Compositions and methods for preventing and alleviating mitochondrial diseases

Abstract

The invention described the therapeutic treatment of mitochondrial disease caused by mtDNA mutants with vitamin MK-4 which restores cellular ATP and cytosolic Ca2+ levels, improves synaptic development, and suppresses sensory and behavioral defects and embryonic death.

Description

[0001] COMPOSITIONS AND METHODS FOR PREVENTING AND ALLEVIATING MITOCHONDRIAL DISEASES

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This International PCT application claims the benefit of U.S. Provisional Application Serial No. 63 / 468,692, filed May 24, 2023, the specification, claims and drawings of which are incorporated herein by reference in their entirety.

[0004] GOVERNMENT INTEREST

[0005] This invention was made with government support under grant number GM118188 awarded by National Institutes of Health (NIH). The government has certain rights in the invention.

[0006] SEQUENCE LISTING

[0007] The instant application contains contents of the electronic sequence listing (90245.01041- Sequence-Listing.xml; Size: 4,644 bytes; and Date of Creation: May 20, 2024) is herein incorporated by reference in its entirety.

[0008] TECHNICAL FIELD

[0009] The present invention includes novel systems, methods, and compositions for the treatment of one or more mitochondrial diseases, and specifically mitochondrial diseases caused by mutations in the mitochondrial genome (mtDNA).

[0010] BACKGROUND

[0011] Mitochondria are responsible for generating the main energy source within the cell, adenosine triphosphate (ATP), which drives many important cellular processes. ATP is produced through the mitochondrial electron transport chain composed of proteins encoded by both the nuclear genome and the mitochondrial genome (mtDNA). Mutations in mtDNA or the nuclear genome can cause dysfunction of mitochondria and malfunction of organs or tissues that are sensitive to the levels of ATP, especially the neuronal tissues. In humans, mtDNA mutations have been implicated in causing various disorders with neurological symptoms, including neuromuscular dysfunction and sensory deficiencies, such as visual and hearing loss and hyposmia.

[0012] For example, mitochondrial diseases like Leber Hereditary Optic Neuropathy (LHON) and Leigh syndrome (LS) can cause visual defects, while Maternally Inherited Diabetes and Deafness (MIDD), Wolfram syndrome (WS), LHON and Kearns-Sayre syndrome (KSS) often show different levels of deafness. Neuroimaging observations from Magnetic Resonance Imaging (MRI) reveal that mtDNA mutations in mitochondrial diseases, such as LS, LHON and KSS, impair the development of the nervous system and cause structural abnormalities, including cerebral atrophy and MRI signal changes in multiple brain regions, optic nerve, and spinal cord. These abnormalities compromise neuronal connections and functions, contributing to various sensory and neuromuscular symptoms. mtDNA mutations not only affect children and adults, but also perturb embryo development. A recent survey found higher incidences of miscarriages (29.2% of 370 pregnancies vs. 8-20% in general population) and other pregnancy complications among pregnant women with mitochondrial diseases. Moreover, mothers with LS, Progressive External Ophthalmoplegia (PEO), Mitochondrial Encephalomyopathy, Lactic Acidosis, or Stroke-like episodes (MELAS) had been reported to have multiple miscarriages. Therefore, mtDNA mutations negatively impact all stages of the life cycle.

[0013] Mitochondrial diseases exhibit various problems in motor, sensory, metabolism and development and understanding of their pathogenesis is rather limited. Mutations in virtually every human mtDNA-encoded gene, including those coding for 13 proteins, 22 transfer RNAs (tRNAs), and 2 ribosomal RNAs (rRNA), have been found to cause various disorders. In many cases, mutations in multiple different mtDNA genes result in similar defects, such as LHON (in 7 different protein- and tRNA-coding genes), LS (5 protein- and tRNA-coding genes), and myopathy (in 13 protein- and tRNA-coding genes). These observations suggest that mtDNA mutations likely impact a common signaling pathway that senses deficiency in energy, given the vital role of mitochondria in ATP production.

[0014] Two important cellular homeostatic processes have been found to be affected in cells derived from patients with mitochondrial diseases. One is the cellular ATP homeostasis, which relies on the ATP synthesis by the electron transport chain composed of proteins encoded by both nuclear genome and mtDNA. Pathogenic mtDNA mutations directly impair mtDNA-encoded proteins or tRNAs important for mitochondrial protein synthesis, leading to reduced ATP outputs, which has been observed in most common mitochondrial diseases, such as LS, MELAS, and LHON. The other compromised cellular homeostasis is the cytosolic Ca2+, the crucial “second messenger” involved in multiple important cellular processes. Maintaining a proper and stable cellular Ca2+ concentration is crucial for the formation and conduction of nerve signals, neurodevelopment, muscle contraction, and embryo development, whereas abnormally elevated cytosolic Ca2+ or Ca2+ overload could lead to cell death and is associated with multiple neurodegenerative diseases. Interestingly, elevated cytosolic Ca2+ seems to be a common phenomenon in multiple mitochondrial diseases and has been observed in cells from patients with mtDNA mutations, including LHON, LS, MIDD, MELAS, WS and PEO. For example, the cytosolic Ca2+ level is increased 1 .4 fold in MIDD cells, 1 .5 fold in WS cells, and approximately 1.8-fold in MELAS cells. How mtDNA mutations lead to elevated cytosolic Ca2+ is poorly understood and will be the key for understanding and treating mitochondrial diseases.

[0015] Understanding how mtDNA mutations cause cellular, neurological, and developmental defects has been challenging, because mtDNAs with these mutations normally co-exist with wildtype copies of mtDNA in heteroplasmic mixtures, which often lead to mild or highly variable clinical symptoms that are difficult to track. The mitochondrial genome also coordinates with the nuclear genome to affect crucial cellular functions and processes, which complicates the mechanistic analysis of the impact of mtDNA mutations. Moreover, despite recent breakthroughs in mitochondrial genome editing in cultured cells, it has been very difficult to recreate human pathogenic mtDNA mutations or deletions in animal models, which has been a major hurdle that impedes effective mechanistic study and drug discovery. Hence, mitochondrial diseases caused by mtDNA mutations remain to have few treatment options.

[0016] The Caenorhabditis elegans (C. elegans) mitochondrial genome is highly similar to that of mammals in size and gene content, with 13,794 base pair (bp) in length that encodes 2 rRNAs, 22 tRNAs, and 12 proteins that are components of the mitochondrial respiratory chain (Fig. 1A). Several mtDNA mutations, affecting single or multiple mtDNA genes, have been isolated and found to be stably inherited. These mtDNA mutants in combination with the myriad cellular, neurological, behavioral, and developmental assays and robust genetic tools available in C. elegans provide a platform to dissect the signaling pathways and mechanisms by which mtDNA mutations impact neuronal functions, behaviors, and embryo development.

[0017] Here, Applicants demonstrate that three different C. elegans mtDNA mutations cause reduced ATP levels in neurons and embryos, which activates the energy-sensitive AMP-activated protein kinase AMPK (AAK-2 in C. elegans) and the nuclear translocation of the FOXO transcription factor DAF- 16, a target of AAK-2. Activated DAF- 16 then upregulates the expression of the Inositol 1,4,5-trisphosphate (IP3) receptor ITR-1, an endoplasmic reticulum calcium channel, leading to increased basal cytosolic Ca2+ levels, decreased neuronal responsiveness, compromised synapse formation, and impaired behaviors and embryo development, which recapitulate some of the common cellular and phenotypic defects seen in human mitochondrial diseases. Importantly, Applicants have discovered that treatment of mtDNA mutants with vitamin MK-4, (also referred to as MK-4, or the composition of the invention), a subtype of vitamin K2, restores their cellular ATP and basal cytosolic Ca2+ levels, improves synaptic development and functions, and rescues sensory, locomotion, behavioral, learning and developmental defects, providing a promising new method to treat mitochondrial diseases. As described below, the present invention provides for the novel treatment of mitochondrial disease and disorders through the therapeutic application of MK-4. SUMMARY OF THE INVENTION In one aspect, the present invention describes a new signaling pathway, the AMPK-FOXO- IP3R pathway, responsible for mediating defects caused by mtDNA mutations. In a preferred embodiment, a therapeutically effective amount of vitamin MK-4 can remedy the deficiencies in mtDNA mutants by restoring their cellular ATP levels and inhibiting abnormal activation of the AMPK-FOXO-IP3R pathway caused by one or more mitochondrial diseases. Additional aspects of the invention will be evident from the specification, figures, and claims provided herein. BRIEF DESCRIPTION OF DRAWINGS Figure 1A-J. mtDNA mutants exhibit multiple behavioral defects. (A) Map of C. elegans mtDNA showing the locations of the 3054 bp uaDf5 deletion, the 783 bp tm4273 deletion, and the qm189 substitution. Proteins and rRNAs encoded by mtDNA are indicated. (B) Avoidance responses of wild-type (WT) animals and three different mtDNA mutants to high (1 M) and low (50 mM) concentrations of glycerol, respectively. At least 6 independent experiments were conducted for each strain. In each experiment, ten animals were tested. Data are mean ± SEM. ***P < 0.001, ns, not significant (P > 0.05). Unpaired Student t test. (C and D) Calcium responses (C) in ASH neurons and their maximum ΔF / F0 changes (D) induced by 50 mM glycerol in the indicated strains are shown. F0 is the average fluorescence intensity before glycerol addition. ΔF is the difference between the current fluorescence intensity and F0. The arrow indicates the time point of glycerol addition. Solid lines show the average fluorescence intensity changes, and the shading shows its SEM. n = 15-18. In D, Data are mean ± SEM. *P < 0.05, **P < 0.01 (unpaired Student t test). (E and F) Avoidance responses of the indicated strains to high (2 mM) and low (100 μM) concentrations of CuCl2 (E) or high (1 M) and low (150 mM) concentrations of NaCl (F).6-11 independent experiments were performed for each strain. In each experiment, ten animals were tested Data are mean ± SEM ***P < 0001 ns not significant (P > 005) Unpaired Student t test. (G) Response latencies of the indicated strains to 2-nonanone (1:10 diluted in DMSO). n = 30 in each column. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test). (H) The workflow of the associative learning and short-term memory assay. A portion of well-fed day-one adults were directly tested for the response latencies to 2-nonanone (1:25 diluted in DMSO). The other day-one adults were subjected to a training procedure before being tested for the response latencies to 2-nonanone (1:25 diluted in DMSO). The training procedure includes 1 hour starvation, 1 hour conditioning (bacteria and 2-nonanone), and 0 or 1 hour on bacteria only. Learning index = (T - Tnaïve) / Tnaïve, in which Tnaïve is the average response latency of naïve animals to 2-nonanone and T is the average response latency of trained animals to 2-nonanone 0 or 1 hour after training. (I) Learning indexes of the indicated strains to 2-nonanone (1:25 diluted in DMSO) with food association 0 and 1 hour after training. n = 40 in each column. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test). (J) Chemotaxis indexes of the indicated strains to high (10-2diluted in DMSO) and low (5 ×10-6diluted in DMSO) concentrations of diacetyl.4-5 independent experiments were conducted for each strain. n = 13-18 in each experiment. Data are mean ± SEM. **P < 0.01, ***P < 0.001, ns, not significant (P > 0.05). Unpaired Student t test. Figure 2A-K. Rescue of reduced neuronal ATP levels and behavioral defects in mtDNA mutants by MK-4 treatment. (A) Relative ATP levels in ASH neurons in WT animals and three mtDNA mutants, which were determined using an ATP sensor QUEEN-2m by its 405 / 488 excitation ratio. The ATP levels in WT animals were set at 1.0. The same two independent transgenic lines expressing QUEEN-2m in ASH neurons were used in all genetic backgrounds. n = 42-102 in each experiment. Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired Student t test). (B) Chemical structure of MK-4. OP50 bacteria containing 2 mM MK- 4 were used to feed animals in MK-4 treatment experiments. (C) Relative ATP levels in ASH neurons in WT animals and three mtDNA mutants with 2 mM MK-4 treatment were determined as in A. n = 37-67. Data are mean ± SEM. Unpaired Student t test; ns, not significant (P > 0.05). (D) Avoidance responses of the indicated strains to 50 mM glycerol without or with 2 mM MK- 4 treatment. At least 6 independent experiments were conducted. In each experiment, ten animals were tested. Data are mean ± SEM. *P < 0.0 5, **P < 0.01, (unpaired Student t test); ns, not significant (P > 0.05). (E and F) Calcium responses of ASH neurons (E) and their maximum ΔF / F0 changes (F) induced by 50 mM glycerol in the indicated strains without or with 2 mM MK-4 treatment. n = 12-18. In F, Data are mean ± SEM. *P < 0.05, **P < 0.01, (unpaired Student t test); ns, not significant (P > 0.05). (G and H) Avoidance responses of the indicated strains to 100 μM CuCl2 (G), and 150 mM NaCl (H) without or with 2 mM MK-4 treatment, respectively. At least 6 independent experiments w conducted. In each experiment, ten animals were tested. Data are mean ± SEM. **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (I) Response latencies of the indicated strains to 2-nonanone (1:10 diluted in DMSO) without or with 2 mM MK-4 treatment. n = 30-60. Data are mean ± SEM. **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (J) Chemotaxis indexes of the indicated strains to dia tyl (5 × 10-6diluted in DMSO) without or with 2 mM MK-4 treatment. 3-4 independent experiments were conducted for each strain. n = 11-14 in each experiment. Data are mean ± SEM. **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (K) Learning indexes of the indicated strains to 2-nonanone (1:25 diluted in DMSO) with food association without or with 2 mM MK-4 treatment one hour after conditioning. n = 40 in each column. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). Figure 3A-C. AAK-2 and DAF-16 mediate behavioral defects in mtDNA mutants. (A) Avoidance responses of animals to 50 mM glycerol without or with the indicated mtDNA mutation, aak- 2(ok524) mutation and daf-16(mu86) mutation. At least 6 independent experiments were performed. In each experiment, ten animals were tested. Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (B and C) Calcium responses of ASH neurons (B) and their maximum ΔF / F0 changes (C) induced by 50 mM glycerol in animals without or with the indicated mtDNA mutation, aak-2 mutation and daf-16 mutation. n = 14-18. In C, Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). Figure 4A-H. mtDNA mutations activate DAF-16 through AAK-2. (A) Representative fluorescent micrographs of zIs356 [daf-16p::DAF-16::GFP] transgenic WT animals and mtDNA mutants with (lower panels) or without (upper panels) an aak-2(ok524) mutation. Images were captured 25 min after the animals were treated with 50 mM sodium azide for 5 min. Dashed rectangles highlight the areas enlarged and shown in insets. Scale bars are 50 μm. (B and C) The number of cells with nuclear DAF-16::GFP pe r animal in transgenic zIs356 animals without or with the indicated mtDNA mutations and the aak-2(ok524) mutation (B), or without or with 2 mM MK-4 treatment (C). Animals were anesthetized with 50 mM sodium azide for 5 min and examined for the nuclear DAF-16::GFP 25 min later. n = 30-41. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (D) Representative images showing ASH neurons without or with DAT- 16 nuclear translocation in zls356 transgenic animals. Scale bar, 1 pm. The dotted blue lines highlight the nuclear regions in ASH neurons. (E and F) The percentage of DAF-16 nuclear translocation in ASH neurons in transgenic zls356 animals without or with the indicated mtDNA mutations and the aak-2(ok524) mutation (E), or without or with 2 mM MK-4 treatment (E). Animals were anesthetized with 10 mM levamisole for 5 min and images were acquired to monitor the nuclear DAF-16. At least 5 independent experiments were performed. In each experiment, ten ASH neurons were scored. Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P <0.001 (unpaired Student t test); ns, not significant (P > 0.05). (G) A schematic diagram showing amino acid substitutions in the DAF-16mut protein. (H) The number of cells with nuclear DAF- 16mut::GFP per animal in transgenic smls578 \daf-16p::DAF- 16nrut::(jFP~\ animals without or with the indicated mtDNA mutations, n = 42-45. Data are mean ± SEM. Unpaired Student t test; ns, not significant (P > 0.05).

[0018] Figure 5A-E. DAF-16 regulates neuronal calcium homeostasis. (A and / >) Basal cytosolic Ca2+levels of ASH neurons in WT animals and three mtDNA mutants without or with 2 mM MK-4 treatment (A), without or with the aak-2(ok524) mutation, the daf-16(mu86) mutation, or both mutations (B), were determined through the GCaMP-5 calcium sensor expressed in ASH neurons, n = 31-72 neurons. Data are mean ± SEM. ***B < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (C-E) DAF-2 regulates basal neuronal calcium levels (£>) and avoidance response to 50 mM glycerol (E), demonstrated by temperature-shift experiments (C). WT, daf-2(e!370) mutant and daf-2(e!370); daf-16(mu86) mutant animals were initially grown at 18°C, the permissive temperature for the daf-2(e!370) mutant, until they reached the larval 4 (L4) stage. A portion of L4 animals were transferred to new NGM plates and grown at 25°C, the nonpermissive temperature for the daf-2(e!370) mutant, until they reached adult day one (ADI). Another portion of L4 animals were transferred to new NGM plates and stayed at 18°C until they reached ADI . All animals were tested at ADI at room temperature (20°C), which includes measurement of basal cytosolic Ca21levels in ASH neurons (£>, n= 28-60) and avoidance responses to 50 mM glycerol (E). In E, at least 6 independent experiments were conducted. In each experiment, ten animals were tested. In D and E, Data are mean ± SEM. **p < 0.01 (unpaired Student 1 test); ns, not significant (P > 0.05).

