Rapid detection method for ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium titanyl oxalate acid system

Abstract

A rapid detection method for ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and a potassium titanyl oxalate acid system, which belongs to the field of antibiotic detection technology. The detection method comprises: mixing an enzyme-linked up-conversion nanoparticle solution with an aptamer-connected magnetized polydopamine solution to obtain a fluorescent-ultraviolet dual-signal sensor detection system; and integrating potassium oxalate acid and hydrogen peroxide to collectively establish a ciprofloxacin content detection fluorescence standard curve and colorimetric standard curve, signal values of the ultraviolet absorbance and the fluorescence intensity of a meat product sample liquid are measured, and the ciprofloxacin content in the meat product is calculated according to the fluorescence standard curve and the colorimetric standard curve.

Description

A rapid detection method for ciprofloxacin in meat products based on enzyme-linked upconversion fluorescence and potassium oxalate titanate system

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application number 202310758306.2, filed with the China Patent Office on June 26, 2023, entitled "A method for rapid detection of ciprofloxacin in meat products based on enzyme-linked upconversion fluorescence and potassium oxalate titanate system," the entire contents of which are incorporated herein by reference. Technical Field

[0003] The invention belongs to the technical field of antibiotic detection, and in particular relates to a method for rapid detection of ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium oxalate titanate system. Background Art

[0004] Ciprofloxacin is a broad-spectrum antibacterial drug with high antibacterial activity and excellent bactericidal efficacy, making it widely used in animal husbandry and aquaculture. However, due to the misuse of ciprofloxacin by unscrupulous businesses in aquaculture, ciprofloxacin residues have been found in food. Long-term consumption of foods containing ciprofloxacin can weaken the immune system and promote bacterial resistance, ultimately leading to serious functional diseases.

[0005] Due to the serious hazards of ciprofloxacin, many countries currently have established maximum residue limits for ciprofloxacin in various agricultural products and foods. For example, China's national standard GB31650-2019 stipulates that the ciprofloxacin content in pork and fish must not exceed 100 μg / kg. However, traditional ciprofloxacin detection methods, such as high-performance liquid chromatography and liquid chromatography-tandem mass spectrometry, are subject to expensive instrumentation, high testing costs, and cumbersome procedures. These methods cannot meet the requirements for rapid and highly sensitive ciprofloxacin detection. Therefore, a simpler and more economical ciprofloxacin detection method is needed.

[0006] Summary of the Invention

[0007] To address the aforementioned issues in the existing technology, the present invention proposes a rapid detection method for ciprofloxacin in meat products based on an enzyme-linked upconversion fluorescence and potassium oxalotitanium acid system. This method overcomes the problems of existing detection technologies, such as high cost, long detection time, and complicated detection procedures.

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] A method for rapid detection of ciprofloxacin in meat products based on an enzyme-linked upconversion fluorescence and potassium titanate oxalate system comprises mixing an enzyme-linked upconversion nanoparticle solution with a magnetized polydopamine solution linked to an aptamer to obtain a fluorescence-ultraviolet dual-signal sensor detection system. Potassium titanate oxalate and hydrogen peroxide are combined to establish fluorescence and colorimetric standard curves for ciprofloxacin content detection. The signal characteristic values ​​of the fluorescence intensity and ultraviolet absorbance of a meat product sample solution are measured, and the ciprofloxacin content in the meat product is calculated based on the fluorescence standard curve and the colorimetric standard curve.

[0010] Furthermore, the method for preparing the enzyme-linked upconversion nanoparticle solution comprises the following steps:

[0011] 1) mixing upconversion nanoparticles, polyacrylic acid aqueous solution, chloroform and toluene, stirring, and centrifugally drying to obtain a carboxylated upconversion nanomaterial;

[0012] 2) Connecting a ciprofloxacin aptamer complementary chain and horseradish peroxidase to the surface of the carboxylated upconversion nanomaterial to obtain an enzyme-linked upconversion nanoparticle solution.

[0013] Furthermore, the usage ratio of the upconversion nanoparticles, polyacrylic acid aqueous solution, chloroform and toluene is 25 mg: 10 mL: 2 mL: 3 mL; the usage ratio of the carboxylated upconversion nanomaterial, ciprofloxacin aptamer and horseradish peroxidase is 10 mg: 2.5 OD: 5 mg.

[0014] Furthermore, the method for preparing the magnetized polydopamine solution for connecting the aptamer comprises the following steps:

[0015] S1. Ultrasonic dispersion of Fe3O4 in Tris-HCl buffer was performed, followed by addition of dopamine hydrochloride and stirring at room temperature to obtain magnetic polydopamine.

