene editing frequency ranged from 91.8% to 35.9% for FS1 and from 58.6% to 17.3% for FS4. The types of mutations and the locations in which they occurred with a frequency greater than 10% in any plant were identified. Figure 16 shows these mutations. Mutations for both FS1 and FS4 primarily involved the T base and occurred at the 5 prime of the PAM site. Inheritance patterns of mutations in the T1 generation When the mutation frequency in the T0 parent was close to 100%, as in MA / a / ZUZI / UIOOUO crosses A and E, it was likely that both alleles had been genetically edited, that is, a biallelic mutation that explained why no wild progeny were segregated in the T1 generation and there was 1:1 segregation for homozygous mutants and heterozygotes carrying different mutations in each allele. When the mutation frequency was around 50%, as in crosses C, DQ, F and V, one of the alleles may have been gene edited and the other not, i.e. a monoallelic mutation. This gave rise to progeny in which 50% were heterozygous and 25% were homozygous mutants or 25% wild-type. This was the case for crosses C, Q F and V, which showed insignificant Chi square p values ​​for the observed genotypes. Cross D, however, showed a significant deviation from the expected genotypic frequencies, indicating that the nextgen mutation frequency of 40% was not due to a monoallelic mutation, but rather because the mutations existed in a chimeric state in the plant. T0, where some segments were mutated and others were not. Even so, homozygous T1 mutants were obtained. Although no wild progeny were obtained in cross A, it is possible that this is a low chimera because the flowers of the T0 parent remained hermaphroditic, unlike cross E, in which T0 plants showed female flowers, indicating that both FSL genes have been completely deleted. The T1 homozygous mutants obtained from the T0 self-crosses are listed in Table 4. Some of the mutations are the same for different crosses and have been aligned in Figure 17. Homozygous T1 mutants were obtained for the guide RNAs FS1 and FS4. The coding sequences were translated and aligned to determine the effect of the mutations on the protein sequence (Figure 18). Table 4. Types of mutation obtained from each T0 crossing. FS1 and FS4 refer to the original guide sequence. Cross number Plant T0 Flower phenotype T0 Homozygous mutation inT1 Plant name T1 A FS1 A1B 01 hermaphrodite FS1 2T deletion T1 A FS1 2Tdel C FS4 M2B 14 hermaphrodite FS4 CT deletion T1 C FS4 CTdel C FS4 M2B 14 hermaphrodite FS4 10bp deletion T1 C FS4 10bpdel D FS4 M2B 03 hermaphrodite FS4 5bp T1 deletion D FS4 5bpdel D FS4 M2B 03 hermaphrodite FS4 T insertion T1 D FS4 Tins E FS1 BIA 3 Female FS1 T insertion T1 E FS1 Tins E FS1 BIA 3 Female FS1 T deletion T1 E FS1 Tdel Mutations cause significant changes in the amino acid sequence All DNA base deletions and insertions cause a frameshift or nonsense mutation that could affect the activity of the protein. T1_C_FS4_CTdel, T1-D_FS4, T1_A_FS1_tins, and T1_A_FS1_2Tdel gave rise to a missense mutation within the PLATZ domain. T1_C-FS4_CTdel occurs before the other mutants. T1_A_FS1_2Tdel and T1_AFs1_Tins give rise to a nonsense mutation at the same position. Floral phenotype in the T1 generation All homozygous mutants of the T1 generation showed conversion from hermaphrodite flowers to female flowers with retracted stamens, and one of the mutants had no pollen production. Flowers with 2 to 6 individual inflorescences and those with 22 to 54 flowers were scored for each mutant (Table 5). Pollen from all mutants showed viability by pollen germination assay. This was further confirmed using pollen in the crosses in which the mutation was transmitted. Pollen counts per anther of the mutants did not differ significantly between the original hermaphrodite plants and the pollen-producing mutants. The number of anthers analyzed ranged from 6 to 49. At least 3 individual homozygous mutants were confirmed to have female flowers and wild T1 progeny had the hermaphrodite phenotype, confirming that the mutations were causing the phenotypic change. IVIA / a / ZUZ l / U I 0DU0 ω σι μ ιυ σι ο Table 5. Summary of the genotype and phenotype of the T1 mutants. Plant TO guide RNA Named plant T1 Homozygous mutation inT1 Position of the mutation (From the