Targeting SF3b2 for axonal protection in central nervous system neurodegenerative diseases

Abstract

The present disclosures relates to RNAi-inducing constructs, antisense oligonucleotides, related compositions, related method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, and related method of treating a subject with multiple sclerosis.

Description

[0001]TARGETING SF3B2 FOR AXONAL PROTECTION IN CENTRAL NERVOUS SYSTEM NEURODEGENERATIVE DISEASES CROSS-REFERENCE TO RELATED APPLICATIONS This application claims benef10it of U.S. Provisional Patent Application No. 63 / 490,326 filed on March 15, 2023, which is incorporated herein by reference in its entirety. SEQUENCE LISTING The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. The XML copy, created on May 15, 2024, is named “JHU_41766_603_SequenceListing.xml” and is 73,549 bytes in size. TECHNICAL FIELD The present disclosures relates to RNAi-inducing constructs, antisense oligonucleotides, related compositions, related method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, and related method of treating a subject with multiple sclerosis BACKGROUND Multiple sclerosis (MS) is a chronic autoimmune inflammatory disease of the central nervous system (CNS) characterized by demyelination of axons and secondary neurodegeneration. It is a disabling neurological disease affecting primarily young female adults and causes numbness or weakness in limbs, optic neuritis, gait ataxia, pain and fatigue, or sphincter dysfunction1,2. Current therapies primarily focus on modulating the autoimmune response, and are quite effective in alleviating the inflammation, but a clinical need to develop neuroprotectant strategies to prevent irreversible neuro-axonal injury persists3,4. 1 41766.101_P17245-01 SUMMARY Certain aspects of the presently disclosed subject matter having been stated hereinabove, which are addressed in whole or in part by the presently disclosed subject matter, other aspects will become evident as the description proceeds when taken in connection with the accompanying Examples and Figures as best described herein below. In some aspects, the presently disclosed subject matter provides a method of reducing or preventing axonal degeneration in a subject, the method comprising administering to the subject an effective amount of an inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression, wherein the SF3B2 gene expression inhibitor is an antisense oligonucleotide (ASO) or an RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand, and wherein axonal degeneration of neurons is reduced or prevented. In certain aspects, the antisense oligonucleotide comprises SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense oligonucleotide consists of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In certain aspects, the antisense oligonucleotide consists essentially of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In certain aspects, the antisense oligonucleotide comprises, consists of, or consists essentially of SEQ ID. NO.68. In certain aspects, the antisense oligonucleotide has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO.74, or SEQ ID. NO.76. In some aspects, the antisense oligonucleotide targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the antisense oligonucleotide has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In certain aspects, the antisense oligonucleotide has at least one modified internucleoside linkage, sugar moiety, or nucleobase. In certain aspects, the RNAi-inducing construct is a short-hairpin RNA (shRNA) or siRNA. In certain aspects, the antisense strand of the RNAi-inducing construct comprises SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO. 76. In certain aspects, the antisense strand of the RNAi-inducing construct 2 41766.101_P17245-01 consists of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In certain aspects, the antisense strand of the RNAi-inducing construct consists essentially of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense strand of the RNAi-inducing construct comprises, consists of, or consists essentially of SEQ ID. NO. 68. In certain aspects, the antisense strand of the RNAi-inducing construct has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In some aspects, the RNAi inducing construct targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the antisense strand of the RNAi-inducing construct has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In certain aspects, the shRNA comprises an inverted repeat of a nucleotide sequence and a loop region. In certain aspects, the shRNA is in the form of a vector expressed shRNA. In certain aspects, the vector is an adenoviral vector or a retroviral vector. In certain aspects, the vector is a lentiviral vector. In certain aspects, the inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression is administered with a delivery agent. In certain aspects, the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant. In certain aspects of the method, adenosine triphosphate (ATP) loss, or nicotinamide adenine dinucleotide (NAD) depletion is reduced or prevented. In certain aspects of the method, the neurons are viable against neurotoxic inflammatory stress. In certain aspects of the method, neuron axonal integrity is preserved against neurotoxic inflammatory stress. In certain aspects, the neurons are retinal ganglion cells or cortical neurons. In certain aspects, the subject has multiple sclerosis. In some aspects, the presently disclosed subject matter provides an RNAi-inducing construct, the RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand, wherein the antisense strand comprises SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense strand consists of SEQ ID 3 41766.101_P17245-01 NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense strand consists essentially of SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In some aspects, the presently disclosed subject matter provides an RNAi inducing construct that targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the antisense strand of the RNAi-inducing construct has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In certain aspects, RNAi-inducing construct is a short-hairpin RNA (shRNA). In certain aspects, the shRNA comprises an inverted repeat of the nucleotide sequence and a loop region. In certain aspects, the loop region comprises between 3 and 24 nucleotides in length. In certain aspects, the shRNA is in the form of a vector expressed shRNA. In certain aspects, the vector expressed shRNA comprises an inverted repeat of the nucleotide sequence and a loop region. In certain aspects, the vector is an adenoviral vector. In certain aspects, the vector is a retroviral vector. In certain aspects, the retroviral vector is a lentiviral vector. In certain aspects, the lentiviral vector is packaged into an infectious particle. In some aspects, the presently disclosed subject matter provides a composition comprising an RNAi-inducing construct described herein and a delivery agent. In certain aspects, the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant. In certain aspects, the composition further comprises a pharmaceutically acceptable diluent, excipient, or carrier. In certain aspects, the composition further comprises a plurality of RNAi-inducing constructs whose presence within a cell results in production of a plurality of different siRNAs or shRNAs targeting at least a portion of SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the presently disclosed subject matter provides a method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method comprising administering a composition described here to a subject. In certain aspects, administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation. In certain aspects, introducing the composition into the subject suppresses expression of a nucleic acid sequence encoding SF3B2 in the subject and 4 41766.101_P17245-01 adenosine triphosphate (ATP) loss, nicotinamide adenine dinucleotide (NAD) depletion, or axonal degeneration is reduced or prevented. In some aspects, the presently disclosed subject matter provides a method of treating a subject with multiple sclerosis, the method comprising administering a composition described herein to a cell, tissue, or organ of a subject with multiple sclerosis. In certain aspects of the method, adenosine triphosphate (ATP) loss, nicotinamide adenine dinucleotide (NAD) depletion, or axonal degeneration is reduced or prevented. In some aspects, the presently disclosed subject matter provides an antisense oligonucleotide (ASO) comprising SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In some aspects, the presently disclosed subject matter provides an antisense oligonucleotide consisting of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In some aspects, the presently disclosed subject matter provides an antisense oligonucleotide consisting essentially of SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO.70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In some aspects, the presently disclosed subject matter provides an ASO that targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the ASO has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the presently disclosed subject matter provides a composition comprising the antisense oligonucleotide described herein, and a delivery agent. In certain aspects, the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant. In certain aspects, the composition further comprises a pharmaceutically acceptable diluent, excipient, or carrier. In some aspects, the presently disclosed subject matter provides a method of treating multiple sclerosis in a subject, the method comprising administering the composition described herein to a subject with multiple sclerosis. In certain aspects of the method, axonal degeneration in neurons is reduced or prevented. In certain aspects of the method, neurons are viable against neurotoxic inflammatory stress. In certain aspects of the method neuron 5 41766.101_P17245-01 axonal integrity is preserved against neurotoxic inflammatory stress. In certain aspects, the neurons are retinal ganglion cells or cortical neurons. In some aspects, the presently disclosed subject matter provides a method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method comprising administering the composition of any one of claims 36-38 to a subject with multiple sclerosis. In certain aspects of the method, axonal degeneration in neurons is reduced or prevented. In certain aspects of the method, neurons are viable against neurotoxic inflammatory stress. In certain aspects of the method, neuron axonal integrity is preserved against neurotoxic inflammatory stress. In certain aspects, the neurons are retinal ganglion cells or cortical neurons. BRIEF DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee. Having thus described the presently disclosed subject matter in general terms, reference will now be made to the accompanying drawings, which are not necessarily drawn to scale, and wherein: FIG.1-1A, FIG.1-1B, FIG.1-1C, FIG.1-1D, FIG.1-1E, and FIG.1-1F demonstrate that AAV-mediated knock down of SF3B2 prevents RGC death in EAE mice. (FIG. 1-1A) Timeline of AAV administration and EAE experiment. (FIG. 1-1B) Clinical scores of CFA control and EAE-induced mice (n ≥ 5). (FIG.1-1C) Representative images of whole-mount retinas immunostained with Brn3a. Scale bar = 500 μm. (FIG. 1-1D- FIG. 1-1F) Quantifications of densities of Brn3a+ RGCs in the central (FIG.1-1D), medial (FIG.1-1E), and peripheral regions (FIG.1-1F) of retina (total number of samples is 7 for CFA control and EAE uninj, 8 for EAE+AAV-GFP, 9 for EAE+AAV-Sf3b2 shRNA). All data shown as mean ± SEM of combined data from 3 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-2A, FIG. 1-2B, FIG. 1-2C, FIG.1-2D, FIG.1-2E, FIG. 1-2F, and FIG.1-2G demonstrate that SF3B2 downregulation by AAV-shRNA attenuates axonal degeneration and demyelination in EAE mice. (FIG.1-2A) Electron microscopy images of optic nerves. Scale 6 41766.101_P17245-01 bar = 2 μm.10,000X mag. (FIG.1-2B- FIG.1-2D) Quantifications of densities of myelinated axons (FIG.1-2B), degenerating axons (FIG.1-2C), and demyelinated axons (FIG.1-2D). For (FIG. 1-2D), demyelinated axons with a diameter larger than 1 μm were included (total number of samples is ≥ 6 for FIG.1-2B- FIG.1-2D). (FIG.1-2E) Quantification of mean g- ratio of axons. (FIG.1-2F) Quantification of mean axon diameter. (FIG.1-2G) Scatter plot of g-ratio as a function of axon diameter for all groups. Linear regression analysis indicated a significant difference in slope between EAE mice treated with AAV-Sf3b2 shRNA and the other two EAE-diseased groups (total number of samples is ≥5 for FIG.1-2E- FIG.1-2G and at least 160 axons per each condition were analyzed). All data shown as mean ± SEM combined data from 3 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-3A, FIG. 1-3B, FIG. 1-3C, FIG.1-3D, FIG.1-3E, FIG. 1-3F, and FIG.1-3G demonstrate that lentiviral delivery of Sf3b2 shRNA preserves axonal outgrowth and neuronal viability from MCM-induced toxicity. (FIG. 1-3A- FIG. 1-3C) Cortical neurons were challenged with MCM for 24 hrs at DIV9 following lentiviral transduction at DIV 6. (FIG.1- 3A) Representative tiled images of cortical neurons cultured onto microfluidic devices. Neuronal cell bodies plated in the bottom compartment projected their Tau+ axons toward the upper axonal sector which is connected via 450-µm long microgrooves. (FIG. 1-3B) Percentage of areas covered by Tau-1 positive axons (n = 3-5). (FIG. 1-3C) Percentage of axons reaching over 750 µm from the entry of microgrooves (n = 3-5). (FIG.1-3D) SF3B2 mRNA levels from cortical neurons transduced with lentivirus for 3 days (n = 4). (FIG.1-3E, FIG.1-3F) Cortical neurons were treated with MCM at DIV4 following siRNA transfection at DIV2. (FIG.1-3E) Cell viability (n = 3-4) and (FIG.1-3F) NAD+ concentrations of cortical neurons (n = 10-12). (FIG.1-3G) Western blot analysis in cortical neurons transfected with scrambled siRNA or Sf3b2 siRNA for 48 hrs (n = 4). Beta-actin was used as a loading control. All data shown as mean ± SEM of 3-5 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-4A, FIG. 1-4B, FIG. 1-4C, FIG.1-4D, FIG.1-4E, FIG. 1-4F, and FIG.1-4G demonstrate that overexpression of SF3B2 impairs neurite development and integrity. (FIG. 1-4A) Representative images of differentiated N2A cells treated with vehicle or transfected with 0.5 µg of GFP control or SF3B2-GFP plasmid (bar = 50 µm). (FIG.1-4B) Representative 7 41766.101_P17245-01 image and quantitation of SF3B2 overexpression. (FIG. 1-4C) Percentage of cells having neurites. (FIG.1-4D) Percentage of cells without neurites. (FIG.1-4E) Quantification of total branches per cell. (FIG.1-4F) Quantification of neurite length. (FIG.1-4G) Measurement of NAD+ concentration in differentiated N2A cells. All data shown as mean ± SEM with n=4-5 from each independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-5A and FIG.1-5B demonstrate that lentiviral-mediated knockdown of SF3B2 in cortical neurons reduces the transcription of regeneration-associated genes (RAG) after exposure to inflammatory insult. Cortical neurons were exposed to MCM for 24 hrs at DIV9 following lentiviral transduction at DIV6. mRNA expression levels of Sf3b2 (FIG.1-5A) and regeneration-associated genes (RAG) (FIG.1-5B). The combination of three reference genes, 18SR1, Hprt, Hmbs, was used as a loading control. All data shown as mean ± SEM with at least 5 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-6 demonstrates that expression of genes involved in apoptosis pathways are not significantly modulated by MCM or SF3B2 knockdown. Cortical neurons were exposed to MCM for 24 hrs following lentiviral transduction and mRNA expression levels of apoptosis- related genes were measured. The combination of three reference genes, 18SR1, Hprt, Hmbs, was used as a loading control. All data shown as mean ± SEM of 5 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-7A, FIG.1-7B, and FIG.1-7C demonstrate that apoptosis is neither the target modulated by SF3B2 knockdown induced neuroprotection nor the key mechanism mediating MCM-induced axonal injury. Differentiated N2A cells (FIG.1-7A- FIG.1-7C) were exposed to MCM for 24 hrs following siRNA transfection (FIG.1-7A) or the incubation with caspase inhibitors (FIG.1-7B, FIG.1-7C). (FIG.1-7A) Measurement of caspase-3 / 7 and -8 activity in differentiated N2A cells. (FIG. 1-7B, FIG. 1-7C) Measurement of NAD+ concentrations in differentiated N2A cells. A pan-caspase inhibitor z-VAD-FMK (50 µM), z-DEVD-FMK (25 µM) targeting Caspase-3,-6,-7,-8,-10, Wedelolactone (10 µM) inhibiting Caspase-11, z- WEHD-FMK (20 µM) suppressing Caspase-1,-8,-11, VX-765 (20 µM) inhibiting Caspase- 1,-4, z-YVAD-FMK (20 µM) targeting Caspase-1,-11, and z-VEID-FMK suppressing Caspase-6 were used as negative modulators for caspase activity. All data shown as mean ± SEM of 3-4 independent experiments *P<0.05, **P<0.01, ****p<0.0001; 8 41766.101_P17245-01 FIG. 1-8 demonstrates that lentiviral-mediated knockdown of SF3B2 suppresses the transcription of necroptosis genes in cortical neurons after MCM treatment. Cortical neurons were exposed to MCM for 24 hrs following lentiviral transduction and then mRNA expression levels of necroptosis-related genes were measured. The combination of three reference genes, 18SR1, Hprt, Hmbs, was used as a loading control. All data shown as mean ± SEM of 5 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-9A, FIG.1-9B, FIG.1-9C, FIG.1-9D, and FIG.1-9E demonstrate that whole mount retinal immunohistochemistry showing AAV transduction in RGCs and knockdown efficiency of AAV-Sf3b2 shRNA in vitro and in vivo. (FIG.1-9A) Representative images of whole-mount retinas transduced with AAV. (FIG. 1-9B) Confocal images of flat mounted retina showing GFP, anti-Brn3A, and a merged image. (FIG.1-9C, FIG.1-9D) Fluorescence intensity of SF3B2 in RGCs at 2 weeks (FIG. 1-9C) and 8 weeks (FIG. 1-9D) post virus administration into the vitreous body. Total fluorescence intensity in cells was divided by respective cellular volume by Imaris, and retinas infected with AAV-GFP were used as a control (n=6). (FIG.1-9E) Sf3b2 mRNA levels from N2A cells transduced with AAV for 5 days. The combination of three reference genes, 18SR1, Hprt, Hmbs, was used as a loading control (n=3). All data shown as mean ± SEM and n=total number of biological replicates. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.1-10A, FIG.1-10B, FIG.1-10C, and FIG.1-10D demonstrate validation of AAV safety in RGCs. (FIG.1-10A, FIG.1-10B) Quantification of RGC survival at 2 weeks (FIG. 1-10A) and 8 weeks (FIG.1-10B) post intravitreal delivery of AAV (n ≥ 5 for (FIG.1-10A), n ≥ 6 for (FIG.1-10B)). (FIG.1-10C, FIG.1-10D) Quantification of healthy myelinated axons at 2 weeks (FIG.1-10C) and 8 weeks (FIG.1-10D) post-intravitreal delivery of AAV (n ≥ 5 for (FIG.1-10C), n ≥ 6 for (FIG.1-10D)). All data shown as mean ± SEM and n = total number of biological replicates. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG. 1-11A, FIG. 1-11B, FIG. 1-11C, FIG. 1-11D, and FIG. 1-11E show SF3B2 primary antibody validation and knock down efficiency and specificity of siRNA. (FIG. 1- 11A, FIG. 1-11B) Western blot analysis (FIG. 1-11A) and quantification (FIG. 1-11B) of SF3B2 protein level in N2A cells after the transfection with siRNA for 48 hrs. (FIG.1-11C, FIG. 1-11D, FIG. 1-11E) Western blot analysis (FIG. 1-11C) and quantification of SF3B3 (FIG. 1-11D) and SF3B4 (FIG. 1-11E) after siRNA transfection. Beta-actin was used as a 9 41766.101_P17245-01 loading control. All data shown as mean ± SEM and n=3 biological replicates. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG. 1-12A, FIG. 1-12B, FIG. 1-12C, FIG. 1-12D, FIG. 1-12E, and FIG. 1-12F demonstrate neurotoxicity of LPS-stimulated microglial media (MCM) and neuroprotection against MCM toxicity in N2A cells via SF3B2 downregulation. (FIG. 1-12A- FIG. 1-12D) Western blot analysis (FIG.1-12A) and quantification of SF3B2 (FIG.1-12B), Capsse-3 (FIG. 1-12C), Cleaved-caspase-3 (FIG.1-12D) in cortical neurons challenged with MCM for 48 hrs (n=3). (E) N2A cells were treated with MCM following siRNA transfection. (FIG. 1-12E) Cell viability of N2A cells (n=5) and (FIG.1-12F) western blot analysis (n=3). Beta-actin was used as a loading control. All data shown as mean ± SEM and n=total number of biological replicates. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG. 1-13 demonstrates that necroptosis inhibitors do not prevent MCM-induced decline in NAD+ concentrations. Differentiated N2A cells were exposed to MCM for 24 hrs following the incubation with necroptosis or apoptosis inhibitors and their combinations, and then NAD+ concentrations in differentiated N2A cells were measured. z-DEVD-FMK (25 µM) targeting Caspase-3,-6,-7,-8,-10, and z-VAD-FMK (50 µM) which is a pan-caspase inhibitor, Necrostatin-1 (50 µM) suppressing RIPK1, and GSK’872 which is known to target RIPK3 were used as negative modulators for necroptosis pathway. All data shown as mean ± SEM and n=4 biological replicates. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.2-1 is a timeline of an EAE experiment; FIG.2-2 is a schematic diagram of AAV2-PHP.eb-GFP and AAV2-PHP.eb-SF3B2 shRNA; FIG.2-3A, FIG.2-3B, FIG.2-3C, FIG.2-3D, and FIG.2-3E demonstrate validation of AAV-SF3B2 shRNA in vitro and in vivo. (FIG.2-3A, FIG.2-3B) Fluorescence intensity of SF3B2 in RGCs at 2 weeks (FIG.2-3A) and 8 weeks (FIG.2-3B) post-virus administration into the vitreous body. Total fluorescence intensity in cells was divided by respective cellular volume by Imaris and retinas infected with AAV-GFP were used as a control (n=6). (FIG.2- 3C) SF3B2 mRNA levels from N2A cells transduced with AAV for 5 days (n=3). (FIG. 2- 3D, FIG. 2-3E) Quantification of RGC survival 2 weeks (FIG. 2-3D) and 8 weeks (FIG. 2- 3E) post intravitreal delivery of AAV (n≥5 for 2 weeks, n≥6 for 8 weeks). All data shown as mean± SEM with 2-3 independent experiments. *P<0.05, **P<0.01; 10 41766.101_P17245-01 FIG. 2-4A, FIG. 2-4B, FIG. 2-4C, and FIG. 2-4D show EAE progression and neuroprotective effect of AAV-SF3B2 shRNA on RGC survival in EAE. (FIG.2-4A) Clinical scores of CFA control and EAE-induced mice (n ≥ 5). (FIG.2-4B) EAE severity determined by the guideline from Hooke labs. (FIG.2-4C) Representative images of whole-mount retinas immunostained with Brn3a. Scale bar = 500 μm. (FIG.2-4D) Quantifications of densities of Brn3a+ RGCs in the central, medial, and peripheral regions of retina (n ≥ 7). All data shown as mean ± SEM with 3 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.2-5A, FIG.2-5B, FIG.2-5C, FIG.2-5D, FIG.2-5E, FIG.2-5F, and FIG.2-5G demonstrate prevention of axon degeneration and demyelination in the optic nerves by decreasing SF3B2 in RGCs. (FIG.2-5A) Electron microscopy images of optic nerves. Scale bar = 2 μm.10,000X mag. (FIG.2-5B, FIG.2-5C, FIG.2-5D) Quantifications of densities of myelinated axons (FIG. 2-5B), degenerating axons (FIG. 2-5C), and unmyelinated axons (FIG. 2-5D). For (FIG. 2-5D), unmyelinated axons with a diameter larger than 1 μm were included (n ≥ 6). (FIG. 2-5E) Quantification of mean g-ratio of axons. (FIG. 2-5F) Quantification of mean axon diameter. (FIG. 2-5G) Scatter plot of g-ratio as a function of axon diameter for all groups. Linear regression analysis indicated a significant difference in slope between EAE mice treated with AAV-SF3B2 shRNA and the other two EAE-diseased groups. All data shown as mean ± SEM with 3 independent experiments. *P<0.05, **P<0.01, ***P<0.001,****p<0.0001; FIG.2-6 is a schematic diagram of lentiviral scrambled shRNA and lentiviral SF3B2 shRNA; FIG. 2-7A, FIG.2-7B, FIG.2-7C, FIG.2-7D, and FIG. 2-7E shows SF3B2 primary antibody validation and knock down efficiency and specificity of siRNA. (FIG.2-7A, FIG.2- 7B) Western blot analysis (FIG.2-7A) and quantification (FIG.2-7B) of SF3B2 protein level in N2A cells after siRNA transfection for 48 hours. (FIG. 2-7C, FIG. 2-7D, FIG. 2-7E) Western blot analysis (FIG.2-7C) and quantification of SF3B3 (FIG.2-7D) and SF3B4 (FIG. 2-7E) after siRNA transfection. All data shown as mean ± SEM with 2-3 independent experiments. *P<0.05, **P<0.01, ***P<0.001; FIG.2-8A, FIG. 2-8B, FIG. 2-8C, FIG.2-8D, FIG.2-8E, FIG. 2-8F, and FIG.2-8G show neurotoxicity of LPS-stimulated microglial media (MCM) and neuroprotection against 11 41766.101_P17245-01 MCM toxicity via SF3B2 downregulation. (FIG. 2-8A-FIG. 2-8D) Western blot analysis (FIG. 2-8A) and quantification of SF3B2 (FIG. 2-8B), Capsse-3 (FIG. 2-8C), Cleaved- caspase-3 (FIG. 2-8D) in cortical neurons challenged with MCM for 48 hours. (FIG. 2-8E- FIG.2-8G) Cells were treated with MCM following siRNA transfection. Cell viability of N2A cells (FIG. 2-8E) and cortical neurons (FIG. 2-8F), and western blot analysis at respective siRNA concentration (6 nM for N2A cells, 25 nM for cortical neurons). (FIG. 2-8G) NAD concentrations in cortical neurons. All data shown as mean ± SEM with at 2-5 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG. 2-9A, FIG. 2-B, FIG. 2-9C, FIG. 2-9D demonstrate that lentiviral delivery of shRNA helped cortical neurons overcome the MCM-mediated inhibition for axon extension. (FIG. 2-9A) Representative tiled images of cortical neurons cultured onto microfluidic devices. Neuronal cell bodies plated in the bottom compartment projected their Tau+ axons toward the upper axonal sector which is connected via 450-µm long microgrooves. (FIG.2- 9B) Percentage of areas covered by Tau-1 positive axons. (FIG. 2-9C) Percentage of axons reaching over 750 µm from the entry of microgrooves. (FIG.2-9D) SF3B2 mRNA levels from cortical neurons transduced with lentivirus for 3 days. All data shown as mean ± SEM with at least 3 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; FIG.2-10A, FIG.2-10B, FIG.2-10C, FIG.2-10D, FIG.2-10E, FIG.2-10F, and FIG. 2-10G show inhibited neurite outgrowth by overexpressed SF3B2. (FIG. 2-10A) Representative images of N2A cells treated with vehicle or transfected with GFP control or SF3B2-GFP plasmid (bar = 50 µm). (FIG.2-10B) Percentage of cells having neurites. (FIG. 2-10C) Percentage of neurites without neurites. (FIG.2-10D) Quantification of total branches per cell. (FIG.2-10E) Quantification of neurite length. (FIG.2-10F) Transfection efficiency based on GFP expression. (FIG.2-10G) NAD concentrations in N2A cells. All data shown as mean ± SEM with 2 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001; and FIG.2-11A and FIG.2-11B show qRT-PCR analysis on 25 candidate genes. (FIG.2- 11A) Expression levels of apoptotic, necroptotic genes, and Sf3b2. (FIG.2-11B) Expression levels of regeneration-associated genes (RAG) and other genes. All data shown as mean ± SEM with at least 5 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001. 