[0016] S2. Add magnetic polydopamine to buffer E and disperse it ultrasonically. Then add ciprofloxacin aptamer and NaCl, shake, and dissolve the precipitate in buffer F to obtain a magnetized polydopamine solution connected to the aptamer.

[0017] Furthermore, the dosage ratio of Fe3O4, Tris-HCl buffer and dopamine hydrochloride is 100 mg: 200 mL: 75 mg; the dosage ratio of magnetic polydopamine, ciprofloxacin aptamer and NaCl is 10 mg: 2.5 OD: 52.65 mg; and the buffer E and buffer F are both PBS buffer.

[0018] Furthermore, the volume ratio of the enzyme-linked upconversion nanoparticle solution to the aptamer-linked magnetized polydopamine solution is (1-1.5):0.5.

[0019] Furthermore, a method for establishing a fluorescence standard curve and a colorimetric standard curve for ciprofloxacin content detection using a fluorescence-ultraviolet dual-signal sensor detection system in combination with potassium titanate oxalate and hydrogen peroxide includes: adding ciprofloxacin standard solutions of different concentrations to the fluorescence-ultraviolet dual-signal sensor detection system, detecting the fluorescence intensity signal characteristic value of the supernatant after magnetic separation, adding an aqueous hydrogen peroxide solution to the supernatant, reacting for a period of time, adding potassium titanate oxalate solution to obtain a light yellow solution, detecting the ultraviolet absorbance of the light yellow solution, and drawing ultraviolet and fluorescence standard curves related to ciprofloxacin concentration based on the fluorescence intensity and ultraviolet absorbance signal characteristic values ​​corresponding to the ciprofloxacin standard solutions of different concentrations.

[0020] Furthermore, the method for detecting ciprofloxacin in meat products also includes: obtaining a meat product sample liquid, measuring the signal characteristic values ​​of the fluorescence intensity and ultraviolet absorbance of the sample liquid, and determining the content of ciprofloxacin in the actual sample based on the obtained ciprofloxacin detection standard curve.

[0021] Furthermore, the method for obtaining a meat product sample liquid includes: beating the meat product into a homogenate, adding acidified acetonitrile and anhydrous sodium sulfate, taking the precipitate after oscillation and centrifugation, adding acidified acetonitrile again, and oscillating and centrifuging to obtain a supernatant; combining the supernatants obtained from the two centrifugations, adding n-hexane to the supernatant and oscillating, taking the lower layer solution, rotary evaporating, adding methanol, filtering, and obtaining a sample liquid.

[0022] Compared with the prior art, the present invention has the following advantages and technical effects:

[0023] (1) The present invention uses magnetized polydopamine as an energy receptor and signal separator. Magnetized polydopamine is an effective quencher that can effectively quench the fluorescence of upconversion fluorescent materials through fluorescence resonance energy transfer, and quench the fluorescence of enzyme-linked upconversion materials in a short time, thereby improving the detection efficiency. Compared with traditional commonly used quenchers such as gold nanoparticles, manganese dioxide, and graphene oxide, magnetized polydopamine has a signal separation effect. The material has good magnetic properties and can be effectively separated from interferences without time-consuming centrifugal filtration. Using magnetized polydopamine to separate the target from coexisting ions can eliminate the interference of actual samples, improve detection sensitivity, detection efficiency and reliability, and achieve trace detection of the target.

[0024] (2) The present invention utilizes the ability of potassium titanium oxalate acid solution to selectively react with H2O2 to generate yellow peroxytitanic acid to produce a colorimetric signal. The reaction formula of potassium titanium oxalate with H2O2 in an acidic environment is: TiO 2+ +H2O2→[TiO(H2O2)] 2+ , the generated [TiO(H2O2)] 2+The color of the yellow complex changes with the H2O2 concentration. By measuring the absorbance of the solution, the ciprofloxacin content in the analyte can be accurately calculated. Potassium titanium oxalate reacts rapidly with H2O2 under mild conditions, eliminating the need for complex procedures, shortening detection time and improving efficiency.