FSL start codon of the hermaphrodite V6) Flower phenotype Flower count # of inflorescences Pollen count # of anthers FS1 A1B 01 FS1 Τ1 A09 FS1 2Tdel 2T delation 157bp Female flower 30 / 30 3 348.5+ / - 79.5 7 FS4 M2B 14 FS4 T1 C72 FS4 CTdel CT delation 182bp Female flower and without pollen 54 / 54 5 0 49 FS4 M2B 14 FS4 T1 C74 FS4 Wbpdel 10bp delation 180 bp Female flower 29 / 29 3 335.52 + / 156.6 21 FS4 M2B 03 FS4 T1 D18 FS4 5bpdel 5bp delation 184bp Female flower 44 / 44 6 276.3 + / 82.0 16 FS4 M2B 03 FS4 T1 D13 FS4 Tins T insertion 184bp Female flower 2 2 / 22 2 283.5 + / - 31.7 6 FS4 m2b 14 FS4 T1 C84 FS4 TDEL T Delion 184BP FLOR Discussion The inventors have demonstrated using CRISPR / Cas9 technology that the transcription factor VViFSL PLATZ within the grapevine linkage group 2 is necessary for the normal development of the male organ in flowers. Deletion of the gene appears to be recessive, as plants with a single mutated allele display the hermaphrodite phenotype. No differences were found at the DNA and protein level between VViFSL in the male and in the hermaphrodite, suggesting that it behaves similarly to Sp, the dominant gene necessary for the development of the male organ described by Oberle 1938. However, in the female allele, amino acid substitutions along with an altered position of the start codon rendered the protein nonfunctional and resulted in loss of male organ development. The significantly lower expression in the female genotype (fsl / fsl) indicates that a lack of gene expression / protein amount interferes with the development of male organs. The ATG start of the female gene is further 5' compared to the male or hermaphrodite sequence (Figure 2), which could alter 5' upstream sequences that may affect the binding of transcription inducers. However, there are also amino acid substitutions that could influence the activity of the protein. With CRISPR / Cas9 mutants, the inventors have similarly achieved the female phenotype by inactivating VviFSL as a result of changes in the protein sequence. Monoallelic T0 mutants maintained the original hermaphroditic flower phenotype, indicating that only one functional FSL gene is necessary for male organ development, making it a dominant trait. NCBI LOC100247272 appears to be the dominant FSL leading to normal development of male organs and LOC100852507 appears to be the recessive fsl leading to abnormal development of male organs according to the SNP. This indicates that the Pinot Noir genome is heterozygous for the FSL / fsl sexual locus. It is unclear why the CT mutation affected pollen fertility while the other mutations resulted in retracted stamens and viable pollen. The missense mutation occurs earlier in the PLATZ domain and could therefore have a greater effect on its function. This is the first time that a PLATZ domain transcription factor has been described as playing a role in flower development in plants. MA / a / ZUZI / UIOOUO 100 EXAMPLE 13: DISCUSSION The present inventors have identified that a locus, called the flower sex locus (FSL), is responsible for flower sex in angiosperms, such as grapevines, and that the different genotypes of the FSL locus and the polypeptides expressed from They can be used to determine, control and / or select the flower sex phenotype, that is, the female, male or hermaphrodite flower phenotypes, respectively. The inventors have characterized the locus responsible for the determination of the male sexual organ, the FSL locus in a Vitis sp., and have also demonstrated a 100% concordance between the female FSL / fsl and hermaphroditic FSL / Fsl or FSL / fsl genotypes in a single nucleotide polymorphism (SNP) within a plant domain rich in AT's and zinc binding (PLATZ) sequences of the FSL locus and the respective sexual phenotype of the flower. The present inventors have produced FSL knockout Vitis vinifera plants by introducing mutations in the PLATZ domain of the FSL locus using CRISPR. The inventors have shown that the resulting FSL knock out plants do not develop functional male reproductive organs, supporting the conclusion that expression of the FSL locus is essential for the development of functional male reproductive organs in flowers. Based on these findings, the present disclosure describes plants and plant parts with altered