Pharmaceutical composition and use thereof

Abstract

The present invention relates to a pharmaceutical composition and a use thereof, and specifically provides a pharmaceutical composition, comprising: a cell and a pharmaceutically acceptable adjuvant. The adjuvant comprises a diluent and a cryoprotectant; the cell is a T cell containing and / or expressing a chimeric antigen receptor, and / or containing a coding sequence of the chimeric antigen receptor; an antigen-binding domain of the chimeric antigen receptor comprises a mesothelin binding molecule containing an anti-mesothelin single-domain antibody; the anti-mesothelin single-domain antibody comprises CDR1, CDR2, and CDR3; the CDR1 comprises a sequence as shown in SEQ ID NO: 1; CDR2 comprises a sequence as shown in SEQ ID NO: 2; and CDR3 comprises a sequence as shown in SEQ ID NO: 3.

Description

Pharmaceutical composition and its application Technical Field

[0001] The present invention relates to the field of chimeric antigen receptor therapy, and in particular to a pharmaceutical composition and application thereof. Background Art

[0002] The mesothelin (MSLN) gene is located on chromosome 1p13.3 and is 8 kDa in length. It contains an 1884-bp open reading frame, encoding 17 exons and 628 amino acids. The MSLN precursor protein is a 69-kDa glycoprotein anchored to the cell membrane by glycosylphosphatidylinositol. It can be hydrolyzed by proteases into two components: a 31-kDa soluble protein at the N-terminus with megakaryocyte-stimulating activity, termed megakaryocyte potentiating factor (MPF); and a 40-kDa membrane-bound protein at the C-terminus with cell-adhesive properties, termed MSLN. The membrane protein structure of MSLN can be divided into three distinct regions, with region I being the binding site for the ligand CA125.

[0003] Mesothelin, as a differentiation antigen, is highly expressed in a variety of malignant tumors and is closely related to the occurrence and development of tumors. This target is one of the most promising anti-tumor targets, and many large pharmaceutical companies have already targeted this target for development. Currently, the drugs entering clinical trials include CAR-T, monoclonal antibodies, and ADCs. In the past nearly 20 years, a variety of anti-mesothelin monoclonal antibodies have been developed, mainly including SS1P immunotoxin and MORAB-009. SS1P is a recombinant immunotoxin composed of a scFv fused to a truncated pseudoextracellular bacterial toxin, which mainly mediates cell killing. MORAB-009 is an IgG1 antibody recombined with the SS1P sequence, which mainly causes antibody-dependent cell-mediated cytotoxicity (ADCC).

[0004] The SS1P antibody binds to the mesothelin I region and can block the binding of CA125 to mesothelin. This antibody has also been used in CAR-T therapy, but the efficacy has been unsatisfactory (Jiang, H. et al., Protein Cell 8, 926-931, 2017; Adusumilli, P.S. et al., Sci. Transl. Med. 6, 261ra151, 2014; Lanitis, E. et al., Mol. Ther. 20, 633-643, 2012). Nanobodies have the inherent advantages of high stability, strong penetrance, and broad binding epitopes (Muyldermans S. Annu Rev Biochem. 2013; 82: 775-97). There are no reports of the use of the MSLN nanobody in CAR-T therapy.

[0005] At present, although CAR-T therapy has achieved great results in the treatment of hematological tumors, its response rate for solid tumors is relatively low. CAR-T therapy combined with PD-1 inhibitors is an emerging therapy for the treatment of solid tumors. Researchers at the Memorial Sloan Kettering Cancer Center in the United States constructed a CAR-T cell that can secrete anti-PD-1 single-chain antibody (scFv) (Sarwish Rafiq et al., Nat Biotechnol 2018 Oct; 36(9): 847-856). However, studies have found that traditional scFv antibodies have low expression levels in T cells and are difficult to fully exert the effect of PD-1 inhibitors. This is mainly due to the properties of scFv antibodies themselves, such as easy aggregation, easy mismatch in folding, and low thermal stability (Martin N et al., Macromol Biosci. 2017 Feb; 17(2)). Nanobodies have natural advantages such as easy expression, high stability, and high affinity. Based on the advantages of nanoantibodies themselves, the biological mechanisms of MSLN and PD-1, developing a CAR-T based on MSLN nanoantibodies and a therapy that combines autocrine PD-1 nanoantibodies has become an urgent problem to be solved.

[0006] Summary of the Invention

[0007] In one aspect, the present invention provides a chimeric antigen receptor (CAR) comprising an optional signal peptide sequence, a mesothelin-binding molecule comprising an anti-mesothelin single domain antibody, a hinge region, a transmembrane region, and an intracellular region.

[0008] In one or more embodiments, the intracellular region includes an intracellular costimulatory domain and / or an intracellular signaling domain.

[0009] In one or more embodiments, the anti-mesothelin single domain antibody is a single domain antibody specific for the mesothelin III region (membrane-proximal end).

[0010] In one or more embodiments, the anti-mesothelin single-domain antibody comprises CDR1, CDR2, and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3.

[0011] In one or more embodiments, the CDR1 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 4-27, 73. Preferably, the CDR1 comprises the sequence shown in any one of SEQ ID NOs: 5, 11, 14, 15, 17, 21, 27, 73.

[0012] In one or more embodiments, the CDR2 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 28-47, 74. Preferably, the CDR2 comprises the sequence shown in any one of SEQ ID NOs: 29, 35, 37, 38, 39, 43, 40, 74.

[0013] In one or more embodiments, the CDR3 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 48-72, 75. Preferably, the CDR3 comprises the sequence shown in any one of SEQ ID NOs: 49, 55, 58, 59, 61, 65, 72, 75.

[0014] In one or more embodiments, the FR region of the anti-mesothelin single domain antibody is the FR region of any one VHH selected from SEQ ID NOs: 76-120.

[0015] In one or more embodiments, the anti-mesothelin single-domain antibody VHH is shown in any one of SEQ ID NOs: 76 to 120. Preferably, the anti-mesothelin single-domain antibody is shown in any one of SEQ ID NOs: 77, 83, 85, 86, 87, 89, 93, 100, and 103.

[0016] In one or more embodiments, the mesothelin binding molecule is a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or an antigen binding fragment thereof, an antibody or an antigen binding fragment thereof comprising one, two or more of the single domain antibodies.