[0019] Figure 6A-G. ITR-1 is upregulated and impairs neuronal Ca2+and sensory responses in mtDNA mutants. (A) Avoidance responses of the indicated strains without or with the itr-l(sa73) mutation to 50 mM glycerol. At least 6 independent experiments were performed. In each experiment, ten animals were tested. Data are mean ± SEM. **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (B and C) Calcium responses of ASH neurons in the indicated strains without or with the itr-1(sa73) mutation induced by 50 mM glycerol (B) and corresponding maximum ΔF / F0 changes (C). n = 12-22 neurons. In C, Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (D) The itr-1 expression levels in ASH neurons from the indicated strains carrying the integrated itr- 1p::gfp reporter transgene without or with the aak-2(ok524) mutation, the daf-16(mu86) mutation, or both mutations. n = 22-95. Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (E) The GFP expression levels in ASH neurons from the integrated itr-1p(mut)::gfp reporter transgene in WT and three mtDNA mutants. n = 39-45. Data are mean ± SEM. unpaired Student t test; ns, not significant (P > 0.05). (F) Basal cytosolic Ca2+levels of ASH neurons in animals without or with the indicated mtDNA mutation or itr- 1(sa73) mutation. n = 29-72. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (G) The GFP expression levels in ASH neurons from the integrated unc-68p::gfp reporter transgene in WT and three mtDNA mutants. n = 35-54. Data are mean ± SEM. Unpaired Student t test; ns, not significant (P > 0.05). Figure 7A-F. The AMPK pathway mediates locomotion and synaptic defects caused by mtDNA mutations. (A and B) The number of lateral swimming movements (thrashes) in the M9 buffer in one minute was scored in WT and three mtDNA mutants, respectively, without or with 2 mM MK- 4 treatment (A), or without or with the aak-2(ok524) mutation, the daf-16(mu86) mutation, or the itr-1(sa73) mutation (B). n = 20-25 for each bar. Data are mean ± SEM. **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (C) Representative fluorescent images of the juIs1 [unc-25p::SNB-1::GFP] animals. The two ventral class D neurons, VD10 and VD11, are indicated with arrowheads. Scale bar, 100 µm. (D) Representative images showing SNB-1::GFP puncta between the VD10 and VD11 neurons (indicated by arrowheads) in WT and three mtDNA mutants without or with 2 mM MK-4 treatment, or with the daf-16(mu86) mutation. Scale bar, 5 µm. (E and F) The number of SNB- 1::GFP puncta between VD10 and VD11 neurons in WT and three mtDNA mutants without or with 2 mM MK-4 treatment (E), or without or with the aak- 2(ok524) mutation, the daf- 16(mu86) mutation, and the itr-1(sa73) mutation (F). n = 29-39 for each bar. Data are mean ± SEM. **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). Figure 8A-E. The AMPK-FOXO-IP3R pathway mediates embryonic death caused by mtDNA mutations. (A) The embryonic lethality rate of WT animals and three mtDNA mutants without or with 2 mM MK-4 treatment. n > 2000 embryos for each column. Data are mean ± SEM. *P < 0.05, ***P < 0.001 (unpaired Student t test). (B) Representative differential interference contrast (DIC) and fluorescence images of embryos from WT animals and three mtDNA mutants stained by BioTracker ATP-Red without or with 2 mM MK-4 treatment. Animals were grown on NGM plates containing 8 µM BioTracker ATP-Red. Scale bars, 10 µm. (C) The fluorescent intensity value in embryos from WT anim mtDNA mutants without or with 2 mM MK-4 treatment. Animals were grown on NGM plates containing 8 µM BioTracker ATP-Red. n = 63-89 for each bar. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test). (D) The embryonic lethality rate of WT animals and three mtDNA mutants without or with the aak-2(ok524) mutation or the daf-16(mu86) mutation. n > 2000 embryos for each column. Data are mean ± SEM. * 01 (unpaired Student t test); ns, not significant (P > 0.05). (E) The embryonic lethality rate of WT animals and three mtDNA mutants fed with control RNAi bacteria or 3% itr-1 RNAi bacteria. n > 2000 embryos for each column. Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P <0.001 (unpaired Student t test); ns, not significant (P > 0.05). Figure 9. A working model showing how mtDNA mutations affect cytosolic Ca2+levels to cause sensory, behavioral and developmental defects. Reduced ATP production from mitochondria due to mtDNA mutations activates AMPK AAK-2 and nuclear translocation of the FOXO transcription factor DAF-16, leading to increased expression of the IP3R / ITR-1 calcium release channel in ER and elevation of the basal cytosolic calcium levels, which compromises sensory responses and synaptic development and causes various behavioral and developmental defects, including learning and memory. Figure 10A-K. Desensitized responses of mtDNA mutants to different types of chemical signals. (A) Schematic diagram of the “Dry drop test”. A micro-drop of solution containing the repellent (glycerol, NaCl or CuCl2) was delivered on the agar at a few millimeters ahead of a forward moving animal, the direction of the animal’s movement was observed and recorded when the animal encountered the repellent containing region, where the micro-drop had been absorbed into the agar. The avoidance index was calculated as nreversal / ntotal, where the nreversal is the number of animals turned back when they encountered the repellent containing region, and the ntotal is the total number of animals tested. Generally, ntotal = 10 in each independent experiment for each assay. (B) Avoidance responses of wild-type (WT) animals and three mtDNA mutants to 250 mM glycerol. From 6-8 independent experiments. In each experiment, ten animals were tested. Data are mean ± SEM. Unpaired Student t test; ns, not significant (P > 0.05). (C to H ) Calcium responses of ASH neurons to 250 mM glycerol (C and D), 100 μM CuCl2 (E and F) and 150 mM NaCl (G and H), as well as their respective maximum ΔF / F0 changes in WT and three mtDNA mutants as indicated. F0 is the average fluorescence intensity before the addition of glycerol, CuCl2 or NaCl. ΔF is the difference between the current fluorescence intensity and F0. The arrows indicate the timing of glycerol, CuCl2 or NaCl addition. The solid lines show the average fluorescence intensity changes, and the shading shows corresponding SEM. n = 10-21. In D, F and H, Data are mean ± SEM. *P < 0.05, **P < 0.01 (unpaired Student t test); ns, not significant (P > 0.05). (I) Schematic diagram of the chemotaxis assay with important experimental parameters indicated, including the starting position of the animals in the middle indicated in black, the odorant placing positions indicated in red, the DMSO control positions indicated in blue, and auxiliary marked lines. Chemotaxis index = (nA - nB) / (nA + nB); “nA” indicates the number of animals in region A; “nB” indicates the number of animals in region B. (J) Chemotaxis indexes of WT animals and three mtDNA mutants to 2- nonanone (1:250 diluted in DMSO). 3-4 independent experiments were conducted for each strain. n = 8-10 for each experiment. Data are mean ± SEM. *P < 0.05, **P < 0.01 (unpaired Student t test). (K) Response latencies of the indicated strains to 2-nonanone (1:25 diluted in DMSO) without or with food association training at 0 or 1 hour after conditioning. n = 30-40. Data are mean ± SEM. *P < 0.05, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). Figure 11A-C. Verification of the QUEEN-2m ATP sensor in ASH neurons and response latencies of animals in 2-nonanone associative learning and memory tests. (A) Relative ATP levels of ASH neurons in wild type animals treated with different concentrations of sodium azide for 10 min were determined using an ATP sensor QUEEN-2m expressed in ASH neurons by its 405 / 488 excitation ratio. n = 15-18. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test). (B and C) Response latencies of the indica ed strains to 2-nonanone (1:25 diluted in DMSO) without or with 2-nonanone and food associative training. Animals were not treated (B) or treated with (C) 2 mM MK-4. n = 30-40. Data are mean ± SEM. *P < 0.05, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). Figure 12A-D. AAK-2 and DAF-16 mediate the behavioral defects of mtDNA mutants. (A-D) Avoidance responses, response latencies, and chemotaxis indexes of WT animals and the indicated mtDNA mutants without (shaded in grey) or with the aak-2(ok524) mutation (in red), the daf-16(mu86) mutation (in blue), or both mutations (in yellow) to 100 μM CuCl2 (A), 150 mM NaCl (B), 2-nonanone (1:10 diluted in DMSO; C), and diacetyl (5 × 10-6diluted in DMSO; D), respectively. In A and B, 6-11 independent experiments were conducted for each strain and 10 animals were scored in each experiment. In C, 30 animals were examined. In D, 4-5 independent experiments were conducted for each strain. n = 12-18 animals in each experiment. In A-D, Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). Figure 13A-C. Sensory defects of the daf-2(e1370) mutant. (A and B) Avoidance responses of WT animals, the daf-2(e1370) mutant, and the daf-2(e1370); daf-16(mu86) mutants to 100 μM CuCl2 (A) and 150 mM NaCl (B) in two different temperatures. At least 6 independent experiments were conducted for each strain. In each experiment, ten animals were tested. Data are mean ± SEM. **P < 0.01 (unpaired Student t test); ns, not significant (P > 0.05). (C) Response latencies of WT animals, the daf-2(e1370) mutants, and the daf-2(e1370); daf-16(mu86) mutants to 2-nonanone (1:10 diluted in DMSO). n = 30 for each bar. Animals were grown at 18℃ until they reached L4 larval stage. Some continued to grow at 18℃ and some were shifted to grow at 25℃, as illustrated in Fig.5C. Adult day one animals were scored. Data are mean ± SEM. **P < 0.01 (unpaired Student t test); ns, not significant (P > 0.05). Figure 14. RNAi analysis of various Ca2+regulators on the behaviors of mtDNA mutants. Avoidance responses of three different mtDNA mutants to 50 mM glycerol, grown on different RNAi plates as indicated. At least 6 independent experiments were conducted. In each experiment, ten animals were tested. Data are mean ± SEM. *P < 0.05, **P < 0.01 (unpaired Student t test). Figure 15A-G. ITR-1 is involved in the behavioral defects of mtDNA mutants. (A and B) Avoidance responses of animals without or with the indicated mtDNA mutation and the itr- 1(sa73) mutation to 100 μM CuCl2 (A) and 150 mM NaCl (B). At least 6 independent experiments were conducted. In each experiment, ten animals were tested. Data are mean ± SEM. **P < 0.01, ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (C) Response latencies of animals without or with the indicated mtDNA mutation and the itr-1(sa73) mutation to 2-nonanone (1:10 diluted in DMSO). n = 30-70. Data are mean ± SEM. ***P < 0.001 (unpaired Student t test); ns, not significant (P > 0.05). (D) Chemotaxis indexes of animals without or with the indicated mtDNA mutation and the itr-1(sa73) mutation to diacetyl (5 × 10-6diluted in DMSO).4-5 independent experiments were conducted for each strain. n = 13-19 in each experiment. Data are mean ± SEM. **P < 0.01 (unpaired Student t test); ns, not significant (P > 0.05). (E) Representative fluorescent images of animals with the integrated otIs453 [itr- 1p::GFP] transgene and the WT animals, which exhibited a low level of background fluorescence. Scale bar, 100 μm. (F) Representative fluorescent images of the ASH neurons labeled by both the otIs453 [itr-1p::GFP] transgene and the smEx6539 [sra-6p::RFP] transgene. GFP, RFP and merged images are shown. Scale bar, 1 μm. (G) A schematic diagram showing the deleted sequence (indicated by a line) in the itr-1 promoter of the integrated smIs577 [itr- 1p(mut)::GFP] transgene. The motifs highlighted in red in the wild-type itr-1 promoter are predicted DAF-16 binding sites. Fig.16. Treatment with MK-4 restored ATP levels in fibroblasts derived from a human patient carrying a mtDNA mutation, Arg340His, in the ND4 gene. Fig.17. Treatment with MK-4 restored mitochondrial health in fibroblasts derived from a human patient carrying a mtDNA mutation, Leu156Arg, in the ATP6 gene. DETAILED DESCRIPTION OF INVENTION As noted above, pathological mutations in human mitochondrial genomes (mtDNA), as well as nuclear DNA, can cause a series of neurological, behavioral and developmental defects, but the underlying molecular mechanisms are poorly understood. Applicants show here that the energy-sensing AMP-activated protein kinase (AMPK) signaling pathway plays a key role in mediating similar defects caused by different mtDNA mutations in vivo, including loss or reduction of osmotic, chemical and olfactory sensing, locomotion, and associative learning and memory, as well as increased embryonic lethality. mtDNA mutations cause reduced ATP levels, activation of AMPK AAK-2, and nuclear translocation of the FOXO transcription factor DAF-16. Activated DAF-16 upregulates the expression of inositol triphosphate receptor (IP3R) ITR-1, an endoplasmic reticulum calcium channel, leading to increased basal cytosolic Ca2+ levels, decreased neuronal responsiveness, compromised synapses, and increased embryonic death. Treatment of mtDNA mutants with vitamin MK -4 restores cellular ATP and cytosolic Ca2+ levels, improves synaptic development, and suppresses sensory and behavioral defects and embryonic death. In one embodiment, the present invention includes methods and compositions for treating a disease or condition caused by one or more mtDNA mutations, also referred to herein as a mitochondrial disease. In a preferred embodiment, the present invention includes a method of treating a mitochondrial disease in a subject in need thereof, comprising administering a therapeutically effective amount of Vitamin MK-4. In another preferred embodiment, the present invention includes a method of treating a mitochondrial disease in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

[0020] In another preferred embodiment, the present invention includes a method of treating a mitochondrial disease in a subject in need thereof, comprising administering a therapeutically effective amount of a compound according to Formula (I): or a pharmaceutically acceptable salt thereof.

[0021] In another preferred embodiment, the present invention includes a method of treating a mitochondrial disease in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of the compound according to Formula (I), or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0022] In another preferred embodiment, the present invention includes a method of increasing ATP levels in a cell, and preferably a human cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I). In another preferred embodiment, the present invention includes a method of increasing ATP levels in a cell, and preferably a human cell, comprising contacting the cell with a pharmaceutical compositions having a therapeutically effective amount of compound according to Formula (I), and a pharmaceutically acceptable carrier.

[0023] In another preferred embodiment, the present invention includes a method of inhibiting Ca2+ overload in a cell, and preferably a human cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I). In another preferred embodiment, the present invention includes a method of inhibiting Ca2+ overload in a cell, and preferably a human cell, comprising contacting the cell with a pharmaceutical compositions having a therapeutically effective amount of compound according to Formula (I), and a pharmaceutically acceptable carrier. In another preferred embodiment, the present invention includes a method of reducing Ca2+ levels in a cell, and preferably a human cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I). In another preferred embodiment, the present invention includes a method of reducing Ca2+ levels in a cell, and preferably a human cell, comprising contacting the cell with a pharmaceutical compositions having a therapeutically effective amount of compound according to Formula (I), and a pharmaceutically acceptable carrier.

[0024] In another preferred embodiment, the present invention includes a method of inhibiting activation of the AMPK-F0X0-IP3R pathway resulting from one or more mitochondrial diseases in a cell, and preferably a human cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I). In another preferred embodiment, the present invention includes a method of inhibiting activation of the AMPK-F0X0-IP3R pathway resulting from one or more mitochondrial diseases in a cell, and preferably a human cell, comprising contacting the cell with a pharmaceutical compositions having a therapeutically effective amount of compound according to Formula (I), and a pharmaceutically acceptable carrier.

[0025] As noted above, mitochondrial diseases are a genetically heterogeneous group of disorders caused by mutations in mtDNA displaying a wide range of severity and phenotypes (See e.g., Wallace, D. C. and Chalkia, D., Cold Spring Harb. Perspect. Biol. 2013). The prevalence of mtDNA-related disease is about 1 in 8500 in the population (See e.g., Elliott, H. R. et al., American Journal of Human Genetics, 83, 254-260, 2008), yet to date, apart from supportive therapy there is no effective treatment for the majority of mitochondrial diseases. A variety of treatments have been evaluated in clinical trials, but none has delivered breakthrough results (See e.g., Kanabus, M. et al., British journal of pharmacology, 171, 1798-1817, 2014).

[0026] As used herein, the term “mitochondrial disease” refers to a disease, disorder, or condition in which the function of a subject’s mitochondria becomes impaired or dysfunctional, and in particular due to oxidative stress or aberrant ATP production. A “mitochondrial disease” also refers to a disease or condition that can be treated through the administration of a therapeutically effective amount of vitamin Mk-4. According to some embodiments, the primary mitochondrial disease is characterized by sub-normal mitochondrial parameters in the affected cells. According to some embodiments, the affected cells have abnormal ATP levels, Ca2+ overload, or improper activation of the AMPK-FOXO-IP3R pathway. In certain embodiments, the terms “decrease,” “lower” or “inhibit” as used herein refers to a statistically-significant decrease below the normal values. In certain embodiments, the term “lower” or “inhibit” as used herein refers to a pathological decrease, i.e., to a level in which at least one pathological symptom associated with the lower value becomes apparent.

[0027] In certain embodiments, the term “sub-normal” as used herein refers to a value which is at least 2 fold, at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, or at least 10 fold lower than the corresponding value found in corresponding cells or corresponding mitochondria of a subject or of a plurality of subjects not afflicted with a mitochondrial disease. Each possibility represents a separate embodiment of the invention.

[0028] In certain embodiments, the mitochondrial disease or disorder is associated with a mutation in nuclear DNA. The phrase “associated with a mutation in nuclear DNA” as used herein generally means that the etiology of the mitochondrial disease or disorder, at least in part, is operably linked to a mutation, or to a group of mutations, in a coding region in nuclear DNA, coding for a mitochondrial molecule. The term “mitochondrial molecule” generally refers to any molecule delivered and / or active and / or found in healthy functional mitochondria. Such molecules may be nucleic acids molecules, protein molecules, enzyme molecules, etc. In some embodiments, the mitochondrial disease or disorder is associated with a mutation in genes of the nuclear DNA that either encode OXPHOS proteins directly or affect OXPHOS function indirectly by impacting production of the complex machinery needed to run the OXPHOS process.