FSL polypeptide activity, as well as methods of producing plants with a particular floral sex phenotype by selecting for specific genotypes of the FSL locus or modifying the FSL locus. The present disclosure is also based on the inventors' finding that new varieties of parthenocarpic seedless grapes can be produced by combining (i) an FSL locus that determines the sex of the male flower that has been modified to confer a phenotype of female flower, and (i) a polynucleotide that confers dwarf stature, as a variant of the Gibberellic Acid Insensitive (GAI1) locus that confers dwarf stature and rapid flowering in vines. The inventors have shown that vines having the aforementioned fsl / GAI1 genetic profile produce seedless parthenocarpic fruits when the flowers are not pollinated and seed-containing fruits when the flowers are pollinated with viable pollen. Furthermore, the present disclosure is based on the inventors' surprising finding that new stenospermocarpic / parthenocarpic seedless grape varieties can be produced by combining (i) an FSL locus that is homozygous in females or that has been modified to confer a phenotype of female flower, (i) a polynucleotide that confers dwarf stature, such as a variant of the GAI1 locus that confers dwarf stature and rapid flowering in vines; and (i¡) a polynucleotide that confers stenospermocarpy, as a variant of the Vitis vinifera MADS-box protein 5 locus ΜΛ / a / ZUZ 1 / U1 DOUO 101 (VvMADS5). The inventors have shown that grapevines having the aforementioned fsl / GAI1 / VvMADS5 genetic profile produce seedless parthenocarpic fruits when the flowers are not pollinated and stenospermocarpic fruits when the flowers are pollinated with viable pollen. In this regard, the present disclosure provides new seedless genotypes that are capable of producing seedless fruits in grapes, including truly seedless fruits even after pollination. Those skilled in the art will appreciate that numerous variations and / or modifications can be made to the invention, as shown in the specific embodiments, without departing from the spirit or scope of the invention, as generally described. Therefore, the present embodiments should be considered in all respects as illustrative and not restrictive. All publications discussed and / or referenced in this document are incorporated herein in their entirety. Any discussion of documents, acts, materials, devices, articles or the like that has been included in the present description is solely for the purpose of providing context for the present invention. It should not be taken as an admission that any or all of these matters form part of the basis of the prior art or were generally known in the field relevant to the present invention as it existed before the priority date of each claim of this application. REFERENCES Almeida and Allshire (2005) TRENOS Cell Biology 15: 251-258. Antcliff (1980) Annales de TAmelioration des Plantes 39:113-122. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. (1988, including all updates until present), Associates and Wiley-lnterscience. Battilana et al. (2013) Molecular Biotechnology, 54(3):1031-1037. Bevan et al. (1983) Nucleic Acid Research, 11: 369-385. Bibikova et al. (2001) Molecular and Cellular Biology, 21: 289-287. Bibikova et al. (2002) Genetics, 161:1169-1175. Boss and Thomas, (2002) Nature, 416(6883):847-850 Bourque (1995) Plant Science, 105: 125-149. Brown T.A. (editor), Essential Molecular Biology: A Practice! Approach, (1991), Volumes 1 and 2, IRL Press. Carmona et al. (2008) Journal of Experimental Botany, 59(10):2579-2596. MA / a / ZUZI / UIOOUO 102 Certo et al. (2012) Nature Methods, 8:941-943. Chaib et al. (2010) The Plant Journal, 62(6):1083-1092. Chanderbali et al. (2010) PNAS USA, 107:22570-22575. Christensen & Quail (1989) Plant Molecular Biology. 12:619-632. Christensen et al. (1992) Plant Molecular Biology. 18:675-689. Coitus etal. (2017) Frontiers in Plant Science, 8:98. Coito etal., (2019) PeerJ, DOI 10.7717 / peerj.7879. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons. Comai et al. (2004) Plant Journal, 37: 778-786. Coombe Adoption of a system for identifying grapevine growth stages' (1995) Aust. J. Grape and Wine Res. 1:104-110Dalbo, et al. (2000). Doyon et al. (2010) Nature Methods, 7:459-460. Doyon et al. (2011) Nature Methods, 8:74-79. Fechter et al. (2012) Molecular Genetics and Genomics, 287 247-259. Friedlander et al. (1977) Plant and Cell Physiology, 18(1):261-269. Gelvin et al. Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990 Gloverand Hames (eds.), DNA Cloning: A Practical Approach, (1995 and 1996) Volumes 1-4, IRL Press. Groenen et al. (1993) MolecularMicrobiology, 10:1057-1065. Guo et al. (2010) Journal of Molecular Biology, 400:96-107. Haft et al. (2005) Computational Biology, 1(6):e60 Harlow and Lane (eds.) Antibodies: A Laboratory Manual (1988), Coid Spring Harbor Laboratory. Hartmann and Endres, Manual of Antisense Methodology, Kluwer (1999). Henikoff et al. (2004) Plant Physiology, 135: 630-636. Hinchee et al. (1988) Biotechnology, 6: 915. Hoe et al. (1999) Emerging Infectious Diseases, 5:254-263. locco etal. (2001) Transgenic Research 10: 105-112. MA / a / ZUZI / UIOOUO 103 Ishino et al. (1987) Journal of Bacteriology, 169:5429-5433. Jackson (1992) In-situ hybridization in plants. In: Molecular Plant Pathology: A Practical Approach. Practical Approach Series, 1 (85). Oxford University Press. Janssen et al. (2002) OMICS Journal of Integrated Biology, 6:23-33. Jí etal, (2015) Scientia Hortícolae, 193:367-373. Jí etal. (2016) Journal of Integrated Plant Biology, 58:762-765. Jie et al. (2017) Horticulture! Plant Journal, 3(3):91-100. Jinek et al. (2012) Science, 337(6096): 816-821. Joshi (1987) Nucleic Acid Research, 15: 6643-6653. Kim et al. (1996) PNAS USA, 93:1156-1160. Kim et al. (2012) Genome Research, 22:1327-1333. Koziel et al. (1996) Plant Molecular Biology, 32:393-405. Last etal. (1991) Theoretical and Applied Genetics, 81(5):581-588. Medberry et al. (1992) Plant Cell, 4: 185-192. Medberry et al. (1993) Plant Journal, 3: 619-626. Manzano et al. (2011) Plant Growth Regulation, 65:213-221. Mao et al. (2017) Frontiers in Plant Science, 8:1291. McEIroy et al. (1990) Plant Cell, 2:163-171. McConnell-Smith et al. (2009) PNAS USA, 106:5099-5104. Millar and Waterhouse (2005) Functional and Integrative Genomics, 5:129-135. Miller et al. (2007) Nature Biotechnology, 25:778-785. Mojica et al. (1995) Molecular Microbiology, 17:85-93. Mojica et al. (2000) Molecular Microbiology, 36:244-246. Nakata et al. (1989) Journal of Bacteriology, 171:3553-3556. Nagano et al. (2001) Nucleic Acids Research, 29(20):4097-4105. Negi and Olmo (1966) Science, 152:1624-1625. Negi and Olmo (1971) Vitis, 9:265-279. Odell et al. (1985) Nature, 313:810-812. 104 Oberle (1938) New York State Agriculture! Experiment Station Bulletin 250:3-32. Pannell (2017) Current Biology, 27(5):R191-R197. Perbal (1984), A Practical Guide to Molecular Cloning, John Wiley and Sons J. (supp. 1987). Pasquinelli et al. (2005) Current Opinions in Genetics and Development, 15: 200-205. Peterson and Anhder, (1960) Science, 131: 1673-1674. Pouwels et al. Cloning Vectors: A Laboratory Manual, 1985. Ramírez et al. (2012) Nucleic Acids Research, 40:5560-5568. Riaz et al. (2006) Theoretical and Applied Genetics, 113:1317-1329. Royo et al. (2018) Plant Physiology, 177:1234-1253. Sambrook et al. (1989) Molecular Cloning·. A Laboratory Manual, Coid Spring Harbor Laboratory Press. Senior (1998) Biotechology and Genetics. Engineering Reviews, 15: 79-119. Sigrist, C.J.A., (2009) Nucleic Acids Research, 38:161-166. Slade and Knauf (2005) Transgenic Research, 14: 109-115. Smith et al. (2000) Nature, 407: 319-320. So etal, (2015) POJ, 8(6):479-484. Stalker et al. (1988) Science, 242: 419-423. Szczepek et al. (2007) Nature Biotechnology, 25:786-793. Taylor (1997) The Plant Cell 9:1245-1249. Tanurdzic and Banks (2004) Plant Cell, 16(Suppl. 1):S61-S71. Thillet et al. (1988) The Journal of Biological Chemistry, 263:12500. van Embden et al. (2000) Journal of Bacteriology, 182:2393-2401. Valleau (1916) The American Naturalist 50(597):554-564. Velten et al. (1984) EPBO Journal, 3:2733-2730. Waterhouse et al. (1998) PNAS USA, 95: 13959-13964. Wang et al. (2012) Genome Research, 22:1316-1326. MA / a / ZUZI / UIOOUO 105 Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989. Yamasaki et al. (2000) Plant and Cell Physiology, 41:608-616. Yamasaki et al (2001) Plant and Cell Physiology, 42:608-619. Yamasaki, et al (2005) Vitamins and Hormones, 72:79-110. Zhang et al (2013) Current Biology, 23(20):1979-1989.