[0017] In one or more embodiments, the chimeric antigen receptor comprises, from N-terminus to C-terminus, a signal peptide, a mesothelin-binding molecule comprising an anti-mesothelin single domain antibody, a hinge region, a transmembrane region, an intracellular costimulatory domain, and an intracellular signaling domain.

[0018] In one or more embodiments, the signal peptide is a CD8 signal peptide, a CD28 signal peptide, a CD4 signal peptide or a light chain signal peptide; more preferably, it is a CD8 signal peptide; preferably, the amino acid sequence of the CD8 signal peptide is as shown in amino acid residues 1-22 of SEQ ID NO: 121.

[0019] In one or more embodiments, the hinge region is selected from the group consisting of a CD8 hinge region, an IgD hinge region, an IgG1 Fc CH2CH3 hinge region, and an IgG4 Fc CH2CH3 hinge region; preferably, the hinge region is a CD8 hinge region; more preferably, the amino acid sequence of the CD8 hinge region is as shown in amino acid residues 149-203 of SEQ ID NO: 121.

[0020] In one or more embodiments, the transmembrane region is one of the CD28 transmembrane region, CD8 transmembrane region, CD3ζ transmembrane region, CD134 transmembrane region, CD137 transmembrane region, ICOS transmembrane region and DAP10 transmembrane region; preferably, the CD28 transmembrane region, and more preferably, its amino acid sequence is as shown in amino acid residues 204-231 of SEQ ID NO: 121.

[0021] In one or more embodiments, the intracellular costimulatory domain includes the intracellular domain of a costimulatory signaling molecule, including the intracellular domains of CD28, CD134 / OX40, CD137 / 4-1BB, lymphocyte-specific protein tyrosine kinase, inducible T cell co-stimulator (ICOS) and DNAX activating protein 10; preferably, the intracellular costimulatory domain is the intracellular domain of CD28; preferably, the amino acid sequence of the CD28 intracellular domain is as shown in amino acid residues 231-272 of SEQ ID NO: 121.

[0022] In one or more embodiments, the intracellular signaling domain is a CD3ζ intracellular signaling domain or an FcεRIγ intracellular signaling domain; preferably, it is a CD3ζ intracellular signaling domain, and preferably, the amino acid sequence of the CD3ζ intracellular signaling domain is as described in amino acid residues 273-384 of SEQ ID NO: 121.

[0023] In one or more embodiments, the chimeric antigen receptor contains, from N-terminus to C-terminus, a CD8 signal peptide, an anti-MSLN nanobody, a CD8 hinge region, a CD28 transmembrane region, a CD28 costimulatory domain, and a CD3ζ intracellular signaling domain.

[0024] In one or more embodiments, the amino acid sequence of the chimeric antigen receptor is shown in SEQ ID NO: 121 or 122 or 123.

[0025] The present invention also provides a chimeric antigen receptor, wherein the antigen binding domain of the chimeric antigen receptor comprises an anti-mesothelin single domain antibody.

[0026] In one or more embodiments, the anti-mesothelin single domain antibody can be as described in any of the above embodiments.

[0027] The present invention also provides a nucleic acid molecule comprising a sequence selected from the group consisting of:

[0028] (1) the coding sequence of the chimeric antigen receptor described in any embodiment of the present invention;

[0029] (2) The complementary sequence of (1);

[0030] (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

[0031] In one or more embodiments, the fragment is a primer.

[0032] In one or more embodiments, the coding sequence is DNA or RNA.

[0033] The second aspect of the present invention also provides a nucleic acid construct, which comprises the nucleic acid molecule according to any embodiment of the present invention.

[0034] In one or more embodiments, the nucleic acid construct further comprises a coding sequence for a PD-1 binding molecule.

[0035] In one or more embodiments, the nucleic acid construct further comprises a coding sequence for a transposase and / or a coding sequence for a PD-1 binding molecule, wherein the transposase is used to transpose the coding sequence of the chimeric antigen receptor and / or the PD-1 binding molecule, for example, to integrate the coding sequence or expression cassette of the transposed chimeric antigen receptor and / or the PD-1 binding molecule into the genome.

[0036] In one or more embodiments, the transposase encoding sequence is DNA or RNA.

[0037] In one or more embodiments, the coding sequence for the PD-1 binding molecule is DNA or RNA.

[0038] In one or more embodiments, the PD-1 binding molecules include: PD-1 antibodies or antigen-binding fragments thereof, PD-1 heavy chain antibodies or antigen-binding fragments thereof, monovalent or multivalent single-domain antibodies comprising one, two or more PD-1 single-domain antibodies, and multispecific single-domain antibodies.

[0039] In one or more embodiments, the PD-1 binding molecule (e.g., PD-1 single domain antibody) further comprises an Fc region. Preferably, the Fc region is an IgG4 Fc region, the sequence of which is shown in SEQ ID NO: 132.

[0040] In one or more embodiments, the nucleic acid construct is a vector, such as a cloning vector, an expression vector, or an integrating vector.

[0041] In one or more embodiments, the expression vector is a constitutive expression vector. Preferably, the constitutive expression vector is a transposable vector.

[0042] In one or more embodiments, the coding sequence for the chimeric antigen receptor is located between the recognition sequences for the transposase.

[0043] In one or more embodiments, the coding sequence of the PD-1 binding molecule is located between the recognition sequences of the transposase.

[0044] In one or more embodiments, the transposase is PiggyBac transposase (PBase).

[0045] In one or more embodiments, the transposase is as described in CN105154473A.

[0046] In one or more embodiments, the nucleic acid construct comprises an expression cassette for CAR. In one or more embodiments, the nucleic acid construct further comprises an expression cassette for a transposase and / or an expression cassette for a PD-1 binding molecule. The one, two, or three expression cassettes are contained in one or more vectors.

[0047] In one or more embodiments, the nucleic acid construct contains an expression cassette for the chimeric antigen receptor and an expression cassette for the transposase; or the nucleic acid construct is an expression cassette, wherein the coding sequence for the chimeric antigen receptor and the coding sequence for the transposase are within the expression frame.

[0048] In one or more embodiments, the nucleic acid construct contains an expression cassette for the chimeric antigen receptor and an expression cassette for the PD-1 binding molecule; or the nucleic acid construct is an expression cassette, wherein the coding sequence for the chimeric antigen receptor and the coding sequence for the PD-1 binding molecule are within the expression frame.