[0029] In certain embodiments, the mitochondrial disease or disorder associated with a mutation in mtDNA or a mutation nuclear DNA in is selected from the group consisting of: Apical hypertrophic cardiomyopathy (AHCM). neuropathy, ataxia, autism, Charcot-Marie-Tooth syndrome (CMT), encephalopathy, epilepsy with brain pseudoatrophy, Episodic Weakness, Hereditary Spastic Paraplegia (HSP), Familiar Bilateral Striatal Necrosis (FBSN), Infantile cardiomyopathy, Leber Hereditary Optic neuropathy (LHON), Left Ventricular Hyper Trabeculation syndrome (LVHT), Maternally inherited Diabetes, Deafness syndrome (MIDD), Kearns-Sayre syndrome (KSS). Wolfram syndrome (WS), Maternally inherited Leigh Syndrome (MILS), Mesial Temporal Lobe Epilepsies with Hippocampal Sclerosis (MTLE-HS), Metabolic Syndrome (MS), Motor Neuron Syndrome (MNS), Myopathy, lactic Acidosis, Sideroblastic Anemia (MLASA), Neurogenetic Ataxia Retinis Pigmentosa syndrome (NARP), Periodic paralyzes, Schizophrenia, Spino Cerebellar Ataxia (SCA), Tetralogy of Fallot (ToF), short-chain acyl- coA dehydrogenase deficiency (SCAD), medium-chain acyl-coA dehydrogenase deficiency (MCAD), long-chain acyl-coA dehydrogenase deficiency LCAD), progressive ophthalmoplegia (CPEO), Pearson Syndrome, Barth Syndrome, Alpers Disease, Luft Disease, mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), Mitochondrial Encephalomyopathy, neuropathy, ataxia, retinal pigmentosa (NARP), myoclonic epilepsy, ragged red fibers (MERRF), mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Alzheimer’s diseases (AD), Parkinson’s disease (PD), Huntington’s disease (HD), amyotrophic lateral sclerosis (ALS, aka Lou Gehring’s diseases, Epilepsy, Autism, Fibromyalgia, chronic fatigue, cerebral palsy, Friedreich’s Ataxia, Rett Syndrome, and Fragile X Syndrome, cardiomyopathy and muscular dystrophy (MD), diabetes and side effects of antibiotics treatment of bacterial infection, ataxia neuropathy syndrome (ANS), Mendelian neurodegenerative mitochondriopathy, 3- methylglutaconic aciduria (MEG), MEGDEL syndrome, Sengers syndrome, Minimal change nephrotic syndrome (MCNS), Mitochondrial DNA depletion Syndrome (MDDS), and Leigh- like disease. Each possibility represents a separate embodiment of the present invention.

[0030] In certain embodiments, the ANS is selected from the group consisting of mitochondrial recessive ataxia syndrome (MIRAS); spinocerebellar ataxia with epilepsy (SCAE); sensory ataxia neuropathy dysarthria and ophthalmoplegia (SANDO); and myoclonic epilepsy myopathy sensory ataxia (MEMSA). Each possibility represents a separate embodiment of the present invention.

[0031] In certain embodiments, the mitochondrial disease or disorder associated with acquired mitochondrial dysfunction becomes symptomatic at adulthood. In certain embodiments, the mitochondrial disease or disorder associated with acquired mitochondrial dysfunction is aggravated with time. In certain embodiments, the mitochondrial disease or disorder associated with acquired mitochondrial dysfunction is not operably linked, or is only partly linked, to a mutation, or to a group of mutations, in a coding region in mitochondrial or nuclear DNA, coding for a mitochondrial molecule. In certain embodiments, the patient is an adult. In certain embodiments, the patient is over 20 years in age. In certain embodiments, the patient is over 30, 40, 50, 60 or 70 years in age. In certain embodiments, the patient is an infant or a child. In certain embodiments, the patient is a newborn. In certain embodiments, the patient has age between newborn and 10 years, or between 10 years to 20 years.

[0032] In certain embodiments, the mitochondrial disease or disorder is associated with an organ selected from the group consisting of kidney, liver, brain, muscle, pancreas, eye and any combination thereof. In certain embodiments, the mitochondrial disease or disorder is associated with a kidney. In certain embodiments, the mitochondrial disease or disorder is associated with the liver. In certain embodiments, the mitochondrial disease or disorder is associated with the brain. In certain embodiments, the mitochondrial disease or disorder is associated with a muscle. In certain embodiments, the mitochondrial disease or disorder is associated with the heart. In certain embodiments, the mitochondrial disease or disorder is associated with the pancreas. In certain embodiments, the mitochondrial disease or disorder is associated with an eye.

[0033] In certain embodiments, the symptom is selected from the group consisting of impaired walking capability, impaired motor skills, impaired language skills, impaired memory, impaired weight gain, failure to thrive, low blood alkaline phosphatase levels, low blood magnesium levels, high blood creatinine levels, low blood bicarbonate levels, low blood base excess levels, high urine glucose / creatinine ratios, high urine chloride / creatinine ratios, high urine sodium / creatinine ratios, high blood lactate levels, high urine magnesium / creatinine ratios, high urine potassium / creatinine ratios, high urine calcium / creatinine ratios, glucosuria, magnesuria, high blood urea levels, low C- Peptide level, high HbAlC level, hypoparathyroidism, ptosis, hearing loss, cardiac conduction disorder, low ATP content and oxygen consumption in lymphocytes. Each possibility represents a separate embodiment of the present invention. It should be understood that defining symptoms as “high” and “low” correspond to “detectably higher than normal” and “detectably lower than normal”, respectively, wherein the normal level is the corresponding level in a plurality of subjects not afflicted with a mitochondrial disease.

[0034] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compound are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compound of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a 13C- or 14C-enriched carbon are within the scope of this invention. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present invention. The term “stereoisomer” refers to a molecule that is an enantiomer, diastereomer or geometric isomer of a molecule. Stereoisomers, unlike structural isomers, do not differ with respect to the number and types of atoms in the molecule's structure but with respect to the spatial arrangement of the molecule's atoms. Examples of stereoisomers include the (+) and (-) forms of optically active molecules.

[0035] As used herein the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound” includes a plurality of such compounds, and reference to “the method” includes reference to one or more methods, method steps, and equivalents thereof known to those skilled in the art, and so forth. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Hence “comprising A or B” means including A, or B, or A and B. Furthermore, the use of the term “including,” as well as other related forms, such as “includes” and “included,” is not limiting.

[0036] The term “about” as used herein is a flexible word with a meaning similar to “approximately” or “nearly.” The term “about” indicates that exactitude is not claimed, but rather a contemplated variation. Thus, as used herein, the term “about” means within 1 or 2 standard deviations from the specifically recited value, or ± a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 4%, 3%, 2%, or 1 % compared to the specifically recited value.

[0037] The term “compound,” or “composition," or “compound of the invention” includes all solvates, complexes, polymorphs, radiolabeled derivatives, tautomers, stereoisomers, and optical isomers of the compound of the invention having a structure according to the structure of MK-4, and salts thereof, unless otherwise specified.

[0038] The term “treatment,” as used herein in the context of treating a condition, pertains generally to treatment and therapy, whether of a human or an animal (e.g., in veterinary applications), in which some desired therapeutic effect is achieved, for example, the inhibition of the progress of the condition, and includes a reduction in the rate of progress, a halt in the rate of progress, amelioration of the condition, and cure of the condition. Treatment as a prophylactic measure (i.e., prophylaxis) is also included.

[0039] A “pharmaceutical composition” or “pharmaceutical composition of the invention” refers to a compound of the invention or a pharmaceutically acceptable salt, solvate, hydrate or prodrug thereof as an active ingredient, and at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises two or more pharmaceutically acceptable carriers and / or excipients. In other embodiments, the pharmaceutical composition further comprises at least one additional antibiotic, such as through a co-treatment. As used herein, a “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered composition of the invention. The pharmaceutical acceptable carrier may comprise any conventional pharmaceutical carrier or excipient. The choice of carrier and / or excipient will to a large extent depend on factors such as the particular mode of administration, the effect of the carrier or excipient on solubility and stability, and the nature of the dosage form.

[0040] The term “pharmaceutically acceptable carrier” as used herein further pertains to compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of a subject (e g., human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Each carrier, excipient, etc. must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, diluents, excipients, etc. can be found in standard pharmaceutical texts. See, for example, “Handbook of Pharmaceutical Additives,” 2nd Edition (eds. M. Ash and I. Ash), 2001 (Synapse Information Resources, Inc., Endicott, N.Y., USA), “Remington's Pharmaceutical Sciences”, 20th edition, pub. Lippincott, Williams & Wilkins, 2000; and “Handbook of Pharmaceutical Excipients”, 2nd edition, 1994.

[0041] Suitable pharmaceutically acceptable carriers include inert diluents or fdlers, water, and various organic solvents (such as hydrates and solvates). The pharmaceutical compositions may, if desired, contain additional ingredients such as flavorings, binders, excipients, and the like. Thus, for oral administration, tablets containing various excipients, such as citric acid may be employed together with various disintegrants such as starch, alginic acid and certain complex silicates and with binding agents such as sucrose, gelatin, and acacia. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Additionally, lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc are often useful for tableting purposes. Solid compositions of a similar type may also be employed in soft and hard filled gelatin capsules. Non-limiting examples of materials, therefore, include lactose or milk sugar and high molecular weight polyethylene glycols. When aqueous suspensions or elixirs are desired for oral administration the active compound therein may be combined with various sweetening or flavoring agents, coloring matters or dyes and, if desired, emulsifying agents or suspending agents, together with diluents such as water, ethanol, propylene glycol, glycerin, or combinations thereof. The pharmaceutical composition of the invention may, for example, be in a form suitable for oral administration as a tablet, capsule, pill, powder, sustained release formulations, solution suspension, for parenteral injection as a sterile solution, suspension, or emulsion, for topical administration as an ointment or cream or for rectal administration as a suppository. The pharmaceutical composition may be in unit dosage forms suitable for single administration of precise dosages. Exemplary parenteral administration forms include solutions or suspensions of active compounds in sterile aqueous solutions, for example, aqueous propylene glycol or dextrose solutions. Such dosage forms may be suitably buffered, if desired.

[0042] A pharmaceutical composition of the invention may be administered as single or multiple agents, for example a pharmaceutical composition of the compound of the invention, or a pharmaceutical composition of the compound of the invention and a second therapeutic compound or agent. In some embodiments, the methods the pharmaceutical composition of the invention can be used to treat a mitochondrial disease, or one or more of its symptoms. Pharmaceutical compositions suitable for the delivery of the compound of the invention as described herein, and methods for their preparation will be readily apparent to those skilled in the art. Such compositions and methods for their preparation can be found, for example, in 'Remington's Pharmaceutical Sciences', 19th Edition (Mack Publishing Company, 1995), the disclosure of which is incorporated herein by reference in its entirety.

[0043] The active compound MK-4 can be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it can be enclosed in hard or soft shell gelatin capsules, or it can be compressed into tablets, or it can be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipient and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparation can contain at least 0.1% of active compound. The percentage of the compositions and preparation can, of course, be varied and can conveniently be between about 1 to about 10% of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Typical compositions or preparations according to the invention are prepared such that an oral dosage unit form contains from about 1 to about 1000 mg of active compound.

[0044] Pharmaceutical compositions for use in the methods of the present invention may be prepared by any of the methods of pharmacy, but all methods include the step of bringing the active ingredient into association with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation. For example, a tablet may be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding, in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.

[0045] The compound of the invention can also be administered parenterally. Solutions of the active compound as a free base or pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersion can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0046] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It can be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent of dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, e.g., sugars or sodium chloride. Prolonged absorption of the injectable compositions of agents delaying absorption, e.g., aluminum monostearate and gelatin.

[0047] Sterile injectable solutions are prepared by incorporating the compound of the invention in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.

[0048] The compound of the invention can be administered to a subject alone or in combination with pharmaceutically acceptable carriers, as noted above, the proportion of which is determined by the solubility and chemical nature of the compound, chosen route of administration and standard pharmaceutical practice. The physician can readily determine the dosage of the present therapeutic agents which will be most suitable for prophylaxis or treatment, and it will vary with the form of administration and the particular compound chosen, and also, it will vary with the particular patient under treatment. The physician will generally wish to initiate treatment with small dosages by small increments until the optimum effect under the circumstances is reached. The therapeutic dosage can generally be from about 0.1 to about 1000 mg / day, and preferably from about 10 to about 100 mg / day, or from about 0.1 to about 50 mg / Kg of body weight per day and preferably from about 0.1 to about 20 mg / Kg of body weight per day and can be administered in several different dosage units. Higher dosages, on the order of 2Xto about 4X, may be required for oral administration.

[0049] A “therapeutically effective amount” means the amount of a compound that, when administered to a subject for treating a mitochondrial disease, is sufficient to effect such treatment for the disease or one or more of its symptoms. The “therapeutically effective amount” will vary depending on the compound, the disease and its severity and the age, weight, etc., of the mammal to be treated. “Treating” or “treatment” of a mitochondrial disease includes: ( 1) preventing the mitochondrial disease, i.e., causing the clinical symptoms of a mitochondrial disease not to develop in a subject that may be exposed to or predisposed to the infection but does not yet experience or display symptoms of the infection; (2) inhibiting the mitochondrial disease, i.e., arresting or reducing the development of the disease or its clinical symptoms; or (3) relieving the mitochondrial disease, i.e., causing regression of the disease or its clinical symptoms.

[0050] As noted above, the compound of the invention, or pharmaceutical composition comprising the compound of the invention, may be administered to a “subject,” and preferably a human subject, by any convenient route of administration, whether systemically / peripherally or at the site of desired action, including but not limited to, oral (e g. by ingestion); topical (including e g. transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e g. by inhalation or insufflation therapy using, e.g. an aerosol, e.g. through mouth or nose); rectal; vaginal; parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrastemal; by implant of a depot, for example, subcutaneously or intramuscularly. The subject may be a eukaryote, an animal, a vertebrate animal, a mammal, a rodent (e.g., a guinea pig, a hamster, a rat, a mouse), murine (e.g., a mouse), canine (e.g., a dog), feline (e.g., a cat), equine (e.g., a horse), a primate, simian (e.g., a monkey or ape), a monkey (e g., marmoset, baboon), an ape (e.g., gorilla, chimpanzee, orangutang, gibbon), or a human.

[0051] It will be appreciated that appropriate dosages of the active compound, and compositions comprising the active compound, can vary from patient to patient. Determining the optimal dosage will generally involve the balancing of the level of therapeutic benefit against any risk or deleterious side effects of the treatments of the present invention. The selected dosage level will depend on a variety of factors including, but not limited to, the activity of the particular compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, and / or materials used in combination, and the age, sex, weight, condition, general health, and prior medical history of the patient. The amount of compound and route of administration will ultimately be at the discretion of the physician, although generally the dosage will be to achieve local concentrations at the site of action which achieve the desired effect without causing substantial harmful or deleterious side-effects.

[0052] Administration in vivo can be effected in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.

[0053] The term “pharmaceutically acceptable salt” means a salt which is acceptable for administration to a patient, such as a mammal, such as human (salts with counterions having acceptable mammalian safety for a given dosage regime). Such salts can be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids. “Pharmaceutically acceptable salt” refers to pharmaceutically acceptable salts of a compound, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, formate, tartrate, besylate, mesylate, acetate, maleate, oxalate, and the like.

[0054] The term “salt thereof’ means a compound formed when a proton of an acid is replaced by a cation, such as a metal cation or an organic cation and the like. Where applicable, the salt is a pharmaceutically acceptable salt, although this is not required for salts of intermediate compounds that are not intended for administration to a patient. By way of example, salts of the present compound include those wherein the compound is protonated by an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the salt. For therapeutic use, salts of the compound are those wherein the counter-ion is pharmaceutically acceptable. However, salts of acids and bases which are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.

[0055] The invention now being generally described will be more readily understood by reference to the following examples, which are included merely for the purposes of illustration of certain embodiments of the embodiments of the present invention. The examples are not intended to limit the invention, as one of skill in the art would recognize from the above teachings and the following examples that other techniques and methods can satisfy the claims and can be employed without departing from the scope of the claimed invention. Indeed, while this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

[0056] EXAMPLES

[0057] Example 1 : Invention Overview and Rationale.

[0058] Mitochondria play a vital role in maintaining normal cellular functions and biological processes. Mutations or deletions in the mitochondrial genome can cause numerous human diseases, and in particular, neurological and muscular disorders, including dementia, deafness, hyposmia, neuropathy, and myopathy, as well as increased incidences of fetal death, generally referred to herein as mitochondrial diseases or disorders. It has been challenging to understand the molecular basis of these mitochondrial diseases, especially the neurological and behavioral defects, due to varying numbers of mitochondria in the cells and variable copy numbers of mtDNA in mitochondria. These characteristics and the heteroplasmic nature of most mtDNA mutations often result in highly variable and heterogeneous phenotypes that could be either subtle or severe, depending on the mutation load of mtDNA, the percentage of mtDNA copies with a mutation, in specific cells, tissues, or individuals. These have greatly complicated the mechanistic analysis. Here Applicants demonstrate that three different C. elegans mtDNA mutants, despite carrying drastically different mtDNA mutations that affect different sets of genes (Fig. 1A), exhibit surprisingly consistent neurological, behavioral, and developmental defects, including reduced sensory responses, locomotion, and learning and memory, and increased embryonic lethality, which resemble some of the typical symptoms seen in human patients with mtDNA mutations. These unexpected results indicate that different mtDNA mutations can act through a common signaling pathway and mechanism to affect the nervous system and the developmental process.