Claims

1. A plant or part thereof having an altered level of flower sex polypeptide (FSL) activity compared to a corresponding plant or part thereof having an FSL locus genotype that confers a male or hermaphrodite flower phenotype.

2. The plant or part thereof of claim 1, characterized in that: a genotype of the FSL locus conferring a hermaphrodite flower phenotype comprises a hermaphrodite allele of the FSL locus encoding the FSL polypeptide comprising an amino acid sequence established in SEQ ID NO:1, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to the sequence established in SEQ ID NO:1; and a genotype of the FSL locus conferring a male flower phenotype comprises a male allele of the FSL locus encoding the FSL polypeptide comprising an amino acid sequence established in SEQ ID NO:3, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to the sequence established in SEQ ID NO:

3.

3. The plant or part thereof of claim 1, characterized in that: a hermaphrodite allele of the FSL locus encodes the FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, or a biologically active fragment thereof; and a male allele of the FSL locus encodes the FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:3, or a biologically active fragment thereof.

4. The plant or part thereof of any of claims 1 to 3, characterized in that it comprises an FSL locus comprising a polynucleotide sequence encoding the FSL polypeptide, wherein the polynucleotide sequence is modified relative to a corresponding polynucleotide sequence of a wild-type FSL locus allele that confers a male or hermaphrodite flower phenotype when expressed.

5. The plant or part thereof of claim 4, characterized in that a region of the polynucleotide sequence encoding a plant domain rich in AT and zinc-binding sequences (PLATZ) of the FSL locus is modified. IVIA / a / ZUZ l / UI 30U0 107 6. The plant or part thereof of claim 4 or 5, characterized in that the polynucleotide sequence encoding the FSL polypeptide comprises one or more nucleotide additions, deletions, or substitutions in relation to the corresponding polynucleotide sequence of an allele of the FSL locus that confers a male or hermaphrodite flower phenotype when expressed.

7. The plant or part thereof of any of claims 1 to 6, characterized in that the activity of the FSL polypeptide is reduced in the plant or part thereof relative to a level of activity of the FSL polypeptide in a corresponding wild-type plant or part thereof.

8. The plant or part thereof of any of claims 1 to 7, characterized in that the altered activity of the FSL polypeptide causes a male reproductive part of a flower of the plant to be absent or non-functional.

9. A plant or part thereof that produces seedless fruit, characterized in that said plant comprises: (i) a polynucleotide that confers dwarf stature to a plant; and (ii) a flower sex locus (FSL) that is homozygous for a female allele (f / f) that confers a female flower phenotype.

10. The plant or part thereof of claim 9, characterized in that the FSL locus has an ORF comprising a sequence established in SEQ ID NO: 5 or a sequence that is at least 70% thereof, provided that the nucleotide corresponding to position 621 of the sequence established in SEQ ID NO: 5 is an A.

11. The plant or part thereof of any of claims 1 to 8, characterized in that it comprises a polynucleotide that confers dwarf stature to the plant.

12. The plant or part thereof of any of claims 9 to 11, characterized in that the polynucleotide that confers dwarf stature is altered in relation to the corresponding wild polynucleotide sequence.

13. The plant or part thereof of any of claims 9 to 12, characterized in that the polynucleotide that confers dwarf stature is a variant of the gibberellic acid insensitive gene (GAI1) or a fragment thereof.

14. The plant or part thereof of claim 13, characterized in that the variant of the GAI1 gene or fragment thereof that confers dwarf stature to the plant comprises one or more mutations in the region encoding a DELLA domain.

15. The plant or part thereof of claim 13 or 14, characterized in that the variant of the GAI1 gene or fragment thereof is present in a homozygous (GAI1 / GAI1) or heterozygous (GAI1 / GaI1) state. IVIA / a / ZUZ l / UI oouo 108 16. The plant or part thereof of any of claims 13 to 15, characterized in that the GAI1 gene encodes a GAI1 protein comprising the amino acid sequence set out in SEQ ID NO: 8 or an amino acid sequence that is at least 90% identical to the sequence set out in SEQ ID NO: 8 and retains the GA signaling function thereof, and wherein the variant of the GAI1 gene encodes a variant GAI1 protein comprising an amino acid sequence set out in SEQ ID NO: 9 or an amino acid sequence that is at least 90% identical to the sequence set out in SEQ ID NO: 9, provided that the amino acid sequence of the variant GAI1 protein comprises a Leu to His substitution at position 38 relative to the sequence set out in SEQ ID NO:

8.

17. The plant or part thereof of any of claims 13 to 15, characterized in that the GAI1 gene encodes a GAI1 protein comprising the amino acid sequence set forth in SEQ ID NO: 8 or an amino acid sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 8 retaining the GA signaling function thereof, and wherein the variant of the GAI1 gene encodes a variant of the GAI1 protein in which the DELLA domain is deleted, truncated, or altered.