[0025] (3) The enzyme-linked upconversion fluorescent material prepared in the present invention, combined with magnetized polydopamine, can achieve a dual fluorescence and colorimetric signal response to ciprofloxacin. Precisely controlling the ratio of the enzyme-linked upconversion fluorescent material and magnetized polydopamine can improve the sensitivity and reliability of detection. Compared with existing detection methods based on upconversion materials, the system constructed in the present invention can generate two detection signals, making the detection results more accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings, which constitute part of this application, are intended to provide a further understanding of this application. The exemplary embodiments and descriptions of this application are intended to explain this application and do not constitute an improper limitation on this application. In the accompanying drawings:

[0027] FIG1 is a transmission electron microscope image of an upconversion fluorescent nanomaterial;

[0028] FIG2 is a transmission electron micrograph of magnetized polydopamine;

[0029] FIG3 is a hysteresis loop diagram of magnetized polydopamine;

[0030] FIG4 is a graph showing fluorescence (A) and UV (B) standard curves of ciprofloxacin at different concentrations. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] The "room temperature" mentioned in the present invention is 25±2°C unless otherwise specified.

[0037] The raw materials used in the following examples of the present invention are all commercially available.

[0038] The present invention provides a method for rapid detection of ciprofloxacin in meat products based on enzyme-linked upconversion fluorescence and potassium titanate oxalate system, comprising the following steps:

[0039] Step 1, preparation of carboxylated upconversion nanomaterials: yttrium chloride hexahydrate, ytterbium chloride hexahydrate and erbium chloride hexahydrate are dispersed in anhydrous methanol A, oleic acid and 1-octadecene are added, and the mixture is heated and stirred for the first time under a nitrogen atmosphere, and then cooled to room temperature after stirring. After turning off the nitrogen, a mixed solution of sodium hydroxide and ammonium fluoride dissolved in anhydrous methanol B is added dropwise, and heated and stirred for the second time. Nitrogen is introduced, and the reaction is heated and stirred for the third time, and then cooled to room temperature after stirring. The obtained mixed solution is centrifuged to obtain an upconversion nanoparticle precipitate, and the upconversion nanoparticle precipitate is washed with a mixed solution of cyclohexane and ethanol, and dried to obtain pure upconversion nanoparticles;

[0040] The upconversion nanoparticles, polyacrylic acid aqueous solution, chloroform and toluene are mixed in proportion and stirred for a fourth time to obtain the carboxylated upconversion nanomaterial after centrifugal drying.

[0041] Step 2: Linking a ciprofloxacin aptamer complementary chain and horseradish peroxidase to the surface of the carboxylated upconversion nanomaterial: The carboxylated upconversion nanoparticles obtained in step 1 are dissolved in buffer A, followed by addition of an aqueous solution of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and an aqueous solution of N-hydroxysulfosuccinimide. The mixture is first mixed and shaken at a predetermined temperature. After the first shaking, deionized water A is added for centrifugal washing. The precipitate is then redispersed in buffer B. The ciprofloxacin aptamer complementary chain solution and horseradish peroxidase are added to the mixture, and the mixture is mixed and shaken for a second time at a predetermined temperature. After the second shaking, deionized water B is added for centrifugal washing, and the mixture is dissolved in buffer C to obtain an enzyme-linked upconversion nanoparticle solution. The enzyme-linked upconversion fluorescent material, acting as an energy donor and colorimetric signal source, can simultaneously provide both fluorescent and colorimetric signals, facilitating more accurate detection of ciprofloxacin.

[0042] Step 3. First, dissolve FeCl3·6H2O and FeSO4·7H2O in deionized water C, introduce nitrogen, and stir, then add NH3·H2O and heat and stir for the first time. After the reaction is completed, use a strong magnet to separate the obtained Fe3O4 from the solution and rinse with ultrapure water at least three times to effectively remove excess NH3·H2O. Finally, dry the product in a vacuum oven to obtain dry Fe3O4. Weigh a certain amount of Fe3O4 and ultrasonically disperse it in buffer D. Add dopamine hydrochloride to the above solution and stir for a second time at room temperature. After the stirring is completed, magnetized polydopamine is obtained. The magnetized polydopamine is collected by magnetic adsorption, washed three times with deionized water and ethanol, and dried.

[0043] Step 4: Magnetized polydopamine linked to the aptamer: Dried magnetized polydopamine was added to buffer E and ultrasonically dispersed. The ciprofloxacin aptamer and NaCl were then added and shaken for a period of time. After washing with deionized water, the precipitate was dissolved in buffer F to obtain a magnetized polydopamine solution linked to the aptamer. The magnetized polydopamine linked to the aptamer can specifically recognize ciprofloxacin, thus providing this method with good selectivity and interference resistance.

[0044] Step 5: Preparation of Potassium Titanium Oxalate Acid Solution: Potassium titanium oxalate, aminosulfonic acid, and deionized water C are mixed in appropriate proportions to prepare a potassium titanium oxalate acid solution. This potassium titanium oxalate acid solution selectively reacts with hydrogen peroxide to produce yellow peroxytitanic acid. The absorbance of the solution changes with the amount of hydrogen peroxide, enabling colorimetric detection.