[0059] Since the mitochondrial genome is packed with genes that encode components of the respiratory chain crucial for ATP production and genes that encode rRNAs and tRNAs important for mitochondrial protein synthesis, any mutation in mtDNA could impair the ATP production and hence the functions of tissues and organs. Indeed, mitochondrial diseases can be caused by mutations in virtually every single mtDNA gene and mutations in different protein- and tRNA- coding genes often cause similar defects. Since the nervous system is highly sensitive to ATP levels, interference of ATP production by mtDNA mutations could compromise neuronal functions and lead to neurological and related defects. For example, the human T9176G mtDNA mutation in the ATPase 6 gene decreases ATP production and causes Leigh syndrome, which is a common mitochondrial disease characterized by intellectual and movement retardation, brainstem dysfunction, and other neurological defects and can be caused by mutations in at least five different mtDNA-encoding genes. Some pregnant women with the Leigh syndrome also had high incidences of miscarriages and fetal deaths. Moreover, in multiple cellular models of human mitochondrial diseases, such as MELAS, NARP, and LHON (17), significant cellular ATP reduction has been detected. Using a genetically encoded ATP sensor, Queen-2m, or a fluorescent mitochondrial ATP sensor, BioTracker ATP-Red, Applicants show that three different mtDNA mutations cause similar reduction of ATP levels in neurons (Fig. 2A) and in embryos (Fig. 8 B and 0. Importantly, treatment of these mtDNA mutants with MK-4, a subtype of vitamin K2 that can improve the efficiency of mitochondrial ATP production by acting as an electron carrier, not only restored neuronal and embryo ATP levels but also rescued all neurological, behavioral and developmental defects of these mutant animals (Fig. 2 C-K), confirming that reduced ATP levels are directly responsible for the defects caused by these mtDNA mutations. The observations that the AMPK-F0X0-IP3R pathway, which senses and is modulated by cellular ATP levels, is required for the manifestation of these defects induced by mtDNA mutations (Fig. 3 A-C, and Fig. 8 D and E, , Fig. 12 A-D), provide strong support that reduced ATP levels and the activation of the AMPK pathway underlie the neurological and developmental defects in mtDNA mutants.

[0060] Ca2overload is another important feature in mitochondrial diseases and has been observed in cells from a variety of patients with mitochondrial diseases, such as LHON (m.11778G>A), LS (m.8993T>G), MERRF (m.8344A>G), MIDD (m.3244A>G), MELAS (m,13565OT), and PEO (m.3243A>G). In the nervous system, Ca2+overload negatively affects neuronal development and signal transduction and can cause neurological disorders and neuronal death. In muscle cells, Ca2+overload impairs muscle contraction and can cause muscle fiber degeneration. However, how mtDNA mutations lead to Ca2+overload is not understood and is a critical issue for treating mitochondrial disease. Here, Applicants demonstrate that Ca2+overload induced by mtDNA mutations is suppressed by treatment with vitamin MK-4, which acts by restoring cellular ATP levels, suggesting a direct link between reduced cellular ATP levels and Ca2+overload. Moreover, the Ca2 1overload is suppressed by loss or reduction of the aak-2, daf-16, or itr-1 activity, indicating that the AMPK- F0X0-IP3R signaling pathway acts downstream of mtDNA mutations to increase cytosolic Ca2elevation. Taken together, Applicants results suggest that reduced ATP outputs due to mtDNA mutations trigger activation of AMPK and one of its downstream transcription factors, F0X0 / DAF-16, which translocates to the nucleus to enhance the expression of the ER calcium release channel IP3R / ITR-1, leading to elevated cytosolic calcium levels (Fig. 9). Therefore, Applicants findings delineate a new ATP-sensing signaling pathway that leads to Ca2+overload and associated neurological, behavioral, and developmental defects observed in mtDNA mutants and that is likely to be conserved across different species.

[0061] Currently, there is no cure for mitochondrial disorders caused by mtDNA mutations and this has been a major unmet medical need. Production of reactive oxygen species (ROS) due to compromised oxidative phosphorylation and accumulation of ROS-induced cellular damage have been proposed to be the main contributing cause of mtDNA-related mitochondrial disorders. However, antioxidant therapies, such as treatment with vitamin C / E and glutathione precursors, have not shown satisfactory treatment outcomes. Idebenone, an analog of coenzyme Q, has been used in human LHON patients to improve visual acuity with mixed results, in which idebenone appears to act by increasing the activity of mitochondrial complex I, and potentially, improving ATP synthesis. In comparison, Applicants demonstrate that vitamin MK-4 treatment can significantly increase ATP synthesis and restore cellular ATP levels in three different mtDNA mutants. More importantly, MK-4 treatment improves all downstream events, including neuronal excitability and synaptic connections, and prevents or alleviates neurological, behavioral, and developmental defects of these different mtDNA mutants. Therefore MK-4 represents a novel general drug for treating mitochondrial diseases.

[0062] Example 2: Desensitized sensory responses by mtDNA mutations.

[0063] To understand how mtDNA mutations affect neurological functions and behaviors, Applicants analyzed two C. elegans heteroplasmic mtDNA mutants, uaDf5 / + and ctb- l(tm4273) / 1 , and a rare homoplasmic mtDNA mutant, ctb-l(qm!89) (Fig. 1A). The 3053 bp uaDf5 deletion removes four mtDNA-encoded genes (ctb-1, ND2, ATP6, and ND1) and 7 tRNAs made by mtDNA (36). qm!89 is a Cytosine to Thymine single nucleotide change that results in Ala 170 to Vai substitution in the ctb-1 gene, which encodes the cytochrome b protein of the mitochondrial complex III (35). The 782 bp tm4273 deletion was isolated in a Trimethylolpropane (TMP) and Ultraviolet (UV) mutagenesis screen (37) (See Methods) and removes most of the ctb-1 gene. In an avoidance behavioral assay induced by high osmolarity (1 M or 250 mM glycerol, SI Appendix, Fig. 10 / 1 ), which is mainly mediated by two ASH sensory neurons in C. elegans (38, 39), all three mtDNA mutants were indistinguishable from wild type (WT) animals, exhibiting similar avoidance indexes (Fig. 15 and SI Appendix, Fig. 105). When the concentration of glycerol was reduced to 50 mM, these three mtDNA mutants showed significantly lower avoidance indexes than that of WT animals (Fig. 15), suggesting compromised osmolarity sensing.

[0064] Since the osmolarity avoidance behavior is triggered by the calcium flux in ASH neurons (40), Applicants used a genetically encoded Ca2+sensor, GCaMP-5 (41), to detect calcium changes in ASH neurons upon osmolarity stimulation. 50 mM glycerol induced a calcium spike in ASH neurons in WT animals, as indicated by GCaMP-5 expressed in ASH neurons under the control of the sra-6 gene promoter (40), but such calcium increases were significantly reduced in three mtDNA mutants (Fig. 1 C and D). In contrast, treatment with 250 mM glycerol triggered comparable levels of elevated cytosolic calcium in ASH neurons of WT animals and three mtDNA mutants (SI Appendix, Fig. 10 C and D), indicating that mtDNA mutations do not affect the response to strong osmolarity stimulation but impair the response to weaker osmolarity stimulation. Applicants observed a similar avoidance behavioral defect in all three mtDNA mutants to a low concentration of CuC12 (100 pM), a repellent, but not to a higher concentration (2 mM) of CuCl2 (Fig.1E), which is also sensed by the two ASH neurons (38). Similarly, 100 µM of CuCl2 induced significantly less calcium increases in ASH neurons in three mtDNA mutants than in WT animals (SI Appendix, Fig.10 E and F). These results indicate that mtDNA mutations desensitize the avoidance response of animals to osmolarity and repellents. Applicants observed a similar pattern of desensitization of avoidance responses to other stimuli in these three mtDNA mutants. For example, these mtDNA mutations desensitized avoidance response to 150 mM NaCl, but not to 1 M NaCl (Fig.1F), which is mainly mediated by the two ASE (ASEL and ASER) neurons (42). Similarly, 150 mM NaCl induced less calcium increases in the ASEL neurons in these three mtDNA mutants than in WT animals (SI Appendix, Fig.10 G and H), as indicated by the GCaMP-5 sensor expressed in the ASEL neuron under the control of the gcy-6 gene promoter (43). The avoidance responses to 1:10 diluted 2-nonanone, an aversive odorant sensed by the AWB neurons (44), were also significantly delayed in three mtDNA mutants (Fig.1G), which is consistent with reduced chemotaxis of these mtDNA mutant animals away from 1:250 diluted 2- nonanone (SI Appendix, Fig.10 I and J). Interestingly, in an associative learning and memory test based on 2-nonanone (Fig.1H), these three mtDNA mutants exhibited reduced ability in learning to associate 2-nonanone with food compared with WT animals and their memories of such association disappeared rapidly (Fig.1I and SI Appendix, Fig.10K). On the other hand, the chemotaxis indexes of animals towards 5 × 10-6diluted diacetyl, an attractant sensed by the AWA neurons (45), were reduced significantly in three mtDNA mutants, but remained comparable to that of WT animals towards more concentrated 10-2diluted diacetyl (Fig. 1J), showing a similar desensitization to the attractant by mtDNA mutations. Together, these results indicate that these three mtDNA mutations, despite being very different molecular lesions (Fig. 1A), have similar effects in desensitizing multiple sensory responses mediated by several different neurons to various chemicals with differing properties. Example 3: Reduced neuronal ATP level by mtDNA mutations. Given that mtDNA-encoded proteins are components of the electron transport chain involved in ATP production, Applicants examined whether mtDNA mutations affect neuronal ATP levels. Applicants expressed a ratiometr c fluorescent ATP sensor, QUEEN-2m, under the control of the sra-6 gene promoter (sra-6p::queen-2m) to monitor the ATP levels in ASH neurons (46, 47). When WT animals transgenic for sra-6p::queen-2m were treated with sodium azide (a respiratory chain inhibitor) for 10 min, the ATP levels in ASH neurons decreased in response to increasing concentrations of sodium azide (SI Appendix, Fig.11A), indicating that this QUEEN- 2m ATP sensor works well in ASH neurons. Using this method, Applicants found that the ATP levels of ASH neurons in three mtDNA mutants were significantly lower than that in WT animals (Fig. 2A), indicating that mtDNA mutations compromise ATP production and decrease neuronal ATP levels.

[0065] Example 4: MK-4 treatment restores ATP levels and alleviates behavioral defects.

[0066] MK-4, a subtype of vitamin K2 (Fig. 2B), is a mitochondrial electron carrier that can improve the efficiency of ATP production (48). When mtDNA mutant animals were fed with 2 mM MK-4, the ATP levels in ASH neurons were restored to the levels seen in WT animals (Fig. 2Q. The avoidance indexes of these three mtDNA mutants to 50 mM glycerol and corresponding calcium fluxes in ASH neurons upon glycerol stimulation were significantly improved (Fig. 2 D- F), indicating that ASH neuronal responsiveness is largely restored in mtDNA mutants with MK- 4 treatment. Moreover, avoidance indexes of three mtDNA mutants to CuC12 and NaCl, latencies of their avoidance response to 2-nonanone, their chemotaxis indexes towards the attractant diacetyl, as well as their learning indexes in responding to 2-nonanone through food association, were all significantly improved by MK-4 treatment (Fig. 2 G to K, and SI Appendix, Fig. 1 IB and 0. These results indicate that increasing ATP production and ATP levels by feeding with MK-4 alleviates multiple sensory and behavioral defects caused by three different mtDNA mutations and that the neuronal energy levels directly impact the functions of neurons and associated behaviors. Example 5: AMPK-FOXO signaling mediates behavioral defects.

[0067] AMPK is a sensor of the energy status in the cell that regulates many important cellular functions (49, 50). In C. elegans, the AMPK homologue, AAK-2, exerts its effects in part through activating the FOXO transcription factor, DAF-16, which plays a key role in regulating cell growth, development, longevity, metabolism and behaviors (51, 52). Applicants thus examined whether the AMPK signaling pathway is associated with the sensory and behavioral defects caused by mtDNA mutations. In glycerol avoidance tests, single aak-2(ok524) and daf-16(mu86) loss-of- function mutations and these two mutations together rescued the behavioral defect of the mtDNA mutants (Fig. 3 / 1). Calcium flux in ASH neurons induced by 50 mM glycerol was largely restored in these mtDNA mutants by loss of aak-2, daf-16, or both (Fig. 3 B and C), indicating that the neuronal and behavioral response of these mtDNA mutants to glycerol is restored. Loss of aak-2, daf-16 or bothalso rescued the behavioral defects of these three mtDNA mutants in CuC12 and NaCl avoidance assays, 2-nonanone response latency tests, and diacetyl chemotaxis assays (SI Appendix, Fig. 12 A-Dy In all assays, rescue of the neuronal and behavioral defects caused by three mtDNA mutations is indistinguishable among the aak-2(ok524) and daf-16(mu86) single mutants and the daf-16(mu86); aak-2(ok524) double mutants, suggesting that aak-2 and daf-16 act in the same pathway to modulate neuronal and behavioral response of animals to multiple different chemicals in three different mtDNA mutants by sensing the levels of ATP in neurons. Example 6: mtDNA mutations activate FOXO / DAF-16. Since low ATP levels activate AAK-2 and lead to translocation of DAF-16 from the cytoplasm to the nucleus where it regulates the expression of downstream genes (51, 53), Applicants asked whether mtDNA mutations might promote DAF-16 nuclear translocation using an integrated transgene, zIs356 (daf- 16p::daf-16::gfp), that expresses the DAF-16::GFP translational fusion from its own promoter (54). Applicants found that compared with wild-type animals mtDNA mutants had far more nuclei with the relocated DAF-16::GFP (Fig. 4 A and B). The increased DAF-16 nuclear translocation in mtDNA mutants was blocked or markedly reduced by loss of aak-2 (Fig. 4B) or by MK-4 treatment (Fig. 4C), indicating that the DAF-16 nuclear translocation is triggered by low ATP levels and AAK-2 activation. The mtDNA mutants also showed significantly increased DAF-16::GFP nuclear localization in ASH neurons compared with wild type animals, which was similarly blocked by the aak-2(ok524) mutation (Fig.4 D and E) or by treatment with MK-4 (Fig. 4F). Because DAF-16 could be activated by the AAK-2 kinase through phosphorylation at three key residues (Thr166, Ser314, Ser466) (51), Applicants substituted these residues with Alanine in the daf-16p::daf-16::gfp reporter and found that these substitutions blocked increased DAF-16 nuclear translocation induced by mtDNA mutations (Fig. 4 G and H). These results suggest that mtDNA mutations prompt nuclear translocation of DAF-16 through AAK-2 to affect neuronal functions and responsiveness. Example 7: Activated DAF-16 elevates basal cytosolic Ca2+ level. As the major trigger of neurotransmitter release, calcium plays a critical role in regulating neuronal excitability (55). Abnormal calcium levels can lead to neuronal dysfunction and degeneration in various pathological conditions (56, 57). Applicants expressed GCaMP-5 in a bicistronic transcript with the red fluorescent protein mCherry, which is used as an internal expression control, to monitor the cytosolic ca ium levels in ASH neurons. Applicants found that the basal cytosolic calcium levels in the ASH neurons of the three mtDNA mutants were significantly higher than that in wild type animals (Fig. 5A), indicating that mtDNA mutations result in elevation of the basal cytoplasmic calcium levels in the ASH neurons. Since maintenance of the proper calcium homeostasis depends on ATP consumption (58), Applicants tested if feeding animals with MK-4 affects cytosolic calcium levels in three mtDNA mutants and found that MK-4 treatment restored their cytosolic calcium concentrations to the level seen in WT animals (Fig. 5A), which was not affected by MK-4 treatment. Moreover, loss of aak- 2, daf-16 or both similarly suppressed increase of basal cytosolic calcium caused by mtDNA mutations (Fig. 5B), but did not alter the cytosolic calcium level in WT animals. These results indicate that AAK-2 and DAF-16 play critical roles in regulating neuronal cytosolic calcium levels in response to cellular ATP levels.

[0068] To further determine whether activated DAF-16 leads to elevated basal cytosolic calcium, Applicants measured the cytosolic calcium levels in a temperature-sensitive loss-of-function mutant (el 370) defective in daf-2, which encodes an insulin-like receptor and acts upstream to inhibit the activity of DAF-16 (52). When daf-2(e!370) animals were grown at 25°C, a nonpermissive temperature that results in activation of DAF-16 (59), the basal cytosolic calcium levels in their ASH neurons were significantly higher than that in daf-2(el370) animals grown at 18°C (Fig. 5 C and D), a permissive temperature that does not activate DAF-16 (59). In comparison, growing at 25°C did not raise basal cytosolic calcium levels in ASH neurons in WT animals or in the daf-2(e!370); daf- 16(mu86) double mutant (Fig. 5 C and D). These data confirm that activated DAF- 16 due to reduced daf-2 activity causes elevated basal cytosolic calcium in ASH neurons. Accordingly, the avoidance responses of daf-2(el370) animals to 50 mM glycerol (Fig. 5A), 100 uM CuC12 (SI Appendix, Fig. 13 / 4 ), 150 mM NaCl (SI Appendix, Fig. 135), and 1 : 10 diluted 2-Nonanone (SI Appendix, Fig. 13C), were weakened significantly at 25°C, but not at 18°C. These results provide further support to the conclusion that activated DAF-16 causes elevated basal cytosolic calcium levels in neurons and associated sensory and behavioral defects. Example 8: Unregulated IP3R / ITR-1 by DAF-16 leads to cytosolic Ca2+ overload.