18. The plant or part thereof of any of claims 9 to 17, characterized in that said plant produces parthenocarpic fruits without seeds when the flowers are not pollinated and fruits containing seeds when the flowers are pollinated with viable pollen.

19. The plant or part thereof of any of claims 9 to 18, characterized in that it comprises a polynucleotide that confers stenospermocarpy.

20. The plant or part thereof of claim 19, characterized in that the polynucleotide that confers stenospermocarpy is a variant of the Vitis vinifera MADSbox protein 5 locus (VvMADS5).

21. The plant or part thereof of claim 20, characterized in that the VvMADS5 locus encodes a VvMADS5 protein comprising the amino acid sequence set forth in SEQ ID NO: 10 or an amino acid sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10 and retains the biological function thereof, and wherein the variant of the VvMADS5 protein comprises the amino acid sequence set forth in SEQ ID NO: 11 or an amino acid sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 11, provided that the amino acid sequence of the variant VvMADS5 protein comprises an R197L substitution relative to the sequence set forth in SEQ ID NO:

10. MA / a / ZUZI / UIOOUO 109 22. The plant or part thereof of claim 20, characterized in that the variant VvMADS5 locus comprises one or more mutations resulting in deletion or truncation of the VvMADS5 protein.

23. The plant or part thereof of any of claims 20 to 22, characterized in that the variant VvMADS5 locus conferring stenospermocarpy is present in a homozygous or heterozygous state. MA / a / ZUZI / UIOOUO 24. The plant or part thereof of any of claims 19 to, characterized in that said plant produces parthenocarpic seedless fruits when flowers are not pollinated and stenospermocarpic fruits when the flowers are pollinated with viable pollen.

23.

25. A plant or part thereof that produces seedless fruit, characterized in that said plant comprises: (i) a flower sex locus (FSL) genotype that is heterozygous for a female FSL locus allele and a hermaphrodite FSL locus allele (FSL / fsl), or homozygous for the hermaphrodite FSL locus allele (FSL / FSL); (ii) a polynucleotide that confers dwarf stature to a plant; and (iii) a polynucleotide that confers stenospermocarpy.

26. The plant or part thereof of any of the characterized in that the plant is a dioecious plant species.

27. The plant or part thereof of any of the following, characterized in that the plant is a hermaphroditic plant species. claims claims 25, 25, 28. The plant or part thereof of any kind characterized in that the plant is a fruit-producing plant.

29. The plant or part thereof of any of the characterized in that the plant is a Vitis sp.

30. The plant or part thereof of any of the claims 27, 28, 29, characterized in that the part of the plant is a fruit, roots, stems, thorn, cuttings, cells, seeds and parts of seeds.

31. A method for controlling the sex of the flower in a plant, characterized in that said method comprises altering a level of activity of the flower sex polypeptide (FSL) in the plant or part thereof compared to a level of activity of the FSL polypeptide in a corresponding plant or part thereof having a genotype of the FSL locus that confers a male or hermaphrodite flower phenotype.

32. The method of claim 31, characterized in that it comprises: a genotype of the FSL locus conferring a hermaphrodite flower phenotype comprising a hermaphrodite allele of the FSL locus encoding the FSL polypeptide comprising an amino acid sequence established in SEQ ID NO:1, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to the sequence established in SEQ ID NO:1; and a genotype of the FSL locus conferring a male flower phenotype comprising a male allele of the FSL locus encoding the FSL polypeptide comprising an amino acid sequence established in SEQ ID NO:3, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to the sequence established in SEQ ID NO:

3.

33. The method of claim 32, characterized in that it comprises: a hermaphrodite allele of the FSL locus encoding the FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:1, or a biologically active fragment thereof; and a male allele of the FSL locus encoding the FSL polypeptide comprising the amino acid sequence set forth in SEQ ID NO:3, or a biologically active fragment thereof.

34. The method of any of claims 31 to 33, characterized in that a plant or part of a plant having an altered level of FSL polypeptide activity comprises an FSL polypeptide comprising an amino acid sequence established in SEQ ID NO:2, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to the sequence established in SEQ ID NO:

2.

35. The method of any of claims 31 to 34, characterized in that it comprises modifying an FSL locus comprising a polynucleotide sequence encoding the FSL polypeptide or a biologically active fragment thereof.

36. The method of claim 35, characterized in that it comprises modifying a region within the FSL locus that encodes a plant AT and zinc-rich sequence binding domain (PLATZ).

37. The method of claim 35 or 36, characterized in that it comprises introducing one or more nucleotide insertions, deletions, or substitutions in the polynucleotide sequence encoding the FSL polypeptide in relation to a corresponding polynucleotide sequence of an allele of the wild-type FSL locus that confers a male or hermaphrodite flower phenotype when expressed.