12 41766.101_P17245-01 BRIEF DESCRIPTION OF THE SEQUENCE LISTING SEQ ID NO: 1 represents a short hairpin nucleotide sequences targeting mouse SF3B2: 5'-CCGG-GCTCGTCACTTCCTGTTCTTA-CTCGAG- TAAGAACAGGAAGTGACGAGC-TTTTTG-3' SEQ ID NO: 2 represents a short hairpin nucleotide sequences targeting mouse SF3B2: 5'-CCGG-CTGATTGCCATGCAGCGATAT-CTCGAG- ATATCGCTGCATGGCAATCAG-TTTTTG-3' SEQ ID NO: 3 represents a scrambled shRNA sequence: 5’-CTAAGGTTAAGTCGCCCTCG-CTCGAG-CGAGGGCGACTTAACCTTAGG-3’ SEQ ID NO: 4 represents a scrambled shRNA sequence: 5’-CCTAAGGTTAAGTCGCCCTCG-CTCGAG-CGAGGGCGACTTAACCTTAGG-3’ SEQ ID NO: 5 represents a 18SR1 forward primer sequence: GCAATTATTCCCCATGAACG SEQ ID NO: 6 represents a 18SR1 reverse primer sequence: GGCCTCACTAAACCATCCAA SEQ ID NO: 7 represents a Hprt forward primer sequence: AGGGATTTGAATCACGTTTG SEQ ID NO: 8 represents a Hprt reverse primer sequence: TTTACTGGCAACATCAACAG SEQ ID NO: 9 represents a Hmbs forward primer sequence: TCTAAGATTGGAGAGAAGAGC SEQ ID NO: 10 represents a Hmbs reverse primer sequence: AAAGACAACAGCATCACAAG 13 41766.101_P17245-01 SEQ ID NO: 11 represents a Sf3b2 forward primer sequence: ATGAGAACAGAGAGATGGATG SEQ ID NO: 12 represents a Sf3b2 reverse primer sequence: TCAGCTGAAGAATCTTTTCC SEQ ID NO: 13 represents a Ripk1 forward primer sequence: TATGTAGAAGAGGATGTGGC SEQ ID NO: 14 represents a Ripk1 reverse primer sequence: TCCAGGTTGTTCTGAATTTTG SEQ ID NO: 15 represents a Ripk3 forward primer sequence: CGAACCAAAAACCAATGAAG SEQ ID NO: 16 represents a Ripk3 reverse primer sequence: CAGATAATGCTTTACCTCGG SEQ ID NO: 17 represents a Mlkl forward primer sequence: GTTCAACGATATATGTCTCCC SEQ ID NO: 18 represents a Mlkl reverse primer sequence: AGAATCACAGCCTTCAAATG SEQ ID NO: 19 represents a Tnf forward primer sequence: CTATGTCTCAGCCTCTTCTC SEQ ID NO: 20 represents a Tnf reverse primer sequence: CATTTGGGAACTTCTCATCC SEQ ID NO: 21 represents a Tnfrsf1a forward primer sequence: GGTTATCTTGCTAGGTCTTTG SEQ ID NO: 22 represents a Tnfrsf1a reverse primer sequence: GATCCCTACAAATGATGGAG SEQ ID NO: 23 represents a Casp8 forward primer sequence: 14 41766.101_P17245-01 CAAGAGAACAAGACAGTGAG SEQ ID NO: 24 represents a Casp8 reverse primer sequence: ACTCAGAGCCTCTTTATCAC SEQ ID NO: 25 represents a Fadd forward primer sequence: CAAGCTGAGTGTAACTGAAG SEQ ID NO: 26 represents a Fadd reverse primer sequence: TTAAAAGGCATCAGCAAGAG SEQ ID NO: 27 represents a Casp3 forward primer sequence: CATAAGAGCACTGGAATGTC SEQ ID NO: 28 represents a Casp3 reverse primer sequence: GCTCCTTTTGCTATGATCTTC SEQ ID NO: 29 represents a Casp9 forward primer sequence: TGATCGAGGATATTCAGCAG SEQ ID NO: 30 represents a Casp9 reverse primer sequence: CCTCTAAGCAGGAGATGAAG SEQ ID NO: 31 represents a Bid forward primer sequence: TAGAGCCAGATTCTGAAAGTC SEQ ID NO: 32 represents a Bid reverse primer sequence: CAGTTCCTTTTGTCTTCCTC SEQ ID NO: 33 represents a Bad forward primer sequence: CCTTCAAGGGACTTCCTC SEQ ID NO: 34 represents a Bad reverse primer sequence: TGTGGAGCAGAAGATCAC SEQ ID NO: 35 represents a Bax forward primer sequence: CCTTTTTGCTACAGGGTTTC 15 41766.101_P17245-01 SEQ ID NO: 36 represents a Bax reverse primer sequence: ATATTGCTGTCCAGTTCATC SEQ ID NO: 37 represents a Bcl-xl forward primer sequence: GCTTGGGATAATGAGACAAG SEQ ID NO: 38 represents a Bcl-xl reverse primer sequence: GAGAACATTCAGACCACAAG SEQ ID NO: 39 represents a Rel forward primer sequence: GTGGTCACTTTACTGAGAAAC SEQ ID NO: 40 represents a Rel reverse primer sequence: CGCATGAAGAATAGTAAGGTTC SEQ ID NO: 41 represents a Atf3 forward primer sequence: AAGACTGGAGCAAAATGATG SEQ ID NO: 42 represents a Atf3 reverse primer sequence: GTCAGGTTAGCAAAATCCTC SEQ ID NO: 43 represents a Gap43 forward primer sequence: GAACCAAACAGGTTGAAAAG SEQ ID NO: 44 represents a Gap43 reverse primer sequence: GGAAGCTAGCCTGAATTTTG SEQ ID NO: 45 represents a Stmn2 forward primer sequence: TTTTGAGCTGATCTTGAAGC SEQ ID NO: 46 represents a Stmn2 reverse primer sequence: AGCCTCTTGAGACTTTCTTC SEQ ID NO: 47 represents a Gadd45 forward primer sequence: AGATCCATTTCACCCTCATC SEQ ID NO: 48 represents a Gadd45 reverse primer sequence: 16 41766.101_P17245-01 ATTGTGATGAATGTGGGTTC SEQ ID NO: 49 represents a Sox11forward primer sequence: CACTCGGCTTTCTTATTCTC SEQ ID NO: 50 represents a Sox11 reverse primer sequence: CCACAAAGATACATATGCCC SEQ ID NO: 51 represents a Myc forward primer sequence: TTTTGTCTATTTGGGGACAG SEQ ID NO: 52 represents a Myc reverse primer sequence: CATAGTTCCTGTTGGTGAAG SEQ ID NO: 53 represents a TGF-β1 forward primer sequence: GGATACCAACTATTGCTTCAG SEQ ID NO: 54 represents a TGF-β1 reverse primer sequence: TGTCCAGGCTCCAAATATAG SEQ ID NO: 55 represents a TGF-βR1 forward primer sequence: CCTGAAGTTCTAGATGATTCC SEQ ID NO: 56 represents a TGF-βR1 reverse primer sequence: CTTCATGGATTCCACCAATAG SEQ ID NO: 57 represents a Capn1 forward primer sequence: AGCCTATGCTAAAGTGAATG SEQ ID NO: 58 represents a Capn1 reverse primer sequence: GCCTTTAGAATGATCTGGTAG SEQ ID NO: 59 represents a Capn2 forward primer sequence: GAAACTCACCAAGATGGATG SEQ ID NO: 60 represents a Capn2 reverse primer sequence: CCAGAAGGTATTTGGGTAATTC 17 41766.101_P17245-01 SEQ ID NO: 61 represents a Nmnat2 forward primer sequence: GGCAGATATGGAAGTGATTG SEQ ID NO: 62 represents a Nmnat2 reverse primer sequence: GGAGTATGGAGGAGTGATTC SEQ ID NO: 63 represents a Sarm1 forward primer sequence: CTTATCCAAAGCGTCATAGC SEQ ID NO: 64 represents a Sarm1 reverse primer sequence: CTTAAAGCAGTCACAATCTCC SEQ ID NO: 65 represents a short hairpin nucleotide sequences targeting human SF3B2 mRNA: 5'-CCGG-CCCTCACACTAGCCCTTTTTT-CTCGAG- AAAAAAGGGCTAGTGTGAGGG-TTTTTG-3' SEQ ID NO: 66 represents an antisense sequence 3’ to 5’ targeting human SF3B2 mRNA: GGGAGTGTGATCGGGAAAAAA SEQ ID NO: 67 represents a short hairpin nucleotide sequences targeting human SF3B2 mRNA: 5'-CCGG-CTGATTGCCATGCAGCGATAT-CTCGAG- ATATCGCTGCATGGCAATCAG-TTTTTG-3' SEQ ID NO: 68 represents an antisense sequence 3’ to 5’ targeting human SF3B2 mRNA: GACTAACGGTACGTCGCTATA SEQ ID NO: 69 represents a short hairpin nucleotide sequences targeting human SF3B2 mRNA: 5'-CCGG-CCCAAGAAGAAGGGATTTGAA-CTCGAG- TTCAAATCCCTTCTTCTTGGG-TTTTTG-3' 18 41766.101_P17245-01 SEQ ID NO: 70 represents an antisense sequence 3’ to 5’ targeting human SF3B2 mRNA: GGGTTCTTCTTCCCTAAACTT SEQ ID NO: 71 represents a short hairpin nucleotide sequences targeting human SF3B2 mRNA: 5'-CCGG- CCACAAGACATGGGCCAGATT-CTCGAG- AATCTGGCCCATGTCTTGTGG-TTTTTG-3' SEQ ID NO: 72 represents an antisense sequence 3’ to 5’ targeting human SF3B2 mRNA: GGTGTTCTGTACCCGGTCTAA SEQ ID NO: 73 represents a short hairpin nucleotide sequences targeting human SF3B2 mRNA: 5'-CCGG-CCATCGTATCCCAACCTGAAA-CTCGAG- TTTCAGGTTGGGATACGATGG-TTTTTG-3' SEQ ID NO: 74 represents an antisense sequence 3’ to 5’ targeting human SF3B2 mRNA: GGTAGCATAGGGTTGGACTTT SEQ ID NO: 75 represents a short hairpin nucleotide sequences targeting human SF3B2 mRNA: 5'-CCGG- GCTGATGTTGAGATTGAGTAT-CTCGAG- ATACTCAATCTCAACATCAGC-TTTTTG-3' SEQ ID NO: 76 represents an antisense sequence 3’ to 5’ targeting human SF3B2 mRNA: CGACTACAACTCTAACTCATA SEQ ID NO: 77 represents a human SF3B2 sequence: CTGATTGCCATGCAGCGATAT 19 41766.101_P17245-01 SEQ ID NO: 78 represents a human SF3B2 sequence: CCCTCACACTAGCCCTTTTTT SEQ ID NO: 79 represents a human SF3B2 sequence: CCCAAGAAGAAGGGATTTGAA SEQ ID NO: 80 represents a human SF3B2 sequence: CCACAAGACATGGGCCAGATT SEQ ID NO: 81 represents a human SF3B2 sequence: CCATCGTATCCCAACCTGAAA SEQ ID NO: 82 represents a human SF3B2 sequence: GCTGATGTTGAGATTGAGTAT DETAILED DESCRIPTION The presently disclosed subject matter now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the presently disclosed subject matter are shown. Like numbers refer to like elements throughout. The presently disclosed subject matter may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Indeed, many modifications and other embodiments of the presently disclosed subject matter set forth herein will come to mind to one skilled in the art to which the presently disclosed subject matter pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the presently disclosed subject matter is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood 20 41766.101_P17245-01 by one of ordinary skill in the art to which this presently described subject matter belongs. Following long-standing patent law convention, the terms “a,” “an,” and “the” refer to “one or more” when used in this application, including the claims. Thus, for example, reference to “a subject” includes a plurality of subjects, unless the context clearly is to the contrary (e.g., a plurality of subjects), and so forth. Throughout this specification and the claims, the terms “comprise,” “comprises,” and “comprising” are used in a non-exclusive sense, except where the context requires otherwise. Likewise, the term “include” and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items. As used herein, the term “consists of” or “consisting of” means that the preceding term includes only the elements, steps, or ingredients specifically recited in the particular claimed embodiment or claim. As used herein, the term “consisting essentially of” or “consists essentially of” means that the only active pharmaceutical ingredient in the composition or method that treats the specified condition is the specifically recited therapeutic in the particular embodiment or claim. As used herein, the terms “sequence identity” or, for example, comprising a “sequence 50% identical to,” refer to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods 21 41766.101_P17245-01 selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., Nucl. Acids Res.25:3389, 1997. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing amounts, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, quantities, characteristics, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about” even though the term “about” may not expressly appear with the value, amount or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are not and need not be exact, but may be approximate and / or larger or smaller as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art depending on the desired properties sought to be obtained by the presently disclosed subject matter. For example, the term “about,” when referring to a value can be meant to encompass variations of, in some embodiments ± 100%, in some embodiments ± 50%, in some embodiments ± 20%, in some embodiments ± 10%, in some embodiments ± 5%, in some embodiments ±1%, in some embodiments ± 0.5%, and in some embodiments ± 0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions. Further, the term “about” when used in connection with one or more numbers or numerical ranges, should be understood to refer to all such numbers, including all numbers in a range and modifies that range by extending the boundaries above and below the numerical values set forth. The recitation of numerical ranges by endpoints includes all numbers, e.g., whole integers, including fractions thereof, subsumed within that range (for example, the recitation of 1 to 5 includes 1, 2, 3, 4, and 5, as well as fractions thereof, e.g., 1.5, 2.25, 3.75, 4.1, and the like) and any range within that range. Splicing factor 3b subunit 2 (SF3B2) Neurodegeneration induced by inflammatory stress in multiple sclerosis (MS) leads to long-term neurological disabilities that are not amenable to current immunomodulatory therapies. These long-term neurological disabilities are due to secondary axonal degeneration. 22 41766.101_P17245-01 The presently disclosed subject matter demonstrates that neuronal downregulation of Splicing factor 3b subunit 2 (SF3B2), a component of U2 small nuclear ribonucleoprotein (snRNP), preserves retinal ganglion cell (RGC) survival and axonal integrity in experimental autoimmune encephalomyelitis (EAE)-induced mice. By employing an in vitro system recapitulating the inflammatory environment of MS lesion, we show that when SF3B2 levels are downregulated, cell viability and axon integrity are preserved in cortical neurons against inflammatory toxicity. Notably, knockdown of SF3B2 substantially suppresses the expression of injury-response and necroptosis genes. These findings suggest that downregulation of SF3B2 is a novel potential therapeutic target to prevent secondary neurodegeneration in MS. Accordingly, the presently disclosed subject matter identifies a molecular target to prevent long term disability in multiple sclerosis patients by preventing secondary axonal degeneration that occurs after inflammatory injury. More particularly, this Examples demonstrates that neurodegeneration induced by inflammatory stress in multiple sclerosis (MS) leads to long-term neurological disabilities that are not amenable to current immunomodulatory therapies. Antisense Oligonucleotides An antisense compound, which hybridizes to a target nucleic acid, modulates gene expression activities such as transcription, splicing or translation through one of a number of antisense mechanisms. The sequence specificity of antisense compounds makes them extremely attractive as tools for target validation and gene functionalization, as well as therapeutics to selectively modulate the expression of genes involved in disease. In some aspects, the presently disclosed subject matter provides an antisense oligonucleotide (ASO) comprising SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In some aspects, the presently disclosed subject matter provides an antisense oligonucleotide consisting of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In some aspects, the presently disclosed subject matter provides an antisense oligonucleotide consisting essentially of SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO.70, SEQ ID. NO. 72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense oligonucleotide has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 66, SEQ ID. NO.68, SEQ 23 41766.101_P17245-01 ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In some aspects, the antisense oligonucleotide targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the antisense oligonucleotide has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. Target human SF3B2 mRNA sequences (SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82) were generated using The Genetic Perturbation Platform (https: / / portals.broadinstitute.org / gpp / public / ; https: / / portals.broadinstitute.org / gpp / public / trans / details?transName=NM_006842.3 (incorporated herein by reference); Yang, X., Boehm, J., Yang, X. et al. A public genome- scale lentiviral expression library of human ORFs. Nat Methods 8, 659–661 (2011). https: / / doi.org / 10.1038 / nmeth.1638); and ASOs that SF3B2 mRNA sequences can be made by means available in the art (e.g. ordering the complementary, Watson-Crick-base-pairing ASO from a vendor, and optionally with certain design modifications known in the art – e.g. chemical modifications to resist nuclease degradation, modifications with internucleotide linkages, sugars, and bases; see https: / / www.sigmaaldrich.com / US / en / technical-documents / technical- article / genomics / gene-expression-and-silencing / antisense-oligonucleotides). The Examples herein demonstrate for the first time SF3B2 mRNA as a therapeutic target for reducing or preventing axonal degeneration in a subject. The Genetic Perturbation Platform is a dynamic portal such that the target human SF3B2 mRNA sequences are only generated with the specific gene query and at the time of the query. ASOs that target human SF3B2 mRNA sequences, as described herein, will be tested in human neuronal cells to validate the ASOs as a therapeutic molecule.The term “antisense oligonucleotide” refers to a single-stranded oligonucleotide comprising 8 to 50 monomeric units and having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid. An antisense oligonucleotide may comprise natural, non-natural, and / or modified nucleosides and / or internucleoside linkages; and may be a modified antisense oligonucleotide. Hybridization occurs by Watson-Crick base pairing to form an oligomer RNA heteroduplex within the target sequence. Antisense oligonucleotides can comprise structural modifications to resist nuclease 24 41766.101_P17245-01 degradation; such as: internucleotide linkages (i.e. Phosphorothioate (aka Thiophosphate or S-oligo) having the structure ; sugars (methyl RNA / 2'-OMe-RNA having the structure methyoxyethyl RNA / 2'-MOE-RNA having the structure , fluoro RNA / 2'-F-RNA having the . can comprise structural modifications to 7- deaza-dG, e.g. to block quartet formation or prevent immunostimulation; 7-deaza-dG having the structure: 25 41766.101_P17245-01 . The cyclic subunits may be based on ribose or another pentose sugar or, in ments, a morpholino group (see description of morpholino oligomers herein). Modified antisense oligonucleotides can comprise peptide nucleic acids (PNAs), locked nucleic acids (LNAs), tricyclo-DNA oligomers, tricyclo-phosphorothioate oligomers, and 2′- O-Methyl oligomers, among other antisense agents known in the art. Included are non- naturally-occurring oligomers, or “oligonucleotide analogs,” including oligomers having (i) a modified backbone structure, e.g., a backbone other than the standard phosphodiester linkage found in naturally-occurring oligo- and polynucleotides, and / or (ii) modified sugar moieties, e.g., morpholino moieties rather than ribose or deoxyribose moieties. Oligomer analogs support bases capable of hydrogen bonding by Watson-Crick base pairing to standard polynucleotide bases, where the analog backbone presents the bases in a manner to permit such hydrogen bonding in a sequence-specific fashion between the oligomer analog molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA). Preferred analogs are those having a substantially uncharged, phosphorus containing backbone. An antisense oligonucleotide can hybridize to the targe nucleic acid and can reduce the expression of gene products and the proteins encoded by them. For example, by virtue of their complementarity to certain target regions of splicing factor 3B subunit 2 (SF3B2) pre- mRNA or SF3B2 mRNA, the antisense oligonucleotides (ASOs) of the present disclosure can block or inhibit translation of the SF3B2 pre-mRNA or mRNA, and / or modify the processing of SF3B2 pre-mRNA or mRNA to produce a splice variant of the mRNA, and / or block or inhibit excision of introns from an SF3B2 pre-mMRNA into a mature mRNA. “Pre-mRNA” is also referred to as “mRNA precursor”, and indicates RNA which includes both exons and introns. “mRNA” indicates RNA in which introns are deleted and exons are bound together. The mRNA is translated into protein. 26 41766.101_P17245-01 In certain aspects, the antisense oligonucleotide comprise from about 12 to about 35 linked nucleotides. This embodies antisense oligonucleotides of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides in length. In at least certain exemplary (but non-limiting) embodiments, the ASOs of the present disclosure have approximately, for example, 12 to 28 bases, 10-30 bases, 15-25 bases, or 15-20 bases; and include a sequence that is complementary to a target sequence of a nucleic acid which comprises a portion of (1) a pre-mRNA transcribed from an SF3B2gene sequence, and / or (2) a mature mRNA processed from said pre-mRNA. When the ASO binds to the target region of a preprocessed mRNA, it effectively inhibits splicing at the normal splice acceptor site and thus produces a splice variant mRNA, leading to truncated or otherwise aberrant versions of the SF3B2 protein upon translation. When the ASO binds to the target region of a mature mRNA, it effectively inhibits proper translation of the mRNA into an SF3B2 protein. Where used herein, the term antisense oligonucleotide (ASO) may also refer to an antisense compound which includes a moiety linked to the antisense oligonucleotide, such as (but not limited to) a cell penetration enhancing moiety, such as (but not limited to) a cell penetrating peptide or ligand. As used herein, the terms “cell penetrating peptide” (CPP) or “a peptide moiety which enhances cellular uptake” are used interchangeably and refer to cationic cell penetrating peptides, also called “transport peptides”, “carrier peptides”, or “peptide transduction domains”. The peptides, as shown herein, have the capability of inducing cell penetration within about or at least about 30%, 40%, 50%, 60%, 70%, 80%.90%, or 100% of cells of a given cell culture population and allow macromolecular translocation within multiple tissues in vivo upon systemic administration. In some embodiments, the CPPs are of the formula — [(C(O)CHR′NH)m]R″ wherein R′ is a side chain of a naturally occurring amino acid or a one- or two-carbon homolog thereof, R″ is selected from hydrogen or acyl, and m is an integer up to 50. CPPs may also have the formula —[(C(O)CHR′NH)m]Ra wherein R′ is a side chain of a naturally occurring amino acid or a one- or two-carbon homolog thereof, and where Ra is selected from Hydrogen, acyl, benzoyl, or stearoyl. CPPs of any structure may be linked to the 3′ or 5′ end of an antisense oligomer via a “linker” such as, for example, — C(O)(CH2)5NH—, —C(O)(CH2)2NH—, —C(O)(CH2)2NH—C(O)(CH2)5NH—, or — C(O)CH2NH—. Additional CPPs are well-known in the art and are disclosed, for example, 27 41766.101_P17245-01 in U.S. Patent Publication No. 2010 / 0016215, which is incorporated by reference in its entirety. In other embodiments, m is an integer selected from 1 to 50 where, when m is 1, the moiety is a single amino acid or derivative thereof. As used herein, “nucleobase” (Nu), “base pairing moiety” or “base” are used interchangeably to refer to a purine or pyrimidine base found in native DNA or RNA (uracil, thymine, adenine, cytosine, and guanine), as well as analogs of the naturally occurring purines and pyrimidines, that confer improved properties, such as binding affinity to the oligomer. Exemplary analogs include hypoxanthine (the base component of the nucleoside inosine); 2, 6-diaminopurine; 5-methyl cytosine; C5-propynyl-modified pyrimidines; 9- (aminoethoxy)phenoxazine (G-clamp) and the like. Further examples of base pairing moieties include, but are not limited to, uracil, thymine, adenine, cytosine, guanine and hypoxanthine having their respective amino groups protected by acyl protecting groups, 2-fluorouracil, 2- fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs such as pseudoisocytosine and pseudouracil and other modified nucleobases such as 8-substituted purines, xanthine, or hypoxanthine (the latter two being the natural degradation products). The modified nucleobases disclosed in Chiu and Rana, R N A, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196 and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313, are also contemplated. Further examples of base pairing moieties include, but are not limited to, expanded-size nucleobases in which one or more benzene rings has been added. Nucleic base replacements described in the Glen Research catalog (www.glenresearch.com); Krueger A T et al, Acc. Chem. Res., 2007, 40, 141-150; Kool, ET, Acc. Chem. Res., 2002, 35, 936-943; Benner S. A., et al., Nat. Rev. Genet., 2005, 6, 553-543; Romesberg, F. E., et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627, are contemplated as useful for the synthesis of the oligomers described herein. A nucleobase covalently linked to a ribose, sugar analog or morpholino comprises a nucleoside. “Nucleotides” are composed of a nucleoside together with one phosphate group. The phosphate groups covalently link adjacent nucleotides to one another to form an oligomer. In some aspects, the presently disclosed subject matter provides a composition comprising the antisense oligonucleotide described herein, and a delivery agent. In certain aspects, the delivery agent is selected from the group consisting of a liposome, a cationic or 28 41766.101_P17245-01 non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant. In certain aspects, the composition further comprises a pharmaceutically acceptable diluent, excipient, or carrier. Acceptable diluent, excipient, or carrier are well known to those skilled in the art. A pharmaceutically acceptable diluent can be, for example, phosphate-buffered saline. A pharmaceutically acceptable carrier or excipient can be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal and are known in the art. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Selection of a dilutent or carrier is based on a number of factors, including, but not limited to, the solubility of the compound and the route of administration. Such considerations are well understood by those skilled in the art. The compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including but not limited to ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer (intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Sites of administration are known to those skilled in the art. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be useful for oral administration. In some aspects, the presently disclosed subject matter provides a method of treating multiple sclerosis in a subject, the method comprising administering the composition described herein to a subject with multiple sclerosis. In certain aspects of the method, axonal degeneration in neurons is reduced or prevented. In certain aspects of the method, neurons are viable against neurotoxic inflammatory stress. In certain aspects of the method neuron axonal integrity is preserved against neurotoxic inflammatory stress. In certain aspects, the neurons are retinal ganglion cells or cortical neurons. In some aspects, the presently disclosed subject matter provides a method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method 29 41766.101_P17245-01 comprising administering the composition of any one of claims 36-38 to a subject with multiple sclerosis. In certain aspects of the method, axonal degeneration in neurons is reduced or prevented. In certain aspects of the method, neurons are viable against neurotoxic inflammatory stress. In certain aspects of the method, neuron axonal integrity is preserved against neurotoxic inflammatory stress. In certain aspects, the neurons are retinal ganglion cells or cortical neurons. In certain aspects, administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation. RNAi-inducing constructs Gene suppression by RNA-induced gene silencing provides several levels of control: transcription inactivation, RNAi-induced mRNA degradation, and RNAi-induced transcriptional attenuation. In some instances, RNA interference (RNAi) provides long lasting effect over multiple cell divisions. As such, RNAi represents a viable method useful for drug target validation, gene function analysis, pathway analysis, and disease therapeutics. RNAi can be induced by double-stranded RNA that is processed by the RNase III-like enzyme Dicer into small interfering RNAs (siRNAs) of about 21 bp. The siRNA is incorporated into a RNA-induced silencing complex (RISC) in the cytoplasm and directs RISC to degrade an mRNA that is perfectly complementary to one strand of the siRNA. Accordingly, the term “RNAi-inducing construct” as used herein refers to RNA molecules and vectors whose presence within a cell triggers RNA interference and leads to reduced expression of a transcript to which the RNAi-inducing construct is targeted. The term specifically includes short interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), and RNAi-inducing vectors. Generally, shRNAs comprise sense and antisense sequences which form the “stems” of the hairpin and a loop region of unpaired nucleotides that connects the two stems. As used herein, the term “RNAi-inducing vector” encompasses a vector whose presence within a cell results in transcription of one or more RNAs that self-hybridize or hybridize to each other to form an shRNA or siRNA. Generally, RNAi-inducing vectors comprise a nucleic acid operably linked to a promoter such that the vector produces one or more RNA molecules that hybridize or self-hybridize to form an siRNA or shRNA when the vector is present within a cell. When transcription of the nucleic acid operably linked to a 30 41766.101_P17245-01 promoter produces a siRNA or shRNA that triggers RNA interference and leads to reduced expression of a target gene of interest, the RNAi-inducing vector is considered to be targeted to transcripts of the target gene. In some aspects, the presently disclosed subject matter provides an RNAi-inducing construct, the RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand, wherein the antisense strand comprises SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense strand consists of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense strand consists essentially of SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In some aspects, the presently disclosed subject matter provides an RNAi inducing construct that targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the antisense strand of the RNAi-inducing construct has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. Target human SF3B2 mRNA sequences (SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82) were generated using The Genetic Perturbation Platform (https: / / portals.broadinstitute.org / gpp / public / ; https: / / portals.broadinstitute.org / gpp / public / trans / details?transName=NM_006842.3 (incorporated herein by reference); Yang, X., Boehm, J., Yang, X. et al. A public genome- scale lentiviral expression library of human ORFs. Nat Methods 8, 659–661 (2011). https: / / doi.org / 10.1038 / nmeth.1638); and siRNA and these human SF3B2 mRNA sequences can be made by means available in the art (e.g. ordering the complementary, Watson-Crick-base-pairing siRNA and shRNA from a vendor - https: / / cellecta.com / products / custom-shrna-constructs, https: / / www.sigmaaldrich.com / US / en / technical-documents / technical-article / genomics / gene- expression-and-silencing / mission-shrna-getting-started). The Examples herein demonstrate for the first time SF3B2 mRNA as a therapeutic target for reducing or preventing axonal degeneration in a subject. The Genetic Perturbation Platform is a dynamic portal such that the target human SF3B2 mRNA sequences are only generated with the specific gene query 31 41766.101_P17245-01 and at the time of the query. siRNA and shRNA that target human SF3B2 mRNA sequences, as described herein, will be tested in human neuronal cells to validate the RNAi-inducing constructs as a therapeutic molecule. In certain aspects, the RNAi-inducing construct is a small interfering RNA (siRNA). The term “siRNA” refers to a double-stranded oligonucleotide comprising a first strand comprising 10 to 30 monomeric units and a second strand comprising 10 to 30 monomeric units that is complementary to the first strand, wherein the first strand or second strand has a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid. In certain aspects, the antisense strand may be about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases in length. The first strand and second strand may have 0, 1, 2, or 3 mismatches with respect to one another. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. In one nonlimiting example, the first strand of the siRNA is antisense to the target nucleic acid, while the second strand is complementary to the first strand. Once the antisense strand is designed to target a particular nucleic acid target, the sense strand of the siRNA can then be designed and synthesized as the complement of the antisense strand and either strand may contain modifications or additions to either terminus. For example, in one embodiment, both strands of the siRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini. It is possible for one end of a duplex to be blunt and the other to have overhanging nucleobases. In one embodiment, the number of overhanging nucleobases is from 1 to 6 on the 3′ end of each strand of the duplex. In another embodiment, the number of overhanging nucleobases is from 1 to 6 on the 3′ end of only one strand of the duplex. In a further embodiment, the number of overhanging nucleobases is from 1 to 6 on one or both 5′ ends of the duplexed strands. In another embodiment, the number of overhanging nucleobases is zero. In certain aspects, double-stranded antisense compounds are canonical siRNAs. As used herein, the term “canonical siRNA” is defined as a double-stranded oligomeric compound having a first strand and a second strand each strand being 21 nucleobases in length with the strands being complementary over 19 nucleobases and having on each 3′ termini of each strand a deoxy thymidine dimer (dTdT) which in the double-stranded compound acts as a 3′ overhang. 32 41766.101_P17245-01 Each strand of the siRNA duplex may be from about 12 to about 35 nucleobases. In a preferred embodiment, each strand of the siRNA duplex is about 17 to about 25 nucleobases. The central complementary portion may be from about 12 to about 35 nucleobases in length. In a preferred embodiment, the central complimentary portion is about 17 to about 25 nucleobases in length. It is understood that each the strand of the siRNA duplex and the central complementary portion may be about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases in length. The terminal portions can be from 1 to 6 nucleobases. It is understood that the terminal portions can be about 1, 2, 3, 4, 5, or 6 nucleobases in length. The siRNAs may also have no terminal portions. The two strands of an siRNA can be linked internally leaving free 3′ or 5′ termini, or can be linked to form a continuous hairpin structure or loop. The hairpin structure may contain an overhang on either the 5′ or 3′ terminus producing an extension of single-stranded character. In certain aspects, the double-stranded antisense compounds are blunt-ended siRNAs. As used herein the term “blunt-ended siRNA” is defined as an siRNA having no terminal overhangs. That is, at least one end of the double-stranded compound is blunt. siRNAs, whether canonical or blunt, act to elicit dsRNAse enzymes and trigger the recruitment or activation of the RNAi antisense mechanism. In a further embodiment, single-stranded RNAi (ssRNAi) compounds that act via the RNAi antisense mechanism are contemplated. Further modifications can be made to the double-stranded compounds and may include conjugate groups attached to one of the termini, selected nucleobase positions, sugar positions or to one of the internucleoside linkages. Alternatively, the two strands can be linked via a non-nucleic acid moiety or linker group. When formed from only one strand, the compounds can take the form of a self-complementary hairpin-type molecule that doubles back on itself to form a duplex. Thus, the compounds can be fully or partially double-stranded. When formed from two strands, or a single strand that takes the form of a self-complementary hairpin-type molecule doubled back on itself to form a duplex, the two strands (or duplex-forming regions of a single strand) are complementary when they base pair in Watson-Crick fashion. In certain aspects, the RNAi-inducing construct is a short-hairpin RNA (shRNA). In certain aspects, the shRNA comprises an inverted repeat of the nucleotide sequence and a loop region. In certain aspects, the loop region comprises between 3 and 24 nucleotides in length. In certain aspects, the shRNA is in the form of a vector expressed shRNA. In certain aspects, 33 41766.101_P17245-01 the vector expressed shRNA comprises an inverted repeat of the nucleotide sequence and a loop region. In certain aspects, the vector is an adenoviral vector. In certain aspects, the vector is a retroviral vector. In certain aspects, the retroviral vector is a lentiviral vector. In certain aspects, the lentiviral vector is packaged into an infectious particle. In some aspects, the presently disclosed subject matter provides a composition comprising an RNAi-inducing construct described herein and a delivery agent. In certain aspects, the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant. In certain aspects, the composition further comprises a pharmaceutically acceptable diluent, excipient, or carrier. Acceptable diluent, excipient, or carrier are well known to those skilled in the art. A pharmaceutically acceptable diluent can be, for example, phosphate-buffered saline. A pharmaceutically acceptable carrier or excipient can be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal and are known in the art. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Selection of a dilutent or carrier is based on a number of factors, including, but not limited to, the solubility of the compound and the route of administration. Such considerations are well understood by those skilled in the art. In certain aspects, the composition further comprises a plurality of RNAi-inducing constructs whose presence within a cell results in production of a plurality of different siRNAs or shRNAs targeting at least a portion of SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. The compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including but not limited to ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer (intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Sites of administration are known to those skilled in the art. 34 41766.101_P17245-01 In some aspects, the presently disclosed subject matter provides a method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method comprising administering a composition described here to a subject. In certain aspects, administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation. In certain aspects, introducing the composition into the subject suppresses expression of a nucleic acid sequence encoding SF3B2 in the subject and adenosine triphosphate (ATP) loss, nicotinamide adenine dinucleotide (NAD) depletion, or axonal degeneration is reduced or prevented. In certain aspects, administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation. In some aspects, the presently disclosed subject matter provides a method of treating a subject with multiple sclerosis, the method comprising administering a composition described herein to a cell, tissue, or organ of a subject with multiple sclerosis. In certain aspects of the method, adenosine triphosphate (ATP) loss, nicotinamide adenine dinucleotide (NAD) depletion, or axonal degeneration is reduced or prevented. In certain aspects, administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation. In some cases, RNAi-inducing constructs are siRNAs or shRNAs. For example, an RNAi-inducing construct can be a siRNA or shRNA designed to specifically target SF3B2 transcripts. Short hairpin RNAs useful for RNAi-inducing constructs of the present invention can comprise stems of 19-29 contiguous nucleotides, and preferably 19-23 contiguous nucleotides, derived from a target sequence. To specifically target SF3B2 transcripts, sequence for a siRNA or shRNA provided herein can be obtained from the SF3B2 open reading frame or the SF3B25′ or 3′ untranslated region (UTR). It will be appreciated that RNAi-inducing constructs can comprise a 19-29 nucleotide stem region comprising a target sequence and a loop region. Evidence suggests that the loop region sequence does not confer specificity to the shRNA but does affect processing and efficacy of shRNAs (Jensen et al., PLoS One 7:e43095, 2012). The loop region is preferably between 3 and 23 nucleotides in length. There is evidence that, at least in the context of a 9- nucleotide loop region, shRNA efficacy does not increase as stem length increases (Li et al., RNA 13:1765-74, 2007). In some cases, the loop sequence can comprise one or more restriction endonuclease sites to facilitate, for example, cloning of an RNAi-inducing 35 41766.101_P17245-01 construct into an expression vector. See, for review, Invitrogen, “Using siRNA for gene silencing is a rapidly evolving tool in molecular biology: siRNA Design Guidelines,” available at Invitrogen.com / site / us / en / home / References / Ambion-Tech-Support / rnai- sirna / general-articles / -sirna-design-guidelines.html on the World Wide Web. Therapeutic Methods In some aspects, the presently disclosed subject matter provides a method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method comprising administering to the subject an effective amount of an inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression, wherein the SF3B2 gene expression inhibitor is an antisense oligonucleotide (ASO) or an RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand, and wherein expression of the nucleic acid sequence encoding SF3B2 is suppressed in the subject. In some aspects, the presently disclosed subject matter provides a method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method comprising administering a composition described here to a subject. In certain aspects, administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation. In certain aspects, introducing the composition into the subject suppresses expression of a nucleic acid sequence encoding SF3B2 in the subject and adenosine triphosphate (ATP) loss, nicotinamide adenine dinucleotide (NAD) depletion, or axonal degeneration is reduced or prevented. In certain aspects, the ASO or the RNAi- inducing construct inhibit the expression of SF3B2 causing a reduction of RNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%. The reduction of the expression of SF3B2 can be measured in a bodily fluid, tissue or organ of the animal. Methods of obtaining samples for analysis, such as body fluids or tissues, and methods of preparation of the samples to allow for analysis are well known to those skilled in the art. Methods for analysis of RNA and protein levels are well known to those skilled in the art. The effects of treatment can be assessed by measuring biomarkers associated with the target gene expression 36 41766.101_P17245-01 in fluids, tissues or organs, collected from an animal contacted with one or more compounds of the invention, by routine clinical methods known in the art. In some aspects, the presently disclosed subject matter provides a method of reducing or preventing axonal degeneration in a subject, the method comprising administering to the subject an effective amount of an inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression, wherein the SF3B2 gene expression inhibitor is an antisense oligonucleotide (ASO) or an RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand, and wherein axonal degeneration of neurons is reduced or prevented. In some aspects, the presently disclosed subject matter provides a method of reducing or preventing axonal degeneration in a subject, the method comprising administering a composition described here to a subject. In certain aspects, administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation. In some aspects, the presently disclosed subject matter provides a method of treating a subject with multiple sclerosis in a subject, the method comprising administering to the subject an effective amount of an inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression, wherein the SF3B2 gene expression inhibitor is an antisense oligonucleotide (ASO) or an RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand, and wherein axonal degeneration of neurons is reduced or prevented. In some aspects, the presently disclosed subject matter provides a method of treating a subject with multiple sclerosis, the method comprising administering a composition described herein to a cell, tissue, or organ of a subject with multiple sclerosis. In certain aspects of the method, adenosine triphosphate (ATP) loss, or nicotinamide adenine dinucleotide (NAD) depletion is reduced or prevented. In certain aspects, the antisense oligonucleotide comprises SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense oligonucleotide consists of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In certain aspects, the antisense oligonucleotide consists essentially of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In certain aspects, the antisense oligonucleotide comprises, consists of, or consists essentially of SEQ ID. NO.68. 37 41766.101_P17245-01 In certain aspects, the antisense oligonucleotide has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO. 70, SEQ ID. NO. 72, SEQ ID. NO.74, or SEQ ID. NO.76. In some aspects, the antisense oligonucleotide targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the antisense oligonucleotide has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In certain aspects, the antisense strand of the RNAi- inducing construct comprises SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76. In certain aspects, the antisense strand of the RNAi- inducing construct consists of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO. 76. In certain aspects, the antisense strand of the RNAi- inducing construct consists essentially of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In certain aspects, the antisense strand of the RNAi- inducing construct comprises, consists of, or consists essentially of SEQ ID. NO. 68. In certain aspects, the antisense strand of the RNAi-inducing construct has at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO. 72, SEQ ID. NO. 74, or SEQ ID. NO. 76. In some aspects, the RNAi inducing construct targets SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In some aspects, the antisense strand of the RNAi-inducing construct has at least 90%, 95%, or 100% complementarity to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82. In certain aspects, the inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression is administered with a delivery agent. In certain aspects, the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant. In certain aspects, the inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression is administered by parenteral injection (e.g. intravenous infusion or subcutaneous injection); intrathecal (IT) or intracerebroventricular (ICV) administration (e.g. to the cerebrospinal fluid and e.g. by surgically implanted pumps); or intraparenchymal administration (e.g. surgical placement of a catheter). In certain aspects, the composition may comprise a pharmaceutically acceptable diluent (e.g. phosphate-buffered 38 41766.101_P17245-01 saline). In some embodiments, a therapeutically effective amount of the ASO or the RNAi- inducing construct is 7, 8, 9, 10, 11, 12, or 13 mg. An therapeutically effective amount can be determined by monitoring the modulatory effect of the antisense compound or compounds or compositions on target nucleic acids or their products by methods routine to the skilled artisan. Further contemplated are ex vivo methods of treatment whereby cells or tissues are isolated from a subject, contacted with an effective amount of the antisense compound or compounds or compositions and reintroduced into the subject by routine methods known to those skilled in the art. In certain aspects of the methods described herein, adenosine triphosphate (ATP) loss, or nicotinamide adenine dinucleotide (NAD) depletion is reduced or prevented. In certain aspects of the methods described herein, the neurons are viable against neurotoxic inflammatory stress. In certain aspects of the methods described herein, neuron axonal integrity is preserved against neurotoxic inflammatory stress. In certain aspects, the neurons are retinal ganglion cells or cortical neurons. In certain aspects, the subject has multiple sclerosis. In certain aspects, RNAi-inducing construct is a short-hairpin RNA (shRNA). In certain aspects, the shRNA comprises an inverted repeat of the nucleotide sequence and a loop region. In certain aspects, the loop region comprises between 3 and 24 nucleotides in length. In certain aspects, the shRNA is in the form of a vector expressed shRNA. In certain aspects, the vector expressed shRNA comprises an inverted repeat of the nucleotide sequence and a loop region. In certain aspects, the vector is an adenoviral vector. In certain aspects, the vector is a retroviral vector. In certain aspects, the retroviral vector is a lentiviral vector. In certain aspects, the lentiviral vector is packaged into an infectious particle. In other embodiments, the method is in combination with one or more methods for treating MS. Current treatments for MS include, but are not limited to, interferon beta medications, glatiramer acetate (Copaxone, Glatopa), monoclonal antibodies, including, but not limited to, Ofatumumab (Kesimpta, Arzerra), oral treatments, including, but not limited to, Teriflunomide (Aubagio), Dimethyl fumarate (Tecfidera), Diroximel fumarate (Vumerity), Monomethyl fumarate (Bafiertam), Fingolimod (Gilenya), Siponimod (Mayzent), Ozanimod (Zeposia), Ponesimod (Ponvory), and Cladribine (Mavenclad), and infusion treatments, 39 41766.101_P17245-01 including, but not limited to, Natalizumab (Tysabri), Ocrelizumab (Ocrevus), and Alemtuzumab (Campath, Lemtrada). The term “combination” is used in its broadest sense and means that a subject is administered at least two agents, more particularly a composition described herein and at least one other therapeutic agent, such as a chemotherapeutic agent. More particularly, the term “in combination” refers to the concomitant administration of two (or more) active agents for the treatment of a, e.g., single disease state. As used herein, the active agents may be combined and administered in a single dosage form, may be administered as separate dosage forms at the same time, or may be administered as separate dosage forms that are administered alternately or sequentially on the same or separate days. In one embodiment of the presently disclosed subject matter, the active agents are combined and administered in a single dosage form. In another embodiment, the active agents are administered in separate dosage forms (e.g., wherein it is desirable to vary the amount of one but not the other). The single dosage form may include additional active agents for the treatment of the disease state. Further, the compositions described herein can be administered alone or in combination with adjuvants that enhance stability of the compositions alone or in combination with one or more therapeutic agents, facilitate administration of pharmaceutical compositions containing them in certain embodiments, provide increased dissolution or n dispersion, increase inhibitory activity, provide adjunct therapy, and the like, including other active ingredients. Advantageously, such combination therapies utilize lower dosages of the conventional therapeutics, thus avoiding possible toxicity and adverse side effects incurred when those agents are used as monotherapies. The timing of administration of a composition described herein and at least one additional therapeutic agent can be varied so long as the beneficial effects of the combination of these agents are achieved. Accordingly, the phrase “in combination with” refers to the administration of a composition described herein and at least one additional therapeutic agent either simultaneously, sequentially, or a combination thereof. Therefore, a subject administered a combination of a composition described herein and at least one additional therapeutic agent can receive a composition and at least one additional therapeutic agent at the same time (i.e., simultaneously) or at different times (i.e., sequentially, in either order, on 40 41766.101_P17245-01 the same day or on different days), so long as the effect of the combination of both agents is achieved in the subject. EXAMPLES The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compounds of the disclosure by other methods. EXAMPLE 1 Downregulation of SF3B2 Protects CNS Neurons in Models of Multiple Sclerosis 1.1 Overview This Example demonstrates that neuronal downregulation of Splicing factor 3b subunit 2 (SF3B2), a component of U2 small nuclear ribonucleoprotein (snRNP), preserves retinal ganglion cell (RGC) survival and axonal integrity in experimental autoimmune encephalomyelitis (EAE)-induced mice. By employing an in vitro system recapitulating the inflammatory environment of MS lesion, we show that when SF3B2 levels are downregulated, cell viability and axon integrity are preserved in cortical neurons against inflammatory toxicity. Notably, knockdown of SF3B2 suppresses the expression of injury-response and necroptosis genes and prevents activation of Sterile Alpha and TIR Motif Containing 1 (Sarm1), a key enzyme that mediates programmed axon degeneration. Together, these findings suggest that downregulation of SF3B2 is a novel potential therapeutic target to prevent secondary neurodegeneration in MS. 1.2 Background Splicing Factor 3B Subunit 2 (SF3B2) is part of the SF3B complex, which is an essential component of the spliceosome and is required for accurately recognizing the branch point of pre-messenger RNAs during splicing process5,6. Previously, we have shown that 41 41766.101_P17245-01 SF3B2 may have an additional neuroprotective function in the peripheral nervous system7, aside from its canonical role as a splicing factor5,6. Reducing SF3B2 protein by RNAi in rat sensory neurons was sufficient to prevent cisplatin-induced neurotoxicity in vitro7. The effect of SF3B2 knockdown in CNS neurons and its underlying mechanism, however, have yet to be studied yet. 1.3 Scope This Example demonstrates that reducing SF3B2 expression by multiple gene silencing techniques makes cortical neurons resistant to subsequent degeneration triggered by neurotoxic inflammatory stress. Specifically, AAV-mediated knockdown of SF3B2 substantially prevents RGC loss, and demyelination and axon degeneration in optic nerves of EAE mice compared to the EAE group treated with control AAV. We further confirmed the neuroprotective effect of lowering SF3B2 levels in cortical neurons cultured in a microfluidic platform mimicking inflammatory active lesions of MS and found that RNAi-mediated knockdown of SF3B2 preserved axonal integrity when challenged with neurotoxic microglia media conditioned by lipopolysaccharide (LPS). This observation was associated with suppression of mRNA levels of regeneration-associated genes and necroptosis genes, and prevention of activation of Sarm1, a key enzyme mediating programmed axon degeneration. These findings suggest that targeting SF3B2 could serve as an effective therapeutic strategy to prevent neurodegeneration in inflammatory CNS diseases. 1.4 Materials and methods 1.4.1 Mice C57BL / 6J female mice at the age of 7 weeks were purchased from Jackson Laboratory. Before the intravitreal injection and EAE induction procedure, mice were anesthetized by i.p. injection of ketamine (120 mg / kg) and xylazine (8 mg / kg). All animal experiments were conducted following the protocols approved by Institutional Animal Care and Use Committee at Johns Hopkins University School of Medicine. 1.4.2 EAE induction and clinical scoring 2 weeks post AAV vector delivery, EAE was induced in C57BL / 6J female mice as previously described8. Emulsion containing 150 μg of MOG33-55 (AnaSpec) in complete Freund’s adjuvant (CFA) (MilliporeSigma) with 600 μg of Mycobacterium tuberculosis (BD) was subcutaneously injected into both sides of the lateral abdomen.375 ng of pertussis toxin 42 41766.101_P17245-01 (List Biologicals) was injected intraperitoneally on days 0 and 2. For healthy controls, the same emulsion without MOG33-55 peptide was used. EAE clinical symptoms were monitored on a daily basis following Hooke lab’s Mouse EAE scoring guidelines. 1.4.3 Design and production of AAV vectors expressing shRNAs Two shRNA sequences targeting SF3B2 were selected using the TRC shRNA design process offered by Broad Institute (portals.broadinstitute.org / gpp / public / resources / rules). H1 promoter and two shRNAs were synthesized and cloned into HindIII and BamHI sites of pAAV-U6-CMV-GFP vector provided by the Boston Children’s Hospital Viral Core. shRNA synthesis and subcloning were done by GenScript, and all plasmids were packaged into AAVs by the same Viral Core. The AAV titers used for this study were in the range of 1.48-8.02 × 1012genome copy (GC) / mL. (Two targeting sequences against SF3B2: 5'-CCGG- GCTCGTCACTTCCTGTTCTTA-CTCGAG-TAAGAACAGGAAGTGACGAGC- TTTTTG-3' (SEQ ID NO: 1), and 5'-CCGG-CTGATTGCCATGCAGCGATAT-CTCGAG- ATATCGCTGCATGGCAATCAG-TTTTTG-3’ (SEQ ID NO: 2), scrambled shRNA sequence: 5’-CTAAGGTTAAGTCGCCCTCG-CTCGAG- CGAGGGCGACTTAACCTTAGG-3’ (SEQ ID NO: 3),) 1.4.4 Intravitreal injection of AAV vectors At 8-9 weeks of age, 1.2 μL of AAV with a titer of 1.5ⅹ1012gc / mL in PBS was delivered into the mouse vitreous. After anesthetizing mice with Ketamine / Xylazine, a small hole was made approximately 1-mm posterior to the limbus. Injection was carefully performed with a 32-gauge microliter Hamilton syringe without damaging the lens. 1.4.5 Retina and optic nerve tissue preparation Mice were sacrificed by a lethal dose of isoflurane and perfused with 50-mL ice-cold phosphate buffered saline (PBS). Eyes were removed and fixated in 4% paraformaldehyde for 1 hr at room temperature and kept in ice-cold PBS until immunofluorescence staining. Optic nerves were removed and post-fixed in ice-cold 3% glutaraldehyde / 4% paraformaldehyde in 0.1 M Sorensen’s phosphate buffer for 72 hrs at 4 °C, and washed with ice-cold 0.1 M Sorensen’s phosphate buffer for 48 hrs at 4 °C. 1.4.6 Whole mount retina staining and RGC density analysis Retinas were isolated from the eyes and blocked with 10% normal goat serum / 1% Triton-X 100 in PBS (1% PBST) at room temperature for 30 min, and incubated with primary 43 41766.101_P17245-01 antibodies in 1% PBST for 48 hrs at 4 °C. Following is the antibody information: Mouse anti- BRN3A (Cat: MAB1585, MilliporeSigma, 1:250); Rabbit anti-SF3B2 (Cat: A301-605A, Bethyl, 1:300). Whole retinas were washed with 1% PBST for 6-8 hrs at room temperature and incubated with Alexa Fluor secondary antibodies in 1% PBST for 24 hrs at 4 °C. Washed retinas were cut into four leaflets and flat-mounted onto slides. RGC counting was conducted as previously described8with some modifications. Specifically, retinal images were captured using Zeiss LSM 800 confocal microscope and Zen software with a z-stack interval of 3 μm with the same parameters and setting, and randomly selected 12 regions (central, medial, peripheral parts from the center of retina and four leaflets) were examined for counting RGCs. To assess the knockdown efficiency of AAV2 / PHP.eb-SF3B2 shRNA in RGCs, images were taken with z-stack interval of 1 / 2 airy unit (0.45 μm) and the setting conditions were same across all samples. Since the promoter for GFP is different from the promoters directing shRNA expression, both regions having faint and strong GFP signals were included for this analysis. 