[0069] Analysis of the C. elegans genome suggests that calcium homeostasis could be regulated by approximately 216 calcium related genes, including multiple ion channels, transporters, and calcium binding proteins (60). An RNA sequencing analysis showed that expression of approximately 97 calcium related genes was detected in isolated C. elegans neurons, thirteen of which were significantly upregulated (log2FC > 2, FC: Fold Change) or down-regulated (log2FC < - 2) when DAF-16 was activated (61) (Table SI). Applicants performed RNAi knockdown of these thirteen genes and found that RNAi knockdown of the itr-1 gene significantly suppressed the behavioral defects of all three mtDNA mutants in glycerol avoidance assays (SI Appendix, Fig. 14), whereas RNAi knockdown of the other twelve genes had no detectable effect, itr-1 encodes an orthologue of the inositol trisphosphate receptor (IP3R), which has been shown to be an endoplasmic reticulum (ER) calcium release channel and a key regulator of the cytosolic calcium levels (62-64). itr-1 is widely expressed in the nervous system and regulates the neuronal functions (62, 65-67). In mice deficient in the wfs-1 gene, which is associated with the Wolfram syndrome and mitochondrial dysfunction (6), the function of IP3R is disturbed, leading to disruption of cytosolic Ca2homeostasis and reduced Ca2+transients in neurons (68). Importantly, in our behavioral assays, an itr-1 partial loss-of-function mutation (sa73) strongly suppressed the behavioral defects of all three mtDNA mutants in response to glycerol, CuC12, 2-nonanone, NaCl and diacetyl (Fig. 6A and SI Appendix, Fig. 15 A-D). Furthermore, itr-l(sa73) restored glycerol- induced calcium spikes in ASH neurons of three mtDNA mutants in response to 50 mM glycerol (Fig. 6 B and C), indicating that reduction of the itr-1 activity alone is sufficient to suppress cellular and behavioral defects of these three mtDNA mutants. Using an integrated itr-lp::gfp transgene (otls453) as a transcription reporter, Applicants observed increased GFP expression in the ASH neurons of three mtDNA mutants, significantly higher than that in wild type animals (Fig. 6D and SI Appendix, Fig. 15 / ; and / ). Loss of aak-2, daf-16 or both reduced GFP expression from otls453 in three mtDNA mutants to or lower than the level seen in wild-type animals (Fig. 6D). These results suggest that the expression of itr-1 is upregulated in mtDNA mutants through the AAK-2 and DAF- 16 pathway.

[0070] Recent data from chromatin immunoprecipitation sequencing (ChlP-seq, GSE15567, modENCODE project) show that the itr-1 promoter has strong DAF-16 binding signals (69). Deleting part of the sequence that contains strong DAF-16 binding sites in the itr-1 promoter [itr- lp(mut)~] was sufficient to nullify the increased expression of itr-1 in the ASH neurons of three mtDNA mutants (Fig. 6E and SI Appendix, Fig. 15G), suggesting that activated DAF-16 binds to the itr-1 promoter to increase its expression. The itr-l(sa73) mutation, while not affecting the basal cytosolic calcium level on its own, suppressed the elevation of basal cytosolic calcium levels in ASH neurons caused by these three mtDNA mutations (Fig. 6F). On the other hand, the expression levels of unc-68, which encodes an ortholog of the human ryanodine receptor I and another Ca2+release channel localized in ER (70), were similar in wild type and three mtDNA mutant animals (Fig. 6G). These results suggest that activated DAF-16 functions through ITR-1 to regulate the basal cytosolic calcium levels in neurons.

[0071] Example 9: The AMPK-FOXO-IP3R pathway regulates synaptic development.

[0072] Myopathy is another important clinical feature of human mitochondrial diseases caused by mtDNA mutations, including KSS, PEO, MELAS and MERRF (5, 71-73). Interestingly, locomotor defects were also observed in three C. elegans mtDNA mutants (Fig.7A), which were assessed by counting the number of animal thrashes in the liquid medium (74, 75). Treatment with 2 mM MK-4, or loss of aak-2, daf-16 or itr-1, suppressed the locomotor defects of these three mtDNA mutants without affecting the locomotion of WT animals (Fig.7 A and B), indicating that the AMPK-FOXO- IP3R pathway is involved in mediating the locomotor defect of mtDNA mutants. Since the locomotor defect could be caused by malfunction of motor neurons and muscle (76), and DAF-16 is involved in the development of synapses and formation of the neuromuscular junction (NMJ) (77, 78), Applicants examined whether mtDNA mutations affect the formation of NMJs. Using an integrated transgene juIs1, which drives expression of a presynaptic marker SNB- 1::GFP under the control of the unc-25 gene promoter in GABAergic neurons (78, 79) (Fig.7C), Applicants quantified the number of NMJs between two C. elegans ventral motor neurons, VD10 and VD11, and found that the numbers of NMJs were significantly reduced in all three mtDNA mutants, compared with that in WT animals (Fig.7 D and E), indicating that mtDNA mutations also affect the formation of NMJs. Moreover, the NMJ defects in these mtDNA mutants were rescued by MK-4 treatment or by the aak-2(ok524), daf-16(mu86) or itr-1(sa73) mutation (Fig.7 E and F). These data indicate that mtDNA mutations compromise the formation of synapses and NMJs through affecting the AMPK-FOXO-IP3R signaling pathway and thus result in locomotor defects. Example 10: The AMPK-FOXO-IP3R pathway mediates embryonic death caused by mtDNA mutations. C. elegans animals carrying the uaDf5 mtDNA deletion have been shown to exhibit a higher rate of embryonic lethality in their progeny than N2 animals (80), similar to what have been observed in human mothers with mtDNA mutations (10-13). Applicants detected increased embryonic lethality in the ctb-1(qm189) mutant (8.6%) and in the ctb-1(tm4273) / + mutant (3.7%), as in the uaDf5 / + mutant (6.3%) (Fig.8A). In contrast, WT animals have a low embryonic lethality rate (1.12%, Fig. 8A), suggesting that increa ed fetal mortality is a general feature of mtDNA mutants. Since treatment of mtDNA mutants with 2 mM MK-4 remedied their sensory and behavioral defects, Applicants examined if MK-4 treatment could reduce embryonic lethality of mtDNA mutants and found that 2 mM MK-4 treatment significantly suppressed embryonic lethality in all three mtDNA mutants (Fig. 8A). These results indicate that enhancing ATP production can prevent embryonic death caused by mtDNA mutations. Using a fluorescent mitochondrial ATP sensor, BioTracker ATP-Red (81), Applicants measured mitochondrial ATP levels in embryos of WT animals and mtDNA mutants and observed significantly lower ATP levels in embryos of three mtDNA mutants than in N2 embryos (Fig. 8, B and 0, confirming that mtDNA mutations cause reduction of ATP levels in embryos. Indeed, when mtDNA mutants were treated with 2 mM MK-4, the ATP levels in their embryos increased significantly (Fig. 8 B and 0, close to the levels seen in WT embryos. These results indicate that mtDNA mutations cause reduced ATP production in embryos, leading to increased embryonic death.

[0073] Applicants next examined if increased embryonic death caused by mtDNA mutations is also mediated by the AMPK-F0X0-IP3R pathway. Applicants found that loss of aak-2 or daf-16 strongly suppressed embryonic lethality in all three mtDNA mutants (Fig. 8Z>), indicating that aak- 2 and daf-16 mediate embryonic death induced by mtDNA mutations. IP3R is crucial for embryo development and most of the IP3R deficient mice die in utero (82). Similarly, itr-l(sa73) causes high embryonic lethality in C. eleglans (83), which prevents interrogation of its role in embryonic death induced by mtDNA mutations. Applicants thus tested if mild reduction of the itr-1 activity by limited RNAi knockdown could have a much-reduced effect on embryo development and thus allow examination of the impact of mtDNA mutations on embryos. Applicants found that feeding mtDNA mutants with a bacterial mixture containing 3% itr-1 RNAi bacteria and 97% control RNAi bacteria, albeit showing no detectable effect on WT animals, significantly suppressed embryonic lethality of all three mtDNA mutants, compared with these mutant animals fed with 100% control RNAi bacteria (Fig. 8£), suggesting that ITR-1 also mediates embryonic deaths caused by mtDNA mutations. These data together indicate that increased embryonic death caused by mtDNA mutations is also mediated by the AMPK-FOXO-IP3R pathway.

[0074] Taken together, our data suggest a model that accounts for the neurological, behavioral and developmental defects of mtDNA mutants: reduced mitochondrial ATP production due to mtDNA mutations triggers the activation of the ATP sensor, AMPK / AAK-2, and the activation of the AAK-2 target, the FOXO transcription factor DAF-16, which then translocates into the nucleus where it increases the expression of the IP3R / ITR-1 calcium release channel in ER, leading to the elevation of the basal cytosolic calcium levels, reduced calcium flux upon sensory stimulations, compromised synapse and NMJ formation, desensitization of animals to various sensation stimuli, and defects in locomotion, behaviors and embryo development (Fig. 9).

[0075] Example 1 1 : Treatment with MK-4 restored ATP levels in fibroblasts derived from a human patient carrying a mtDNA mutation, Arg340His, in the ND4 gene. MK-4 was tested for therapeutic effects, and in particular restoration of ATP levels in a human cell line having a genetic ATP impairment. As shown in Figure 16, GM03858 fibroblasts derived from a 33-year old Caucasian male patient, who carried the Arg340His mutation in the ND4 gene encoded by the mitochondrial genome (mtDNA) and had congenital optic atrophy and other symptoms, were treated with 100 μM of MK-4 for 7 days, before they were stained with fluorescent ATP sensor, BioTracker ATP-Red. The ATP levels of MK-4-treated fibroblasts were significantly elevated compared with mock-treated fibroblasts (P=0.002, unpaired Student’s t test), indicating that the impaired mitochondrial function and ATP production are significantly improved by MK-4 treatment. Example 12: Treatment with MK-4 restored mitochondrial health in fibroblasts derived from a human patient carrying a mtDNA mutation, Leu156Arg, in the ATP6 gene. MK-4 was tested for therapeutic effects, and in particular restoration of mitochondrial health in a human cell line having a genetic mitochondrial impairment. As shown in Figure 16, GM13411 fibroblasts derived from an 8-month old Chinese baby boy, who carried the Leu156Arg mutation in the ATP6 gene encoded by the mitochondrial genome (mtDNA) and died of Leigh syndrome and Hypertrophic Cardiomyopathy, were treated with 10 μM of MK-4 or DMSO control for 24 hours, before they were stained with a fluorescent membrane-permeant mitochondrial dye, JC-1, which is widely used to monitor mitochondrial health. The red / green fluorescence intensity ratio, which directly correlates with mitochondrial membrane potential and mitochondrial health, in MK-4-treated fibroblasts were significantly elevated compared with DMSO-treated fibroblasts (P=0.0184, unpaired Student’s t test), indicating that the impaired mitochondrial functions are significantly improved by MK-4 treatment. Example 13: Materials and Methods. Nematode strains and culture conditions: All C. elegans strains were cultured at 20℃ on nematode growth medium (NGM) plates seeded with Escherichia coli OP50 as food using standard procedures (102). The N2 Bristol strain was used as wild-type strain. Alleles used in this study: LGI, daf-16(mu86); LGIII, daf-2( 1370); LGIV, itr-1(sa73); LGX, aak-2(ok524); mtDNA, uaDf5, ctb-1(qm189), ctb-1(tm4273). Transgenic strains used in this study: zIs356 V [daf-16p::daf-16::gfp + rol-6(su1006)], otIs453 [itr-1p::gfp::utr-1a 3' utr+ pha-1(+)]; wuIs305 [myo-3p::queen-2m]; smIs577 [itr-1p(mut)::gfp]; khIs22 [(pRRG4824L) unc- 68p::gfp + rol-6(su1006)]; juIs1 IV [unc-25p::snb-1::gfp + lin-15(+)]; smIs578 [daf-16p::daf-16mut::gfp + rol- 6(su1006)]; smEx6528 [sra-6p::gcamp-5 + lin-44p::mcherry]; smEx6532 [sra- 6p::gcamp- 5::sl2::mcherry + lin-44p::gfp]; smEx6637 [gcy-6p::gcamp-5 + lin-44p::gfp]; smEx6539 [sra- 6p::rfp + lin-44::mcherry]; smEx6551 [sra-6p::queen-2m+ lin-44p::gfp] and smEx6552 [sra- 6p::queen-2m + lin-44p::gfp]. zIs356, otIs453, wuIs305, juIs1 and KhIs22 are acquired from the Caenorhabditis Genetics Center (CGC). smIs577 and smIs578 are integrated transgenes generated by UV irradiation of animals carrying an extrachromosomal array containing itr- 1p(mut)::gfp or daf-16p::daf-16mut::gfp + rol-6(su1006). They were backcrossed six times with N animals before being used in this study. All C. elegans strains used in this study are listed in Table S2. Dry drop test: Day one adult animals maintained in 20℃ were used in all behavioralexperiments.3.5 cm NGMplates and related solutions were prepared fresh daily. Glycerol, NaCla d CuCl2 were dissolved in the M9 minimal media (5.8 g Na2HPO4, 3.0 g KH2PO4, 0.5 g NaCl and 1.0 g NH4Cl in 1.0-liter ddH2O). The dry drop test was used to examine the response of a single worm to repellent stimulation (39). Briefly, 10 worms as a group were put on an NGMplate and allowed to adapt for5 min. A micro-drop of solution containing glycerol, NaCl orCuCl2at the desired concentrationwas dispensed on the agar in a few millimeters’ diameterahead of a forward moving animal via a 10 μm glass capillary. The direction of the animal’s movement was observed and recorded when the animal encountered the repellent containing region, at which the micro-drop liquid has been absorbed into the agar. The avoidance index wascalculated as nreversal / ntotal, where the nreversalisthe number of worms that reversed when itencountered the repellent containing region, and thentotalis the total number of worms tested.Generally, ntotal= 10 in each independent experiment inthese tests.2-Nonanone response latency test: Single worm volatile odorant avoidance assay was performed to evaluate animal’s response latency to 2-nonanone in this study as described previously (103, 104). A day one adult animal was placed at the center of an NGM plate and allowed to adapt for 5 min. A 20 μl microcapillary pipette tip containing 5 μl of 2-nonanone (1:10 diluted in DMSO) was placed in front of the nose of a forward moving animal. Response latency was scored as the time (second as a unit) from the odorant presentation to the initiation of a reversal by the animal. 2-Nonanone and food associative learning and memory test: The 2-nonanone associative learning and memory assay was designed based on a protocol of butanone associative learning and short-term memory assay (105). First, a portion of the day-one adults were subjected to the 2-nonanone (1 :25 diluted in DMSO) response latency test. The results were recorded as “naive” responding times and the average value was calculated as Tnaive. The other day-one adults were placed in an NGM plate without any OP50 bacteria and starved at room temperature for I hour. At the end of the starving period, animals were transferred to an NGM plate with an OP50 bacterial lawn, and the inside of the lid of the NGM plate was smeared with 2 pl of 2- nonanone (1 :25 diluted in DMSO). After a 1-hour room temperature incubation and food associative training, animals were transferred to a new NGM plate with an OP50 bacterial lawn (without 2-nonanone) and incubated at room temperature for one additional hour. After that, animals were subjected to the 2-nonanone (1 :25 diluted in DMSO) response latency test, with the results recorded as T1 hour. The learning index (LI) was calculated as (T1 hour - Tnaive) / Tnaive. A positive learning index value indicates that animals are less aversive to 2- nonanone due to the food association training and exhibit short-term associative memory.

[0076] Chemotaxis assay: The chemotaxis assays were conducted based on a previously described protocol with some modifications (45, 106), which are illustrated in Fig. 101. The assays were conducted in 9 cm diameter NGM plates. The starting point, odorant position and the negative control position were marked. Ten minutes before placing the animals, 1 pl of 0.5 M sodium azide was spotted onto the agar surface at the positions of the attractant and the negative control to immobilize animals that enter the regions. 1 pl of odorant (diluted in DMSO) and 1 pl of pure DMSO were placed at the attractant position and the negative control position, respectively. Before the assay, well-fed, synchronized day-one adult animals were washed 5 times with the M9 minimal media and then placed on the starting point. After 20 minutes, the assay plates were moved into a 4°C refrigerator to quickly immobilize all the animals. The numbers of animals in the attractant region (nodorant) and the negative control region (nctrl) were counted. The chemotaxis index was calculated as (nodorant - nctrl) / (nodorant + nctrl).

[0077] Calcium imaging: Calcium imaging experiments were performed as described previously (103, 107). A day-one adult was immersed in an external solution (150 mM NaCl, 5 mM KC1, 1 mM MgC12, 5 mM CaC12, 15 mM HEPES, 10 mM glucose, pH 7.3) and subsequently glued to a 15 mm square coverslip with medical cyanoacrylate-based glue (Gluture Topical Tissue Adhesive, Abbott Laboratories). The coverslip was then attached to a plexiglass flow chamber using Vaseline and then positioned on an inverted Nikon Ti-E microscope. Glycerol was diluted to the desired concentration before being used. The fluorescent signals of GCaMP-5 in ASH neurons were recorded by the Nikon Al laser scanning confocal system with a NIS-Elements imaging software under a 40 / / 0.9 NA Plan Apo Lambda objective lens. Intensity of 488 nm laser: 0.2%, zoom: 3x. Samples were imaged at 1 Hz. The fluorescent imaging data were analyzed using Fiji Image J software. The imaging of calcium changes in ASEL neurons induced by NaCl and in ASH neurons induced by CuC12 was performed similarly.

[0078] Quantification of the ASH neuronal ATP levels through the QUEEN-2m sensor. ATP sensor, QUEEN-2m, was expressed in the ASH neurons under the control of the sra-6 promoter. Day one adults were anesthetized using 10 mM levamisole. The fluorescent signals excited by the 405 nm laser and the 488 nm laser were collected by Zeiss LSM 800 laser scanning confocal system with ZEN imaging software under a 63 * objective lens. Intensity of 405 nm laser: 0.1%; intensity of 488 nm laser: 0.1%; zoom: 10*. The fluorescence intensity ratio of 405 nm excitation and 488 nm excitation was quantified using Fiji Image J software and normalized to that in wild type animals imaged in parallel.