[0049] In one or more embodiments, the nucleic acid construct contains an expression cassette for the chimeric antigen receptor, an expression cassette for the transposase, and an expression cassette for the PD-1 binding molecule; or the nucleic acid construct is composed of two expression cassettes, one of which contains any one of the coding sequence for the chimeric antigen receptor, the coding sequence for the transposase, and the coding sequence for the PD-1 binding molecule, and the other contains the remaining coding sequences; or the nucleic acid construct is a single expression cassette, wherein the coding sequence for the chimeric antigen receptor, the coding sequence for the transposase, and the coding sequence for the PD-1 binding molecule are within the expression cassette.

[0050] In one or more embodiments, the nucleic acid construct is one or more vectors, each vector comprising one, two, or three expression cassettes as described in any of the embodiments herein.

[0051] In one or more embodiments, the nucleic acid construct comprises:

[0052] A vector comprising (a) an expression cassette for a CAR and optionally (b) an expression cassette for a transposase and / or an expression cassette for a PD-1 binding molecule;

[0053] Two vectors, wherein the two vectors (a) respectively comprise an expression cassette for CAR and an expression cassette for a PD-1 binding molecule, and optionally, either of the two vectors further comprises an expression cassette for a transposase, or (b) one comprises an expression cassette for a transposase, and the other comprises an expression cassette for a CAR and an expression cassette for a PD-1 binding molecule;

[0054] Three vectors, each containing an expression cassette for CAR, an expression cassette for PD-1 binding molecules, and an expression cassette for transposase.

[0055] On the other hand, the present invention also provides a combination of coding sequences, comprising the coding sequence of the chimeric antigen receptor described in any of the embodiments herein, and further comprising the coding sequence of a transposase and / or the coding sequence of a PD-1 binding molecule.

[0056] In one or more embodiments, any one of the coding sequences of the combination can be freely selected as DNA or RNA. For example, all three coding sequences are DNA, or all three coding sequences are RNA, or any one or two of the three are selected as DNA.

[0057] In one or more embodiments, the combination of coding sequences includes a coding sequence for a chimeric antigen receptor, a coding sequence for a transposase, and a coding sequence for a PD-1 binding molecule, and all three coding sequences are DNA.

[0058] In one or more embodiments, the combination of coding sequences includes a coding sequence for a chimeric antigen receptor, a coding sequence for a transposase, and a coding sequence for a PD-1 binding molecule, wherein the coding sequence for the chimeric antigen receptor and the coding sequence for the PD-1 binding molecule are DNA, and the coding sequence for the transposase is RNA, more preferably mRNA.

[0059] In one or more embodiments, the coding sequences in the combination may be located in the same nucleic acid molecule or in different nucleic acid molecules. For example, the coding sequence for the chimeric antigen receptor, the coding sequence for the transposase, and the coding sequence for the PD-1 binding molecule are located in the same nucleic acid molecule; or the coding sequence for the chimeric antigen receptor and the coding sequence for the transposase are located in the same nucleic acid molecule, while the coding sequence for the PD-1 binding molecule is located in another nucleic acid molecule; or the coding sequence for the chimeric antigen receptor, the coding sequence for the transposase, and the coding sequence for the PD-1 binding molecule are located in three separate nucleic acid molecules.

[0060] Another aspect of the present invention provides a cell, wherein:

[0061] (1) comprising and / or expressing the chimeric antigen receptor described in any embodiment herein, and / or comprising the coding sequence of the chimeric antigen receptor described in any embodiment herein;

[0062] and / or optionally comprises, expresses and / or secretes a PD-1 binding molecule, and / or contains a coding sequence for a PD-1 binding molecule, and / or

[0063] (2) comprising a nucleic acid molecule and / or nucleic acid construct as described herein, and / or

[0064] (3) comprising the coding sequence combination described herein.

[0065] The transposase and PD-1 binding molecule are as described in the second aspect of this invention.

[0066] In one or more embodiments, the cell is an immune cell, preferably a T cell, ie, the cell is a CAR-T cell (also referred to herein as MSLN CAR-T cell).

[0067] In one or more embodiments, the cell contains: (a) a coding sequence for a chimeric antigen receptor as described in any embodiment herein; and optionally contains (b) a coding sequence for a PD-1 binding molecule as described in any embodiment herein.

[0068] In one or more embodiments, the cell contains: a coding sequence for a chimeric antigen receptor as described in any embodiment herein and a coding sequence for a PD-1 binding molecule as described in any embodiment herein.

[0069] Another aspect of the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and:

[0070] (1) The chimeric antigen receptor and / or its coding sequence as described in any embodiment herein, optionally further comprising (i) a transposase and / or its coding sequence, and / or (ii) a PD-1 binding molecule and / or its coding sequence, or

[0071] (2) The nucleic acid molecule, nucleic acid construct, combination of coding sequences or cell described in any embodiment of the present invention.

[0072] In one or more embodiments, the pharmaceutical composition comprises the cells described in any embodiment herein and pharmaceutically acceptable excipients, wherein the excipients include a diluent and a cryoprotectant.

[0073] The transposase and PD-1 binding molecule are as described in the second aspect of this invention.

[0074] In one or more embodiments, the pharmaceutical composition is used to treat cancer.

[0075] In one or more embodiments, the cancer comprises a mesothelin-mediated cancer. Preferably, the cancer further comprises a PD-1-mediated cancer.

[0076] In one or more embodiments, the cancer comprises one or more selected from mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma.

[0077] Another aspect of the present invention provides use of a reagent in preparing activated immune cells (e.g., T cells), the reagent comprising:

[0078] (1) The chimeric antigen receptor and / or its coding sequence as described in any embodiment herein, optionally further comprising (i) a transposase and / or its coding sequence, and / or (ii) a PD-1 binding molecule and / or its coding sequence, or

[0079] (2) The nucleic acid molecule, nucleic acid construct, combination of coding sequences or cell described in any embodiment of the present invention.

[0080] The transposase and PD-1 binding molecule are as described in the second aspect of this invention.

[0081] Another aspect of the present invention provides use of a reagent in the preparation of a drug for treating cancer, the reagent comprising:

[0082] (1) The chimeric antigen receptor and / or its coding sequence as described in any embodiment herein, optionally further comprising (i) a transposase and / or its coding sequence, and / or (ii) a PD-1 binding molecule and / or its coding sequence, or

[0083] (2) The nucleic acid molecule, nucleic acid construct, combination of coding sequences or cell described in any embodiment of the present invention.