38. The method of any of claims 31 to 34, characterized in that it comprises introducing into the plant or part of the plant an RNA interfering agent (RNAi) that targets a messenger RNA (mRNA) of the FSL locus or an allele thereof, thereby reducing the activity of the FSL polypeptide in the plant or part thereof. 111 39. The method of any of claims 31 to 38, characterized in that the activity of the FSL polypeptide is reduced in the plant or part of the plant relative to a level of activity of the FSL polypeptide in a corresponding wild-type plant or part thereof.

40. The method of any of claims 31 to 39, characterized in that the reduction of FSL polypeptide activity in the plant or part of the plant causes a male reproductive part of a flower of the plant or part of the plant to be absent or non-functional.

41. The method of any of claims 31 to 40, characterized in that the plant is a dioecious plant species.

42. The method of any of claims 31 to 40, characterized in that the plant is a hermaphrodite plant species.

43. The method of any of claims 31 to 42, characterized in that the plant is a fruit-bearing plant.

44. The method of any of claims 31 to 43, characterized in that the plant is a Vitis sp.

45. The method of any of claims 31 to 44, characterized in that the plant part is selected from the group consisting of fruits, roots, stems, prongs, cuttings, cells, seeds, and seed parts.

46. ​​A method for producing a plant that produces flowers of known sex, said method being characterized in that it comprises the steps of: i) crossing two parental plants; ii) examining one or more parental plants of the cross to determine the genotype at a flower sex locus (FSL); and iii) selecting a progeny plant capable of exhibiting a desired flower sex phenotype on the basis of the FSL locus genotype, characterized in that (a) an FSL locus genotype being homozygous for a female FSL locus allele (f / f) confers a female flower phenotype; (b) an FSL locus genotype being heterozygous for a female allele and a hermaphrodite allele of the FSL locus (f / H) confers a hermaphrodite flower phenotype.and an FSL locus genotype that is homozygous for a hermaphrodite allele of the FSL locus (H / H) confers a hermaphrodite floral phenotype; (c) an FSL locus genotype that is heterozygous for a male FSL locus allele and a female FSL locus allele (M / f) or a hermaphrodite FSL locus allele (M / H) confers a male flower phenotype; and an FSL locus genotype that is homozygous for a male FSL locus allele (M / M) confers a male flower phenotype, thus producing a plant that produces flowers of known sex.

47. The method of claim 46, characterized in that it comprises selecting a progeny plant having a genotype of the FSL locus that is homozygous for a female allele (f / f) to produce a plant that produces female flowers.

48. A method for producing a plant that produces seedless fruit, said method being characterized in that it comprises the steps of: i) crossing two parental plants, wherein one of the parental plants comprises a flower sex locus (FSL) that is homozygous for a female allele (f / f) that confers a female flower phenotype, and the other parental plant comprises a polynucleotide that confers dwarf stature, ii) selecting one or more parental plants from the cross to detect the presence or absence of the FSL locus that is homozygous for a female allele (f / f), and the presence or absence of the polynucleotide that confers dwarf stature, and ii) selecting a parental plant that comprises the FSL locus that is homozygous for a female allele (f / f) and that comprises the polynucleotide that confers dwarf stature, thereby generating a plant that produces seedless fruit.

49. A method for producing a plant that produces seedless fruit, characterized in that said method comprises the steps of: i) crossing two parental plants, wherein at least one of the parents comprises a) a flower sex locus (FSL) that is homozygous for a female allele (f / f) conferring a female flower phenotype, homozygous for the FSL allele (FSL / FSL), or heterozygous for FSL (FSL / fsl) conferring a hermaphrodite flower phenotype, b) at least one of the parents comprises a polynucleotide conferring dwarf stature, and c) at least one of the parents comprises a polynucleotide conferring stenospermocarpy, i) selecting one or more parent plants from the cross to detect the presence or absence of the FSL locus that is homozygous for FSL (fsl / fsl), homozygous for a hermaphrodite allele (FSL / FSL), or heterozygous for a (a) the presence or absence of the polynucleotide that confers dwarf stature,and (b) the presence or absence of the polynucleotide that confers stenospermocarpy, and (iii) selecting a parent plant comprising (a) a genotype at the FSL locus that confers a female or hermaphrodite flower phenotype, (b) a polynucleotide that confers dwarf stature, and (c) the polynucleotide that confers stenospermocarpy, thereby producing a plant that produces seedless fruit. 113, 50. The method of claim 49, characterized in that it comprises: a progeny plant comprising (a) an FSL locus genotype conferring a hermaphrodite flower phenotype, (b) the polynucleotide conferring dwarf stature, and (c) the polynucleotide conferring stenospermocarpy, producing seedless stenospermocarpic fruits; and a parent plant comprising (a) an FSL locus genotype conferring a female flower phenotype, (b) the polynucleotide conferring dwarf stature, and (c) the polynucleotide conferring stenospermocarpy, producing seedless parthenocarpic fruits.