[0079] MK-4 treatment of animals: MK-4 (Sigma Aldrich) was diluted to the concentration of 2 mM with fresh E. coli OP50 suspension and seeded on NGM plates (25 pl OP50 suspension per plate). Seeded plates were placed at room temperature (about 20°C) in dark for 24 hours before they were used to treat animals.

[0080] Quantification of the number of cells with nuclear DAF-16: The zls356 [daf-16p::daf- 16::gfp + rol-6(su 1006)] strain was used to determine the number of cells with nuclear DAF- 16 (54). Day one adult animals were anesthetized using 50 mM sodium azide for 5 min on an agar pad on top of a glass slide, which was then covered with a cover slip and left for 25 min before imaging. The DAF-16::GFP fluorescent patterns in the animals were scored under Nomarski optics with a 40x objective lens. The number of nuclei labelled by DAF- 16::GFP in each animal was then counted.

[0081] Quantification of DAF-16 nuclear translocation in ASH neurons: A transgene that expresses red fluorescent protein (RFP) in ASH neurons under the control of a 4.0 kb sra-6 gene promoter was crossed into animals carrying the zls356 transgene. Day one adult animals were anesthetized by 10 mM levamisole for 5 min. The GFP images of ASH neurons were acquired by a Zeiss LSM 800 laser scanning confocal system with ZEN imaging software under a 63 * objective lens. Intensity of 488 nm laser: 1%; zoom: 10*. The percentage of DAF-16 nuclear translocation in ASH neurons were quantified using the Fiji Image I software.

[0082] Quantification of the basal cytosolic calcium levels in ASH neurons: The smEx6532 [sra-6p: :gcamp-5::sl2: :mcherry + lin-44p: :gfp] transgenes were used to determine the basal cytosolic calcium levels in ASH neurons. The day -one adult animals were anesthetized by 10 mM levamisole for 5 min, left on the slide for 15 min to hold the neuronal calcium at the resting level. The GCaMP-5 and mCherry images of the animals were recorded by Zeiss LSM 800 laser scanning confocal system with the ZEN imaging software under a 63 x objective lens. Intensity of 488 nm laser: 0.1%; intensity of 561 nm laser: 0.1 %; zoom: 10x. The fluorescence intensity ratio of GCaMP-5 and mCherry was quantified using Fiji Image J software and normalized to that of wild type animals imaged in parallel.

[0083] Quantification of the itr-1 and unc-68 expression levels in ASH neurons: Animals containing a sra-6p::RFP reporter transgene that labels the ASH neurons and the otls453 [itr- lp::gfp::ntr-la 3’ utr + pha-l(-)} transgene or the khls22 \_unc-68p::gfp + rol-6(sul006)~\ transgene were used to determine the itr-1 and imc-68 expression levels in ASH neurons, respectively. The larval stage 4 (L4) animals were anesthetized by 10 mM levamisole for 5 min and the GFP fluorescence images of ASH neurons were collected by Zeiss LSM 800 laser scanning confocal system with ZEN imaging software under a 63 x objective lens. Intensity of 488 nm laser: 0.5%; zoom: 10x . The GFP fluorescence intensity was quantified using Fiji Image J software and normalized to that of wild type animals obtained in parallel.

[0084] RNA interference (RNAi) experiments: All RNAi bacterial clones used are from an RNAi library constructed by the Ahringer laboratory. A bacterial feeding protocol was used to perform the RNAi experiments (108). Briefly, individual bacterial RNAi clones were grown in LB medium containing 50 ng / pl ampicillin for 8-16 hours and then seeded on fresh NGM plates containing 1 mM IPTG. L4 stage animals were moved to RNAi plates and grown 72 hours at 20°C. Their L4 progenies were transferred to new RNAi plates and grown till the day one adult stage for behavioral assays, bacteria harboring the RNAi vector with a random insert was used as the RNAi control.

[0085] Molecular biology: The “Gibson Assembly” cloning method was used to ligate two or more DNA fragments in this study using the ClonExprss II One Step Cloning Kit (Vazyme Biotech) (109). All oligonucleotide primers were designed under the principles of this method. The sra-6p::gcamp-5 plasmid, the Un- 44p::gfp plasmid and the pGP30 (daf-16p::daf-16::gfp) plasmid were kind gifts from Dr. Lijun Kang (Zhejiang University) and Dr. Thomas E. Johnson (University of Colorado at Boulder). To construct the itr-lp::gfp plasmid, a 3079 bp itr-lp::gfp fragment was PCR amplified from the genomic DNA of animals carrying the otJs453 \itr- lp::gfp\ transgene and ligated with a 3619 bp pPD95.77 vector fragment. To construct the sra- 6p::queen-2m plasmid, a 1143 bp queen-2m fragment was PCR amplified from the genomic DNA of yvu!s305 [myo-3p::queen-2m] animals and ligated with a 7628 bp pPD95.77-.s,ra-6 / > DNA fragment. To construct the sra-6p::gcamp- 5::SL2::mCherry plasmid that directs coexpression of gcamp-5 and mCherry through polycistronic mRNAs (103), a 5388 bp SL2 : :mCherry-PBS77 vector fragment and a 4393 bp sra- 6p::gcamp-5 fragment were PCR amplified and ligated together. To construct the gcy-6p: :gcamp- 5 plasmid, a 710 bp gcy-6 promoter fragment was PCR amplified from the genomic DNA of wild- type animals and ligated with a 4985 bp gcawp-5-pPD95.77 vector fragment. To construct the Hr- lp(mut)::gfp plasmid, a pair of primers that span the intended deletion junctions with 15 bp overlap were used to PCR amplify the entire itr-lp::gfp-pPD95.77 vector and then transformed into E. coli DH5a. To construct the daf-16p::daf-16mut::gfp plasmid, three pairs of primers that contain three specific mutations were used to amplify DNA fragments that contain the daf- 16(aal66-314, T166A, S3I4A) region, the daf-I6(aa314-466, S314A, S466A) region, and the daf-16(aa466-5I0, S446A): :gfp-vector-daf-16p: :daf-16(aal-166, T166A) fragment, respectively, using the pGP30 (daf-16p::daf-16::gfp) plasmid as a template and then ligated together. The important regions of all these plasmids were sequenced and confirmed to be correct. All oligonucleotide primers used in this study are listed in Table S3.

[0086] Isolation of the ctb-l(tm4273) allele: Applicants mutagenized wild-type (N2) adult worms by the TMP / UV method as described previously (37), collected their progeny, and screened the progeny for animals with deletions in the ctb-1 gene by the nested PCR method. For nested PCR, primer pairs of GTAAAGTTCCAGTTGGGAGA (SEQ ID NO. 1) and CTCCGAATTTAAACCCGTCT (SEQ ID NO. 2) were used in the first round, and CTATGTTTGGTTACGGTCCA (SEQ ID NO. 3) and TTAACATTCCGGCTGAGGCA (SEQ ID NO. 4) were used in the second round. The tm4273 allele was isolated and identified to be a deletion of 783 bp by the Sanger sequencing method.

[0087] Thrashing assay: C. elegans thrashing assays were performed according to a previously reported protocol (74). Briefly, a drop of 100 pl M9 buffer was added onto the agar surface of an NGM plate, individual L4 stage animals were transferred into the M9 drop. After 1 minute recovery, the number of thrashes was counted for 1 minute under a dissecting microscope. A thrash was defined as a change in the direction of bending at the midbody of the animal. Each animal was scored only once. Quantification of the number of SNB-1::GFP puncta between VD10 and VD11 neurons: The julsl \unc-25p::snb-l::gfp + lin-15(+)\ transgene was used to determine the number of SNB- 1 ::GFP puncta in VD neurons (78). The larval stage 4 (L4) animals were anesthetized by 10 mM NaN3 for 5 min and the GFP fluorescence images between VD10 and VD11 neurons were collected by Zeiss LSM 800 laser scanning confocal system with the ZEN imaging software under a 63 * objective lens. Intensity of 488 nm laser: 1%. Fiji Image I software was used to analyze the fluorescence images.

[0088] Embryonic lethality assays: Embryonic lethality assays were performed at 25°C as described previously ( 1 10). Animals were grown on NGM plates until they reached adult day one (ADI). ADI animals were transferred to fresh NGM plates to lay eggs for 4 hours and then moved to new NGM plates. The embryos they laid in each plate were counted. After two more transfers, the animals were discarded. The number of embryos after each transfer was scored and totaled. 24 hours after each transfer, embryos that did not hatch were scored as dead embryos. Embryonic lethality rate was calculated as the number of dead embryos divided by the total number of embryos.

[0089] Measurement of the ATP levels in embryos: The ATP level in C. elegans embryos was measured using a previously reported protocol (81). The fluorescent dye, BioTracker ATP -Red (Sigma), was added to the liquid NGM to a final concentration of 8 uM prior to plate pouring. Two days later, fresh OP50 bacterial suspension containing 8 pM BioTracker ATP-Red was seeded on these NGM plates and grown overnight at room temperature. Several mid-stage L4 animals were grown on the ATP-Red-containing NGM plates for three days. Their larval progenies were transferred to new ATP-Red-containing NGM plates and grown to the adult day one (ADI) stage. The fluorescent images of embryos from these ADI animals were acquired by Zeiss LSM 800 laser scanning confocal system with the ZEN imaging software under a 63 x objective lens. Fiji Image J software was used to analyze the fluorescence intensity of the acquired images.

[0090] Quantification and statistical analysis: All data collection was randomized. The Sample sizes were determined by the reproducibility of the experiments and are similar to what is commonly used in the field. All data were presented as mean ± SEM. Unpaired, two-tailed Student’s t test was used to compare two data sets, p < 0.05 was considered to be statistically significant for all experiments. GraphPad Prism 5 software were used for all statistical analyses. REFERENCES

[0091] 1. S. E. Calvo, V. K. Mootha, The mitochondrial proteome and human disease. Ann. Rev. Genomics Hum. Genet. 1 1, 25-44 (2010).

[0092] 2. L. Craven, C. L. Alston, R. W. Taylor, D. M. Turnbull, Recent Advances in Mitochondrial Disease. Ann. Rev. Genomics Hum. Genet. 18, 257-275 (2017).

[0093] 3. N. J. Lake, M. J. Bird, P. Isohanni, A. Paetau, Leigh syndrome: neuropathology and pathogenesis. J. Neuropathol. Exp. Neurol. 74, 482-492 (2015).

[0094] 4. P. Yu-Wai-Man, P. G. Griffiths, P. F. Chinnery, Mitochondrial optic neuropathies - disease mechanisms and therapeutic strategies. Prog. Retin. Eye Res. 30, 81-114 (2011).

[0095] 5. P. Kabunga, A. K. Lau, K. Phan, R. Puranik, C. Liang, R. L. Davis, C. M. Sue, R. W. Sy, Systematic review of cardiac electrical disease in Kearns-Sayre syndrome and mitochondrial cytopathy. Int. J. Cardiol. 181, 303-310 (2015).

[0096] 6. L. Rigoli, C. Di Bella, Wolfram syndrome 1 and Wolfram syndrome 2. Curr. Opin. Pediatr. 24, 512-517 (2012).

[0097] 7. S. H. Tsang, A. R. P. Aycinena, T. Sharma, Mitochondrial Disorder: Maternally Inherited Diabetes and Deafness. Adv. Exp. Med. Biol. 1085, 163-165 (2018).

[0098] 8. M. Mascalchi, M. Montomoli, R. Guerrini, Neuroimaging in mitochondrial disorders. Essays Biochem. 62, 409-421 (2018).

[0099] 9. R. P. Saneto, S. D. Friedman, D. W. Shaw, Neuroimaging of mitochondrial disease. Mitochondrion 8, 396-413 (2008).

[0100] 10. A. Karaa, I. Elsharkawi, M. A. Clapp, C. Balcells, Effects of mitochondrial disease / dysfunction on pregnancy: A retrospective study. Mitochondrion 46, 214-220 (2019).

[0101] 11. C. C. Huang, R. S. Chen, C. M. Chen, H. S. Wang, C. C. Lee, C. Y. Pang, H. S. Hsu, H. C. Lee, Y. H. Wei, MEL AS syndrome with mitochondrial tRNA(Leu(UUR)) gene mutation in a Chinese family. J. Neurol. Neurosurg. Psychiatry 57, 586-589 (1994).

[0102] 12. D. N. Nan, M. Fernandez- Ayala, J. Infante, P. Matorras, J. Gonzalez-Macias, Progressive cardiomyopathy as manifestation of mitochondrial disease. Postgrad. Med. J. 78, 298- 299 (2002).

[0103] 13. J. Zhang, H. Liu, S. Luo, Z. Lu, A. Chavez -Badiola, Z. Liu, M. Yang, Z. Merhi, S. J. Silber, S. Munne, M. Konstantinidis, D. Wells, J. J. Tang, T. Huang, Live birth derived from oocyte spindle transfer to prevent mitochondrial disease. Reprod. Biomed. Online 34, 361-368 (2017).

[0104] 14. S. DiMauro, K. Tanji, E. A. Schon, Mitochondrial Encephalomyopathies. Reference Module in Neuroscience and Biobehavioral Psychology, 1-8. (2017).

[0105] 15. R. Carrozzo, A. Tessa, M. E. Vazquez-Memije, F. Piemonte, C. Patrono, A. Malandrini, C. Dionisi-Vici, L. Vilarinho, M. Villanova, H. Schagger, A. Federico, E. Bertini, F. M. Santorelli, The T9176G mtDNA mutation severely affects ATP production and results in Leigh syndrome. Neurology 56, 687-690 (2001).

[0106] 16. D. S. Lin, S. H. Kao, C. S. Ho, Y. H. Wei, P. L. Hung, M. H. Hsu, T. Y. Wu, T. J. Wang, Y. R. Jian, T. H. Lee, M. F. Chiang, Inflexibility of AMPK-mediated metabolic reprogramming in mitochondrial disease. Oncotarget 8, 73627-73639 (2017). 17. A. Baracca, G. Sgarbi, G. Solaini, G. Lenaz, Rhodamine 123 as a probe of mitochondrial membrane potential: evaluation of proton flux through FO during ATP synthesis. Biochim. Biophys. Acta 1606, 137-146 (2003).

[0107] 18. N. Matikainen, T. Pekkarinen, E. M. Ryhanen, C. Schalin-Jantti, Physiology of Calcium Homeostasis: An Overview. Endocrinol. Metab. Clin. North Am. 50, 575-590 (2021).

[0108] 19. S. E. Webb, A. L. Miller, Calcium signalling during embryonic development. Nat. Rev. Mol. Cell Biol. 4, 539-551 (2003).

[0109] 20. M. Calvo-Rodriguez, S. S. Hou, A. C. Snyder, E. K. Kharitonova, A. N. Russ, S. Das, Z. Fan, A. Muzikansky, M. Garcia-Alloza, A. Serrano-Pozo, E. Hudry, B. J. Bacskai, Increased mitochondrial calcium levels associated with neuronal death in a mouse model of Alzheimer's disease. Nat. Commun. 11, 2146 (2020).

[0110] 21. C. Krieger, M. R. Duchen, Mitochondria, Mitochondria, Ca2+ and neurodegenerative disease. Eur. J. Pharmacol. 447, 177-188 (2002).

[0111] 22. M. F. Haroon, A. Fatima, S. Scholer, A. Gieseler, T. F. Horn, E. Kirches, G. Wolf, P. Kreutzmann, Minocycline, a possible neuroprotective agent in Leber's hereditary optic neuropathy (LHON): studies of cybrid cells bearing 11,778 mutation. Neurobiol. Dis. 28, 237-250 (2007).

[0112] 23. W. Y. Huang, M. J. Jou, T. I. Peng, Hypoxic preconditioning-induced mitochondrial protection is not disrupted in a cell model of mtDNA T8993G mutation-induced F1F0-ATP synthase defect: the role of mitochondrial permeability transition. Free Radic. Biol. Med. 67, 314-329 (2014).

[0113] 24. P. B. de Andrade, B. Rubi, F. Frigerio, J. M. van den Ouweland, J. A. Maassen, P. Maechler, Diabetes-associated mitochondrial DNA mutation A3243G impairs cellular metabolic pathways necessary for beta cell function. Diabetologia 49, 1816-1826 (2006).

[0114] 25. A. M. Moudy, S. D. Handran, M. P. Goldberg, N. Ruffin, I. Karl, P. Kranz-Eble, D. C. DeVivo, S. M. Rothman, Abnormal calcium homeostasis and mitochondrial polarization in a human encephalomyopathy. Proc. Natl. Acad. Sci. U. S. A. 92, 729-733 (1995).

[0115] 26. S. Lu, K. Kanekura, T. Hara, J. Mahadevan, L. D. Spears, C. M. Oslowski, R. Martinez, M. Yamazaki-Inoue, M. Toyoda, A. Neilson, P. Blanner, C. M. Brown, C. F. Semenkovich, B. A. Marshall, T. Hershey, A. Umezawa, P. A. Greer, F. Urano, A calciumdependent protease as a potential therapeutic target for Wolfram syndrome. Proc. Natl. Acad. Sci. U.S.A. I l l, E5292-5301 (2014).

[0116] 27. J. C. von Kleist-Retzow, H. T. Hornig-Do, M. Schauen, S. Eckertz, T. A. Dinh, F. Stassen, N. Lottmann, M. Bust, B. Galunska, K. Wielckens, W. Hein, J. Beuth, J. M. Braun, J. H. Fischer, V. Y. Ganitkevich, K. Maniura-Weber, R. J. Wiesner, Impaired mitochondrial Ca2+ homeostasis in respiratory chain-deficient cells but efficient compensation of energetic disadvantage by enhanced anaerobic glycolysis due to low ATP steady state levels. Exp. Cell Res. 313, 3076-3089 (2007).

[0117] 28. R. W. Taylor, D. M. Turnbull, Mitochondrial DNA mutations in human disease. Nat. Rev. Genet. 6, 389-402 (2005).