[0084] The transposase and PD-1 binding molecule are as described in the second aspect of this invention.

[0085] In one or more embodiments, the cancer comprises a mesothelin-mediated cancer. Preferably, the cancer further comprises a PD-1-mediated cancer.

[0086] In one or more embodiments, the cancer comprises one or more selected from mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma.

[0087] The present invention also provides a method for treating or preventing cancer, comprising administering a therapeutically effective amount of the cell or pharmaceutical composition according to any embodiment of the present invention to a patient in need thereof.

[0088] In one or more embodiments, the method comprises administering to a patient in need thereof a pharmaceutical composition as described in any embodiment herein, thereby delivering a dose of the cells to the patient.

[0089] In one or more embodiments, the dose comprises 0.5×10 6 ~2×10 8 cells / kg patient body weight, preferably 1×10 6 ~2×10 7 cells / kg patient body weight, more preferably 6×10 6 ~2×10 7 cells / kg of patient body weight.

[0090] In one or more embodiments, the cancer comprises a mesothelin-mediated cancer. Preferably, the cancer further comprises a PD-1-mediated cancer.

[0091] In one or more embodiments, the cancer is mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, etc.

[0092] In one or more embodiments, the patient's tumor tissue cells express mesothelin positively, preferably with a mesothelin expression rate of more than 50%. Optionally, the patient also satisfies any one or more of the following conditions:

[0093] (1) The patient has positive expression of PD-L1,

[0094] (2) The patient is diagnosed with one or more of malignant pleural or peritoneal mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma;

[0095] (3) The patient has received standard therapy and the treatment has failed.

[0096] In one or more embodiments, a lymphocyte depletion regimen is performed before administering the pharmaceutical composition. Preferably, the lymphocyte depletion regimen comprises administering cyclophosphamide and / or fludarabine to the patient. More preferably, 300 mg / m2 of cyclophosphamide is administered to the patient. 2 / day and fludarabine 30 mg / m 2 / day for three days.

[0097] In one or more embodiments, the cells or pharmaceutical compositions are administered intravenously.

[0098] In one or more embodiments, the dose is administered to the patient via a single infusion, or via multiple infusions, optionally in an ascending dose or isodose manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] Figure 1. Clinical research process.

[0100] Figure 2. Preprocessing and grouping.

[0101] Figure 3. Measurement of CAR copy number by PCR.

[0102] Figure 4. Quantification of anti-PD-1 VHH in peripheral blood by MSD.

[0103] Figure 5. IFNγ levels in peripheral blood.

[0104] Figure 6. IL-6 levels in peripheral blood.

[0105] Figure 7. Survival follow-up of patients after treatment.

[0106] Figure 8. PET-CT and CT images of patient BZ-02 who achieved CR.

[0107] Figure 9. Lesion size of patients with CR, PR, and SD after treatment assessed by mRECIST.

[0108] Figure 10. Lesion size of patient BZ-13 who achieved PR by mRECIST after infusion.

[0109] Figure 11. Lesion size in patients with lung adenocarcinoma who achieved a PR after infusion as assessed by mRECIST. DETAILED DESCRIPTION

[0110] The present invention provides a chimeric antigen receptor (CAR) targeting mesothelin. The CAR comprises an optional signal peptide sequence, a mesothelin-binding molecule containing an anti-mesothelin single-domain antibody sequence, a hinge region, a transmembrane region, an intracellular costimulatory domain, and an intracellular signaling domain.

[0111] As used herein, an antigen "binding molecule" is a protein that specifically binds to an antigen, including but not limited to antibodies, antigen-binding fragments of antibodies, heavy chain antibodies, nanobodies, minibodies, affibodies, target binding regions of receptors, cell adhesion molecules, ligands, enzymes, cytokines, and chemokines. As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions with multiple epitope specificities, multispecific antibodies (e.g., bispecific antibodies), diabodies, and single-chain molecules, as well as antibody fragments, particularly antigen-binding fragments, e.g., Fab, F(ab')2, and Fv). As used herein, the terms "immunoglobulin" (Ig) and "antibody" are used interchangeably.

[0112] The "heavy chain antibodies" described herein are antibodies derived from camelids or cartilaginous fish. Compared to the above-mentioned four-chain antibodies, heavy chain antibodies lack light chains and heavy chain constant region 1 (CH1), and only contain two heavy chains composed of variable regions (VHH) and other constant regions. The variable regions are connected to the constant regions by a hinge-like structure. Each heavy chain of the camelid heavy chain antibody contains one variable region (VHH) and two constant regions (CH2 and CH3), and each heavy chain of the cartilaginous fish heavy chain antibody contains one variable region and five constant regions (CH1-CH5). The antigen-binding fragments of heavy chain antibodies include VHH and single-chain heavy chain antibodies. By fusing with the constant region of human IgG Fc, heavy chain antibodies can have CH2 and CH3 of human IgG Fc. Exemplarily, the heavy chain constant region comprises the sequence shown in SEQ ID NO: 132.

[0113] As used herein, the terms "single-domain antibody," "heavy chain variable region domain of a heavy chain antibody," "VHH," "nanobody," and "single variable domain" are used interchangeably and refer to a single-domain polypeptide or protein that specifically recognizes and binds to an antigen. A single-domain antibody is the variable region of a heavy chain antibody. Typically, a single-domain antibody contains three CDRs and four FRs. A single-domain antibody is the smallest functional antigen-binding fragment. Typically, an antibody naturally lacking the light chain and heavy chain constant region 1 (CH1) is first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single-domain antibody consisting of only one heavy chain variable region.

[0114] Binding molecules comprising two or more single-domain antibodies are multivalent single-domain antibodies; binding molecules comprising two or more single-domain antibodies with different specificities are multispecific single-domain antibodies. Multivalent single-domain antibodies or multispecific single-domain antibodies connect multiple single-domain antibodies via a linker. The linker is typically composed of 1-15 amino acids selected from G and S.

[0115] In this article, the terms heavy chain antibody and antibody are used to distinguish different combinations of antibodies. Due to the structural similarities between the two, the following description of the structure of antibodies, except for the light chain, also applies to heavy chain antibodies.

[0116] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of an antibody. The variable domains of the heavy and light chains may be referred to as "VH" and "VL," respectively. These domains are generally the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen-binding site.