3D images were constructed and SF3B2 fluorescence intensity per volume in BRN3A+ cells was semi-automatically measured by Imaris 9.5 software. The entire process of imaging and analysis was done in a blinded fashion. 1.4.7 Electron microscopy and axon quantification Fixed optic nerves were transferred from Sorenson’s buffer and post-fixed in 2% osmium tetroxide and later dehydrated in graded ethanol. The tissue was then embedded in Embed 812 (Electron Microscopy Sciences) and 1 micron sections were stained on slides with 1% toluidine blue. For electron microscopy, 70-nm sections were cut with a Reicher-Jung Ultracut E ultramicrotome and placed on 100-mesh formvar coated grids and viewed on a Zeiss Libra 120 at an accelerating voltage of 120 KV, using a Veleta camera (Olympus). To evaluate RGC axonal integrity, 10 randomly selected areas per each optic nerve sample were imaged, and the density of healthy myelinated axons and degenerating axons and g-ratio were manually quantified in a blinded manner. 1.4.8 Primary culture of mouse cortical neurons C57BL / 6J pregnant mice were purchased from Jackson Laboratory. Cortices were isolated from embryonic day (E) 16 mouse embryos. Dissected tissues were dissociated with 0.25% trypsin and cells were counted using a hemocytometer and 0.2% trypan blue to exclude dead cells. Cells were seeded in tissue culture (TC)-treated plates precoated with Matrigel and 44 41766.101_P17245-01 microfluidic devices precoated with poly-D-lysine. Cortical neurons were cultured in Neurobasal medium containing 2% B-27 supplement, 1% N-2 supplement, 0.5% GlutaMAX, 0.5% non-essential amino acids (NEAA), and 1% penicillin / streptomycin for the first 3 days. Half of the medium was changed with fresh Neurobasal medium supplemented with 2% B-27 supplement, 1% N-2 supplement, 1% penicillin / streptomycin every 2-3 days. 1.4.9 Neuro-2a (N2a) cell culture N2a cells (CLL-131) were purchased from American Type Culture Collection (ATCC). Cells with passage number 7-8 were used for experiments. Cells were maintained in Dulbecco’s modified eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin / streptomycin. N2a cells were differentiated using DMEM with 1% FBS and 10-μM retinoic acid (RA) (Sigma, R2625) for 2 days following transfection with siRNA. 1.4.10 Conditioned medium from LPS-stimulated microglia cell line (MCM) SIM-A9 cells (CRL-3265) were obtained from ATCC. Cells with passage number 8- 9 were used for experiments. Cells were cultured in DMEM / F12 medium plus 10% FBS, 1% penicillin / streptomycin. To prepare conditioned medium for further experiments, SIM-A9 cells were stimulated in DMEM / F12 medium containing 1% FBS and 100-ng / mL LPS or 2% FBS and 2000-ng / mL LPS (Sigma, L6529), for N2A cells or cortical neurons, respectively. 24 hrs later, supernatant was collected and used for experiments. Freshly prepared conditioned medium was used for all experiments. 1.4.11 Transfection and plasmid Primary mouse cortical neurons (DIV2) or N2A cells were transfected with siRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778100) and plasmid DNA using Lipofectamine 3000 (Thermo Fisher Scientific, L3000001) following the manufacturer’s protocol with a minor modification. Cells were incubated with serum-free medium for 1-2 hrs prior to transfection and replenished with fresh complete medium 5-6 hrs post transfection. 6 nM of siRNA for N2A cells and 25 nM of siRNA for cortical neurons were used, and 2.0 µg and 0.5 µg of DNA plasmid were added onto N2A cells cultured in 6- well plates and 24-well plates, respectively. siRNAs were purchased from Ambion (SF3B2 siRNA: S147808, negative control siRNA: 4390846). pcDNA3.1(+)-SF3B2-GFP contains the coding sequence of the mouse SF3B2 gene (NM_030109.2) under the control of CMV 45 41766.101_P17245-01 promoter, and the control backbone vector expressing GFP was used as a control. Plasmids were purchased from GenScript. 1.4.12 Cortical neuronal culture on microfluidic devices 5 x 104cortical neurons were seeded onto the cell body sector of devices pre-coated with of Poly-D-Lysine (PDL) at 100 µg / mL. At day 6, lentiviral particles at MOI 140 were added into the cell body sector, and 72 hrs later, axons growing in the axonal compartment were challenged with MCM for 24 hrs. 1.4.13 ATP measurements Intracellular levels of ATP were measured using ViaLight Plus BioAssay kit (Lonza, LT07-121, 221). 5 x 104cortical neurons or 7 x 103N2a cells were seeded in Matrigel- precoated 96 well plate, and transfection with siRNA was performed at 2 days in vitro (DIV) for cortical neurons and at day 1 for N2a cells. Cortical neurons were incubated with 1:1 mixture of microglial conditioned media (MCM) with LPS and neurobasal medium containing 2% B27 minus AO (Thermo Fisher Scientific, 10889038). For N2a cells, 1:1 mixture of MCM with LPS and DMEM containing 1% FBS and 10uM retinoic acid was added. After 48 hrs, ATP levels in each well were measured using LMax II luminescence microplate reader. MCM without LPS incubation was used as a control. 1.4.14 Caspase activity assays Caspase-Glo® 3 / 7 and 8 assays (Promega G8091, G8201) were used to assess the activity of caspase-3 / 7 and -8 in neurons. 2 x 103N2a cells were seeded in Matrigel-coated 96-well plate 24 hrs before the transfection and 1:1 mixture of MCM with LPS and DMEM containing 1% FBS and 10 μM retinoic acid was added. The activity of caspases was measured using LMax II luminescence microplate reader. MCM without LPS incubation was used as a control. 1.4.15 NAD+ measurements Concentrations of NAD+ were measured using NAD+ / NAD+H-Glo Assay kit (Promega G9071, 9072).2 x 104cortical neurons or 2 x 103N2a cells were seeded in Matrigel- precoated 96-well plate. For cortical neurons, cells were transfection with siRNA at DIV 2 and incubated with 1:1 mixture of microglial conditioned media (MCM) with LPS and neurobasal medium containing 2% B27 minus AO (Thermo Fisher Scientific, 10889038) for 24 hrs. N2A cells were transfected with 0.125 µg of plasmid DNA and NAD+ concentrations 46 41766.101_P17245-01 were measured using LMax II luminescence microplate reader following the manufacturer’s protocol. MCM without LPS incubation was used as a control. 1.4.16 Drug Treatments All compounds were dissolved in DMSO (D2650, MilliporeSigma) and diluted with cell culture media. For apoptosis inhibitors, a pan-caspase inhibitor z-VAD-FMK (FMK001, R&D systems) was used at 50 µM, z-DEVD (FMK004, R&D systems), targeting Caspase-3,- 6,-7,-8,-10, was used at 25 µM, Wedelolactone (401474, Calbiochem), targeting Caspase-11, was used at 10 µM, z-WEHD-FMK (FMK002, R&D systems), targeting Caspase-1,-8,-11, was used at 20 µM, VX-765 (S2228, Selleckchem), targeting Caspase-1,-4, was used at 20 µM, z-YVAD-FMK (218746, MilliporeSigma), targeting Caspase-1,-11, was used at 20 µM, z-VEID-FMK (FMK006, R&D systems), targeting Caspase-6, was used at 10 µM. For necroptosis inhibitors, Necrostatin-1 (N9037, MilliporeSigma), targeting RIPK1, was used at 50 µM, and GSK872’ (6492, R&D systems), targeting RIPK3, was used at 2 µM. Both inhibitors and vehicle (DMSO) were added to the cell culture medium 1-2 hrs prior to the treatment of MCM and control media. 1.4.17 Western blotting Protein lysates were prepared using radio-immunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific, 89901), and concentrations were determined by BCA assay (Thermo Fisher Scientific, 23225). 10 µg of proteins were loaded and run on mini-protean TGX precast protein gels (Biorad, 456-1094, 145-1106) and transferred onto trans-blot turbo midi 0.2-µm polyvinylidene difluoride (PVDF) membranes (Biorad, 170-4157). The membranes were blocked with 5% blotting-grade blocker in tris-buffered saline with 0.1% tween 20 detergent (TBST) for 30 min and incubated with primary antibodies diluted in blocking buffer for overnight at 4 ℃. Following is the antibody information: Rabbit anti- SF3B2 (Cat: A301-605A, Bethyl, 1:2000); Rabbit anti-SF3B3 (Cat: A302-508A-T, Bethyl, 1:1000); Rabbit anti-SF3B4 (Cat: A303-950A-T, Bethyl, 1:1000); Rabbit anti-Caspase-3 (Cat: 9662, Cell signaling technology (CST), 1:1000); Rabbit anti-Cleaved caspase-3 (Cat: 9661, CST, 1:1000); Mouse anti-β-actin (Cat: AC004, Neo Scientific, 1:4000). After triple washing steps, membranes were probed with secondary antibodies conjugated with HRP (goat anti-rabbit IgG antibody HRP-conjugate (MilliporeSigma, 12-348, 1:2000), goat anti-mouse 47 41766.101_P17245-01 IgG H&L HRP (Abcam, ab6789, 1:2000) for 1 hr at RT. Bands were detected with Pierce ECL western blotting substrate (Thermo Fisher Scientific, 32106). 1.4.18 Lentivirus generation The third-generation pLL3.7 (plasmid #11795) lentiviral vector was purchased from Addgene, and U6 promoter with SF3B2 shRNAs or scrambled shRNA were cloned into NotⅠ and NsiⅠ sites of a backbone plasmid. All plasmids were packaged into lentivirus by the Boston Children’s Hospital Viral Core. Two shRNA sequences targeting mouse SF3B2 are listed in Table 1, and scrambled shRNA sequence is 5’-CCTAAGGTTAAGTCGCCCTCG- CTCGAG-CGAGGGCGACTTAACCTTAGG-3’ (SEQ ID NO: 4). 1.4.19 Immunofluorescence staining Cells were fixed in 4% paraformaldehyde for 50 min at room temperature and washed three times with PBS. Fixed cells were permeabilized and blocked with 0.25% Triton X-100 and 5% goat serum in PBS for 30 min. Cells were incubated with mouse monoclonal anti- TAU-1 (1:300, MilliporeSigma, MAB3420) diluted in blocking solution overnight at 4°C. Non-immune IgG isotype (Thermo Fisher Scientific, 10400C) was used as a negative control at concentration identical to the primary antibody. Following primary antibody incubation, cells were rinsed in PBS twice, and incubated with Alexa Fluor 555 anti-mouse secondary antibody (1:500, Thermo Fisher Scientific, A21424) diluted in blocking solution for 2 hrs at RT. Cells were washed in PBS, stained with Hoechst 33342 (1:5000, Thermo Fisher Scientific, 62249) for nuclear visualization, and then rinsed in PBS three times for visualization. 1.4.20 Axon outgrowth analysis Primary cortical neurons in microfluidic chambers were infected with lentiviral shRNA (MOI of 140) for 24 hrs at day 6, and treated with microglial CM at day 9 for 24 hrs. To evaluate axon sprouting, areas covered by Tau-1 positive axons and the number of axons extending beyond 750 μm from the opening of the channels were quantified. 1.4.21 Knockdown efficiency of lentiviral SF3B2 shRNAs by RT-PCR Primary cortical neurons were infected with lentivirus at MOI of 140 for 3 days. Total RNA was purified using Trizol (Thermo Fisher Scientific, 15596026) and RNA isolation kit (Zymo Research, R2070) following manufacturers’ protocol. Reverse transcription was carried out using SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific, 48 41766.101_P17245-01 11754050), and 500ng of cDNA samples in duplicate were analyzed in LightCycler 480 Real- Time PCR system (Roche) with KiCqStart SYBR GREEN qPCR ReadyMix (Sigma, KCQS00). RNA and DNA concentrations were determined by Nano Drop 2000 (Thermo Fisher Scientific). RT-PCR data were normalized to the mean of three housekeeping genes mRNA expression levels (HPRT1, HMBS, 18S rRNA). 1.4.22 RNA isolation and quantitative PCR Total RNAs of cortical neurons were extracted at 24 hrs post MCM incubation. Detailed experimental steps were described above. KiCqStart SYBR Green Primers were purchased from MilliporeSigma. Primer sequences for all 25 genes of interest used in RT- PCR experiments are listed in Table 2. Table 2. Primer sequences for genes of interest. Gene SEQ ID Primer sequences 49 41766.101_P17245-01 22 R: GATCCCTACAAATGATGGAG Casp8 23 F: CAAGAGAACAAGACAGTGAG 50 41766.101_P17245-01 52 R: CATAGTTCCTGTTGGTGAAG TGF-β1 53 F:GGATACCAACTATTGCTTCAG 1.4.23 Statistical analysis All statistical analyses were performed by t-test or two-way ANOVA or simple linear regression or one-way ANOVA with Tukey’s multiple comparison test using GraphPad (Prism version 9). All data are presented as mean ± SEM. Statistical significance was considered when p-value was less than 0.05. 1.5 Results 1.5.1 AAV-mediated knockdown of SF3B2 improves the survival of RGCs in EAE mice To determine whether reduction of SF3B2 prevents RGCs from inflammation-induced degeneration9, we employed AAV2 / PHP.eb particles possessing a tropism toward CNS neurons10,11in EAE mice. We introduced the virus intravitreally and first confirmed the knockdown efficiency and safety of AAV vectors expressing Sf3b2 shRNA (FIG.1-9, FIG. 1-10). For the analysis of RGC survival, we included EAE mice whose clinical scores peaked at 3.0 and maintained mean clinical scores of at least 2.5. There was no difference in disease scores between EAE groups except on days 13-17, where the two EAE groups with virus injection had slightly higher clinical scores than uninjected EAE groups, which may be due 51 41766.101_P17245-01 to the additional experimental procedure for virus administration (FIG.1-1A, FIG.1-1B). To quantify the density of RGCs, we made four radial cuts in retinas and immunostained with brain-specific homeobox protein 3A (BRN3A), a pan-RGC marker12. Within each flattened retina, we separated central, medial, and peripheral regions from the center, and examined a total 12 areas in each retina (FIG.1-1C). We confirmed that there was a dramatic loss of RGCs in both EAE-induced mice without virus injection and with AAV-GFP control virus injection compared to healthy Complete Freund’s adjuvant (CFA)-injected control mice. In contrast, reducing SF3B2 levels by AAV-Sf3b2 shRNA prevented the loss of RGCs from retrograde degeneration caused by axon injury. We found that RGC densities were significantly higher in all three regions of retinas from EAE mice administered AAV-SF3B2 shRNA compared to both EAE mice injected with AAV-GFP and EAE mice without virus injection (EAE wo inj) (FIG.1-1D-FIG.1-1F). These results suggest that downregulating the cellular level of SF3B2 makes RGCs resistant to inflammatory neurodegeneration. 1.5.2 Downregulated SF3B2 preserves axonal integrity and myelination in EAE mice To further verify whether the reduction of SF3B2 by virus delivery also protects the integrity of RGC axons and their myelination, we examined optic nerve sections by transmission electron microscopy (TEM) (FIG. 1-2A). We counted 10 randomly selected areas per each optic nerve and quantified the number of myelinated axons having discernible neurofilaments and tightly formed myelin sheaths (FIG. 1-2B). We also counted the degenerating axons with distinct patterns of Wallerian-like degeneration and disrupted filaments13(FIG.1-2C, FIG.1-2D). We found that there were higher densities of myelinated axons in EAE mice administered AAV-Sf3b2 shRNA compared to both EAE wo inj and EAE with AAV-GFP, demonstrating that myelinated axons were preserved in EAE mice with SF3B2 reduction (Fig. 2B). There were fewer degenerating and unmyelinated axons when compared to both EAE wo inj and EAE with AAV-GFP groups (FIG. 1-2C, FIG. 1-2D). Together, these results indicate that demyelination and axonal degeneration that occurred during EAE progression were substantially suppressed in EAE with SF3B2 downregulation. In addition, we also examined the size of axons and thickness of myelin sheaths. As shown in FIG. 1-2E, g-ratio in EAE with reduced SF3B2 tended to be lower than the other two EAE disease controls, indicating thicker myelin. There was no significant difference in average diameter of axon fibers, however, among all groups (FIG.1-2F). We then analyzed 52 41766.101_P17245-01 the distribution of myelinated nerve fibers using a scatter plot showing g-ratio as a function of inner axon diameter (FIG.1-2G). All groups had similar g-ratios of smaller axons but in both groups of EAE mice without SF3B2 downregulation, g-ratios were higher in larger axons compared to CFA control and EAE with AAV-Sf3b2 shRNA groups, indicating that larger axons were thinly myelinated during EAE progression when SF3B2 levels were not manipulated. Together, these results demonstrate that downregulation of SF3B2 preserves RGC axonal integrity and myelination against inflammatory injury induced in EAE mice. 1.5.3 Reduction of SF3B2 by RNAi protects axonal integrity and survival of cortical neurons challenged with LPS-stimulated microglia cell line media To further dissect the mechanism of neuroprotection afforded by reduced SF3B2 levels, we examined the effects of reduced SF3B2 on axonal outgrowth and cell survival in an in vitro model of inflammatory neuronal injury. We first confirmed the antibody specificity and the ability of siRNA constructs to downregulate SF3B2 levels in vitro (FIG.1-11). Using a microfluidic platform, a well-established system for evaluating axonal elongation14, we transduced cultured embryonic mouse primary cortical neurons (PCNs) with lentivirus expressing Sf3b2 shRNA then exposed to the microglia cell line conditioned media (MCM), which is the supernatant of SIM-A9 microglia cell line stimulated with lipopolysaccharide (LPS). LPS is an endotoxin and a component of outer membrane of gram-negative bacteria15. When microglia are exposed to LPS, they release pro-inflammatory cytokines, such as interferon- γ (IFN-γ), tumor necrosis factor- α (TNF-α), and interleukin-6 (IL-6), which are important mediators of MS pathogenesis16-18. SIM-A9 microglia cell line was stimulated with LPS to mimic activated microglia19,20. First, we confirmed the neurotoxicity of MCM on Neuro-2A cells (N2A) as demonstrated by increase in cleaved caspase-3 and reduction in ATP levels (FIG. 1-12). To assess axonal degeneration induced by MCM directly, we immunostained PCN cultures in microfluidic chambers for axonal protein, Tau-121and imaged the entire axonal compartment (FIG. 1-3A). To determine axonal projections, we semi-automatically analyzed areas covered by axons, and counted the number of axons extending beyond 750 μm from the opening of the channels. As seen in FIG.1-3B and FIG. 1-3C, MCM caused degeneration of axons. In contrast, axons were protected from degeneration when SF3B2 was reduced, as indicated by substantially higher numbers of axons reaching over a set distance (3 / 4 of the entire axonal sector), as well as increased areas 53 41766.101_P17245-01 occupied by axonal processes (FIG. 1-3B, FIG. 1-3C). Consistent with this morphological observation, further biochemical analysis revealed that reduced SF3B2 expression prevented a decline in ATP levels as a measure of overall cellular toxicity22. Perhaps more importantly, it also prevented a decline in nicotinamide adenine dinucleotide (NAD+) concentrations which is degraded upon activation of Sarm1, a key enzyme in the programmed axon degeneration pathway23,24(FIG.1-3E, FIG.1-3F). Our findings substantiate the concept that reducing cellular level of SF3B2 not only supports neurons to maintain axonal outgrowth and integrity but also prevents cytotoxic effect triggered by inflammatory injury. 1.5.4 SF3B2 overexpression causes neurite degeneration Given that knockdown of SF3B2 was neuroprotective against inflammatory injury to neurons, then we asked if overexpressing SF3B2 could exert any effect on neurite maintenance. To assess the impact of increased SF3B2 levels on neurite outgrowth and health, we examined the neurite morphology and measured NAD+ concentrations. N2A cells were transfected with a plasmid coding for GFP or SF3B2-GFP, and immunocytochemistry and NAD+ assay were carried out. In contrast to GFP control, N2A cells overexpressing SF3B2 had a 3-fold higher protein levels of SF3B2 and a marked reduction in the number of neurons with neurites, and those with neurites displayed fewer total number of branches and had shorter neurites (FIG. 1-4A-FIG. 1-4F). This pruning of neurite growth was correlated with significantly lowered NAD+ concentrations in cells with elevated level of SF3B2 compared to controls (FIG. 1-4G). These findings suggest that, in contrast to the protective effects of reduced SF3B2 on CNS neurons, SF3B2 overexpression is likely to impede neurite outgrowth and cause neurite degeneration. 1.5.5 Downregulation of SF3B2 in neurons prevents inflammatory damage To identify which genes or pathways by which SF3B2 downregulation makes neurons resistant to degeneration, we investigated the expression levels of 25 candidate genes involved in injury-response, apoptosis, and necroptosis (see Table 2 for full list). Primary mouse cortical neurons were allowed to establish in culture for 6 days, and infected with lentiviral shRNA for 72 hrs, and then challenged with MCM for 24 hrs prior to RNA isolation. After confirming downregulation of SF3B2 (FIG.1-5A), we screened the mRNA levels of several regeneration-associated genes25-29(FIG.1-5B). We found that inflammatory stress elicited by MCM markedly increased the transcription of several RAGs (Atf3, Gadd45a, Gap43, Stmn2, 54 41766.101_P17245-01 Tgfb1), but not all, compared to the control groups. These genes have been shown to be upregulated upon neuronal damage25,26,28,29, thus, these observations confirm the neurotoxicity of MCM on cortical neurons. As shown in FIG.1-5B, however, neurons with Sf3b2 shRNA had substantially lowered transcriptional levels of four of these RAGs (Atf3, Gap43, Myc, Tgfb1) similar to the controls, supporting the neuroprotective role of SF3B2 knockdown. Together, these findings indicate that SF3B2 downregulation enabled neurons to be resistant and less susceptible to inflammation-induced cellular damage. 1.5.6 Apoptosis is not the target mechanism by which SF3B2 reduction protects against MCM-induced inflammatory neurotoxicity In addition to the analysis of regeneration associated gene expression, we asked whether the transcriptional activation of caspase-dependent apoptosis genes and necroptosis could be modulated with a decline in SF3B2 level since these mechanisms have been shown to play a partial role in inflammation-induced neuronal death30-32. qPCR analysis of Caspases- 8, -9, and -3 involved in initiating and executing apoptotic death33,34showed that there was a small upregulation of Caspase-8, but not Caspase-3 or Caspase-9 with MCM and that there was no transcriptional difference between scrambled control and SF3B2 downregulated groups (FIG.1-6). MCM treatment induced a small change in gene expression of Bid but no other members of the Bcl-2 family members. This small upregulation of Bid by MCM was not reversed by SF3B2 knockdown. Similarly, there were no significant differences in mRNA levels of Calpain-1 and Calpain-2 (FIG. 1-6). In addition to gene expression study, we examined whether SF3B2 downregulation influences the enzymatic activity of Caspase-3 / 7 and Caspase-8 in neuronal cells following MCM treatment. Although MCM induced Caspase- 3 / 7, but not Caspase-8 activity, this enzymatic activity induction was not blocked by downregulation of SF3B2 (FIG.1-7A), suggesting that neuroprotective effect of knockdown of SF3B2 is not mediated through the regulation of apoptosis, but likely acting downstream from activation of Caspase-3. Contrary to what is seen with apoptosis gene expression, MCM- induced upregulation in the transcription of necroptosis-related genes, such as Tnf-α, Ripk3, and Mlkl30,35, was markedly attenuated in neurons where SF3B2 expression was knocked down with shRNA across multiple independent experiments (FIG.1-8). Finally, we examined whether inhibitors targeting either caspases or necroptosis36-39could prevent MCM-induced axon degeneration and reduced NAD+ levels. Among the various caspase inhibitors, only z- 55 41766.101_P17245-01 VAD-FMK, the pan-caspase inhibitor39, prevented a reduction in NAD+ levels (FIG. 1-7B- FIG.1-7C, FIG.1-13). More selective inhibitors, such as z-DEVD-FMK, targeting Caspase- 3,-7,-8,-1040, and z-WEHD-FMK, targeting Caspase-1,-4,-5,-841,42and the specific Caspase- 6 inhibitor z-VEID-FMK43did not block MCM-induced reduction in NAD+ levels. Wedelolactone, a selective inhibitor for Caspase-11, has been shown to suppress LPS-induced inflammatory response in macrophage cell line44, however, it failed to preserve NAD+ concentrations, suggesting that MCM-induced neurotoxicity is not mediated via these caspases (FIG. 1-7B-FIG. 1-7C, FIG. 1-13). Furthermore, Necrostatin-1 (Nec-1), a RIPK1 inhibitor38, and GSK872’ targeting RIPK345, did not prevent NAD+ loss caused by MCM (FIG.1-13). Collectively, these results indicate that both apoptosis and necroptosis are not the direct mechanisms targeted by reduced SF3B2 to prevent inflammatory axonal injury. 