[0045] Step 6: Prepare a fluorescence-UV dual-signal sensor: Mix the enzyme-linked upconversion nanoparticle solution obtained in step 2 with the magnetized polydopamine solution connected to the aptamer prepared in step 4 in a certain proportion, and mix for a period of time to obtain a detection system;

[0046] Step 7: Establishing fluorescence and colorimetric standard curves for ciprofloxacin content detection: First, prepare ciprofloxacin standard solutions of different concentrations, add the ciprofloxacin standard solutions of different concentrations to the detection system obtained in step 5, detect the fluorescence intensity signal characteristic value of the supernatant after magnetic separation, then add an aqueous hydrogen peroxide solution to the supernatant, react for a period of time, add potassium oxalate titanate solution to obtain a light yellow solution, detect the ultraviolet absorbance of the light yellow solution, and draw ultraviolet and fluorescence standard curves related to ciprofloxacin concentration based on the fluorescence intensity and ultraviolet absorbance signal characteristic values ​​corresponding to the ciprofloxacin standard solutions of different concentrations.

[0047] Step 8. Detection of ciprofloxacin content in meat products: Weigh the actual sample, beat into a homogenate, add acidified acetonitrile A and anhydrous sodium sulfate, shake for a period of time, centrifuge and take the precipitate, add acidified acetonitrile B, shake and centrifuge to obtain a supernatant, combine the supernatants obtained from the two centrifugations, place the supernatant in a separatory funnel, add n-hexane and shake, take the lower layer solution, evaporate the lower layer solution to dryness using a rotary evaporator, add methanol solution C, and filter through a filter membrane to obtain a sample solution; measure the signal characteristic values ​​of the fluorescence intensity and ultraviolet absorbance of the sample solution, and calculate the ciprofloxacin content in the actual sample based on the ciprofloxacin detection standard curve obtained in step 6.

[0048] In step 1 of the following embodiment of the present invention, the mass ratio of yttrium chloride hexahydrate, ytterbium chloride hexahydrate, and erbium chloride hexahydrate is 236.6:77.5:7.6; the amount ratio of methanol A, oleic acid, 1-octadecene, NH4F, NaOH, and methanol B is (6-10) mL:6 mL:15 mL:0.1482 g:0.1 g:10 mL; the temperature of the first heating and stirring reaction is 160-170 ° C, and the stirring time is 20-30 minutes; the temperature of the second heating and stirring reaction is 60-70 ° C, and the stirring time is 60-70 minutes; the temperature of the third heating and stirring reaction is 290-300 ° C, and the stirring time is 60-90 minutes.

[0049] The usage ratio of the upconversion nanoparticles, polyacrylic acid aqueous solution, chloroform, and toluene is 25 mg:10 mL:2 mL:3 mL; the concentration of the polyacrylic acid aqueous solution is 15 mg / mL; and the fourth stirring reaction time is 40-60 h.

[0050] In step 2 of the following examples of the present invention, the ratio of the carboxylated upconversion nanoparticles, buffer A, 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride aqueous solution, and N-hydroxysulfosuccinimide aqueous solution is 10 mg:10 mL:0.5 mL:0.5 mL; the concentrations of the 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride aqueous solution and the N-hydroxysulfosuccinimide aqueous solution are 2.0 mg / mL and 1.0 mg / mL, respectively; the ratio of the carboxylated upconversion nanoparticles, ciprofloxacin aptamer complementary strand solution, and horseradish peroxidase is 10 mg:2.5 OD:5 mg; the volume of buffer B is 10 mL; the volume of buffer C is 40 mL. Buffer A is a Tris-HCl buffer with a pH of 8.5; buffer B is a Tris-HCl buffer with a pH of 8.5; and buffer C is a phosphate buffer with a pH of 5.

[0051] In step 3 of the following examples of the present invention, the ratio of FeCl3·6H2O, FeSO4·7H2O, and NH3·H2O is (3.8-4.2) g: (2.3-2.4) g: 25 mL; the ratio of Fe3O4, buffer D, and dopamine hydrochloride is 100 mg: 200 mL: 75 mg. The first heating and stirring temperature is 80°C for 60 minutes, and the second stirring time is 6-10 hours. Buffer D is Tris-HCl buffer with a pH of 8.5.