[0117] The term "variable" refers to the situation where certain segments in the variable domain vary widely in antibody sequence. The variable domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. However, variability is not evenly distributed across all amino acids spanning the variable domain. Instead, it is concentrated in three segments called hypervariable regions (HVRs) (found in both the light and heavy chain variable domains), namely the HCDR1, HCDR2, and HCDR3 of the heavy chain variable domain (which can be abbreviated as CDR1, CDR2, and CDR3 in heavy chain antibodies) and the LCDR1, LCDR2, and LCDR3 of the light chain variable domain. The more highly conserved parts of the variable domain are called framework regions (FRs). The variable domains of native heavy and light chains each contain four FR regions (FR1, FR2, FR3, and FR4), most of which adopt a β-sheet conformation and are connected by three HVRs that form loops connecting and, in some cases, forming part of the β-sheet structure. The HVRs in each chain are held together in close proximity by the FR regions and, together with the HVRs of the other chain, contribute to the formation of the antibody's antigen-binding site. Typically, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domains do not directly participate in the binding of antibodies to antigens, but exhibit various effector functions, such as the participation of antibodies in antibody-dependent cell-mediated cytotoxicity.

[0118] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain that mediates the binding of the immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells), or binding to the first component (Clq) of the classical complement system. In IgG, IgA, and IgD antibody isotypes, the Fc region is composed of two identical protein fragments, the CH2 domain and the CH3 domain from the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain can vary, the human IgG heavy chain Fc region is generally defined as the sequence stretching from amino acid residue at position C226 or P230 of the heavy chain to the carboxyl terminus, where the numbering is according to the EU index, as in Kabat. Each heavy chain of a camelid heavy chain antibody comprises one variable region (VHH) and two constant regions (CH2 and CH3). By fusing with the constant region of human IgG Fc, the heavy chain antibody can have the CH2 and CH3 of human IgG Fc.

[0119] "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen-binding and / or variable region of an intact antibody. Antibody fragments are preferably antigen-binding fragments of an antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multispecific antibodies formed from antibody fragments; and any fragment whose half-life can be increased by chemical modification or incorporation into liposomes. Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, and a residual "Fc" fragment, the name reflecting its ability to crystallize readily. Fab fragments are composed of an intact light chain and heavy chain variable domain (VH) and one heavy chain first constant domain (CH1). Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of an antibody produces a larger F(ab')2 fragment, which is roughly equivalent to two disulfide-linked Fab fragments, with different antigen-binding activities and still capable of cross-linking antigen. Fab' fragments differ from Fab fragments by the addition of some additional residues at the carboxyl terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. F(ab')2 antibody fragments were originally generated as pairs of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The Fc fragment contains the carboxyl terminal portions of two heavy chains held together by disulfide bonds. The effector functions of antibodies are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcR) found on certain types of cells. Antigen-binding fragments of heavy chain antibodies include VHH and single-chain heavy chain antibodies.

[0120] Antibodies herein also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0121] The "humanized" form of a non-human (e.g., mouse) antibody refers to a chimeric antibody that minimally contains sequences derived from non-human immunoglobulins. Therefore, a "humanized antibody" generally refers to a non-human antibody in which the variable domain framework region is exchanged with sequences found in human antibodies. Typically, in a humanized antibody, the entire antibody (except for the CDRs) is encoded by a polynucleotide of human origin or is identical to such an antibody (except for the CDRs). The CDRs (some or all of which are encoded by nucleic acids derived from non-human organisms) are transplanted into the β-pleated skeleton of the variable region of a human antibody to produce an antibody whose specificity is determined by the transplanted CDRs. Methods for producing such antibodies are well known in the art, for example, using mice with genetically engineered immune systems.

[0122] A "human antibody" refers to an antibody that has an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human and / or is produced using any of the techniques disclosed herein for producing human antibodies. This definition of a human antibody specifically excludes humanized antibodies that contain non-human antigen-binding residues. Human antibodies can be produced using a variety of techniques known in the art, including phage display libraries. The binding molecules of any embodiment of the present invention are chimeric antibodies or fully human antibodies; preferably, fully human antibodies.

[0123] The term "immune cell" refers to a cell that participates in or is associated with an immune response, examples of which include but are not limited to lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, mast cells, etc. Preferably, the immune cell is, for example, a T cell, a NK cell, a NKT cell, a tumor-infiltrating lymphocyte, and a macrophage. In certain embodiments, the immune cell of the present invention includes a T cell, such as a CD3 + T cells, CD4 + T cells and / or CD8 + T cells.

[0124] The "mesothelin-binding molecule" described herein comprises an anti-mesothelin single-domain antibody, wherein the complementarity determining region (CDR) of the single-domain antibody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3.

[0125] In one or more embodiments, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8X9X 10 X 11 , wherein X1 is G, E, T or A, X2 is S, N, P, A, H, D, K, I or F, X3 is I, S, V, T, D, L, A, M or H, X4 is F, S, I, A, L or G, X5 is N, S, G, A, D, T, E, R or H, X6 is I, L, F, Y, E or N, X7 is N, A, G, D, K, Y, L or S, X8 is A, Y, V, D or N, X9 is E or none, X 10 F or None, X 11 In one or more embodiments, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8, wherein X1 is G, E, T, or A, X2 is S, N, P, A, H, D, K, I, or F, X3 is I, S, V, T, D, L, A, M, or H, X4 is F, S, I, A, L, or G, X5 is N, S, G, A, D, T, E, or H, X6 is I, L, F, Y, or N, X7 is N, A, G, D, K, Y, or S, and X8 is A, Y, V, or N. In one or more embodiments, SEQ ID NO: 1 is GX2X3X4X5X6X7A, wherein X2 is S, N, A, D, I or F, X3 is I, V, T, D, A, L or S, X4 is F, S, I, A or L, X5 is N, S, A, D, E, T or H, X6 is I, F, N or Y, and X7 is N, G, D or Y. Preferably, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8, wherein X1 is G, E, T or A, X2 is S, N, P, H or I, X3 is I, S, T, D, L or A, X4 is F, I or L, X5 is S, T or E, X6 is I, F or Y, X7 is N, A, D or Y, and X8 is A or Y.

[0126] In one or more embodiments, the CDR1 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 4-27, 73. Preferably, the CDR1 comprises the sequence shown in any one of SEQ ID NOs: 5, 11, 14, 15, 17, 21, 27, 73.