1.6 Discussion In this Example, we show that reduction of SF3B2 protein level in CNS neurons by RNAi is sufficient to prevent RGC loss and axon degeneration and preserve myelin integrity in EAE and protects neuronal viability and axonal integrity against inflammatory injury. We further show that SF3B2 downregulation suppresses the transcription of RAG and necroptosis genes which are markedly upregulated following exposure to MCM. Together, our findings suggest that targeting SF3B2 could be a promising strategy to protect CNS neurons and their axonal integrity from inflammatory neurodegeneration. Current MS therapies primarily focus on modulating autoimmune response, which can effectively alleviate inflammation and slow down the disease progression at early stages3,4. There are currently limited therapies, however, directed at the secondary axonal loss and neurodegeneration. Thus, many researchers have attempted to find potential therapeutics that promote remyelination and directly protect neurons from degeneration. It has been shown that treatment with ursolic acid in EAE mice at the chronic phase was able to not only mitigate clinical symptoms, but also reduce axon degeneration and promote remyelination through oligodendrocyte maturation46. Another group showed that SRT 501, a pharmaceutical formulation of resveratrol and an activator of SIRT1, prevented RGC loss and delayed visual dysfunction in chronic EAE without alleviating CNS inflammation47. Neuroprotection induced by directly altering the expression of target genes has been explored as well. Neuron- specific overexpression of SIRT1 in EAE mice suppressed neuronal apoptosis in the injured 56 41766.101_P17245-01 spinal cords and attenuated clinical symptoms and diminished the level of demyelination and axon injury in the spinal cord48. Similarly, fingolimod and other sphingosine 1-phosphate receptor agonists have been shown to have neuroprotective effects in mouse models of MS49,50. None of these strategies, however, have resulted in clinical success yet. Our previous studies found that ethoxyquin (EQ) and its novel analogue, EQ-6 (6-(5- amino)-ethoxy-2,2,4-trimethyl-1,2-dihydroquinoline hydrochloride), prevent axonal degeneration induced in rat dorsal root ganglion (DRG) neurons treated with cisplatin or paclitaxel and mouse models of chemotherapy-induced peripheral neuropathy (CIPN)7,51,52. EQ is an FDA-approved food preservative, and it is added in animal feed51. Through subsequent experiments, we showed that EQ interacts with heat shock protein 90 (Hsp90) and negatively modulates its chaperone function, resulting in diminished cellular level of SF3B2 protein7,52. Interestingly, direct knockdown of SF3B2 by RNAi was sufficient to make rat DRG neuronal cells resistant to cisplatin-induced toxicity7. In this Example, we observed that this strategy also is effective to preserve CNS neurons from inflammatory neurotoxicity in experimental models for MS. It remains unclear whether EQ or EQ-6 can provide CNS protection following inflammatory injury. If EQ-6 is identified to exert neuroprotective effects in animal models of CNS diseases, as well, it might be worth developing and utilizing EQ-6 as a promising pharmacological approach to prevent neurodegeneration, given that EQ-6 is likely to accumulate in neural tissue and lacks significant genotoxicity and carcinogenicity51. Other strategies that can also reduce SF3B2 levels include anti-sense oligos, which have been shown to be effective in several neurodegenerative studies including spinal muscular atrophy and amyloid neuropathy53,54. A major challenge in developing therapies for CNS axonal protection is targeting the appropriate cell types while reducing complications due to off-target side effects. We were able to achieve this by exploiting the tropism of AAV2 / PHP.eb particles toward CNS neurons10,11and delivering it directly into the eye. We were able to lower the cellular level of SF3B2 in RGC neurons in a stable manner throughout the duration for the in vivo experiments. This was sufficient to improve RGC survival, axonal integrity, and myelin defects in EAE mice. Obviously, this approach is a preventative measure as we had to deliver the AAV- shRNA well in advance of inducing the EAE, and accordingly, it may not be a feasible clinical approach in MS patients. Nevertheless, patients with optic neuritis do suffer from secondary 57 41766.101_P17245-01 axonal degeneration and this is often delayed compared to the initial inflammatory demyelination55,56. The time between the onset of optic neuritis and development of delayed axonal degeneration may offer a therapeutic window to target the SF3B2 in RGC neurons and reduce the likelihood of long-term decreased vision. Although the in vivo EAE model does not render itself to detailed mechanistic molecular studies, the axonal degeneration seen in inflammatory insults can be modeled in vitro. In this Example, we treated cortical neurons with the supernatant of LPS-stimulated microglia cell line. Microglia are the resident immune cells in the CNS and play a key role in the pathogenesis of MS57-59. In response to the treatment with LPS, they have been shown to produce excess amount of TNF-α, IFN-γ, and IL-6, which are the main soluble mediators of immune response in active MS lesions16-18. TNF-α from activated microglia is known to inhibit cell survival signaling and induce caspase-dependent apoptosis, resulting in neurodegeneration60,61. Apoptosis by Fas ligand which is secreted from stimulated microglia potentiates TNF-α-mediated neurotoxicity62. Neurite beading and swellings, and neuronal death are also caused by IFN-γ treatment60. The extent of neurotoxicity by one inflammatory factor itself is weak, however, conditioned media from microglia stimulated with LPS contain diverse neurotoxic cytokines and free radicals which induce marked neuronal injury60. Like these previous studies, we found that conditioned media from LPS-stimulated microglia cell line is able to cause neuronal and axonal damage. In addition to demonstrating axonal degeneration, we also confirmed that MCM likely activated SARM1 (FIG.1-3F, FIG. 1-7B-FIG.1-7C, FIG.1-12E, FIG.1-13), a key mediator of Wallerian degeneration63. When SARM1 is activated, the TIR (Toll / Interleukin-1 Receptor) domain dimerizes and exposes an NAD hydrolase activity, which results in reduced cellular levels of NAD64. In our cultures, we found that MCM-treated cultures had reduced NAD levels and that this reduction in NAD+ was prevented in neuronal cultures where SF3B2 protein expression was reduced by about 50%. How reduced level of SF3B2 prevents activation of SARM1 is unclear. We examined the mRNA levels of NMNAT1 and SARM1 but did not see any significant differences in cultures treated with MCM or SF3B2 RNAi. Although SF3B2 is an RNA binding protein65, it is likely that neuroprotection seen with reduced levels of SF3B2 is not mediated through 58 41766.101_P17245-01 altered transcription of NMNAT2 and SARM1, two key molecules involved in Wallerian degeneration63. Given these negative findings, we explored the changes in other enzymatic pathways implicated in MCM-induced neurotoxicity. We did not observe any meaningful significant changes in gene expression or enzymatic activity of classical apoptosis pathway, but expression levels of several genes involved in necroptosis were upregulated in MCM-treated neurons, specifically, Tnf- α, Ripk3, and Mlkl. TNF-α signaling with other inflammatory factors released by activated microglia triggers RIPK1-RIPK3-MLKL axis required for necroptosis30,66. In addition, neurons have been shown to express TNF-α following injury67, suggesting that TNF-α-induced necroptotic mechanism is a potential key pathway in neurotoxicity of conditioned media from LPS-stimulated microglia. We did not see any significant change, however, in the activation of Caspase-8, a mediator of canonical necroptosis pathway68, and we were unable to block NAD+ loss with necroptosis inhibitors, indicating that axonal degeneration may not be wholly mediated via the TNF-α induced RIPK1-RIPK3-MLKL axis. Nevertheless, the MCM-induced upregulation of Tnf-α, Ripk3, and Mlkl was prevented in neurons where SF3B2 level was downregulated. This observation suggests that SF3B2-mediated neuroprotection may be multipronged, acting at several key pathways. TNF-α causes a rise in intracellular calcium concentration69, which plays a role in injury response70. It is possible that SF3B2 knockdown inhibited a rise in calcium and thereby prevented the upregulation of RAG genes. An interesting observation we made was the consistent inhibition of MCM-induced axon degeneration, as assessed by NAD+ levels, with pan-caspase inhibitor z-VAD-FMK39. We were unable to replicate similar inhibition, however, with more specific inhibitors, such as z-DEVD-FMK targeting Caspase-3,-7,-8,-1040, Wedelolactone blocking Caspase-1144, or Nect-1 targeting RIPK145, suggesting that the effect of z-VAD-FMK may not be via the canonical caspase or necroptosis pathways. It is possible that z-VAD-FMK inhibited calpains71,72which are one of the most downstream mediators of Wallerian axon degeneration73, but the fact that z-VAD-FMK was able to prevent NAD+ loss suggests that the effect is upstream of SARM1. Future studies are needed to further dissect the molecular mechanisms of MCM-induced neurotoxicity and axon degeneration and how this is prevented by downregulating SF3B2 levels. 59 41766.101_P17245-01 Nevertheless, the presently disclosed findings consistently show that downregulation of SF3B2 is sufficient to prevent neurotoxicity and secondary axonal degeneration induced by inflammatory signaling in vitro and in vivo. These results suggest that further examination of strategies to regulate SF3B2 levels as a viable therapeutic target for optic neuritis and MS patients is warranted. EXAMPLE 2 Neuroprotection of Central Nervous System (CNS) Neurons Against Inflammatory Insult by Downregulated SF3B2 2.1 Overview Multiple sclerosis (MS) is a chronic and inflammatory disease of the central nervous system (CNS) characterized by demyelination of axons and neuronal injury. Patients with MS suffer from physical disabilities, vision problems, and even cognitive impairments. Although immunomodulatory therapy has been widely used in MS patients to mitigate symptoms, there is currently no definite treatment to prevent axonal degeneration, which is associated with long term disability. Splicing factor 3B subunit 2 (SF3B2), a component of the spliceosome complex, has been characterized as a potential therapeutic target for neuroprotection. Reduction in SF3B2 protein by RNAi has been shown to be sufficient to preserve rat sensory neuronal cell viability against chemotherapy-induced peripheral neuropathy (CIPN) in vitro. The effect of SF3B2 knockdown on CNS neurons and its underlying mechanism, however, have not been elucidated. This Example examined whether downregulation of SF3B2 also can protect the CNS neurons against exposure to inflammatory insult and explored the molecular pathway by which it exerts protective effects. This Example particularly focused on retinal ganglion cell (RGC) loss and optic nerve (ON) injury in optic neuritis of experimental autoimmune encephalomyelitis (EAE), a widely utilized model for neurodegeneration. In vitro system with primary mouse cortical neurons, which can recapitulate the inflammatory environment of active lesions in EAE, was first optimized and employed to demonstrate the effect of decreased SF3B2 in neuroprotection. Data showed that reduction of SF3B2 by intravitreal delivery of AAV2-PHP.eb-SF3B2 shRNA resulted in substantially improved survival of RGCs in EAE mice compared to AAV2- 60 41766.101_P17245-01 PHP.eb-GFP control. This observation was associated with higher density of myelinated axons and fewer degenerating axons in their optic nerves. We also found that primary mouse cortical neurons infected with lentiviral SF3B2 shRNA were able to elongate their axons more robustly and their viability was preserved during exposure to inflammatory insult caused by LPS-stimulated microglia compared to lentiviral scrambled shRNA control. Further, qPCR data revealed that necroptosis and injury-response upon exposure to inflammatory stress were repressed by SF3B2 reduction. These findings suggest that SF3B2 can be a promising molecular target to prevent degeneration in CNS neurons from inflammatory toxicity. 2.2 Background Multiple sclerosis (MS) is a chronic inflammatory disease of the central nervous system (CNS), characterized by demyelination of axons, damaged oligodendrocytes, and neurodegeneration. It is a disabling neurological disease more likely occurring in young female adults and causes numbness or weakness in limbs, optic neuritis, gait ataxia, pain and fatigue, and sphincter dysfunction1,2. The etiology of MS and its exact pathophysiological mechanism still remain unclear, and there is no effective treatment to cure the disease3. Due to the limited access of MS patients’ brain tissues, animal models emulating MS pathology have been developed to study the disease4. Although each experimental model mirrors specific part of the disease progression, experimental autoimmune encephalomyelitis (EAE) has been extensively utilized to elucidate molecular disease mechanisms and to test novel therapeutics for MS5,6. Current therapies primarily focus on modulating autoimmune response, which can effectively alleviate inflammation and slow down the disease progression at the early stage7-9. Thus, many researchers have been trying to find potential therapeutics that directly protect neurons from degeneration and repair demyelination. It has been shown that treatment with ursolic acid in EAE mice at the chronic phase was able to not only mitigate clinical symptoms, but also reduce axon degeneration and promote remyelination through oligodendrocyte maturation10. Another group showed that SRT 501, a pharmaceutical formulation of resveratrol and an activator of SIRT1, prevented RGC loss and delayed visual dysfunction in chronic EAE without alleviating CNS inflammation11-13. Neuroprotection induced by directly altering the expression of target genes has been explored extensively as well. Neuron-specific overexpression of SIRT1 in EAE mice attenuated clinical symptoms and diminished the level 61 41766.101_P17245-01 of demyelination and axon injury in the spinal cord14. In addition, it has been demonstrated that conditional KO of KLF4 in EAE mice prevented the loss of RGC, resulting in rescued visual function15. Splicing factor 3B subunit 2 (SF3B2) is a component of SF3B, which is an essential complex of spliceosome and required for accurately recognizing the pre-messenger RNA’s branch point region during splicing process16,17. Interestingly, we have recently identified that SF3B2 may have an undiscovered role as a potential therapeutic target for neuroprotection18. In this work, reduction in SF3B2 protein by RNAi was sufficient to enhance cell viability of rat sensory neuronal cells against cisplatin-induced toxicity in vitro. The effect, however, of SF3B2 knockdown on the central nervous system (CNS) neurons and its underlying mechanism have not been elucidated yet. This Example investigated whether the downregulation of SF3B2 can also prevent the CNS neuronal damage from inflammatory insult and explored the possible molecular pathway by which it exerts protective effects. To begin, an optic neuritis model in chronic EAE mouse, which is an intensively studied rodent model for MS19-21, was employed. EAE is induced by the immunization with MOG35-55 emulsion22and its disease progression requires the activation of microglia, macrophages, and auto-reactive CD4+T cells mediating CNS axon injury7,23. This diseased model exhibits distinct pathophysiological features, such as inflammation, demyelination of optic nerves, axon degeneration, and retinal ganglion cell (RGC) loss, which also are observed in MS patients20,24,25. By administering AAV2-PHP.eb-SF3B2 shRNA intravitreally, a substantial increase in RGC survival was seen in EAE mice compared to disease control group with AAV2-PHP.eb-GFP. In addition, reduction of SF3B2 by AAV2- PHP.eb caused a decrease in the density of degenerating axons and an increase in the density of healthy myelinated axons relative to EAE control. The neuroprotective effect of downregulated SF3B2 was further confirmed by conducting an in vitro experiment in a specific platform mimicking inflammatory conditions of MS26,27. To be specific, mouse cortical neurons were first transfected with siRNA and challenged with lipopolysaccharide (LPS)-treated microglial media. Stimulation with LPS induces microglia to release pro-inflammatory cytokines, such as IL-6, TNF-α, and IFN-γ28,29, and these pathogenic cytokines have shown to be involved in autoimmune neuroinflammation of EAE and MS30-32. As opposed to negative control group, neurons transfected with SF3B2 62 41766.101_P17245-01 siRNA maintained higher ATP levels, NAD concentrations, and elongated longer axons against inflammatory stress. In addition, it was found that genes associated with necroptotic signaling and injury-response were downregulated at the transcription level in neurons having reduced SF3B2 following insult. These findings suggest that downregulating SF3B2 protein can render CNS neurons to be resistant to inflammation-induced impairment, resulting in the prevention of necroptotic cell death and axon degeneration. 2.3 AAV2 / PHP.eb-mediated knock down of SF3B2 promoted RGC survival and preserved RGC axonal integrity in EAE mice. 2.3.1 Introduction Adeno-associated Virus (AAV) is a leading vehicle to induce gene silencing, genome editing, and deliver a therapeutic transgene33-36. Despite its limited capacity of gene packaging, recombinant AAVs have been actively utilized in both basic research and clinics due to its low immunogenicity, diverse serotypes infecting a wide range of cells, and its ability to maintain long-term gene expression37-40. With the aid of this gene delivery vehicle, whether reduction of SF3B2 in RGC neurons can prevent neurodegeneration resulting from inflammatory damage and demyelination in the active lesions of optic neuritis was investigated. Two weeks prior to EAE induction, AAV vector carrying two shRNAs against SF3B2 was administered into the vitreous body and disease progression was monitored on a daily basis before harvesting retina and optic nerve tissues for further examination. Based on the quantification data, the density of retinal ganglion cells in EAE mice with reduced SF3B2 was substantially preserved compared to EAE group with GFP control. Moreover, there were fewer degenerating axons and more healthy myelinated axons in EM sections of optic nerves of EAE group with SF3B2 downregulation. 2.3.2 Materials and Methods 2.3.2.1 Experimental timeline AAV particles were delivered into the vitreous body two weeks prior to EAE induction.8 weeks after EAE induction, retina and optic nerve tissues were harvested for the analysis. 2.3.2.2 Animals C57BL / 6J female mice at the age of 7 weeks were purchased from Jackson Laboratory. Before the intravitreal injection and EAE induction procedure, mice were anesthetized by i.p. 63 41766.101_P17245-01 injection of ketamine (120 mg / kg) and xylazine (8 mg / kg). All animal experiments were conducted following the protocols approved by Institutional Animal Care and Use Committee at Johns Hopkins University School of Medicine. 2.3.2.3 Design and production of AAV vectors expressing shRNAs Two shRNA sequences targeting SF3B2 were selected using the TRC shRNA design process offered by Broad Institute (portals.broadinstitute.org / gpp / public / resources / rules). H1 promoter and two shRNAs were synthesized and cloned into HindIII and BamHI sites of pAAV-U6-CMV-GFP vector provided by the Boston Children’s Hospital Viral Core. shRNA synthesis and subcloning were done by GenScript, and all plasmids were packaged into AAVs by the same Viral Core. The AAV titers used for this study were in the range of 1.48-8.02 × 1012genome copy (GC) / mL. Table 2-1. Short hairpin sequences targeting mouse SF3B2 SEQ ID 2.3.2.4 Intravitreal injection of AAV vectors At 8-9 weeks of age, 1.2 μL of AAV with a titer of 1.5ⅹ1012gc / mL in PBS was delivered into the mouse vitreous. After anesthetizing mice with Ketamine / Xylazine, a small hole was made approximately 1 mm posterior to the limbus. Injection was carefully performed with a 32-gauge microliter Hamilton syringe without damaging the lens41. 2.3.2.5 EAE induction and clinical scoring 2 weeks post AAV vector delivery, EAE was induced in C57BL / 6J female mice as previously described22. Emulsion containing 150 μg of MOG33-55 (AnaSpec) in complete Freund’s adjuvant (CFA) (MilliporeSigma) with 600 μg of Mycobacterium tuberculosis (BD) was subcutaneously injected into both sides of the lateral abdomen.375 ng of pertussis toxin (List Biologicals) was injected intraperitoneally on days 0 and 2. For healthy controls, the 64 41766.101_P17245-01 same emulsion without MOG33-55peptide was used. EAE clinical symptoms were monitored on a daily basis following Hooke lab’s Mouse EAE scoring guidelines. Table 2-2. EAE clinical score guide provided by Hooke labs Score Clinical observations 00 No obvious chan es in motor function ge 2.3.2.6 Retina and optic nerve tissue preparation Mice were sacrificed by a lethal dose of isoflurane and perfused with 50-mL ice-cold phosphate buffered saline (PBS). Eyes were removed and fixated in 4% paraformaldehyde for 1 hour at room temperature and kept in ice-cold PBS until immunofluorescence staining. Optic nerves were removed and post-fixed in ice-cold 3% glutaraldehyde / 4% paraformaldehyde in 0.1-M Sorensen’s phosphate buffer for 72 hours at 4 °C and washed with ice-cold 0.1-M Sorensen’s phosphate buffer for 48 hours at 4 °C. 2.3.2.7 Whole mount retina staining and RGC density analysis Retinas were isolated from the eyes and blocked with 10% normal goat serum / 1% Triton-X 100 in PBS (1% PBST) at room temperature for 30 min, and incubated with primary antibodies in 1% PBST for 48 hours at 4 °C. Following is the antibody information: Mouse anti-BRN3A (Cat: MAB1585, MilliporeSigma, 1:250); Rabbit anti-SF3B2 (Cat: A301-605A, Bethyl, 1:300). Whole retinas were washed with 1% PBST for 6-8 hours at room temperature, 65 41766.101_P17245-01 and incubated with Alexa Fluor secondary antibodies in 1% PBST for 24 hours at 4 °C. Washed retinas were cut into four leaflets and flat-mounted onto slides. For RGC counts, retinal images were captured using Zeiss LSM 800 confocal microscope and Zen software with a z-stack interval of 3 μm and randomly selected 12 regions (central, medial, peripheral parts from the center of retina and four leaflets) were examined for counting RGCs. To assess the knockdown efficiency of AAV2 / PHP.eb-SF3B2 shRNA in RGCs, images were taken with z-stack interval of 1 / 2 airy unit (0.45 μm) and the setting conditions were the same across all samples. Since the promoter for GFP is different from the promoters directing shRNA expression, both regions having faint and strong GFP signals were included for this analysis. 3D images were constructed and SF3B2 fluorescence intensity per volume in BRN3A+ cells was semi-automatically measured by Imaris 9.5 software. The entire process of imaging and analysis was done in a blinded fashion. 2.3.2.8 Electron microscopy and axon quantification Fixed optic nerves were transferred from Sorenson’s buffer and post-fixed in 2% osmium tetroxide and later dehydrated in graded ethanol. The tissue was then embedded in Embed 812, and 1-μm sections were stained on slides with 1% toluidine blue. For electron microscopy, 70-nm sections were cut with a Reicher-Jung Ultracut E ultramicrotome and placed on 100-mesh formvar coated grids and viewed on a Zeiss Libra 120 at an accelerating voltage of 120 KV, using a Veleta camera (Olympus). To evaluate RGC axonal integrity, 10 randomly selected areas per each optic nerve sample were imaged, and the density of healthy myelinated axons and degenerating axons and g-ratio were manually quantified in a blinded manner. 2.3.3 Results 2.3.3.1 Characterization of AAV2-PHP.eb vectors in retinal ganglion cells To examine the knock down efficiency and check the direct toxicity of viral vectors on RGC survival, AAV2-PHP.eb-GFP (AAV-GFP) and AAV2-PHP.eb-SF3B2 shRNA (AAV-SF3B2 shR) were first characterized prior to the actual experiment. At 2- and 8-weeks post-delivery into a mouse eye, retina and optic nerve tissues were processed for analyses. From immunofluorescence staining, AAV-SF3B2 shR reduced the intensity of SF3B2 protein by 31.75% and 58.34% compared to AAV-GFP at 2 weeks and 8 weeks, respectively (FIG. 2-3A and FIG.2-3B). Knock down efficiency of AAV-SF3B2 shRNA also was validated in 66 41766.101_P17245-01 vitro culture system in N2A cells by measuring SF3B2 mRNA levels (FIG.2-3C). Next, the density of RGCs and myelinated axons was tested after AAV transduction and there was no significant difference among un-injected control, AAV-GFP control, and AAV-SF3N2 shR group (FIG.2-3D, FIG.2-3E, and Table 2-3). Table 2-3. RGC density after AAV administration. at 2 weeks Un-injected control AAV-GFP AAV-SF3B2 shR ( / 2) In agreement with RGC density result, no significant difference was observed in the density of myelinated axons among all three groups (Table 2-4). Table 2-4. Density of healthy myelinated axons in optic nerves after AAV administration. Un-injected control AAV-GFP AAV-SF3B2 shR 2.3.3.2 Monitoring disease progression. At 2 weeks after the intravitreal injection of viral vectors, EAE was induced in C57BL / 6J mice following the active immunization protocol with a little modification22. Mice that were immunized with MOG33-55peptide started to show limp tail, an initial disease manifestation of EAE, on day 9-10. Clinical symptoms progressed from a limp tail to hindlimb weakness and paralysis, and partial front leg weakness. Peak symptoms were observed at day 67 41766.101_P17245-01 17-19, and only EAE mice showing the typical disease progression (FIG.2-4A) were included for the histological analysis to minimize the variability. For healthy CFA control, mice received the same complete Freund’s adjuvant immunization reagents without antigen peptide. 2.3.3.3 AAV-mediated knock down of SF3B2 improves the survival of RGCs in EAE mice. To determine whether a reduction of SF3B2 prevents RGCs from degeneration, RGC density was quantified. Four radial cuts were made on retina immunostained with BRN3A, a pan-RGC marker42, and the flattened retina was divided into central, media, and peripheral regions from the center, and total 12 areas were examined (FIG.2-4C). Compared to healthy CFA control, there was a dramatic loss of RGCs in both EAE-induced mice without virus injection and with AAV-GFP control virus injection, as indicated by a marked reduction in BRN3A+ RGCs and their faint fluorescence intensities. In contrast, reduced SF3B2 by AAV vectors prevented the loss of RGCs from retrograde degeneration caused by axon injury. RGC density was significantly higher in all three regions of retinas from EAE mice administered with AAV-SF3B2 shRNA compared to both EAE mice injected with AAV-GFP and EAE mice without virus injection (EAE wo inj). (FIG.2-4D and Table 2-5). Table 2-5. RGC density in EAE mice. CFA ctrl EAE uninj EAE+ EAE+AAV 2.3.3.4 Downregulated SF3B2 preserved axonal integrity and myelination in EAE mice. To further verify whether the reduction of SF3B2 by virus delivery also protects the integrity of RGC axons and their myelination, optic nerve TEM sections were assessed (FIG. 68 41766.101_P17245-01 2-5A). Randomly selected 10 areas per each optic nerve were examined and the number of myelinated axons having discernible neurofilaments and tightly formed myelin sheaths were quantified (FIG. 2-5B). Degenerating axons with distinct patterns of Wallerian-like degeneration and disrupted filaments also were investigated (FIG.2-5C). These data showed that there were higher densities of myelinated axons in EAE mice administered AAV-SF3B2 shRNA compared to both EAE wo inj and EAE with AAV-GFP, demonstrating that myelinated axons were preserved in EAE mice with SF3B2 reduction (FIG.2-5B, and Table 2-6). Moreover, they had fewer degenerating and unmyelinated axons when compared to both EAE wo inj and EAE with AAV-GFP groups (FIG. 2-5C, FIG. 2-5D, and Table 2-6). Together, these results indicate that axonal degeneration and demyelination that occurred during EAE progression were substantially suppressed in EAE with SF3B2 downregulation. In addition, to investigate the size of axons and thickness of myelin sheaths, the inner axon caliber and fiber diameter was measured. As shown in FIG.2-5E, g-ratio in EAE with reduced SF3B2 tended to be lower than the other two EAE controls. There was no significant difference, however, in average diameter of axon fibers among all groups (FIG.2-5F). Using a scatter plot showing g-ratio as a function of inner axon diameter, the distribution of myelinated nerve fibers was analyzed (FIG.2-5G). CFA control and EAE with AAV-SF3B2 shRNA groups shared a similar tendency in which smaller axons have higher g-ratio but larger fibers have thicker myelin sheaths compared to EAE mice without SF3B2 downregulation. For EAE diseased groups without SF3B2 modulation, as the axon diameter increased, g-ratio was likely to elevate, demonstrating that myelination was affected and remained incomplete during EAE progression. Table 2-6. Density of RGC axons in optic nerves of EAE mice. CFA ctrl (Mock EAE uninj EAE+AAV-GFP EAE+AAV- 7 2 9 2.3.4 Discussion 69 41766.101_P17245-01 Direct reduction of cellular SF3B2 level by RNAi has previously shown to make rat DRG neuronal cells (50B11) resistant to cisplatin-induced toxicity18, whereas it is not clear whether downregulating SF3B2 expression can also protect the CNS neurons following injury. By exploiting the tropism of AAV2-PHP.eb towards RGCs43-45and anatomical advantage of optic neuritis model, it was identified that downregulation of SF3B2 preserved RGCs and their axons against degeneration induced in EAE mice that manifest severe clinical defects. Multiple studies have reported that RGC survival in EAE can be improved by manipulating a certain signaling pathway or regulating a gene expression11-13,15. This observation means that modulating a specific molecular mechanism by which RGCs maintain their viability or degenerate in response to damage could serve as a therapeutic strategy to prevent neuronal death and visual dysfunction in MS patients. This Example determined that RGCs and their axonal integrity were rescued against degeneration and demyelination by reducing the expression of SF3B2. Demyelinated axons in MS lesions are susceptible to inflammatory environments full of cytokines, proteolytic enzymes, and free radicals that active immune and glial cells release46,47. Axon transection and destruction induced by this inflammatory damage not only lead to retrograde degeneration in RGCs, but also is likely responsible for permanent neurological disabilities48,49. Thus, the Example is meaningful in that it provided an evidence that SF3B2 and its underlying mechanism play an important role in inflammation-induced neurodegeneration and suppressing this protein can be an efficient therapeutic approach for MS to prevent incurable neurological impairment. Local transfer of AAV vectors into the eye enhances viral transduction into target cells and reduces the risk of being cleared by circulating anti-AAV antibodies compared to systemic administration37,50-52. Accordingly, a decline in SF3B2 level in RGCs was stably maintained until the end of the study and improved survival of RGCs was observed. Because viruses were delivered into a mouse eye locally and they have a tropism towards RGCs, however, this observation does not provide an information on the systemic effect of downregulated SF3B2 nor a potential influence on glial and immune cells: will the severity of clinical symptoms be curtailed by SF3B2 reduction? does it modulate immunopathological pathways in MS? In addition to current findings, further investigation on whether SF3B2 downregulation regulates the activity of immune and glial cells and mitigates 70 41766.101_P17245-01 neuropathological symptoms will suggest a comprehensive understanding of undiscovered role of SF3B2. 