[0118] 29. D. C. Wallace, Mitochondrial DNA mutations in disease and aging. Environ. Mol. Mutagen. 51, 440-450 (2010). 30. S. I. Cho, S. Lee, Y. G. Mok, K. Lim, J. Lee, J. M. Lee, E. Chung, J. S. Kim, Targeted A- to-G base editing in human mitochondrial DNA with programmable deaminases. Cell 185, 1764-1776 el712 (2022).

[0119] 31 . B Y. Mok, M. H. de Moraes, J. Zeng, D. E. Bosch, A. V. Kotrys, A. Raguram, F. Hsu, M. C. Radey, S. B. Peterson, V. K. Mootha, J. D. Mougous, D. R. Liu, A bacterial cytidine deaminase toxin enables CRISPR-free mitochondrial base editing. Nature 583, 631-637 (2020).

[0120] 32. E. Ylikallio, H. Tyynismaa, Generating Mouse Models of Mitochondrial Disease. Movement Disorders (Second Edition), 689-701 (2015).

[0121] 33. O. M. Russell, G. S. Gorman, R. N. Lightowlers, D. M. Turnbull, Mitochondrial Diseases: Hope for the Future. Cell 181, 168-188 (2020).

[0122] 34. A. M. van der Bliek, M. M. Sedensky, P. G. Morgan, Cell Biology of the Mitochondrion. Genetics 207, 843-871 (2017).

[0123] 35. J. Feng, F. Bussiere, S. Hekimi, Mitochondrial Electron Transport Is a Key Determinant of Life Span in Caenorhabditis elegans. Dev. Cell 1, 633-644 (2001).

[0124] 36. W. Y. Tsang, B. D. Lemire, Stable heteroplasmy but differential inheritance of a large mitochondrial DNA deletion in nematodes. Biochem. Cell Biol. 80, 645-654 (2002).

[0125] 37. K. Gengyo-Ando, S. Mitani, Characterization of mutations induced by ethyl methanesulfonate, UV, and trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem. Biophys. Res. Commun. 269, 64-69 (2000).

[0126] 38. C. I. Bargmann, J. H. Thomas, H. R. Horvitz, Chemosensory cell function in the behavior and development of Caenorhabditis elegans. Cold Spring Harb. Symp. Quant. Biol. 55, 529-538 (1990).

[0127] 39. M. A. Hilliard, C. I. Bargmann, P. Bazzicalupo, C. elegans Responds to Chemical Repellents by Integrating Sensory Inputs from the Head and the Tail. Curr. Biol. 12, 730- 734 (2002).

[0128] 40. M. A. Hilliard, A. J. Apicella, R. Kerr, H. Suzuki, P. Bazzicalupo, W. R. Schafer, In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents. EMBO J. 24, 63-72 (2005).

[0129] 41. J. Akerboom, T. W. Chen, T. J. Wardill, L. Tian, J. S. Marvin, S. Mutlu, N. C. Calderon, F. Esposti, B. G. Borghuis, X. R. Sun, A. Gordus, M. B. Orger, R. Portugues, F. Engert, J. J. Macklin, A. Filosa, A. Aggarwal, R. A. Kerr, R. Takagi, S. Kracun, E. Shigetomi, B. S. Khakh, H. Baier, L. Lagnado, S. S. Wang, C. I. Bargmann, B. E. Kimmel, V. Jayaraman, K. Svoboda, D. S. Kim, E. R. Schreiter, L. L. Looger, Optimization of a GCaMP calcium indicator for neural activity imaging. I. Neurosci. 32, 13819-13840 (2012).

[0130] 42. C. I. Bargmann, H. R. Horvitz, Chemosensory neurons with overlapping functions direct chemotaxis to multiple chemicals in C. elegans. Neuron 7, 729-742 (1991).

[0131] 43. S. Yu, L. Avery, E. Baude, D. L. Garbers, Guanylyl cyclase expression in specific sensory neurons: a new family of chemosensory receptors. Proc. Natl. Acad. Sci. U. S. A. 94, 3384-3387 ( 1997).

[0132] 44. E. R. Troemel, B. E. Kimmel, C. I. Bargmann, Reprogramming Chemotaxis Responses: Sensory Neurons Define Olfactory Preferences in C. elegans. Cell 91 , 161 -169 (1997). 45. C. I. Bargmann, E. Hartwieg, H. R. Horvitz, Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74, 515-527 (1993).

[0133] 46. E. R. Galimov, R. E. Pryor, S. E. Poole, A. Benedetto, Z. Pincus, D. Gems, Coupling of Rigor Mortis and Intestinal Necrosis during C. elegans Organismal Death. Cell reports 22, 2730- 2741 (2018).

[0134] 47. H. Yaginuma, S. Kawai, K. V. Tabata, K. Tomiyama, A. Kakizuka, T. Komatsuzaki, H. Noji, H. Imamura, Diversity in ATP concentrations in a single bacterial cell population revealed by quantitative single-cell imaging. Sci. Rep. 4, 6522 (2014).

[0135] 48. M. Vos, G. Esposito, J. N. Edirisinghe, S. Vilain, D. M. Haddad, J. R. Slabbaert, S. Van Meensel, O. Schaap, B. De Strooper, R. Meganathan, V. A. Morais, P. Verstreken, Vitamin K2 is a mitochondrial electron carrier that rescues pinkl deficiency. Science 336, 1306-1310 (2012).

[0136] 49. D. Garcia, R. J. Shaw, AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol. Cell 66, 789-800 (2017).

[0137] 50. D. G. Hardie, AMP-activated protein kinase: an energy sensor that regulates all aspects of cell function. Genes Dev. 25, 1895-1908 (2011).

[0138] 51. E. L. Greer, D. Dowlatshahi, M. R. Banko, J. Villen, K. Hoang, D. Blanchard, S. P. Gygi, A. Brunet, An AMPK-FOXO pathway mediates longevity induced by a novel method of dietary restriction in C. elegans. Curr. Biol. 17, 1646-1656 (2007).

[0139] 52. C. T. Murphy, P. J. Hu, Insulin / insulin-like growth factor signaling in C. elegans. WormBook, 1-43 (2013).

[0140] 53. J. Apfeld, G. O'Connor, T. McDonagh, P. S. DiStefano, R. Curtis, The AMP- activated protein kinase AAK-2 links energy levels and insulin-like signals to lifespan in C. elegans. Genes Dev. 18, 3004-3009 (2004).

[0141] 54. S. T. Henderson, T. E. Johnson, daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Curr. Biol. 11, 1975- 1980 (2001).

[0142] 55. E. Neher, T. Sakaba, Multiple roles of calcium ions in the regulation of neurotransmitter release. Neuron 59, 861-872 (2008).

[0143] 56. A. M. Oliveira, H. Bading, D. Mauceri, Dysfunction of neuronal calcium signaling in aging and disease. Cell Tissue Res. 357, 381-383 (2014).

[0144] 57. G. Zundorf, G. Reiser, Calcium dysregulation and homeostasis of neural calcium in the molecular mechanisms of neurodegenerative diseases provide multiple targets for neuroprotection. Antioxid. Redox Signal. 14, 1275- 1288 (201 1).

[0145] 58. M. Gleichmann, M. P. Mattson, Neuronal calcium homeostasis and dysregulation. Antioxid. Redox Signal. 14, 1261-1273 (201 1).

[0146] 59. K. D. Kimura, H. A. Tissenbaum, Y. Liu, G. Ruvkun, daf-2, an insulin receptorlike gene that regulates longevity and diapause in Caenorhabditis elegans. Science 277, 942-946 (1997).

[0147] 60. O. Hobert, The neuronal genome of Caenorhabditis elegans. WormBook, 1-106 (2013).

[0148] 61. R. Kaletsky, V. Lakhina, R. Arey, A. Williams, J. Landis, J. Ashraf, C. T. Murphy, The C. elegans adult neuronal IIS / FOXO transcriptome reveals adult phenotype regulators. Nature 529, 92-96 (2016).

[0149] 62. E. Allman, B. Thyagarajan, K. Nehrke, The inositol 1 ,4,5-trisphosphate receptor in C. elegans. WIREs. Membr. Transp. Signal. 1, 321-328 (2012).

[0150] 63. C. Grienberger, A. Konnerth, Imaging calcium in neurons. Neuron 73, 862-885 (2012).

[0151] 64. K. Mikoshiba, The discovery and structural investigation of the IP(3) receptor and the associated IRBIT protein. Adv. Exp. Med. Biol. 740, 281-304 (2012).

[0152] 65. H. A. Baylis, T. Furuichi, F. Yoshikawa, K. Mikoshiba, D. B. Sattelle, Inositol 1,4,5- trisphosphate receptors are strongly expressed in the nervous system, pharynx, intestine, gonad and excretory cell of Caenorhabditis elegans and are encoded by a single gene (itr-1). J. Mol. Biol. 294, 467-476 (1999).

[0153] 66. K. Mikoshiba, Inositol 1,4,5-trisphosphate IP(3) receptors and their role in neuronal cell function. J. Neurochem. 97, 1627-1633 (2006).

[0154] 67. D. S. Walker, R. P. Vazquez -Manrique, N. J. Gower, E. Gregory, W. R. Schafer, H. A. Baylis, Inositol 1,4,5-trisphosphate signalling regulates the avoidance response to nose touch in Caenorhabditis elegans. PLoS Genet. 5, el000636 (2009).

[0155] 68. M. Cagalinec, M. Liiv, Z. Hodurova, M. A. Hickey, A. Vaarmann, M. Mandel, A. Zeb, V. Choubey, M. Kuum, D. Safiulina, E. Vasar, V. Veksler, A. Kaasik, Role of Mitochondrial Dynamics in Neuronal Development: Mechanism for Wolfram Syndrome. PLoS Biol. 14, el002511 (2016).

[0156] 69. W. Niu, Z. J. Lu, M. Zhong, M. Sarov, J. I. Murray, C. M. Brdlik, J. Janette, C. Chen, P. Alves, E. Preston, C. Slightham, L. Jiang, A. A. Hyman, S. K. Kim, R. H. Waterston, M. Gerstein, M. Snyder, V. Reinke, Diverse transcription factor binding features revealed by genomewide ChlP-seq in C. elegans. Genome Res. 21, 245-254 (2011).

[0157] 70. K. Otsu, H. F. Willard, V. K. Khanna, F. Zorzato, N. M. Green, D. H. MacLennan, Molecular cloning of cDNA encoding the Ca2+ release channel (ryanodine receptor) of rabbit cardiac muscle sarcoplasmic reticulum. J. Biol. Chem. 265, 13472- 13483 (1990).

[0158] 71. H. C. Fan, H. F. Lee, C. T. Yue, C. S. Chi, Clinical Characteristics of Mitochondrial Encephalomyopathy, Lactic Acidosis, and Stroke-Like Episodes. Life 1 1 (2021 ).

[0159] 72. J. Finsterer, S. Zarrouk-Mahjoub, Management of epilepsy in MERRF syndrome. Seizure 50, 166-170 (2017).

[0160] 73. C. McClelland, G. Manousakis, M. S. Lee, Progressive External Ophthalmoplegia. Curr. Neurol. Neurosci. Rep. 16, 53 (2016).

[0161] 74. K. G. Miller, A. Alfonso, M. Nguyen, J. A. Crowell, C. D. Johnson, J. B. Rand, A genetic selection for Caenorhabditis elegans synaptic transmission mutants. Proc. Natl. Acad. Sci. U. S. A. 93, 12593-12598 (1996).

[0162] 75. Y. Zhao, R. Yang, Q. Rui, D. Wang, Intestinal Insulin Signaling Encodes Two Different Molecular Mechanisms for the Shortened Longevity Induced by Graphene Oxide in Caenorhabditis elegans. Sci. Rep. 6, 24024 (2016). 76. S. R. Iyer, S. B. Shah, R. M. Lovering, The Neuromuscular Junction: Roles in Aging and Neuromuscular Disease. Int. J. Mol. Sci. 22 (2021).

[0163] 77. A. B. Byrne, T. Walradt, K. E. Gardner, A. Hubbert, V. Reinke, M. Hammarlund, Insulin / IGFl signaling inhibits age-dependent axon regeneration. Neuron 81, 561-573 (2014).

[0164] 78. W. L. Hung, C. Hwang, S. Gao, E. H. Liao, J. Chitturi, Y. Wang, H. Li, C. Stigloher, J. L. Bessereau, M. Zhen, Attenuation of insulin signalling contributes to FSN-l-mediated regulation of synapse development. EMBO J. 32, 1745-1760 (2013).

[0165] 79. S. J. Hallam, Y. Jin, lin-14 regulates the timing of synaptic remodelling in Caenorhabditis elegans. Nature 395, 78-82 (1998).

[0166] 80. Q. Zhou, H. Li, H. Li, A. Nakagawa, J. L. Lin, E. S. Lee, B. L. Harry, R. R. Skeen- Gaar, Y. Suehiro, D. William, S. Mitani, H. S. Yuan, B. H. Kang, D. Xue, Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization. Science 353, 394-399 (2016).

[0167] 81. M. Samaddar, J. Goudeau, M. Sanchez, D. H. Hall, K. A. Bohnert, M. Ingaramo, C. Kenyon, A genetic screen identifies new steps in oocyte maturation that enhance proteostasis in the immortal germ lineage. eLife 10 (2021).

[0168] 82. M. Matsumoto, T. Nakagawa, T. Inoue, E. Nagata, K. Tanaka, H. Takano, O. Minowa, J. Kuno, S. Sakakibara, M. Yamada, H. Yoneshima, A. Miyawaki, Y. Fukuuchi, T. Furuichi, H. Okano, K. Mikoshiba, T. Noda, Ataxia and epileptic seizures in mice lacking type 1 inositol 1,4, 5 -trisphosphate receptor. Nature 379, 168-171 (1996).

[0169] 83. M. B. Hoegg, S. M. Robbins, J. D. McGhee, Characterization of the C. elegans erlin homologue. BMC Cell Biol. 13, 2 (2012).

[0170] 84. J. B. Stewart, P. F. Chinnery, The dynamics of mitochondrial DNA heteroplasmy: implications for human health and disease. Nat. Rev. Genet. 16, 530-542 (2015).

[0171] 85. M. Erecinska, I. A. Silver, ATP and brain function. J. Cereb. Blood Flow Metab. 9, 2-19 (1989).

[0172] 86. S. Rahman, R. B. Blok, H. H. Dahl, D. M. Danks, D. M. Kirby, C. W. Chow, J. Christodoulou, D. R. Thorbum, Leigh syndrome: clinical features and biochemical and DNA abnormalities. Ann. Neurol. 39, 343-351 (1996).

[0173] 87. M. L. Valentino, P. Barboni, C. Rengo, A. Achilli, A. Torroni, R. Lodi, C. Tonon, B. Barbiroli, F. Fortuna, P. Montagna, A. Baruzzi, V. Carelli, The 13042G — > A / ND5 mutation in mtDNA is pathogenic and can be associated also with a prevalent ocular phenotype. J. Med. Genet. 43, e38 (2006).

[0174] 88. X. D. Zheng, L. Boyer, M. J. Jin, Y. Kim, W. W. Fan, C. Bardy, T. Berggren, R. M. Evans, F. H. Gage, T. Hunter, Alleviation of neuronal energy deficiency by mTOR inhibition as a treatment for mitochondria-related neurodegeneration. eLife 5 (2016).

[0175] 89. T. Amould, S. Vankoningsloo, P. Renard, A. Houbion, N. Ninane, C. Demazy, J. Remacle, M. Raes, CREB activation induced by mitochondrial dysfunction is a new signaling pathway that impairs cell proliferation. EMBO J. 21, 53-63 (2002).

[0176] 90. M. McKenzie, M. R. Duchen, Impaired Cellular Bioenergetics Causes Mitochondrial Calcium Handling Defects in MT-ND5 Mutant Cybrids. PLoS One 1 1, e0154371 (2016). 91. A. R. Burr, J. D. Molkentin, Genetic evidence in the mouse solidifies the calcium hypothesis of myofiber death in muscular dystrophy. Cell Death Differ. 22, 1402-1412 (2015).

[0177] 92. G. S. Gorman, P. F. Chinnery, S. DiMauro, M. Hirano, Y. Koga, R. McFarland, A. Suomalainen, D. R. Thorburn, M. Zeviani, D. M. Turnbull, Mitochondrial diseases. Nat. Rev. Dis. Primers 2, 16080 (2016).

[0178] 93. N. Nissanka, C. T. Moraes, Mitochondrial DNA damage and reactive oxygen species in neurodegenerative disease. FEBS Lett. 592, 728-742 (2018).

[0179] 94. G. M. Enns, T. M. Cowan, Glutathione as a Redox Biomarker in Mitochondrial Disease- Implications for Therapy. J. Clin. Med. 6 (2017).

[0180] 95. M. Hirano, V. Emmanuele, C. M. Quinzii, Emerging therapies for mitochondrial diseases. Essays Biochem. 62, 467-481 (2018).

[0181] 96. T. Klopstock, P. Yu-Wai-Man, K. Dimitriadis, J. Rouleau, S. Heck, M. Bailie, A. Atawan, S. Chattopadhyay, M. Schubert, A. Garip, M. Kernt, D. Petraki, C. Rummey, M. Leinonen, G. Metz, P. G. Griffiths, T. Meier, P. F. Chinnery, A randomized placebo-controlled trial of idebenone in Leber's hereditary optic neuropathy. Brain 134, 2677-2686 (2011).

[0182] 97. C. Angebault, N. Gueguen, V. Desquiret-Dumas, A. Chevrollier, V. Guillet, C. Verny, J. Cassereau, M. Ferre, D. Milea, P. Amati-Bonneau, D. Bonneau, V. Procaccio, P. Reynier, D. Loiseau, Idebenone increases mitochondrial complex 1 activity in fibroblasts from LHON patients while producing contradictory effects on respiration. BMC Res. Notes 4, 557 (2011).