[0127] In one or more embodiments, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12, wherein X1 is I, M, A, T or L, X2 is S, G, N, D, T or V, X3 is S, N, A, R, G or T, X4 is S, T, G, D or N, X5 is N, G, T or I, X6 is S, R, N, D, K, T or G, X7 is D, T, S, I or K, X8 is N, T, G, D or none, X9 is T, K, G or none, X 10 G, R or none, X 11 V, T or none, X 12 is T or none. In one or more embodiments, X3 is S, N, A, R or T. In one or more embodiments, SEQ ID NO: 2 is IX2X3X4X5X6X7X8X9, wherein X2 is S, G, N or D, X3 is S, N, A or T, X4 is S, T, G, D or N, X5 is N or G, X6 is S, R, N, D or K, X7 is D, T, S or K, X8 is N, T or none, and X9 is T, K or none. Preferably, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 , wherein X1 is I, A or T, X2 is S, G, N or T, X3 is S or R, X4 is T, G or D, X5 is N, G or T, X6 is S, R, N, K or T, X7 is D, T, S, I or K, X8 is N, G or none, X9 is T, G or none, X 10 G or None, X 11 V or None, X 12 T or None.

[0128] In one or more embodiments, the CDR2 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 28-47, 74. Preferably, the CDR2 comprises the sequence shown in any one of SEQ ID NOs: 29, 35, 37, 38, 39, 43, 40, 74.

[0129] In one or more embodiments, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23, wherein X1 is N, H, A or Q, X2 is L, A, G or V, X3 is S, R, E, G, D or T, X4 is N, A, R, G, D, K, V, T, I, E or Q, X5 is Y, F, K, S, C, I, D, G, H or R, X6 is D, A, V, G, R, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L, E, S or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y or N, X9 is D, G, I, H, S, Y, Q, K, T, R or V, X 10 R, Y, H, N, T, D, P, V, K, C, L or S, X 11 Y, D, E, P, F, S, L, I or none, X 12 P, V, Q, A, Y, F, N, D, R or none, X 13 D, A, Y, V, Q, P or none, X 14 Y, L, P, A, E or none, X 15 C, S, M, P, T or none, X 15 C, S, M, P or none, X 16 V, D, S, Y or none, X 17 L, F, V, D or none, X 18 R, G, M, S or none, X 19 D, N, S or none, X 20 Y, L or none, X 21 Y or None, X 22 A or None, X 23 In one or more embodiments, X1 is N, H, A, or Q, X2 is L, A, G, or V, X3 is S, R, E, G, D, or T, X4 is N, A, R, G, D, K, V, T, I, or Q, X5 is Y, F, K, S, C, I, D, G, H, or R, X6 is D, A, V, G, R, N, P, T, C, Q, or S, X7 is R, Y, T, A, D, K, L, E, S, or G, X8 is K, S, F, T, D, Q, E, G, P, R, Y, or N, X9 is D, G, I, H, S, Y, Q, K, T, or V, X 10 R, Y, H, N, T, D, P, V, K, C or S, X 11 Y, D, E, P, F, S, L or none, X 12 P, V, Q, A, Y, F, N, D or none, X 13 D, A, Y, V, Q or none, X 14 Y, L, P, A, E or none, X 15 C, S, M, P or none, X 16 V, D, S, Y or none, X 17L, F, V, D or none, X 18 R, G, M, S or none, X 19 D, N, S or none, X 20 Y, L or none, X 21 Y or None, X 22 A or None, X 23 In one or more embodiments, SEQ ID NO: 3 is AX2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 , wherein X2 is A, G or V, X3 is S, E, G, D or T, X4 is N, R, D, K, T or I, X5 is Y, F, K, I, D, G, H or R, X6 is D, A, G, N, P, T, C, Q or S, X7 is R, Y, T, A, D, K, L or G, X8 is K, S, F, D, Q, G, P, Y or N, X9 is D, G, I, S, Y, Q, K or V, X 10 R, Y, H, T, D, P, V, K or C, X 11 Y, D, E, F, S, L or none, X 12 P, V, A, Y, F, N, D or none, X 13 D, A, Y, V or none, X 14 Y, P, E or none, X 15 S, P or none, X 16 D, Y or none, X 17 F, D or none, X 18 G, S or none, X 19 N or none. Preferably, SEQ ID NO: 3 is AX2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 , wherein X2 is A or V, X3 is S, E, G or D, X4 is N, R, D or I, X5 is Y, F, K, D or H, X6 is D, G, P, C or S, X7 is R, Y, D, K or L, X8 is K, Q, G or N, X9 is D, S, Y or Q, X 10 R, Y, D, V or S, X11 Y, D, F, S, L or none, X 12 P, F, or none, X 13 D, V or none, X 14 P or None, X 15 S or None, X 16 D or None, X 17 F or None, X 18 G or None, X 19 N or None.

[0130] In one or more embodiments, the CDR3 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 48-72, 75. Preferably, the CDR3 comprises the sequence shown in any one of SEQ ID NOs: 49, 55, 58, 59, 61, 65, 72, 75.

[0131] In one or more embodiments, the CDR1 of the anti-mesothelin single-domain antibody comprises a sequence as shown in any one of SEQ ID NOs: 4-27, 73, the CDR2 comprises a sequence as shown in any one of SEQ ID NOs: 28-47, 74, and the CDR3 comprises a sequence as shown in any one of SEQ ID NOs: 48-72, 75. Preferably, the anti-mesothelin single-domain antibody comprises a CDR1, CDR2, and CDR3 as shown in any one of the following groups a1 to a26:

[0132] In one or more embodiments, the FR1 of the anti-mesothelin single domain antibody can be selected from the FR1 of the VHH of each antibody number in Table A, the FR2 of the VHH can be selected from the FR2 of the VHH of each antibody number in Table 1, the FR3 of the VHH can be selected from the FR3 of the VHH of each antibody number in Table 1, and the FR4 of the VHH can be selected from the FR4 of the VHH of each antibody number in Table 1. In one or more embodiments, the FR region of the anti-mesothelin single domain antibody is the FR region of any one VHH selected from SEQ ID NOs: 76-120.

[0133] In one or more embodiments, the anti-mesothelin single-domain antibody is represented by any one of SEQ ID NOs: 76 to 120. Preferably, the single-domain antibody is represented by any one of SEQ ID NOs: 77, 83, 85, 86, 87, 89, 93, 100, and 103.