[0052] In step 4 of the following example of the present invention, the ratio of buffer E, magnetized polydopamine, ciprofloxacin aptamer, and NaCl was 6 mL:10 mg:2.5 OD:52.65 mg; the shaking time was 24-30 h, and the temperature was 37°C. Buffer E was PBS buffer with a pH of 6.8; the volume of buffer F was 20 mL, and it was PBS buffer with a pH of 6.8.

[0053] In step 5 of the following example of the present invention, the usage ratio of potassium titanium oxalate, aminosulfonic acid, and deionized water C is 4 mg: 2 mg: 1 mL.

[0054] In step six of the following example of the present invention, the volume ratio of the enzyme-linked upconversion nanoparticle solution to the aptamer-linked magnetized polydopamine solution is (1-1.5):0.5; and the mixing time is 20-30 minutes.

[0055] In step 7 of the following example of the present invention, the concentration of the aqueous hydrogen peroxide solution is 8 mmol / L, and the volume ratio of the ciprofloxacin standard solution to the aqueous hydrogen peroxide solution is 2:1.

[0056] In step eight of the following example of the present invention, the ratio of the actual sample, acidified acetonitrile A, and anhydrous sodium sulfate is 5 g:30 mL:30 g; the ratio of the actual sample, acidified acetonitrile B, n-hexane, and anhydrous methanol C is 5 g:30 mL:25 mL:1 mL; and the oscillation time is 15 minutes.

[0057] The magnetized polydopamine used in the method of the present invention not only possesses the excellent magnetic properties of magnetic nanoparticles, which can separate the target from coexisting ions and eliminate interference from other substances, but also has excellent quenching properties, capable of quenching the fluorescence of enzyme-linked upconversion fluorescent materials. By detecting the hysteresis loop of the magnetized polydopamine, the present invention demonstrates that the material has excellent magnetic properties and can separate the target from other interfering substances in a short period of time using an external magnetic field. By detecting the change in fluorescence lifetime before and after mixing the enzyme-linked upconversion fluorescent material and the magnetized polydopamine, the fluorescence lifetime decreases after mixing, verifying that the magnetized polydopamine can effectively quench the fluorescence of the enzyme-linked upconversion fluorescent material. In addition, the presence of various functional groups in polydopamine, such as o-benzoquinone, amino, imino, and carboxyl groups, can chelate with metal ions, ensuring the adhesion of the polydopamine layer to the metal or metal oxide surface. Furthermore, the carboxyl groups on the polydopamine surface can covalently bind to the amino-modified aptamer, improving the stability of the magnetized polydopamine-linked aptamer.

[0058] Potassium oxalate titanate acid solution can selectively react with hydrogen peroxide to generate yellow peroxytitanic acid, thus realizing colorimetric detection. The principle is that in an acidic environment: TiO 2+ +H2O2→[TiO(H2O2)] 2+ , [TiO(H2O2)] 2+ It is a stable yellow complex whose color intensity is positively correlated with the H2O2 concentration. Therefore, the concentration of ciprofloxacin in a sample can be determined by measuring the absorbance of peroxotitanic acid. This invention utilizes the fluorescence quenching and magnetic separation properties of magnetized polydopamine and the color development of potassium oxalate titanate solution to develop an efficient dual-mode fluorescence and colorimetric detection method for ciprofloxacin, which has been applied to actual sample testing.

[0059] The methanol and deionized water samples with different letters are only used to distinguish different samples, and do not represent different composition. For example, methanol A and methanol B simply represent two separate methanol samples, and their composition is the same.

[0060] In order to further verify the detection effect of the detection method prepared by the present invention on the detection of organic ciprofloxacin in meat products, the following examples of the present invention take the detection of ciprofloxacin in fish as an example.

[0061] Example 1

[0062] (1) Preparation of carboxylated upconversion nanomaterials: First, 236.6 mg of YCl3·6H2O, 77.5 mg of YbCl3·6H2O, and 7.6 mg of ErCl3·6H2O were weighed and dissolved in 10 mL of methanol. After ultrasonic dispersion, the mixture was poured into a three-necked flask. 6 mL of oleic acid and 15 mL of 1-octadecene were added to the three-necked flask, nitrogen was introduced, and the mixed solution was stirred continuously at 160°C for 30 minutes. The solution was then cooled to room temperature. Under continuous stirring, 10 mL of methanol solution containing NH4F (0.1482 g) and NaOH solid (0.1 g) was dropped into the three-necked flask. The solution was heated to 70°C and maintained for 70 minutes to remove methanol. After the methanol evaporated, nitrogen was introduced and the solution was gradually heated to 300°C and maintained for 80 minutes with continuous stirring. After the reaction was completed, the heating switch was turned off and the solution was allowed to cool naturally to room temperature. The oleic acid-coated upconversion nanomaterials were collected by centrifugation, washed several times with cyclohexane and ethanol, and finally dried in an oven at 60°C. 50 mg of the oleic acid-coated upconversion nanomaterials were added to 6 mL of toluene and 4 mL of chloroform, followed by 20 mL of a 15 mg / mL polyacrylic acid aqueous solution, and stirred continuously for 48 hours. Finally, the carboxylated upconversion nanomaterial solution was separated by centrifugation and washed three times with ultrapure water to remove excess polyacrylic acid. The carboxylated upconversion nanomaterials were then dried to obtain the resulting solution (Figure 1).