2.4 Reduction of SF3B2 by siRNA induces neuroprotective effect on neurons challenged with LPS-stimulated microglia media. 2.4.1 Introduction Multiple sclerosis (MS) is an inflammatory and demyelinating disease of the central nervous system, and its active lesions are characterized by infiltration of lymphocytes and T- cells attacking oligodendrocytes, phagocytic macrophages, and activated microglia releasing pro-inflammatory cytokines1,2,53. Immuno-regulatory mediators have been shown to be involved in MS pathogenesis, and the up-regulation of pro-inflammatory cytokines, such as IFN-γ, TNF-α, and IL-6, IL-12, has been commonly detected in brain lesions and cerebrospinal fluid (CSF) of MS patients30-32,54,55. To recapitulate this inflammatory environment in neuronal cultures in vitro, cortical neurons were exposed to LPS-stimulated microglial media containing high levels of several pro-inflammatory cytokines responsible for MS disease state28,56-58. By using RNAi strategy, it was found that knock down of SF3B2 preserved ATP levels and NAD concentrations, which are required for multiple cellular functions and axon maintenance59,60. Furthermore, the axonal elongation in mouse cortical neurons transduced with lentiviral-SF3B2 shRNA was maintained against degenerative processes caused by inflammatory damage. On the contrary, overexpression of SF3B2 in N2A cells displayed the opposite results; it suppressed further development of neurite elongation and branch formation and lowered NAD concentrations. 2.4.2 Materials and Methods 2.4.2.1 Primary culture of mouse cortical neurons C57BL / 6J pregnant mice were purchased from Jackson Laboratory. Cortices were isolated from embryonic day (E) 16 mouse embryos. Dissected tissues were dissociated with 0.25% trypsin and cells were counted using a hemocytometer and 0.2% trypan blue to exclude dead cells. Cells were seeded in tissue culture (TC)-treated plates precoated with Matrigel and microfluidic devices were precoated with poly-D-lysine. Cortical neurons were cultured in Neurobasal medium containing 2% B-27 supplement, 1% N-2 supplement, 0.5% GlutaMAX, 0.5% non-essential amino acids (NEAA), and 1% penicillin / streptomycin for the first 3 days. 71 41766.101_P17245-01 Half of the medium was changed with fresh Neurobasal medium supplemented with 2% B-27 supplement, 1% N-2 supplement, 1% penicillin / streptomycin every 2-3 days. 2.4.2.2 Neuro-2a (N2a) cell culture N2a cells (CLL-131) were purchased from American Type Culture Collection (ATCC). Cells with passage number 7-8 were used for experiments. Cells were maintained in Dulbecco’s modified eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin / streptomycin. N2a cells were differentiated using DMEM with 1% FBS and 10uM retinoic acid (RA) (Sigma, R2625) for 2 days following transfection with siRNA. 2.4.2.3 Conditioned medium from LPS-stimulated microglia (MCM) SIM-A9 cells (CRL-3265) were obtained from ATCC. Cells with passage number 8- 9 were used for experiments. Cells were cultured in DMEM / F12 medium plus 10% FBS, 1% penicillin / streptomycin. To make conditioned medium for further experiments, SIM-A9 cells were stimulated in DMEM / F12 medium containing 2% FBS and 100-ng / mL LPS or 2000- ng / mL LPS (Sigma, L6529), for N2A cells or cortical neurons, respectively. 24 hours later, supernatant was collected and used for experiments. Freshly prepared conditioned medium was used for all experiments. 2.4.2.4 Transfection and Plasmid Primary mouse cortical neurons (DIV2) or N2A cells were transfected with siRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778100) and plasmid DNA using Lipofectamine 3000 (Thermo Fisher Scientific, L3000001) following a manufacturer’s protocol with a little modification. Cells were incubated with serum-free medium for 1-2 hours prior to transfection and replenished with fresh complete medium 5-6 hours post transfection. 6-nM of siRNA for N2A cells and 25 nM of siRNA for cortical neurons were used, and 0.5 µg and 0.125 µg of DNA plasmid were added onto N2A cells cultured in 24-well plate and 96-well plate. siRNAs were purchased from Ambion (SF3B2 siRNA: S147808, negative control siRNA: 4390846). pcDNA3.1(+)-SF3B2-GFP contains the coding sequence of the mouse SF3B2 gene_(NM_030109.2) under the control of CMV promoter, and the control backbone vector expressing GFP was used as a control. Plasmids were purchased from GenScript. 2.4.2.5 Cortical neuronal culture on microfluidic devices 72 41766.101_P17245-01 5 x 104cortical neurons were seeded onto the cell body sector of devices pre-coated with of Poly-D-Lysine (PDL) at 100 µg / mL. At day 6, lentiviral particles at MOI 140 were added into the cell body sector, and 72 hours later axons growing in the axonal compartment were challenged with MCM. 2.4.2.6 ATP measurements Intracellular levels of ATP were measured using ViaLight Plus BioAssay kit (Lonza, LT07-121, 221). 5 x 104cortical neurons or 7 x 103N2a cells were seeded in Matrigel- precoated 96-well plate and transfection with siRNA was performed at 2 days in vitro (DIV) for cortical neurons and at day 1 for N2a cells. Cortical neurons were incubated with 1:1 mixture of microglial conditioned media (CM) with LPS and neurobasal medium containing 2% B27 minus AO (Thermo Fisher Scientific, 10889038). For N2a cells, 1:1 mixture of CM with LPS and DMEM containing 1% FBS and 10-μM retinoic acid was added. After 48 hours, ATP levels in each well were measured. CM without LPS incubation was used as a control. 2.4.2.7 NAD measurements Concentrations of NAD were measured using NAD / NADH-Glo Assay kit (Promega G9071, 9072).2 x 104cortical neurons or 2 x 103N2a cells were seeded in Matrigel-precoated 96-well plate. For cortical neurons, detailed experimental steps before the measurement were the same written in the method for ATP measurements. N2A cells were transfected with 0.125 µg of plasmid DNA and NAD concentrations were measured following the manufacturer’s protocol. 2.4.2.8 Western blotting Protein lysates were prepared using radio-immunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific, 89901), and concentrations were determined by BCA assay (Thermo Fisher Scientific, 23225). 10 µg of proteins were loaded and run on mini-protean TGX precast protein gels (Biorad, 456-1094, 145-1106) and transferred onto trans-blot turbo midi 0.2-µm polyvinylidene difluoride (PVDF) membranes (Biorad, 170-4157). The membranes were blocked with 5% blotting-grade blocker in tris-buffered saline with 0.1% tween 20 detergent (TBST) for 30 min and incubated with primary antibodies diluted in blocking buffer for overnight at 4 ℃. Following is the antibody information: Rabbit anti- SF3B2 (Cat: A301-605A, Bethyl, 1:2000); Rabbit anti-SF3B3 (Cat: A302-508A-T, Bethyl, 1:1000); Rabbit anti-SF3B4 (Cat: A303-950A-T, Bethyl, 1:1000); Rabbit anti-Caspase-3 73 41766.101_P17245-01 (Cat: 9662, Cell signaling technology (CST), 1:1000); Rabbit anti-Cleaved caspase-3 (Cat: 9661, CST, 1:1000); Mouse anti-β-actin (Cat: AC004, Neo Scientific, 1:4000). After triple washing steps, membranes were probed with secondary antibodies conjugated with HRP (goat anti-rabbit IgG antibody HRP-conjugate (MilliporeSigma, 12-348, 1:2000), goat anti-mouse IgG H&L HRP (abcam, ab6789, 1:2000) for 1 hour at RT. Bands were detected with Pierce ECL western blotting substrate (Thermo Fisher Scientific, 32106). 2.4.2.9 Lentivirus generation The third-generation pLL3.7 (plasmid #11795) lentiviral vector was purchased from Addgene, and U6 promoter with SF3B2 shRNAs or scrambled shRNA were cloned into NotⅠ and NsiⅠ sites of a backbone plasmid. All plasmids were packaged into lentivirus by the Boston Children’s Hospital Viral Core. Two shRNA sequences targeting mouse SF3B2 are listed in Table 2-1, and scrambled shRNA sequence is: 5’-CCTAAGGTTAAGTCGCCCTCG-CTCGAG-CGAGGGCGACTTAACCTTAGG-3’ (SEQ ID NO: 4). 2.4.2.10 Knockdown efficiency of lentiviral SF3B2 shRNAs by RT-PCR Primary cortical neurons were infected with lentivirus at MOI of 140 for 3 days. Total RNA was purified using Trizol (Thermo Fisher Scientific, 15596026) and RNA isolation kit (Zymo Research, R2070) following manufacturers’ protocol. Reverse transcription was carried out using SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific, 11754050), and 500 ng of cDNA samples in duplicate were analyzed in LightCycler 480 Real- Time PCR system (Roche) with KiCqStart SYBR GREEN qPCR ReadyMix (Sigma, KCQS00). RNA and DNA concentrations were determined by Nano Drop 2000 (Thermo Fisher Scientific). RT-PCR data were normalized to the mean of three housekeeping genes mRNA expression levels (HPRT1, HMBS, 18S rRNA). Primer information is listed in section 2.5. 2.4.2.11 Immunofluorescence staining Cells were fixed in 4% paraformaldehyde for 50 min at room temperature and washed three times with PBS. Fixed cells were permeabilized and blocked with 0.25% Triton X-100 and 5% goat serum in PBS for 30 min. Cells were incubated with mouse monoclonal anti- TAU-1 (1:300, MilliporeSigma, MAB3420) diluted in blocking solution overnight at 4°C. Non-immune IgG isotype (Thermo Fisher Scientific, 10400C) was used as a negative control 74 41766.101_P17245-01 at concentration identical to the primary antibody. Following primary antibody incubation, cells were rinsed in PBS twice, and incubated with Alexa Fluor 555 anti-mouse secondary antibody (1:500, Thermo Fisher Scientific, A21424) diluted in blocking solution for 2 hours at RT. Cells were washed in PBS, stained with Hoechst 33342 (1:5000, Thermo Fisher Scientific, 62249) for nuclear visualization, and then rinsed in PBS three times for visualization. 2.4.2.12 Axon outgrowth analysis Primary cortical neurons in microfluidic chambers were infected with lentiviral shRNA (MOI of 140) for 24 hours at day 6 and treated with microglial CM at day 9 for 24 hours. To evaluate axon sprouting, areas covered by Tau-1 positive axons and the number of axons extending beyond 750 μm from the opening of the channels were quantified. 2.4.3 Results 2.4.3.1 Validation of siRNA-mediated knockdown of SF3B2 and the primary antibody specificity. SF3b is a heptameric complex of U2 small nuclear ribonucleoprotein (snRNP), and SF3B2 is one of the components of SF3b16,61,62. SF3B2, our protein of interest, is in direct contact with SF3B3 and SF3B4, which stabilizes the duplex of the U2 snRNA and the branch point sequence during splicing process63,64. To confirm whether siRNA specifically targets SF3B2, N2A cells were transfected with siRNA and a western blot was performed. The primary antibody selectively recognized SF3B2 protein (FIG.2-7A) and a decline in SF3B2 expression from cells transfected with siRNA was observed (FIG.2-7B). In addition, siRNA targeting SF3B2 did not modulate the level of SF3B3 and SF3B4 (FIG.2-7C, FIG.2-7D, FIG. 2-7E). 2.4.3.2 Reduction of SF3B2 by RNAi preserves cell viability of neurons challenged with LPS- stimulated microglia media. LPS is an endotoxin and is a component of outer membrane of gram-negative bacteria65. When microglia are exposed to LPS, they release pro-inflammatory cytokines, such as IFN-γ, TNF-α, and IL-6, which are important mediators for MS pathogenesis28,56-58. Before incubating cortical neurons with the supernatant of LPS-incubated microglia (MCM), its cellular toxicity was examined. As shown in FIG. 2-8A and FIG. 2-8D, cleaved form of 75 41766.101_P17245-01 caspase-3 was elevated by about 413% in neurons compared to the control group. Control group was treated with the supernatant of microglia culture without LPS incubation. To evaluate the effect of downregulated SF3B2 in cultured neurons, N2A cells and mouse primary cortical neurons (PCNs) were challenged with MCM. Cell viability was first investigated by measuring ATP levels. Neurons plated in 96-well plate were transfected with siRNA and, 24 hrs later, they were exposed to MCM for 48 hrs. Addition of MCM led to a decline in ATP levels in both N2A cells and PCNs (34.67% and 21.66% reduction in ATP levels compared to the group with scrambled siRNA / control media, N2A and PCNs, respectively). When SF3B2 protein was reduced by RNAi, however, cell viability was preserved in comparison with the group transfected with scrambled siRNA (N2A; 87.15 ± 9.88% and 57.94 ± 4.76%, PCNs; 99.0527 ± 4.26% and 80.27656 ± 4.53% for SF3B2 siRNA / MCM and scrambled siRNA / MCM, respectively) (FIG. 2-8E and FIG. 2-8F). Furthermore, concentrations of NAD in cortical neurons treated with MCM, which is another indicator for axon degeneration, were assessed (FIG.2-8G). Rapid reduction in NAD levels has been shown to correlate with axon degeneration59,66,67, and it was found that with siRNA- mediated SF3B2 knockdown, concentrations of NAD in cortical neurons were maintained even challenged with toxic MCM. 2.4.3.3 Lentiviral-mediated SF3B2 gene knockdown protects axonal length against degeneration induced by inflammatory stress. To further identify whether the axonal integrity is maintained by SF3B2 downregulation, we performed a long-term culture of PCNs on microfluidic devices, which enable the isolation of axons from cell bodies. After the treatment with MCM, neurons were immunostained for axonal protein (Tau-1) and the entire axon compartment was imaged. To determine the axonal projection, areas covered by axons were semi-automatically analyzed, and axons extending beyond 750 μm from the opening of the channels were quantified. According to the data, inflammatory toxicity from MCM caused degeneration of axons. In contrast, axons were greatly protected from degeneration when SF3B2 was reduced, as indicated by substantially higher numbers of axons reaching over a set distance (3 / 4 of the entire axonal sector), as well as increased areas occupied by axonal processes (axonal area; 106.31 ± 8.39% and 53.78 ± 6.06%, axon counts; 140.8307 ± 28.29% and 28.83 ± 12.79% for 76 41766.101_P17245-01 lentiviral SF3B2 shRNA / MCM and lentiviral scrambled shRNA / MCM, respectively) (FIG. 2-9). 2.4.3.4 Overexpression of SF3B2 has an adverse impact on neurite development. Given that knockdown of SF3B2 was neuroprotective against inflammatory injury to axons, we then considered whether overexpression of SF3B2 had any effect on axonal integrity. To assess the impact of increased SF3B2 levels on neurite outgrowth, the neurite morphology was examined and NAD concentrations were measured. N2A cells were transfected with a plasmid coding for GFP or SF3B2-GFP, and immunocytochemistry and NAD assay were carried out. In contrast to GFP control, N2A cells overexpressing SF3B2 had a marked reduction in number of neurons with neurites, and those with neurites displayed fewer total number of branches and had shorter neurites (FIG. 2-10A-FIG. 2-10E). This pruning of neurite growth was correlated with significantly lowered NAD concentrations in cells with elevated level of SF3B2 compared to controls (FIG.2-10G). 2.4.4 Discussion In line with the data from the in vivo EAE model, this Example has demonstrated that siRNA- or lentiviral shRNA-mediated knock down of SF3B2 exerted protective effects on mouse cortical neurons and N2A cells exposed to LPS-stimulated microglial media. Microglia are the resident immune cells in the CNS and play a key role in the pathogenesis of MS68-70. Activated microglia release pro-inflammatory cytokines and chemokines, and especially in response to the treatment with LPS, they have been known to produce excess amount of TNF- α, IFN-γ, and IL-6 which are the main mediators for immune response in MS active lesions28,56-58. Thus, to recapitulate neuroinflammation in vitro, cortical neurons were incubated with MCM and it led to substantial increase in cleaved caspase-3 expression. In this Example, it was shown that siRNA-mediated reduction of SF3B2 enhanced cell viability of N2A cells and cortical neurons challenged with MCM. In addition, NAD concentrations in neurons were maintained compared to control, indicating that axonal degeneration following inflammatory damage was suppressed by SF3B2 reduction. NAD is an essential substrate to maintain axonal integrity, given that a decrease in NAD level has been shown to be associated with axon degeneration caused by both mechanical and chemical injury, and maintaining its concentration by adding NAD protected axons from degenerative process59,66,71. Accordingly, reducing cellular level of SF3B2 can be a promising approach to prevent ATP loss and NAD 77 41766.101_P17245-01 depletion caused by inflammatory neurodegeneration. Axonal outgrowth results shown in this study is another important evidence on protective effect of decreased SF3B2. Compared to the control group exhibiting compromised growth of axons, downregulation of SF3B2 rendered cortical neurons competent to elongate their axons against inflammatory toxicity. While MCM-induced neuronal damage was prevented by SF3B2 reduction, it was found that overexpressing this protein suppressed neurite development and caused a substantial decline in NAD concentrations. Based on this evidence that neuronal response varied depending on the level of SF3B2 expression, without wishing to be bound to any one particular theory, it is thought that SF3B2 may have a novel function in controlling cellular response to stress conditions, along with its canonical role as a splicing factor. To comprehensively understand its additional role, mechanistic studies revealing the potential genes and signaling pathways modulated by SF3B2 are critical. These may point to SF3B2 as a therapeutic target for neuroprotection. 2.5 Gene expression analysis in SF3B2-reduced cortical neurons following inflammatory damage. 2.5.1 Introduction Cultured neurons exposed to inflammatory environment containing TNF-α, IFN-γ, and IL-6, which are secreted from activated microglia28,56-58, can be exploited as an in vitro model of neuro-inflammatory disease. Using this culture system and lentivirus as an efficient vehicle72, candidate genes and signaling pathways were screened to examine which ones are modulated by SF3B2 downregulation to exert protective effect. Pro-inflammatory cytokines found in MS lesions are neurotoxic, and especially, elevated level of TNF-α with a combination of other inflammatory factors is known to induce neuronal death through necroptosis or caspase-dependent apoptotic mechanism73-78. Here, whether reduced SF3B2 influences necroptosis or apoptosis was examined by measuring mRNA transcription levels of associated genes79,80. Furthermore, the expression of regeneration-associated genes (RAG)81-83was examined to determine whether SF3B2 downregulation is involved in preventing neurodegeneration or promoting regenerative state after injury. Based on qPCR results, MCM treatment increased the expression of necroptotic and RAG genes in neurons treated with scrambled shRNA, indicating that inflammatory mediators secreted by microglia were detrimental to neurons. Interestingly, there was a substantial decrease in gene expression 78 41766.101_P17245-01 levels when neurons were transduced with lentiviral SF3B2 shRNA, which demonstrates that lowering SF3B2 led neurons to become resistant to inflammatory insults and activation of necroptotic pathway. 2.5.2 Materials and Methods 2.5.2.1 RNA isolation and quantitative PCR Total RNAs of cortical neurons were extracted at 24 hours post MCM incubation. Detailed experimental steps were described in section 2.4. KiCqStart SYBR Green Primers were purchased from MilliporeSigma. Table 2-7. qPCR primer sequences. Gene Primer sequences 79 41766.101_P17245-01 Atf3 F: AAGACTGGAGCAAAATGATG, R: GTCAGGTTAGCAAAATCCTC Gap43 F: GAACCAAACAGGTTGAAAAG R:GGAAGCTAGCCTGAATTTTG 2.5.2.2 Statistical analysis All statistical analyses were performed by t-test or two-way ANOVA or simple linear regression or one-way ANOVA with Tukey’s multiple comparison test using GraphPad (Prism version 9). All data are presented as mean ± SEM. Statistical significance was considered when p-value was less than 0.05. 2.5.3 Results 2.5.3.1 Necroptosis activation was suppressed by lentiviral-mediated SF3B2 reduction. To identify certain genes or pathways by which SF3B2 downregulation makes neurons resistant to degeneration, the expression levels of 25 candidate genes involved in necroptosis, apoptosis, and injury-response were investigated. PCNs were first infected with lentiviral shRNA at DIV 6 for 72 hours, and challenged with MCM for 24 hours prior to RNA isolation. MCM upregulated mRNA levels of several necroptosis-related genes, specifically Tnf-α, Ripk3 and Mlkl. More importantly, however, it was found that MCM-induced upregulation of the expression of Tnf-α, Ripk3, and Mlkl was markedly attenuated in neurons where SF3B2 expression was knocked down with shRNA across multiple independent experiments (FIG. 2-11A). This suppressed expression of necroptotic genes in addition to enhanced cell viability data supported that a reduction in SF3B2 levels was sufficient to prevent activation of 80 41766.101_P17245-01 necroptosis in neurons exposed to inflammatory environment, which mimic injured lesion of MS. In contrast, caspases-8, -9, and -3 involved in initiating and executing apoptotic death84,85showed no transcriptional difference between scrambled control and SF3B2 downregulated groups. Neurons treated with lentiviral SF3B2 shRNA also had similar expression levels of Bcl-2 family members compared to the scrambled control neurons treated with MCM. 2.5.3.2 Downregulation of SF3B2 in neurons prevents inflammatory damage. To determine the impact of reducing SF3B2 protein in neurons on injury response, the mRNA levels of several regeneration-associated genes and genes involved in Wallerian degeneration pathway81-83,86were screened. It was found that inflammatory stress elicited by MCM markedly increased the transcription of Atf3, Gadd45a, Gap43, Stmn2, Myc, Tgfb1 compared to the control groups (FIG.2-11B). These genes have been shown to be upregulated upon neuronal damage87-92, thus, it represents that cortical neurons were injured by the toxicity of MCM. As shown in FIG.2-11B, however, neurons with SF3B2 shRNA had substantially decreased level of regeneration-associated gene expression. Together, these findings indicate that SF3B2 downregulation enabled neurons to be resistant and less susceptible to inflammation-induced cellular damage. Further examination of the expression of genes involved in axon degeneration showed that there was no difference in mRNA levels except Calpain 1. 2.5.4 Discussion In addition to biochemical assays and morphological examination, the possible mechanisms orchestrated by SF3B2 knockdown, which result in enhanced neuronal survival, were explored by gene expression studies. To determine whether lower levels of SF3B2 prevents neurons from degeneration, the transcriptional levels of necroptotic and apoptotic genes79,80were first assessed. Although no difference was observed in the expression of several genes involved in apoptosis, neurons with lentiviral SF3B2 shRNA exhibited a significantly downregulated mRNA levels of Ripk3, Tnf-α, and the executioner Mlkl, upon exposure to the treatment with neurotoxic media. Besides, many RAGs, including Aft3, Gap43, which are elevated after injury to promote recovery81,87,88,93, showed a similar pattern of repressed expression in neurons with lowered SF3B2. These results support the hypothesis that downregulating cellular level of SF3B2 preserves neuronal survival and axon maintenance against to neurotoxic cytokines via inhibiting the activation of necroptosis and 81 41766.101_P17245-01 exhibit diminished vulnerability to injury. How these pathways are targeted by a decline in SF3B2, what other signaling are altered, and which factors directly bind to this protein and trigger protective effects remain to be unveiled. 