[0134] The mesothelin-binding molecules described herein are monovalent or multivalent single-domain antibodies, multispecific single-domain antibodies, heavy chain antibodies or antigen-binding fragments thereof, antibodies or antigen-binding fragments thereof comprising one, two or more anti-mesothelin single-domain antibodies described herein. The multivalent single-domain antibody or multispecific single-domain antibody connects multiple single-domain antibodies via a linker. The linker is composed of 1-15 amino acids selected from G and S. The heavy chain antibody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody. The antigen-binding fragment of the heavy chain antibody is a single-chain heavy chain antibody. The heavy chain antibody further comprises a heavy chain constant region. In one or more embodiments, the heavy chain constant region is the constant region of a camel heavy chain antibody, comprising CH2 and CH3. In one or more embodiments, the CH2 and CH3 are the CH2 and CH3 of a human IgG Fc, such as the CH2 and CH3 of an IgG4.

[0135] The mesothelin-binding molecules and anti-mesothelin single-domain antibodies mentioned herein include all mesothelin-binding molecules and anti-mesothelin single-domain antibodies described in CN202011584014 or CN202011582948, the entire text of the above patent applications is incorporated herein by reference specifically and individually to each embodiment thereof.

[0136] The optional signal peptide on the CAR can be selected as needed. For example, a CD8 signal peptide, a CD28 signal peptide, a CD4 signal peptide or a light chain signal peptide, the sequence of which is within the knowledge of those skilled in the art. The CD8 signal peptide suitable for the present invention can be various human CD8 signal peptide sequences commonly used in CAR in the art. In certain embodiments, the amino acid sequence of the human CD8 signal peptide can be as shown in amino acids 1-22 of SEQ ID NO: 121.

[0137] The hinge region of the CAR is selected from a CD8 α hinge region, an IgD hinge region, an IgG1 Fc CH2CH3 hinge region, or an IgG4 Fc CH2CH3 hinge region, and its sequence is within the knowledge of those skilled in the art. The CD8 hinge region suitable for use in the present invention can be various human CD8 hinge region sequences commonly used in CARs in the art. In certain embodiments, the amino acid sequence of the human CD8 hinge region can be as shown in SEQ ID NO: 121, amino acids 149-203.

[0138] The transmembrane region of CAR is selected from one of the CD28 transmembrane region, CD8 transmembrane region, CD3ζ transmembrane region, CD134 transmembrane region, CD137 transmembrane region, ICOS transmembrane region and DAP10 transmembrane region; preferably the CD28 transmembrane region, the sequence of which is within the knowledge of those skilled in the art. The human CD28 transmembrane region suitable for the present invention can be various human CD28 transmembrane region sequences commonly used in CAR in the art. In certain embodiments, the amino acid sequence of the human CD28 transmembrane region is as shown in SEQ ID NO: 121, amino acids 204-231.

[0139] Suitable intracellular costimulatory domains can be selected as needed, including intracellular domains with costimulatory signal molecules, such as CD28, CD134 / OX40, CD137 / 4-1BB, lymphocyte-specific protein tyrosine kinase, inducible T cell costimulatory factor (ICOS) and DNAX activation protein 10. The human CD28 costimulatory domain suitable for the present invention can be various human CD28 costimulatory domain sequences commonly used in CAR in the art. In certain embodiments, the amino acid sequence of the CD28 costimulatory domain is as shown in the amino acid sequence of positions 231-272 of SEQ ID NO: 121.

[0140] Similarly, the intracellular signaling domain of CAR can be selected as needed, including but not limited to the CD3ζ intracellular signaling domain or the FcεRIγ intracellular signaling domain. The CD3ζ intracellular signaling domain suitable for the present invention can be various CD3ζ intracellular signaling domains for CAR known in the art. In certain embodiments, the amino acid sequence of the CD3ζ intracellular signaling domain is as shown in the amino acid sequence of positions 273-384 of SEQ ID NO: 121.

[0141] The above-mentioned parts that form the chimeric antigen receptor of the present invention, such as the CD8 signal peptide, anti-MSLN nanobody, CD8 hinge region, CD28 transmembrane region, CD28 costimulatory domain, CD3ζ intracellular signaling domain, etc., can be directly connected to each other, or can be connected through a linker sequence. The linker sequence can be a linker sequence suitable for antibodies well known in the art, such as a linker sequence containing G and S. Typically, the linker contains one or more repeated motifs. For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motif is adjacent in the linker sequence, and no amino acid residues are inserted between the repeats. The linker sequence can be composed of 1, 2, 3, 4 or 5 repeated motifs. The length of the linker can be 3 to 25 amino acid residues, for example 3 to 15, 5 to 15, or 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycine residues in the linker sequence is not particularly limited and is generally 2 to 20, for example, 2 to 15, 2 to 10, or 2 to 8. In addition to glycine and serine, the linker may also contain other known amino acid residues, such as alanine (A), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), and glutamine (Q). For example, the linker may be composed of any of the amino acid sequences in SEQ ID NOs: 7-18. In certain embodiments, the linker sequence is (GGGGS)n, where n is an integer from 1 to 5.

[0142] In an exemplary embodiment, CAR contains a CD8 signal peptide, an anti-MSLN nanobody, a CD8 hinge region, a CD28 transmembrane region, a CD28 costimulatory domain, and a CD3ζ intracellular signaling domain from the N-terminus to the C-terminus. In a specific embodiment, an exemplary CAR having the above structure is shown in any one of SEQ ID NOs: 121-123. In certain embodiments, the amino acid sequence of the CAR of the present invention is shown in SEQ ID NO: 121 amino acids 23-384 or in SEQ ID NO: 122 amino acids 23-377 or in SEQ ID NO: 123 amino acids 23-378.

[0143] It should be understood that in gene cloning operations, it is often necessary to design suitable enzyme cleavage sites, which inevitably introduce one or more irrelevant residues at the end of the expressed amino acid sequence, but this does not affect the activity of the target sequence. In order to construct a fusion protein, promote the expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside the host cell, or facilitate the purification of the recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus or other suitable regions within the protein of the recombinant protein, for example, including but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, etc. Therefore, the amino or carboxyl terminus of the CAR of the present invention may also contain one or more polypeptide fragments as protein tags. Any suitable tag can be used herein. For example, the tag can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE and Ty1. These tags can be used to purify the protein.