[0063] As can be seen from Figure 1, the carboxyl groups on the surface of the carboxylated nanomaterials can be covalently linked to the amino-terminated aptamer complementary chains, making the connection stronger. At the same time, compared with the oleic acid-coated upconversion nanomaterials, they have better water solubility and dispersibility, which is beneficial to the detection of actual samples.

[0064] (2) Attaching the complementary chain of ciprofloxacin aptamer (the sequence of the complementary chain of ciprofloxacin aptamer is 3'-TATGGTCGAATAAGTTAACGTCCCATAGACTCCGAACTAGATGATTTACAGCACTCCCCTAAGTAAACCGCAACTATGCATGTTAGCATTAAGTCAATC-(CH2)6-NH2-5') and horseradish peroxidase to the surface of the carboxylated upconversion nanomaterial: 10 mL of Tris-HCl buffer, 0.5 mL of a 1.0 mg / mL aqueous solution of N-hydroxysulfosuccinimide, and 0.5 mL of a 2.0 mg / mL aqueous solution of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride were added to 10 mg of the carboxylated upconversion nanomaterial and stirred at 4°C for 2.0 h. After washing with deionized water by centrifugation, the precipitate was redispersed in 10.0 mL of Tris-HCl buffer. Subsequently, 2.5 OD of the ciprofloxacin aptamer complementary strand and 5 mg of horseradish peroxidase were added to the mixture, which was slowly stirred at 4°C for 12 hours. The precipitate was centrifuged and washed with ultrapure water to obtain the enzyme-linked upconversion fluorescent material (denoted as cDNA-UCNPs-HRP). Finally, the enzyme-linked upconversion fluorescent material was resuspended in 40 mL of phosphate buffer at pH 5 and stored at 4°C for subsequent use.

[0065] (3) Preparation of magnetized polydopamine: 4.1 g of FeCl₃·6H₂O and 2.35 g of FeSO₄·7H₂O were dissolved in 100 mL of ultrapure water and magnetically stirred under nitrogen for 20 minutes. Then, 25 mL of NH₃·H₂O was added and stirred at 80°C for 60 minutes. After the reaction, the resulting Fe₃O₄ was separated from the solution using a strong magnet and rinsed with ultrapure water at least three times to remove excess NH₃·H₂O. Finally, the product was dried in a vacuum oven at 50°C to obtain dry Fe₃O₄.

[0066] 100 mg of Fe₃O₄ was ultrasonically dispersed in 200 mL of Tris-HCl buffer. 75 mg of dopamine hydrochloride was added to the solution and stirred at room temperature for 8 hours. The magnetized polydopamine was collected by magnetic adsorption and washed three times with deionized water and ethanol. The magnetized polydopamine was then dried in a 60°C oven for 12 hours (Figures 2 and 3).

[0067] As shown in Figure 3, magnetized polydopamine exhibits excellent quenching properties, effectively quenching the fluorescence of the enzyme-linked upconversion fluorescent material and modulating the fluorescence signal. Magnetized polydopamine also possesses excellent magnetic properties, facilitating signal separation and effectively separating it from interfering substances without the need for time-consuming centrifugal filtration. Using magnetized polydopamine to separate the target from coexisting ions eliminates interference from the actual sample and enables trace detection of the target.

[0068] (4) Magnetized polydopamine-linked aptamer: 10 mg of magnetized polydopamine was added to 6 mL of PBS (pH 6.8) and ultrasonically dispersed. Subsequently, 2.5 OD of ciprofloxacin aptamer (the ciprofloxacin aptamer sequence is 5'-NH2-(CH2)6ATA CCA GCT TAT TCA ATT GCA GGG TAT CTG AGG CTT GAT CTA CTA AAT GTC GTG GGG CAT TGC TAT TGG CGT TGA TAC GTA CAA TCG TAA TCA GTT AG-3') and 52.65 mg of NaCl were added. After shaking at 37°C for 24 h, the solution was washed several times with deionized water to remove unbound ciprofloxacin aptamer. Finally, the precipitate was redispersed in 20 mL of PBS (pH 6.8) to obtain a magnetized polydopamine solution linked to the aptamer, which was stored at 4°C.