2.6 Summary This Example demonstrated that SF3B2 downregulation by AAV-shRNA, lentiviral- shRNA, or siRNA, enabled CNS neurons to become resistant to inflammatory insults, leading to preservation of neuronal and axonal integrity. Many researchers have focused on finding potential target genes to protect neurons or promote regeneration against degenerative processes94,95. This focus is because, unlike neurons in PNS, CNS neurons lack the capability to spontaneously enter a regenerative state following injury, which is mediated by coordinated changes in transcription and epigenetic modifications83,96-98. Taking advantage of genetic modulation, many groups have shown protective effect of overexpressed or inactivated genes in diverse CNS injury models81,99-101. Axonal regeneration can be induced by deleting PTEN or overexpressing SOX11, revealing that altering the expression of target gene in injured CNS neurons is sufficient to reprogram neurons into a growth-promoting state94,95,100,102. In EAE mice, an animal model for MS4,6, modulation of certain genes, such as Sirt1, Klf4, Eif2α-Chop, Xbp-1, induces a neuroprotective effect; alleviating clinical symptoms, improving visual function, promoting neuronal survival, reducing myelin loss12,14,15,25. Moreover, inactivation of CCR5 signaling has been found to trigger axon projection and functional recovery of CNS neurons in stroke and traumatic brain injury animal103,104. From this aspect, this discovery on the novel role of SF3B2 protein, enhancing neuronal survival against inflammatory damage, provides a new therapeutic approach to antagonize inflammation-induced neurodegeneration. Previous work from our laboratory found that RNAi-mediated decline of SF3B2 prevented cisplatin-induced toxicity in 50B11 cells, a rat DRG neuronal cell line18. The present results show that downregulation of SF3B2 can exert protective effect on CNS neurons against inflammatory neurotoxicity, as well. First, by exploiting the tropism of AAV2 / PHP.eb particles toward RGCs45, cellular level of SF3B2 was stably diminished during the disease progression and it resulted in increased RGC survival and attenuated myelin defects in EAE mice. Morphologically preserved axons and myelin sheaths as opposed to degenerative processes demonstrate that SF3B2 reduction in neurons plays an important role 82 41766.101_P17245-01 in protecting autoimmune-related damage, leading to RGC survival. This result supports that targeting neuronal SF3B2 could be a promising therapeutic intervention for MS and may facilitate functional recovery with enhanced neuronal survival following injury. Studies on neuronal culture system recapitulating active lesions of MS demonstrate neurons with SF3B2 shRNA become resistant to inflammatory stress. It was found that downregulation of SF3B2 in neurons maintained the level of ATP, an indicator for cell viability105, after the exposure to toxic media. On top of this, neurons with SF3B2 knockdown exhibited extensive axon projections comparable to the control group treated with regular media. In accordance with this protection in axonal morphology, these neurons maintained NAD concentrations which were markedly reduced in scrambled control group. Considering the necessity of NAD for retaining axonal structure and function59,106,107, downregulation of SF3B2 helped neurons become less affected by pro-inflammatory mediators in MCM, raising a possibility that certain upstream molecules depleting NAD level could be inactivated by SF3B2 knockdown. Of note, qPCR analysis showed that necroptosis and injury-signaling were governed by SF3B2 level. The expression of necroptotic genes, such as Ripk3, Mlkl, Tnf-α, was markedly repressed in neurons with SF3B2 shRNA and toxic media compared to scrambled control. TNF-α signaling with other inflammatory factors released by activated microglia triggers RIPK1-RIPK3-MLKL axis required for necroptosis80,108,109. In addition, neurons have been shown to express TNF-α following injury110-112, and based on that, it is possible that TNF-α-induced necroptotic mechanism is potentiated in cultured neurons treated with toxic media. Thus, this qPCR data indicates that SF3B2 downregulation interfered with neuronal response to inflammatory insult, leading to a dramatic decline in the mRNA levels of Ripk3, Mlkl, and Tnf-α. Besides, it also is possible that the reason RAG gene upregulation was inhibited in neurons with SF3B2 shRNA is a diminished sensitivity to detrimental signals which elicit a rapid influx of calcium and calcium-mediated signaling, and ultimately trigger injury response113,114. Thus, reducing the level of SF3B2 could promote neuronal survival and axonal maintenance against inflammatory toxicity by disrupting the activity of necroptosis and injury-signaling pathways. In summary, the presently disclosed findings reveal that downregulation of SF3B2 in CNS neurons exerts a novel and protective role in inflammation-mediated neurodegeneration, 83 41766.101_P17245-01 and targeting this protein could be a valuable therapeutic approach to prevent neuro-axonal impairments in MS. Table 2-8 List of Abbreviations Abbreviation Meanin REFERENCES 1. Ackermann, E. J. et al. Clinical development of an antisense therapy for the treatment of transthyretin-associated polyneuropathy. Amyloid 19 Suppl 1, 43-44 (2012). 2. Aktas, O., Ullrich, O., Infante-Duarte, C., Nitsch, R. & Zipp, F. Neuronal damage in brain inflammation. Arch Neurol 64, 185-189 (2007). 3. Andersson, M., Sjostrand, J., Petersen, A., Honarvar, A. K. & Karlsson, J. O. Caspase and proteasome activity during staurosporin-induced apoptosis in lens epithelial cells. Invest Ophthalmol Vis Sci 41, 2623-2632 (2000). 4. Araki, T., Sasaki, Y. & Milbrandt, J. Increased nuclear NAD biosynthesis and SIRT1 activation prevent axonal degeneration. Science 305, 1010-1013 (2004). 5. Arrázola, M. S. et al. Axonal Degeneration Is Mediated by Necroptosis Activation. The Journal of Neuroscience 39, 3832-3844 (2019). 84 41766.101_P17245-01 Ates, I., Rathbone, T., Stuart, C., Bridges, P. H. & Cottle, R. N. Delivery Approaches for Therapeutic Genome Editing and Challenges. Genes 11, 1113 (2020). Au - Vacca, O. et al. Using Adeno-associated Virus as a Tool to Study Retinal Barriers in Disease. JoVE, e52451 (2015). Baecher-Allan, C., Kaskow, B. J. & Weiner, H. L. Multiple Sclerosis: Mechanisms and Immunotherapy. Neuron 97, 742-768 (2018). Bainbridge, J. W. et al. Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med 358, 2231-2239 (2008). Bang, B., Baadsgaard, O., Skov, L. & Jaattela, M. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells. Arch Dermatol Res 296, 67-73 (2004). Benveniste, E. N. Role of macrophages / microglia in multiple sclerosis and experimental allergic encephalomyelitis. Journal of Molecular Medicine 75, 165-173 (1997). Bertheloot, D., Latz, E. & Franklin, B. S. Necroptosis, pyroptosis and apoptosis: an intricate game of cell death. Cell Mol Immunol 18, 1106-1121 (2021). Blais, V. & Rivest, S. Effects of TNF-alpha and IFN-gamma on nitric oxide-induced neurotoxicity in the mouse brain. J Immunol 172, 7043-7052 (2004). Blank, M., Enzlein, T. & Hopf, C. LPS-induced lipid alterations in microglia revealed by MALDI mass spectrometry-based cell fingerprinting in neuroinflammation studies. Sci Rep 12, 2908 (2022). Block, M. L. & Hong, J. S. Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Prog Neurobiol 76, 77-98 (2005). Botchkina, G. I., Meistrell, M. E., 3rd, Botchkina, I. L. & Tracey, K. J. Expression of TNF and TNF receptors (p55 and p75) in the rat brain after focal cerebral ischemia. Mol Med 3, 765-781 (1997). Brionne, T. C., Tesseur, I., Masliah, E. & Wyss-Coray, T. Loss of TGF-β1 Leads to Increased Neuronal Cell Death and Microgliosis in Mouse Brain. Neuron 40, 1133- 1145 (2003). Cao, L. & Mu, W. Necrostatin-1 and necroptosis inhibition: Pathophysiology and therapeutic implications. Pharmacol Res 163, 105297 (2021). Cetinkaya-Fisgin, A. et al. Development of EQ-6, a Novel Analogue of Ethoxyquin to Prevent Chemotherapy-Induced Peripheral Neuropathy. Neurotherapeutics 18, 2061-2072 (2021). Chamberlain, K. A. & Sheng, Z.-H. Mechanisms for the maintenance and regulation of axonal energy supply. J Neurosci Res 97, 897-913 (2019). Champion-Arnaud, P. & Reed, R. The prespliceosome components SAP 49 and SAP 145 interact in a complex implicated in tethering U2 snRNP to the branch site. Genes Dev 8, 1974-1983 (1994). Chan, K. Y. et al. Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat Neurosci 20, 1172-1179 (2017). Chandran, V. et al. A Systems-Level Analysis of the Peripheral Nerve Intrinsic Axonal Growth Program. Neuron 89, 956-970 (2016). 85 41766.101_P17245-01 Chemokine Receptors CC Chemokine Receptor 5 and C-X-C Motif Chemokine Receptor 4 Are New Therapeutic Targets for Brain Recovery after Traumatic Brain Injury. Journal of Neurotrauma 38, 2003-2017 (2021). Cherry, J. D., Olschowka, J. A. & O'Banion, M. K. Neuroinflammation and M2 microglia: the good, the bad, and the inflamed. J Neuroinflammation 11, 98 (2014). Chitnis, T. & Weiner, H. L. CNS inflammation and neurodegeneration. J Clin Invest 127, 3577-3587 (2017). Coleman, M. P. & Höke, A. Programmed axon degeneration: from mouse to mechanism to medicine. Nature Reviews Neuroscience 21, 183-196 (2020). Dayton, R. D., Grames, M. S. & Klein, R. L. More expansive gene transfer to the rat CNS: AAV PHP.EB vector dose-response and comparison to AAV PHP.B. Gene Ther 25, 392-400 (2018). Dhani, S., Zhao, Y. & Zhivotovsky, B. A long way to go: caspase inhibitors in clinical use. Cell Death Dis 12, 949 (2021). Dhuriya, Y. K. & Sharma, D. Necroptosis: a regulated inflammatory mode of cell death. Journal of Neuroinflammation 15, 199 (2018). di Penta, A. et al. Oxidative stress and proinflammatory cytokines contribute to demyelination and axonal damage in a cerebellar culture model of neuroinflammation. PLoS One 8, e54722 (2013). Di Stefano, M. et al. A rise in NAD precursor nicotinamide mononucleotide (NMN) after injury promotes axon degeneration. Cell Death & Differentiation 22, 731-742 (2015). Dong, Y. & Yong, V. W. When encephalitogenic T cells collaborate with microglia in multiple sclerosis. Nature Reviews Neurology 15, 704-717 (2019). Duan, X. et al. Inhibition of keratinocyte necroptosis mediated by RIPK1 / RIPK3 / MLKL provides a protective effect against psoriatic inflammation. Cell Death Dis 11, 134 (2020). Dutta, R. & Trapp, B. D. Mechanisms of neuronal dysfunction and degeneration in multiple sclerosis. Prog Neurobiol 93, 1-12 (2011). Erecińska, M. & Silver, I. A. ATP and brain function. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 9, 2-19 (1989). Essuman, K. et al. The SARM1 Toll / Interleukin-1 Receptor Domain Possesses Intrinsic NAD(+) Cleavage Activity that Promotes Pathological Axonal Degeneration. Neuron 93, 1334-1343 e1335 (2017). Fagoe, N. D., Attwell, C. L., Kouwenhoven, D., Verhaagen, J. & Mason, M. R. J. Overexpression of ATF3 or the combination of ATF3, c-Jun, STAT3 and Smad1 promotes regeneration of the central axon branch of sensory neurons but without synergistic effects. Human Molecular Genetics 24, 6788-6800 (2015). Farooqi, N., Gran, B. & Constantinescu, C. S. Are current disease-modifying therapeutics in multiple sclerosis justified on the basis of studies in experimental autoimmune encephalomyelitis? J Neurochem 115, 829-844 (2010). Filippi, M. et al. Multiple sclerosis. Nature Reviews Disease Primers 4, 43 (2018). 86 41766.101_P17245-01 Friese, M. A. et al. The value of animal models for drug development in multiple sclerosis. Brain 129, 1940-1952 (2006). Galanos, C. & Freudenberg, M. A. Mechanisms of endotoxin shock and endotoxin hypersensitivity. Immunobiology 187, 346-356 (1993). Gerdts, J., Summers, D. W., Milbrandt, J. & DiAntonio, A. Axon Self-Destruction: New Links among SARM1, MAPKs, and NAD+ Metabolism. Neuron 89, 449-460 (2016). Gilley, J. & Coleman, M. P. Endogenous Nmnat2 Is an Essential Survival Factor for Maintenance of Healthy Axons. PLOS Biology 8, e1000300 (2010). Golas, M. M., Sander, B., Will, C. L., Luhrmann, R. & Stark, H. Major conformational change in the complex SF3b upon integration into the spliceosomal U11 / U12 di-snRNP as revealed by electron cryomicroscopy. Mol Cell 17, 869-883 (2005). Golas, M. M., Sander, B., Will, C. L., Luhrmann, R. & Stark, H. Molecular architecture of the multiprotein splicing factor SF3b. Science 300, 980-984 (2003). Greer, J. M. & McCombe, P. A. Role of gender in multiple sclerosis: clinical effects and potential molecular mechanisms. J Neuroimmunol 234, 7-18 (2011). Guerrero, B. L. & Sicotte, N. L. Microglia in Multiple Sclerosis: Friend or Foe? Front Immunol 11, 374 (2020). Guo, X., Snider, W. D. & Chen, B. GSK3β regulates AKT-induced central nervous system axon regeneration via an eIF2Bε-dependent, mTORC1-independent pathway. eLife 5, e11903 (2016). Haines, J. D., Inglese, M. & Casaccia, P. Axonal damage in multiple sclerosis. Mt Sinai J Med 78, 231-243 (2011). Hoglund, R. A. & Maghazachi, A. A. Multiple sclerosis and the role of immune cells. World J Exp Med 4, 27-37 (2014). Huang, H. et al. Neuroprotection by eIF2α-CHOP inhibition and XBP-1 activation in EAE / optic neuritiss. Cell Death & Disease 8, e2936-e2936 (2017). Huang, W. C. et al. Sophoraflavanone G from Sophora flavescens induces apoptosis in triple-negative breast cancer cells. Phytomedicine 61, 152852 (2019). Huang, W.-X., Huang, P. & Hillert, J. Increased expression of caspase-1 and interleukin-18 in peripheral blood mononuclear cells in patients with multiple sclerosis. Multiple Sclerosis Journal 10, 482-487 (2004). Huebner, E. A. & Strittmatter, S. M. Axon regeneration in the peripheral and central nervous systems. Results Probl Cell Differ 48, 339-351 (2009). James, R. E. et al. Persistent elevation of intrathecal pro-inflammatory cytokines leads to multiple sclerosis-like cortical demyelination and neurodegeneration. Acta Neuropathologica Communications 8, 66 (2020). Jin, J. et al. Glial pathology and retinal neurotoxicity in the anterior visual pathway in experimental autoimmune encephalomyelitis. Acta Neuropathol Commun 7, 125 (2019). Joy, M. T. et al. CCR5 Is a Therapeutic Target for Recovery after Stroke and Traumatic Brain Injury. Cell 176, 1143-1157.e1113 (2019). 87 41766.101_P17245-01 Kamm, C. P., Uitdehaag, B. M. & Polman, C. H. Multiple sclerosis: current knowledge and future outlook. Eur Neurol 72, 132-141 (2014). Kawamura, N. et al. SF3B2-Mediated RNA Splicing Drives Human Prostate Cancer Progression. Cancer Res 79, 5204-5217 (2019). Kim, M. J. & Yoo, J. Y. Active caspase-1-mediated secretion of retinoic acid inducible gene-I. J Immunol 181, 7324-7331 (2008). Kipp, M. et al. Experimental in vivo and in vitro models of multiple sclerosis: EAE and beyond. Mult Scler Relat Disord 1, 15-28 (2012). Kiraz, Y., Adan, A., Kartal Yandim, M. & Baran, Y. Major apoptotic mechanisms and genes involved in apoptosis. Tumor Biology 37, 8471-8486 (2016). Koller, H., Thiem, K. & Siebler, M. Tumour necrosis factor-alpha increases intracellular Ca2+ and induces a depolarization in cultured astroglial cells. Brain 119 ( Pt 6), 2021-2027 (1996). Kwon, J. et al. Differential Effects of Toll-Like Receptor Activation and Differential Mediation by MAP Kinases of Immune Responses in Microglial Cells. Cell Mol Neurobiol 42, 2655-2671 (2022). Lassmann, H. & Bradl, M. Multiple sclerosis: experimental models and reality. Acta Neuropathol 133, 223-244 (2017). Lee, J. Y., Taghian, K. & Petratos, S. Axonal degeneration in multiple sclerosis: can we predict and prevent permanent disability? Acta Neuropathol Commun 2, 97 (2014). Lee, S. C., Liu, W., Dickson, D. W., Brosnan, C. F. & Berman, J. W. Cytokine production by human fetal microglia and astrocytes. Differential induction by lipopolysaccharide and IL-1 beta. J Immunol 150, 2659-2667 (1993). Li, J. & Yuan, J. Caspases in apoptosis and beyond. Oncogene 27, 6194-6206 (2008). Li, S., Gu, X. & Yi, S. The Regulatory Effects of Transforming Growth Factor-beta on Nerve Regeneration. Cell Transplant 26, 381-394 (2017). Li, Y., Struebing, F. L., Wang, J., King, R. & Geisert, E. E. Different Effect of Sox11 in Retinal Ganglion Cells Survival and Axon Regeneration. Frontiers in Genetics 9 (2018). Liu, T. et al. Tumor necrosis factor-alpha expression in ischemic neurons. Stroke 25, 1481-1488 (1994). Liu, Y., Hegarty, S., Winter, C., Wang, F. & He, Z. Viral vectors for neuronal cell type-specific visualization and manipulations. Curr Opin Neurobiol 63, 67-76 (2020). Lively, S. & Schlichter, L. C. Microglia Responses to Pro-inflammatory Stimuli (LPS, IFNgamma+TNFalpha) and Reprogramming by Resolving Cytokines (IL-4, IL-10). Front Cell Neurosci 12, 215 (2018). Luo, C. et al. The role of microglia in multiple sclerosis. Neuropsychiatr Dis Treat 13, 1661-1667 (2017). Ma, T. C. & Willis, D. E. What makes a RAG regeneration associated? Frontiers in Molecular Neuroscience 8, (2015). Maguire, A. M. et al. Age-dependent effects of RPE65 gene therapy for Leber's congenital amaurosis: a phase 1 dose-escalation trial. Lancet 374, 1597-1605 (2009). 88 41766.101_P17245-01 Maimone, D., Gregory, S., Arnason, B. G. W. & Reder, A. T. Cytokine levels in the cerebrospinal fluid and serum of patients with multiple sclerosis. Journal of Neuroimmunology 32, 67-74 (1991). Maldonado, R. F., Sá-Correia, I. & Valvano, M. A. Lipopolysaccharide modification in Gram-negative bacteria during chronic infection. FEMS Microbiology Reviews 40, 480-493 (2016). Manno, C. S. et al. AAV-mediated factor IX gene transfer to skeletal muscle in patients with severe hemophilia B. Blood 101, 2963-2972, (2003). Marambaud, P., Dreses-Werringloer, U. & Vingtdeux, V. Calcium signaling in neurodegeneration. Molecular Neurodegeneration 4, 20 (2009). Masin, L. et al. A novel retinal ganglion cell quantification tool based on deep learning. Scientific Reports 11, 702 (2021). Mathiesen, S. N., Lock, J. L., Schoderboeck, L., Abraham, W. C. & Hughes, S. M. CNS Transduction Benefits of AAV-PHP.eB over AAV9 Are Dependent on Administration Route and Mouse Strain. Mol Ther Methods Clin Dev 19, 447-458 (2020). Matsunaga, Y. et al. Visual functional and histopathological correlation in experimental autoimmune optic neuritis. Invest Ophthalmol Vis Sci 53, 6964-6971 (2012). McIlwain, D. R., Berger, T. & Mak, T. W. Caspase functions in cell death and disease. Cold Spring Harb Perspect Biol 5, a008656 (2013). Mercuri, E. et al. Nusinersen versus Sham Control in Later-Onset Spinal Muscular Atrophy. N Engl J Med 378, 625-635 (2018). Mingozzi, F. & High, K. A. Immune responses to AAV vectors: overcoming barriers to successful gene therapy. Blood 122, 23-36 (2013). Minogue, A. M., Barrett, J. P. & Lynch, M. A. LPS-induced release of IL-6 from glia modulates production of IL-1beta in a JAK2-dependent manner. J Neuroinflammation 9, 126 (2012). Mintzer, R. et al. A whole cell assay to measure caspase-6 activity by detecting cleavage of lamin A / C. PLoS One 7, e30376 (2012). Moore, D. L. & Goldberg, J. L. Multiple transcription factor families regulate axon growth and regeneration. Dev Neurobiol 71, 1186-1211 (2011). Moujalled, D., Strasser, A. & Liddell, J. R. Molecular mechanisms of cell death in neurological diseases. Cell Death Differ 28, 2029-2044 (2021). Nagappan, P. G., Chen, H. & Wang, D.-Y. Neuroregeneration and plasticity: a review of the physiological mechanisms for achieving functional recovery postinjury. Military Medical Research 7, 30 (2020). Nakajima, E., Hammond, K. B., Shearer, T. R. & Azuma, M. Activation of the mitochondrial caspase pathway and subsequent calpain activation in monkey RPE cells cultured under zinc depletion. Eye (Lond) 28, 85-92 (2014). Naldini, L. Lentiviruses as gene transfer agents for delivery to non-dividing cells. Current Opinion in Biotechnology 9, 457-463 (1998). 89 41766.101_P17245-01 Narciso, M. S., Hokoc, J. N. & Martinez, A. M. Watery and dark axons in Wallerian degeneration of the opossum's optic nerve: different patterns of cytoskeletal breakdown? An Acad Bras Cienc 73, 231-243 (2001). Naso, M. F., Tomkowicz, B., Perry, W. L., 3rd & Strohl, W. R. Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs : clinical immunotherapeutics, biopharmaceuticals and gene therapy 31, 317-334 (2017). Nimmagadda, V. K. et al. Overexpression of SIRT1 protein in neurons protects against experimental autoimmune encephalomyelitis through activation of multiple SIRT1 targets. J Immunol 190, 4595-4607 (2013). Noailles, A., Maneu, V., Campello, L., Lax, P. & Cuenca, N. Systemic inflammation induced by lipopolysaccharide aggravates inherited retinal dystrophy. Cell Death Dis 9, 350 (2018). Ofengeim, D. et al. Activation of necroptosis in multiple sclerosis. Cell Rep 10, 1836- 1849 (2015). . Okun, I. et al. Screening for caspase-3 inhibitors: a new class of potent small- molecule inhibitors of caspase-3. J Biomol Screen 11, 277-285 (2006). . Olson, J. K. & Miller, S. D. Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs. J Immunol 173, 3916-3924 (2004). . Paglini, G., Peris, L., Mascotti, F., Quiroga, S. & Caceres, A. Tau protein function in axonal formation. Neurochem Res 25, 37-42 (2000). . Park, J. W., Kim, H. J., Kang, M. W. & Jeon, N. L. Advances in microfluidics-based experimental methods for neuroscience research. Lab Chip 13, 509-521 (2013).. Park, K. K. et al. Promoting axon regeneration in the adult CNS by modulation of the PTEN / mTOR pathway. Science (New York, N.Y.) 322, 963-966 (2008). . Petrova, T. V., Akama, K. T. & Van Eldik, L. J. Selective modulation of BV-2 microglial activation by prostaglandin E(2). Differential effects on endotoxin- stimulated cytokine induction. J Biol Chem 274, 28823-28827 (1999). . Picon, C. et al. Neuron-specific activation of necroptosis signaling in multiple sclerosis cortical grey matter. Acta Neuropathol 141, 585-604 (2021). . Probert, L. TNF and its receptors in the CNS: The essential, the desirable and the deleterious effects. Neuroscience 302, 2-22 (2015). . Qian, C. & Zhou, F.-Q. Updates and challenges of axon regeneration in the mammalian central nervous system. Journal of molecular cell biology 12, 798-806 (2020). . Quinn, T. A., Dutt, M. & Shindler, K. S. Optic neuritis and retinal ganglion cell loss in a chronic murine model of multiple sclerosis. Front Neurol 2, 50 (2011). . Ribas, V. T. & Costa, M. R. Gene Manipulation Strategies to Identify Molecular Regulators of Axon Regeneration in the Central Nervous System. Front Cell Neurosci 11, 231 (2017). . Rivera, V. M. et al. Long-term pharmacologically regulated expression of erythropoietin in primates following AAV-mediated gene transfer. Blood 105, 1424-1430 (2005). 90 41766.101_P17245-01 Rivière, C., Danos, O. & Douar, A. M. Long-term expression and repeated administration of AAV type 1, 2 and 5 vectors in skeletal muscle of immunocompetent adult mice. Gene Therapy 13, 1300-1308 (2006). Shin, J. E., Geisler, S. & DiAntonio, A. Dynamic regulation of SCG10 in regenerating axons after injury. Exp Neurol 252, 1-11 (2014). Shindler, K. S. et al. Oral resveratrol reduces neuronal damage in a model of multiple sclerosis. J Neuroophthalmol 30, 328-339 (2010). Shindler, K. S., Ventura, E., Rex, T. S., Elliott, P. & Rostami, A. SIRT1 activation confers neuroprotection in experimental optic neuritis. Invest Ophthalmol Vis Sci 48, 3602-3609 (2007). Singh, N. P., Hegde, V. L., Hofseth, L. J., Nagarkatti, M. & Nagarkatti, P. Resveratrol (trans-3,5,4'-trihydroxystilbene) ameliorates experimental allergic encephalomyelitis, primarily via induction of apoptosis in T cells involving activation of aryl hydrocarbon receptor and estrogen receptor. Mol Pharmacol 72, 1508-1521 (2007). Slowik, A. et al. The sphingosine 1-phosphate receptor agonist FTY720 is neuroprotective after cuprizone-induced CNS demyelination. Br J Pharmacol 172, 80-92 (2015). Smith, P. D. et al. SOCS3 deletion promotes optic nerve regeneration in vivo. Neuron 64, 617-623 (2009). Sorensen, P. S. Early-Stage Multiple Sclerosis. Drugs 64, 2021-2029 (2004). Stadelmann, C., Wegner, C. & Bruck, W. Inflammation, demyelination, and degeneration - recent insights from MS pathology. Biochim Biophys Acta 1812, 275-282 (2011). Steinman, L. & Zamvil, S. S. Virtues and pitfalls of EAE for the development of therapies for multiple sclerosis. Trends Immunol 26, 565-571 (2005). Strittmatter, S. M., Fankhauser, C., Huang, P. L., Mashimo, H. & Fishman, M. C. Neuronal pathfinding is abnormal in mice lacking the neuronal growth cone protein GAP-43. Cell 80, 445-452 (1995). Sun, C. The SF3b complex: splicing and beyond. Cell Mol Life Sci 77, 3583-3595 (2020). Sun, F. et al. Sustained axon regeneration induced by co-deletion of PTEN and SOCS3. Nature 480, 372-375 (2011). Takeuchi, H. et al. Tumor Necrosis Factor-α Induces Neurotoxicity via Glutamate Release from Hemichannels of Activated Microglia in an Autocrine Manner*. Journal of Biological Chemistry 281, 21362-21368 (2006). Talla, V. & Koilkonda, R. Targeted Kruppel-Like Factor 4 Gene Knock-Out in Retinal Ganglion Cells Improves Visual Function in Multiple Sclerosis Mouse Model. eNeuro 7 (2020). Tassoni, A. et al. The astrocyte transcriptome in EAE optic neuritis shows complement activation and reveals a sex difference in astrocytic C3 expression. Sci Rep 9, 10010 (2019). Taylor, D. L., Jones, F., Kubota, E. S. & Pocock, J. M. Stimulation of microglial metabotropic glutamate receptor mGlu2 triggers tumor necrosis factor alpha- induced neurotoxicity in concert with microglial-derived Fas ligand. J Neurosci 25, 91 41766.101_P17245-01 2952-2964 (2005). Tomar, R. S., Matta, H. & Chaudhary, P. M. Use of adeno-associated viral vector for delivery of small interfering RNA. Oncogene 22, 5712-5715 (2003). Tsujino, H. et al. Activating transcription factor 3 (ATF3) induction by axotomy in sensory and motoneurons: A novel neuronal marker of nerve injury. Mol Cell Neurosci 15, 170-182 (2000). Voet, S., Prinz, M. & van Loo, G. Microglia in Central Nervous System Inflammation and Multiple Sclerosis Pathology. Trends Mol Med 25, 112-123 (2019). Wang, D., Tai, P. W. L. & Gao, G. Adeno-associated virus vector as a platform for gene therapy delivery. Nature Reviews Drug Discovery 18, 358-378 (2019). Wang, J. & He, Z. NAD and axon degeneration: from the Wlds gene to neurochemistry. Cell adhesion & migration 3, 77-87 (2009). Wang, J. et al. A local mechanism mediates NAD-dependent protection of axon degeneration. J Cell Biol 170, 349-355 (2005). Wang, M., Wu, Y., Culver, D. G. & Glass, J. D. The gene for slow Wallerian degeneration (Wld(s)) is also protective against vincristine neuropathy. Neurobiol Dis 8, 155-161 (2001). Weng, Y. L. et al. An Intrinsic Epigenetic Barrier for Functional Axon Regeneration. Neuron 94, 337-346 e336 (2017). Weng, Y.-L., Joseph, J., An, R., Song, H. & Ming, G.-l. Epigenetic regulation of axonal regenerative capacity. Epigenomics 8, 1429-1442 (2016). Wilkins, A. & Scolding, N. Protecting axons in multiple sclerosis. Mult Scler 14, 1013-1025 (2008). Will, C. L. et al. Characterization of novel SF3b and 17S U2 snRNP proteins, including a human Prp5p homologue and an SF3b DEAD-box protein. EMBO J 21, 4978-4988 (2002). Wojda, U., Salinska, E. & Kuznicki, J. Calcium ions in neuronal degeneration. IUBMB Life 60, 575-590 (2008). Xie, J. et al. Effective and Accurate Gene Silencing by a Recombinant AAV- Compatible MicroRNA Scaffold. Mol Ther 28, 422-430 (2020). Yang, J. et al. Pathological axonal death through a MAPK cascade that triggers a local energy deficit. Cell 160, 161-176 (2015). Yang, T. et al. Neuroprotective Effects of Fingolimod Supplement on the Retina and Optic Nerve in the Mouse Model of Experimental Autoimmune Encephalomyelitis. Front Neurosci 15, 663541 (2021). Yoshimori, A. et al. Structural and functional definition of the specificity of a novel caspase-3 inhibitor, Ac-DNLD-CHO. BMC Pharmacol 7, 8 (2007). You, Y. et al. Chronic demyelination exacerbates neuroaxonal loss in patients with MS with unilateral optic neuritis. Neurol Neuroimmunol Neuroinflamm 7 (2020). 92 41766.101_P17245-01 146. Yuan, F., Chen, J., Sun, P. P., Guan, S. & Xu, J. Wedelolactone inhibits LPS- induced pro-inflammation via NF-kappaB pathway in RAW 264.7 cells. J Biomed Sci 20, 84 (2013). 147. Yuan, J., Amin, P. & Ofengeim, D. Necroptosis and RIPK1-mediated neuroinflammation in CNS diseases. Nature reviews. Neuroscience 20, 19-33 (2019). 148. Zelic, M. et al. RIPK1 activation mediates neuroinflammation and disease progression in multiple sclerosis. Cell Reports 35, 109112 (2021). 149. Zhang, X. et al. Structure of the human activated spliceosome in three conformational states. Cell Res 28, 307-322 (2018). 150. Zhang, Y. et al. A dual effect of ursolic acid to the treatment of multiple sclerosis through both immunomodulation and direct remyelination. Proc Natl Acad Sci U S A 117, 9082-9093 (2020). 151. Zhu, J. et al. Ethoxyquin prevents chemotherapy-induced neurotoxicity via Hsp90 modulation. Ann Neurol 74, 893-904 (2013). 152. Zhu, J. et al. Ethoxyquin provides neuroprotection against cisplatin-induced neurotoxicity. Sci Rep 6, 28861 (2016). 153. Zipp, F. Apoptosis in multiple sclerosis. Cell Tissue Res 301, 163-171 (2000). 154. Zukor, K. et al. Short Hairpin RNA against PTEN Enhances Regenerative Growth of Corticospinal Tract Axons after Spinal Cord Injury. The Journal of Neuroscience 33, 15350-15361 (2013). 155. Yang, X., Boehm, J., Yang, X. et al. A public genome-scale lentiviral expression library of human ORFs. Nat Methods 8, 659–661 (2011). https: / / doi.org / 10.1038 / nmeth.1638 All publications, patent applications, patents, and other references mentioned in the specification are indicative of the level of those skilled in the art to which the presently disclosed subject matter pertains. All publications, patent applications, patents, and other references are herein incorporated by reference to the same extent as if each individual publication, patent application, patent, and other reference was specifically and individually indicated to be incorporated by reference. It will be understood that, although a number of patent applications, patents, and other references are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art. Although the foregoing subject matter has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be understood by 93 41766.101_P17245-01 those skilled in the art that certain changes and modifications can be practiced within the scope of the appended claims. 94 41766.101_P17245-01