51. A method for producing a plant that produces seedless parthenocarpic fruit, characterized in that said method comprises the steps of: i) crossing two parental plants, wherein at least one of the parents comprises a flower sex locus (FSL) that is homozygous for a female allele (f / f) conferring a female flower phenotype, at least one of the parents comprises a polynucleotide conferring dwarf stature, and at least one of the parents comprises a polynucleotide conferring stenospermocarpy; ii) selecting one or more parent plants from the cross to detect the presence or absence of the FSL locus that is homozygous fsl / fsl giving rise to female flower morphology, the presence or absence of the polynucleotide conferring dwarf stature, and the presence or absence of the polynucleotide conferring stenospermocarpy; and iii) selecting a parent plant comprising the FSL locus that is homozygous for a female allele (f / f),the polynucleotide that confers dwarf stature and the polynucleotide that confers stenospermocarpy, thus producing a plant that produces seedless parthenocarpic fruits.

52. The method of any of claims 46 to 51, characterized in that the FSL locus or an allele thereof is as structurally defined in one or more of the preceding claims.

53. The method of any of claims 48 to 52, characterized in that the polynucleotide conferring dwarf stature is a variant of the gibberellic acid-insensitive gene (GAI1) or a fragment thereof as structurally defined in any of the preceding claims.

54. The method of any one of claims 49 to 53, characterized in that the polynucleotide conferring stenospermacarpy is a variant of the Vitis vinifera MADS-box protein 5 locus (VvMADS5) as structurally defined in any one of the preceding claims.

55. The method of any of claims 46 to 54, characterized in that the plant is a dioecious plant species. MA / a / ZUZI / UIOOUO 114 56. The method of any of claims 46 to 54, characterized in that the plant is a hermaphrodite plant species.

57. The method of any of claims 46 to 56, characterized in that the plant is a fruit-bearing plant.

58. The method of any of claims 46 to 57, characterized in that the plant is a Vitis sp.

59. Fruit of a plant of any of claims 1 to 30 or of a progeny thereof, preferably characterized in that the plant is a Vitis sp.

60. A method for producing seedless fruit, characterized in that the method comprises: (i) cultivating a plant of any of claims 1 to 30 to thereby produce fruit; and (ii) optionally harvesting the fruit produced in (i); and (iii) optionally processing the harvested fruit.

61. A product produced from a plant of any of claims 1 to 30 or produced from a fruit thereof.

62. The product of claim 61, characterized in that the product is a food product, a food ingredient, a beverage product or a beverage ingredient.

63. The product of claim 62, characterized in that: (i) the food product is selected from the group consisting of table grapes, jam, jelly, sultanas and raisins; (ii) the food ingredient is vincotto, vinegar or grape must syrup (mosto cotto); (iii) the beverage product is wine, grappa, brandy or grape juice; (iv) the beverage ingredient is wine grape or table grape.

64. A flower sex polypeptide (FSL) characterized in that it comprises an amino acid sequence selected from the sequences set forth in SEQ ID NOs: 1, 2 or 3 or a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to a sequence set forth in SEQ ID NOs: 1, 2 or 3.

65. An isolated nucleic acid molecule encoding a flower sex polypeptide (FSL), characterized in that it comprises (a) a polynucleotide sequence selected from the sequences set forth in SEQ ID NOs: 5-7 or a polynucleotide having an open reading frame (ORF) selected from the sequences set forth in SEQ ID NOs: 5-7 or (b) a polynucleotide sequence having at least 40% identity with one of the sequences set forth in SEQ ID NOs: 5-7 or a polynucleotide having an open reading frame (ORF) having at least 40% identity with one of the sequences set forth in SEQ ID NOs: 5-7; or (c) a polynucleotide sequence being complementary to any of the polynucleotide sequences of (a) or (b).

66. An expression vector characterized in that it comprises the isolated nucleic acid molecule of claim 65 operatively linked to a promoter.

67. A host cell characterized in that it comprises the nucleic acid molecule of claim 65 or an expression vector of claim 66.

68. The host cell of claim 67 characterized in that it is a yeast, bacterium or plant cell.