[0069] (5) Preparation of potassium titanate oxalate solution: Dissolve 100 mg of aminosulfonic acid and 200 mg of potassium titanate oxalate in 50 mL of deionized water and shake well to prepare a potassium titanate oxalate solution with a concentration of 2 mg / mL.

[0070] (6) Preparation of fluorescence-ultraviolet dual-signal sensor: 200 μL of the prepared enzyme-linked upconversion fluorescent material was mixed with 100 μL of magnetized polydopamine connected to the adapter, and incubated at 37°C for 20 minutes to form a fluorescence-ultraviolet dual-signal sensor.

[0071] (7) Establishment of fluorescence and colorimetric standard curves for ciprofloxacin content detection: Prepare ciprofloxacin solutions of different concentrations (10, 50, 100, 200, 400, 600, 800, 1000 μg / L), mix 200 μL of ciprofloxacin solutions of different concentrations with the fluorescence-ultraviolet dual signal sensor, detect the fluorescence intensity signal characteristic value of the supernatant after magnetic separation, then add 100 μL of 8 mmol / L hydrogen peroxide aqueous solution to the supernatant, react for 1 hour, add potassium titanate oxalate solution to obtain a light yellow solution, detect the ultraviolet absorbance of the light yellow solution, and draw the ultraviolet and fluorescence standard curves related to ciprofloxacin concentration based on the fluorescence intensity and ultraviolet absorbance signal characteristic values ​​corresponding to the ciprofloxacin standard solutions of different concentrations (see Figure 4).

[0072] (8) Detection of ciprofloxacin content in fish samples: Weigh 5 g of fish sample, beat into a homogenate, add 30 mL of acidified acetonitrile and 30 g of anhydrous sodium sulfate, shake for 15 minutes, centrifuge, take the precipitate, add 30 mL of acidified acetonitrile, shake and centrifuge to obtain a supernatant, place the supernatant obtained by two centrifugations in a separatory funnel, add 25 mL of n-hexane and shake, take the lower layer solution, evaporate the solution to dryness using a rotary evaporator, add 1 mL of methanol solution, filter through a filter membrane to obtain a sample solution; measure the signal characteristic values ​​of the fluorescence intensity and ultraviolet absorbance of the sample solution, and calculate the ciprofloxacin content in the fish sample based on the ciprofloxacin detection standard curve obtained in step (6).

[0073] The ciprofloxacin content in three fish samples was determined using the method and steps described in Example 1 of the present invention, and verified using the national standard method (GB-31656.3-2021). The measurement results are shown in Table 1.

[0074] Table 1 Results of the detection of ciprofloxacin in fish samples by the method of the present invention and high performance liquid chromatography

[0075] As can be seen from Table 1, the method of the present invention has good accuracy in actual samples and has good application prospects.

[0076] Comparative Example 1

[0077] The same as Example 1, except that step (6) is specifically as follows: 100 μL of the prepared enzyme-linked upconversion fluorescent material is mixed with 100 μL of magnetized polydopamine, and the mixture is incubated at 37° C. for 20 minutes to form a fluorescence-ultraviolet dual signal sensor.

[0078] The ciprofloxacin content in fish meat was determined using the method of this comparative example, and the detection accuracy was lower than that of the embodiment.

[0079] Comparative Example 2

[0080] The same as Example 1, except that step (2) is omitted. Step (6) is to mix 200 μL of the carboxylated upconversion nanomaterial prepared in step (1) with 100 μL of magnetized polydopamine and incubate at 37° C. for 20 minutes to form a fluorescence-UV dual-signal sensor. The other steps are the same as in Example 1.

[0081] The ciprofloxacin content in fish meat was determined using the method of this comparative example, and the detection accuracy was lower than that of the embodiment.

[0082] [Corrected 29.03.2024 in accordance with Rule 26] The above are merely preferred embodiments of the present application, but the scope of protection of this application is not limited thereto. Any changes or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in this application should be included in the scope of protection of this application. Therefore, the scope of protection of this application should be based on the scope of protection of the claims.