Claims

THAT WHICH IS CLAIMED:

1. A method of reducing or preventing axonal degeneration in a subject, the method comprising administering to the subject an effective amount of an inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression, wherein the SF3B2 gene expression inhibitor is an antisense oligonucleotide (ASO) or an RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand, and wherein axonal degeneration of neurons is reduced or prevented.

2. The method of claim 1, wherein the antisense oligonucleotide comprises SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO. 76; and / or wherein the antisense oligonucleotide is at least partially complementary to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO:

82.

3. The method of claim 1, wherein the RNAi-inducing construct is a short-hairpin RNA (shRNA).

4. The method of claim 1 or 3, wherein the antisense strand of the RNAi-inducing construct comprises SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76; and / or wherein the antisense strand of the RNAi- inducing construct is at least partially complementary to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO:

82.

5. The method of claim 3, wherein the shRNA comprises an inverted repeat of a nucleotide sequence and a loop region.

6. The method of claim 3, wherein the shRNA is in the form of a vector expressed shRNA. 95 41766.101_P17245-017. The method of claim 6, wherein the vector is an adenoviral vector or a retroviral vector.

8. The method of claim 6, wherein the vector is a lentiviral vector.

9. The method of claim 1 or 3, wherein the antisense oligonucleotide or the antisense strand of the RNAi-inducing construct comprises SEQ ID. NO.

68.

10. The method of claim 1, wherein the inhibitor of splicing factor 3B subunit 2 (SF3B2) gene expression is administered with a delivery agent.

11. The method of claim 10, wherein the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant.

12. The method of claim 1, wherein adenosine triphosphate (ATP) loss, or nicotinamide adenine dinucleotide (NAD) depletion is reduced or prevented.

13. The method of claim 1, wherein the neurons are viable against neurotoxic inflammatory stress.

14. The method of claim 1, wherein neuron axonal integrity is preserved against neurotoxic inflammatory stress.

15. The method of claim 1, wherein the neurons are retinal ganglion cells or cortical neurons.

16. The method of claim 1, wherein the subject has multiple sclerosis.

17. An RNAi-inducing construct, the RNAi-inducing construct comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and 96 41766.101_P17245-01an antisense strand, wherein the antisense strand comprises SEQ ID NO: 66, SEQ ID. NO. 68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76; and / or wherein the antisense strand is at least partially complementary to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO:

82.

18. The RNAi-inducing construct of claim 17, wherein the construct is a short- hairpin RNA (shRNA).

19. The RNAi-inducing construct of claim 18, wherein the shRNA comprises an inverted repeat of the nucleotide sequence and a loop region.

20. The RNAi-inducing construct of claim 19, wherein the loop region comprises between 3 and 24 nucleotides in length.

21. The RNAi-inducing construct of claim 18, wherein the shRNA is in the form of a vector expressed shRNA.

22. The RNAi-inducing construct of claim 21, wherein the vector expressed shRNA comprises an inverted repeat of the nucleotide sequence and a loop region.

23. The RNAi-inducing construct of claim 21, wherein the vector is an adenoviral vector.

25. The RNAi-inducing construct of claim 21, wherein the vector is a retroviral vector.

25. The RNAi-inducing construct of claim 24, wherein the retroviral vector is a lentiviral vector. 97 41766.101_P17245-0126. The RNAi-inducing construct of claim 25, wherein the lentiviral vector is packaged into an infectious particle.

27. A composition comprising the RNAi-inducing construct of claim 17 and a delivery agent.

28. The composition of claim 27, wherein the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant.

29. The composition of claim 27, further comprising a pharmaceutically acceptable diluent, excipient, or carrier.

30. The composition of claim 27, further comprising a plurality of RNAi-inducing constructs whose presence within a cell results in production of a plurality of different siRNAs or shRNAs targeting at least a portion of SEQ ID NO: SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO: 82; 31. A method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method comprising administering the composition of claim 27 to a subject.

32. The method of claim 31, wherein administering comprises introducing the composition into the subject intranasally, intravenously, or by inhalation.

33. The method of claim 32, wherein introducing the composition into the subject suppresses expression of a nucleic acid sequence encoding SF3B2 in the subject and adenosine triphosphate (ATP) loss, nicotinamide adenine dinucleotide (NAD) depletion, or axonal degeneration is reduced or prevented. 98 41766.101_P17245-0134. A method of treating a subject with multiple sclerosis, the method comprising administering the composition of claim 27 to a cell, tissue, or organ of a subject with multiple sclerosis.

35. The method of claim 34, wherein adenosine triphosphate (ATP) loss, nicotinamide adenine dinucleotide (NAD) depletion, or axonal degeneration is reduced or prevented.

36. An antisense oligonucleotide (ASO) comprising SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.76; and / or wherein the ASO is at least partially complementary to SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, or SEQ ID NO:

82.

37. An antisense oligonucleotide consisting of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.

76.

38. An antisense oligonucleotide consisting essentially of SEQ ID NO: 66, SEQ ID. NO.68, SEQ ID. NO.70, SEQ ID. NO.72, SEQ ID. NO.74, or SEQ ID. NO.

76.

39. A composition comprising the antisense oligonucleotide of any one of claims 36-38, and a delivery agent.

40. The composition of claim 39, wherein the delivery agent is selected from the group consisting of a liposome, a cationic or non-cationic polymer, a lipid, a peptide molecular transporter, and a surfactant.

41. The composition of claim 39, further comprising a pharmaceutically acceptable diluent, excipient, or carrier. 99 41766.101_P17245-0142. A method of treating multiple sclerosis in a subject, the method comprising administering the composition of any one of claims 36-38 to a subject with multiple sclerosis.

43. The method of claim 42, wherein axonal degeneration in neurons is reduced or prevented.

44. The method of claim 42, wherein neurons are viable against neurotoxic inflammatory stress.

45. The method of claim 42, wherein neuron axonal integrity is preserved against neurotoxic inflammatory stress.

46. The method of claim 43, wherein the neurons are retinal ganglion cells or cortical neurons.

47. A method of suppressing expression of a nucleic acid sequence encoding SF3B2 in a subject, the method comprising administering the composition of any one of claims 36-38 to a subject with multiple sclerosis 48. The method of claim 47, wherein axonal degeneration in neurons is reduced or prevented.

49. The method of claim 47, wherein neurons are viable against neurotoxic inflammatory stress.

50. The method of claim 47, wherein neuron axonal integrity is preserved against neurotoxic inflammatory stress.

51. The method of claim 48, wherein the neurons are retinal ganglion cells or cortical neurons. 100 41766.101_P17245-01