[0183] 98. V. Giorgio, V. Petronilli, A. Ghelli, V. Carelli, M. Rugolo, G. Lenaz, P. Bernardi, The effects of idebenone on mitochondrial bioenergetics. Biochim. Biophys. Acta 1817, 363-369 (2012).

[0184] 99. J. W. Beulens, S. L. Booth, E. G. van den Heuvel, E. Stoecklin, A. Baka, C. Vermeer, The role of menaquinones (vitamin K(2)) in human health. Br. J. Nutr. 110, 1357-1368 (2013).

[0185] 100. S. J. Elder, D. B. Haytowitz, J. Howe, J. W. Peterson, S. L. Booth, Vitamin k contents of meat, dairy, and fast food in the u.s. Diet. J. Agric. Food Chem. 54, 463-467 (2006).

[0186] 101. R. J. Maries, A. L. Roe, H. A. Oketch-Rabah, US Pharmacopeial Convention safety evaluation of menaquinone-7, a form of vitamin K. Nutr. Rev. 75, 553-578 (2017).

[0187] 102. S. Brenner, The genetics of Caenorhabditis elegans. Genetics 77, 71-94 (1974).

[0188] 103. D. Duan, H. Zhang, X. Yue, Y. Fan, Y. Xue, J. Shao, G. Ding, D. Chen, S. Li, H. Cheng, X. Zhang, W. Zou, J. Liu, J. Zhao, L. Wang, B. Zhao, Z. Wang, S. Xu, Q. Wen, J. Liu, S. Duan, L. Kang, Sensory Glia Detect Repulsive Odorants and Drive Olfactory Adaptation. Neuron 108, 707-721 e708 (2020).

[0189] 104. E. R. Troemel, J. H. Chou, N. D. Dwyer, H. A. Colbert, C. I. Bargmann, Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell 83, 207- 218 (1995).

[0190] 105. A. Kauffman, L. Parsons, G. Stein, A. Wills, R. Kaletsky, C. Murphy, C. elegans positive butanone learning, short-term, and long-term associative memory assays. J. Vis. Exp., e2490 (2011).

[0191] 106. K. Yoshida, T. Hirotsu, T. Tagawa, S. Oda, T. Wakabayashi, Y. lino, T. Ishihara, Odour concentration-dependent olfactory preference change in C. elegans. Nat. Commu. 3, 739 (2012).

[0192] 107. G. Harris, H. Mills, R. Wragg, V. Hapiak, M. Castelletto, A. Korchnak, R. W. Komuniecki, The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic / peptidergic cotransmission. J. Neurosci. 30, 7889- 7899 (2010).

[0193] 108. L. Timmons, D. L. Court, A. Fire, Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263, 103-112 (2001).

[0194] 109. D. G. Gibson, L. Young, R. Y. Chuang, J. C. Venter, C. A. Hutchison, 3rd, H. O. Smith, Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009).

[0195] 110. Y. Peng, M. Zhang, L. Zheng, Q. Liang, H. Li, J. T. Chen, H. Guo, S. Yoshina, Y. Z. Chen, X. Zhao, X. Wu, B. Liu, S. Mitani, J. S. Yu, D. Xue, Cysteine protease cathepsin B mediates radiation-induced bystander effects. Nature 547, 458-462 (2017).

[0196] W' -\ -X\xv « ooxw

[0197] $S» .<x '-? X A <• ' x"Xx ' ' erxxno

[0198] 903 »«X3 wxe® W XX-xX?;. X> mono §03SWPSO <X?X-' XP.<^ xooxno

[0199] X;pMS Xlx.. ?f>» ;AXWXXX^W: A- mono

[0200] Xx«XW A ♦ ' x"X X X? " oimxsi WW Sw AO X XX orono W xXPxX^XX A / xZXXX:; .?::< e«M

[0201] W© Xws»3 A' WOW 303 A? «S® vX XfX^ <'-&'OX mm s^sfUS » W«s W«j$8 Mrf&iiS '□ xis <W1

[0202]

Claims

CLAIMWhat is claimed is\1. A method of treating a mitochondrial disease in a subject in need thereof, comprising administering a therapeutically effective amount of Vitamin MK-4.

2. A method of treating a mitochondrial disease in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

3. A method of treating a mitochondrial disease in a subject in need thereof, comprising administering a therapeutically effective amount of a compound according to Formula (I):(I), or a pharmaceutically acceptable salt thereof.

4. A method of treating a mitochondrial disease in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of a compound according to Formula (I):and a pharmaceutically acceptable carrier.

5. The method of any of claims 1-4, wherein said subject is a human.

6. The method of any of claims 1-5, wherein said mitochondrial disease is caused by mutations in mitochondrial DNA (mtDNA)7. The method of any of claims 1-6, wherein said mitochondrial disease is caused by mutations in nuclear DNA.

8. A method of any of claims 1-7, wherein said mitochondrial disease is selected from: Apical hypertrophic cardiomyopathy (AHCM). neuropathy, ataxia, autism, Charcot -Marie-Tooth syndrome (CMT), encephalopathy, epilepsy with brain pseudoatrophy, Episodic Weakness, Hereditary Spastic Paraplegia (HSP), Familiar Bilateral Striatal Necrosis (FBSN), Infantile cardiomyopathy, Leber Hereditary Optic neuropathy (LHON), Left Ventricular Hyper Trabeculation syndrome (LVHT), Maternally inherited Diabetes, Deafness syndrome (MIDD), Kearns-Sayre syndrome (KSS). Wolfram syndrome (WS), Maternally inherited Leigh Syndrome (MILS), Mesial Temporal Lobe Epilepsies with Hippocampal Sclerosis (MTLE-HS), Metabolic Syndrome (MS), Motor Neuron Syndrome (MNS), Myopathy, lactic Acidosis, Sideroblastic Anemia (MLASA), Neurogenetic Ataxia Retinis Pigmentosa syndrome (NARP), Periodic paralyzes, Schizophrenia, Spino Cerebellar Ataxia (SCA), Tetralogy of Fallot (ToF), short-chain acyl- coA dehydrogenase deficiency (SCAD), medium-chain acyl-coA dehydrogenase deficiency (MCAD), long-chain acyl-coA dehydrogenase deficiency LCAD), progressive ophthalmoplegia (CPEO), Pearson Syndrome, Barth Syndrome, Alpers Disease, Luft Disease, mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), Mitochondrial Encephalomyopathy, neuropathy, ataxia, retinal pigmentosa (NARP), myoclonic epilepsy, ragged red fibers (MERRF), mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Alzheimer’s diseases (AD), Parkinson’s disease (PD), Huntington’s disease (HD), amyotrophic lateral sclerosis (ALS, aka Lou Gehring’s diseases, Epilepsy, Autism, Fibromyalgia, chronic fatigue, cerebral palsy, Friedreich’s Ataxia, Rett Syndrome, and Fragile X Syndrome, cardiomyopathy and muscular dystrophy (MD), diabetes and side effects of antibiotics treatment of bacterial infection, ataxia neuropathy syndrome (ANS), Mendelian neurodegenerative mitochondriopathy, 3- methylglutaconic aciduria (MEG), MEGDEL syndrome, Sengers syndrome, Minimal change nephrotic syndrome (MCNS), Mitochondrial DNA depletion Syndrome (MODS), and Leigh-like disease.

9. A method of increasing ATP levels in a cell, comprising contacting the cell with a therapeutically effective amount of Vitamin MK-4.

10. A method of increasing ATP levels in a cell, comprising contacting the cell with a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

11. A method of increasing ATP levels in a cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I):or a pharmaceutically acceptable salt thereof.

12. A method of increasing ATP levels in a cell, comprising contacting the cell with a pharmaceutical composition including a therapeutically effective amount of a compound according to Formula (I):(I), and a pharmaceutically acceptable carrier.

13. The method of any of claims 8-12, wherein said subject is a human.

14. The method of any of claims 8-13, wherein said ATP levels in the cell are decreased due to a mutation in the cell’s mitochondrial DNA (mtDNA)15. The method of any of claims 8-14, wherein said ATP levels in the cell are decreased due to a mutation in the cell’s nuclear DNA.

16. The method of any of claims 8-15, wherein said the cell comprises a cell having a mitochondrial disease.

17. A method of claim 16, wherein said mitochondrial disease is selected from: Apical hypertrophic cardiomyopathy (AHCM). neuropathy, ataxia, autism, Charcot-Marie-Tooth syndrome (CMT), encephalopathy, epilepsy with brain pseudoatrophy, Episodic Weakness, Hereditary Spastic Paraplegia (HSP), Familiar Bilateral Striatal Necrosis (FBSN), Infantile cardiomyopathy, Leber Hereditary Optic neuropathy (LHON), Left Ventricular Hyper Trabeculation syndrome (LVHT), Maternally inherited Diabetes, Deafness syndrome (MIDD), Kearns-Sayre syndrome (KSS). Wolfram syndrome (WS), Maternally inherited Leigh Syndrome (MILS), Mesial Temporal Lobe Epilepsies with Hippocampal Sclerosis (MTLE-HS), Metabolic Syndrome (MS), Motor Neuron Syndrome (MNS), Myopathy, lactic Acidosis, Sideroblastic Anemia (MLASA), Neurogenetic Ataxia Retinis Pigmentosa syndrome (NARP), Periodic paralyzes, Schizophrenia, Spino Cerebellar Ataxia (SCA), Tetralogy of Fallot (ToF), short-chain acyl- coA dehydrogenase deficiency (SCAD), medium-chain acyl-coA dehydrogenase deficiency (MCAD), long-chain acyl-coA dehydrogenase deficiency LCAD), progressive ophthalmoplegia (CPEO), Pearson Syndrome, Barth Syndrome, Alpers Disease, Luft Disease, mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), Mitochondrial Encephalomyopathy, neuropathy, ataxia, retinal pigmentosa (NARP), myoclonic epilepsy, ragged red fibers (MERRF), mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Alzheimer’s diseases (AD), Parkinson’s disease (PD), Huntington’s disease (HD), amyotrophic lateral sclerosis (ALS, aka Lou Gehring’s diseases, Epilepsy, Autism, Fibromyalgia, chronic fatigue, cerebral palsy, Friedreich’s Ataxia, Rett Syndrome, and Fragile X Syndrome, cardiomyopathy and muscular dystrophy (MD), diabetes and side effects of antibiotics treatment of bacterial infection, ataxia neuropathy syndrome (ANS), Mendelian neurodegenerative mitochondriopathy, 3- methylglutaconic aciduria (MEG), MEGDEL syndrome, Sengers syndrome, Minimal change nephrotic syndrome (MCNS), Mitochondrial DNA depletion Syndrome (MDDS), and Leigh-like disease.

18. A method of inhibiting Ca2+ overload in a cell, comprising contacting the cell with a therapeutically effective amount of Vitamin MK-4.

19. A method of inhibiting Ca2+ overload in a cell, comprising contacting the cell with a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

20. A method of inhibiting Ca2+ overload in a cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I):or a pharmaceutically acceptable salt thereof.

21. A method of inhibiting Ca2+ overload in a cell, comprising contacting the cell with a pharmaceutical composition including a therapeutically effective amount of a compound according to Formula (I):(I), and a pharmaceutically acceptable carrier.

22. The method of any of claims 18-21, wherein said subject is a human.

23. The method of any of claims 18-22, wherein said Ca2+ overload in the cell is caused by a mutation in the cell’s mitochondrial DNA (mtDNA)24. The method of any of claims 18-23, wherein said Ca2+ overload in the cell is caused by a mutation in the cell’s nuclear DNA.

25. The method of any of claims 18-24, wherein said the cell comprises a cell having a mitochondrial disease.A method of claim 25, wherein said mitochondrial disease is selected from: Apical ertrophic cardiomyopathy (AHCM). neuropathy, ataxia, autism, Charcot-Marie-Tooth drome (CMT), encephalopathy, epilepsy with brain pseudoatrophy, Episodic Weakness, editary Spastic Paraplegia (HSP), Familiar Bilateral Striatal Necrosis (FBSN), Infantilediomyopathy, Leber Hereditary Optic neuropathy (LHON), Left Ventricular Hyper beculation syndrome (LVHT), Maternally inherited Diabetes, Deafness syndrome (MIDD),arns-Sayre syndrome (KSS). Wolfram syndrome (WS), Maternally inherited Leigh SyndromeILS), Mesial Temporal Lobe Epilepsies with Hippocampal Sclerosis (MTLE-HS), Metabolicndrome (MS), Motor Neuron Syndrome (MNS), Myopathy, lactic Acidosis, Sideroblasticemia (MLASA), Neurogenetic Ataxia Retinis Pigmentosa syndrome (NARP), Periodicalyzes, Schizophrenia, Spino Cerebellar Ataxia (SCA), Tetralogy of Fallot (ToF), short-chain l- coA dehydrogenase deficiency (SCAD), medium-chain acyl-coA dehydrogenase deficiencyCAD), long-chain acyl-coA dehydrogenase deficiency LCAD), progressive ophthalmoplegiaPEO), Pearson Syndrome, Barth Syndrome, Alpers Disease, Luft Disease, mitochondrial rogastrointestinal encephalomyopathy (MNGIE), Mitochondrial Encephalomyopathy, ropathy, ataxia, retinal pigmentosa (NARP), myoclonic epilepsy, ragged red fibers (MERRF), ochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Alzheimer’seases (AD), Parkinson’s disease (PD), Huntington’s disease (HD), amyotrophic lateral sclerosisLS, aka Lou Gehring’s diseases, Epilepsy, Autism, Fibromyalgia, chronic fatigue, cerebralsy, Friedreich’s Ataxia, Rett Syndrome, and Fragile X Syndrome, cardiomyopathy andscular dystrophy (MD), diabetes and side effects of antibiotics treatment of bacterial infection,xia neuropathy syndrome (ANS), Mendelian neurodegenerative mitochondriopathy, 3- hylglutaconic aciduria (MEG), MEGDEL syndrome, Sengers syndrome, Minimal change hrotic syndrome (MCNS), Mitochondrial DNA depletion Syndrome (MDDS), and Leigh-likeease. A method of inhibiting activation of the AMPK-FOXO-IP3R pathway in a cell, comprising tacting the cell with a therapeutically effective amount of Vitamin MK-4.

28. A method of inhibiting activation of the AMPK-F0X0-IP3R pathway in a cell, comprising contacting the cell with a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

29. A method of inhibiting activation of the AMPK-FOXO-IP3R pathway in a cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I):or a pharmaceutically acceptable salt thereof.

30. A method of inhibiting activation of the AMPK-F0X0-IP3R pathway in a cell, comprising contacting the cell with a pharmaceutical composition including a therapeutically effective amount of a compound according to Formula (I):and a pharmaceutically acceptable carrier.3 I The method of any of claims 27-30, wherein said subject is a human.

32. The method of any of claims 27-31, wherein the activation ofthe AMPK-FOXO-IP3R pathway in the cell is caused by a mutation in the cell’s mitochondrial DNA (mtDNA)33. The method of any of claims 27-32, wherein the activation of the AMPK-FOXO-IP3R pathway in the cell is caused by a mutation in the cell’s nuclear DNA.

34. The method of any of claims 27-33, wherein said the cell comprises a cell having a mitochondrial disease.

35. A method of claim 34, wherein said mitochondrial disease is selected from: Apical hypertrophic cardiomyopathy (AHCM). neuropathy, ataxia, autism, Charcot -Marie-Tooth syndrome (CMT), encephalopathy, epilepsy with brain pseudoatrophy, Episodic Weakness, Hereditary Spastic Paraplegia (HSP), Familiar Bilateral Striatal Necrosis (FBSN), Infantile cardiomyopathy, Leber Hereditary Optic neuropathy (LHON), Left Ventricular Hyper Trabeculation syndrome (LVHT), Maternally inherited Diabetes, Deafness syndrome (MIDD), Kearns-Sayre syndrome (KSS). Wolfram syndrome (WS), Maternally inherited Leigh Syndrome (MILS), Mesial Temporal Lobe Epilepsies with Hippocampal Sclerosis (MTLE-HS), Metabolic Syndrome (MS), Motor Neuron Syndrome (MNS), Myopathy, lactic Acidosis, Sideroblastic Anemia (MLASA), Neurogenetic Ataxia Retinis Pigmentosa syndrome (NARP), Periodic paralyzes, Schizophrenia, Spino Cerebellar Ataxia (SCA), Tetralogy of Fallot (ToF), short-chain acyl- coA dehydrogenase deficiency (SCAD), medium-chain acyl-coA dehydrogenase deficiency (MCAD), long-chain acyl-coA dehydrogenase deficiency LCAD), progressive ophthalmoplegia (CPEO), Pearson Syndrome, Barth Syndrome, Alpers Disease, Luft Disease, mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), Mitochondrial Encephalomyopathy, neuropathy, ataxia, retinal pigmentosa (NARP), myoclonic epilepsy, ragged red fibers (MERRF), mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Alzheimer’s diseases (AD), Parkinson’s disease (PD), Huntington’s disease (HD), amyotrophic lateral sclerosis (ALS, aka Lou Gehring’s diseases, Epilepsy, Autism, Fibromyalgia, chronic fatigue, cerebral palsy, Friedreich’s Ataxia, Rett Syndrome, and Fragile X Syndrome, cardiomyopathy and muscular dystrophy (MD), diabetes and side effects of antibiotics treatment of bacterial infection, ataxia neuropathy syndrome (ANS), Mendelian neurodegenerative mitochondriopathy, 3- methylglutaconic aciduria (MEG), MEGDEL syndrome, Sengers syndrome, Minimal change nephrotic syndrome (MCNS), Mitochondrial DNA depletion Syndrome (MODS), and Leigh-like disease.