Claims

1. A rapid detection method for ciprofloxacin in meat products based on enzyme-linked upconversion fluorescence and potassium titanate oxalate system, characterized in that: The enzyme-linked upconversion nanoparticle solution and the magnetized polydopamine solution connected to the aptamer are mixed to obtain a fluorescence-ultraviolet dual-signal sensor detection system, and a fluorescence standard curve and a colorimetric standard curve for ciprofloxacin content detection are jointly established by combining potassium oxalate titanate and hydrogen peroxide, and the signal characteristic values ​​of the fluorescence intensity and ultraviolet absorbance of the meat product sample liquid are measured, and the ciprofloxacin content in the meat product is calculated according to the fluorescence standard curve and the colorimetric standard curve; The method for preparing the enzyme-linked upconversion nanoparticle solution comprises the following steps: 1) mixing upconversion nanoparticles, polyacrylic acid aqueous solution, chloroform and toluene, stirring, centrifuging and drying to obtain a carboxylated upconversion nanomaterial; 2) connecting a ciprofloxacin aptamer complementary chain and horseradish peroxidase on the surface of the carboxylated upconversion nanomaterial to obtain an enzyme-linked upconversion nanoparticle solution; The method for preparing the magnetized polydopamine solution for connecting the adapter comprises the following steps: S1. Ultrasonic dispersion of Fe3O4 in Tris-HCl buffer, then adding dopamine hydrochloride and stirring at room temperature to obtain magnetic polydopamine; S2. Add magnetic polydopamine to buffer E, disperse by ultrasonication, then add ciprofloxacin aptamer and NaCl, shake, dissolve the precipitate in buffer F, and obtain a magnetized polydopamine solution connected to the aptamer; The buffer E is PBS buffer; The buffer F is PBS buffer.

2. The method for rapid detection of ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium titanate oxalate system according to claim 1, characterized in that: The usage ratio of the upconversion nanoparticles, polyacrylic acid aqueous solution, chloroform and toluene is 25 mg: 10 mL: 2 mL: 3 mL; the usage ratio of the carboxylated upconversion nanomaterial, ciprofloxacin aptamer complementary chain and horseradish peroxidase is 10 mg: 2.5 OD: 5 mg.

3. The method for rapid detection of ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium titanate oxalate system according to claim 1, characterized in that: The dosage ratio of Fe3O4, Tris-HCl buffer and dopamine hydrochloride is 100 mg: 200 mL: 75 mg; the dosage ratio of magnetic polydopamine, ciprofloxacin aptamer and NaCl is 10 mg: 2.5 OD: 52.65 mg.

4. The method for rapid detection of ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium titanate oxalate system according to claim 1, characterized in that: The volume ratio of the enzyme-linked up-conversion nanoparticle solution to the magnetized polydopamine solution connected with the adapter is (1-1.5):0.5, and the mixing time is 20-30 minutes.

5. The method for rapid detection of ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium titanate oxalate system according to claim 1, characterized in that: The method of establishing a fluorescence standard curve and a colorimetric standard curve for detecting ciprofloxacin content by combining a fluorescence-ultraviolet dual signal sensor detection system with potassium titanate oxalate and hydrogen peroxide comprises: Different concentrations of ciprofloxacin standard solutions were added to the fluorescence-ultraviolet dual signal sensor detection system, and the fluorescence intensity signal characteristic value of the supernatant after magnetic separation was detected. A hydrogen peroxide solution was then added to the supernatant. After a period of reaction, a potassium titanate oxalate acid solution was added to obtain a light yellow solution. The ultraviolet absorbance of the light yellow solution was detected, and an ultraviolet standard curve and a fluorescence standard curve related to the ciprofloxacin concentration were drawn according to the fluorescence intensity and ultraviolet absorbance signal characteristic values ​​corresponding to the ciprofloxacin standard solutions of different concentrations.

6. The method for rapid detection of ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium titanate oxalate system according to claim 1, characterized in that: The method for detecting ciprofloxacin in meat products also includes: obtaining a meat product sample liquid, measuring the signal characteristic values ​​of the fluorescence intensity and ultraviolet absorbance of the sample liquid, and determining the content of ciprofloxacin in the actual sample based on the obtained ciprofloxacin detection standard curve.

7. The method for rapid detection of ciprofloxacin in meat products based on enzyme-linked up-conversion fluorescence and potassium titanate oxalate system according to claim 6, characterized in that: The method for obtaining a meat product sample liquid comprises: beating the meat product into a homogenate, adding acidified acetonitrile and anhydrous sodium sulfate, taking a precipitate after oscillation and centrifugation, adding acidified acetonitrile again, and oscillating and centrifuging to obtain a supernatant; combining the supernatants obtained from the two centrifugations, adding n-hexane to the supernatant for oscillation, taking a lower layer solution, rotary evaporating, adding methanol, filtering, and obtaining a sample liquid.

Images