[0144] The present invention also includes mutants of the CAR described in any embodiment. These mutants include: an amino acid sequence having at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity with the CAR and retaining the biological activity of the CAR (such as activated T cells). The sequence identity between the two aligned sequences can be calculated using, for example, NCBI's BLASTp.

[0145] Mutants also include: amino acid sequences having one or more mutations (insertions, deletions, or substitutions) in the amino acid sequence of the CAR described in any embodiment, while still retaining the biological activity of the CAR. The several mutations generally refer to within 1-10, for example, 1-8, 1-5, or 1-3. The substitution is preferably a conservative substitution. For example, in the art, when conservative substitutions are made with amino acids with similar or similar properties, the function of the protein or polypeptide is generally not changed. "Amino acids with similar or similar properties" include, for example, families of amino acid residues with similar side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, replacing one or more sites in a polypeptide of the present invention with another amino acid residue from the same side chain class will not substantially affect its activity.

[0146] The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand. The present invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences that encode the same amino acid sequence but differ in nucleotide sequence.

[0147] The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates to obtain the relevant sequences. Long sequences often require two or more PCR amplifications, followed by splicing the fragments amplified from each amplification into the correct order.

[0148] The present invention also relates to nucleic acid constructs. The term "nucleic acid construct" or "polynucleotide construct" refers to one or more single-stranded or double-stranded nucleic acid molecules that are isolated from naturally occurring genes or modified to contain nucleic acid fragments in a manner that does not exist in nature. The term "nucleic acid molecule" mainly refers to a physical nucleic acid molecule, and the term "nucleic acid sequence" mainly refers to a nucleotide sequence on a nucleic acid molecule, but the two terms are used interchangeably, especially with respect to nucleic acid molecules, or nucleic acid sequences, that can encode proteins or protein domains. The nucleic acid construct contains the polynucleotide sequences described herein, and one or more regulatory sequences operably linked to these sequences. The polynucleotide sequences described in the present invention can be manipulated in a variety of ways to ensure the expression of the CAR. Before the nucleic acid construct is inserted into the vector, the nucleic acid construct can be manipulated according to the different or required expression vectors. The technology of using recombinant DNA methods to change polynucleotide sequences is known in the art.

[0149] The regulatory sequence can be a suitable promoter sequence. The promoter sequence is usually operably linked to the coding sequence of the protein to be expressed. The promoter can be any nucleotide sequence that shows transcriptional activity in the selected host cell, including mutant, truncated and hybrid promoters, and can be obtained from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to the host cell. The regulatory sequence can also be a suitable transcription terminator sequence, a sequence recognized by the host cell to terminate transcription. The terminator sequence is operably linked to the 3' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the selected host cell can be used in the present invention. The regulatory sequence can also be a suitable leader sequence, an untranslated region of an mRNA that is important for host cell translation. The leader sequence is operably linked to the 5' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the selected host cell can be used in the present invention.

[0150] In some embodiments of the present invention, the nucleic acid construct further comprises a coding sequence for a PD-1 binding molecule. PD-1 binding molecules include, but are not limited to, PD-1 antibodies or antigen-binding fragments thereof, PD-1 heavy chain antibodies or antigen-binding fragments thereof, monovalent or multivalent single-domain antibodies comprising one, two or more PD-1 single-domain antibodies, and multispecific single-domain antibodies. The PD-1 binding molecules and anti-PD-1 single-domain antibodies mentioned herein respectively include all PD-1 binding molecules and all anti-PD-1 single-domain antibodies described in CN202011582908, and the full text of this patent application is incorporated herein by reference specifically and individually to each embodiment thereof. As described in this patent application, the PD-1 binding molecule is a monovalent or multivalent single-domain antibody, multispecific single-domain antibody, heavy chain antibody or antigen-binding fragment thereof, antibody or antigen-binding fragment thereof comprising one, two or more of the PD-1 single-domain antibodies.

[0151] Therefore, the complementarity determining regions (CDRs) of the anti-PD-1 single domain antibodies described herein comprise CDR1, CDR2, and CDR3, wherein CDR1, CDR2, and CDR3 comprise the sequences set forth in SEQ ID NOs: 1, 2, and 3, respectively, of CN202011582908. For example, in the anti-PD-1 single domain antibodies described herein, CDR1 comprises the sequence set forth in any one of SEQ ID NOs: 4-39 and 320 of CN202011582908; CDR2 comprises the sequence set forth in any one of SEQ ID NOs: 40-75 of CN202011582908; and CDR3 comprises the sequence set forth in any one of SEQ ID NOs: 76-183 of CN202011582908. In one or more embodiments, the anti-PD-1 single domain antibodies described herein comprise CDR1, CDR2, and CDR3 set forth in any one of Groups a1 to a136 of CN202011582908. The anti-PD-1 single domain antibody VHH described herein may be as shown in any one of SEQ ID NOs: 184-319 in CN202011582908. Preferably, the anti-PD-1 single domain antibody described herein is as shown in any one of SEQ ID NOs: 197, 200, 223-309 in CN202011582908. In addition, each CDR or full length of the anti-PD-1 single domain antibody described herein may be as described in any embodiment of CN202011582908.

[0152] Illustratively, the CDR1 of the anti-PD-1 single domain antibody is shown in SEQ ID NO: 124 or 128, the CDR2 is shown in SEQ ID NO: 125 or 129, and the CDR3 is shown in SEQ ID NO: 126 or 130; the sequence of the anti-PD-1 single domain antibody VHH is shown in SEQ ID NO: 127 or 131.

[0153] The PD-1 binding molecules described herein can be monovalent or multivalent single-domain antibodies, multispecific single-domain antibodies, heavy chain antibodies or antigen-binding fragments thereof, antibodies or antigen-binding fragments thereof comprising one, two, or more anti-PD-1 single-domain antibodies described herein. The multivalent single-domain antibody or multispecific single-domain antibody connects multiple single-domain antibodies via a linker. The linker is composed of 1-15 amino acids selected from G and S. Herein, the heavy chain antibody is a camel heavy chain antibody or a cartilaginous fish heavy chain antibody. The antigen-binding fragment of the heavy chain antibody is a single-chain heavy chain antibody. The heavy chain antibody further comprises a heavy chain constant region. In one or more embodiments, the heavy chain constant region is the constant region of a camel heavy chain antibody, comprising CH2 and CH3. In one or more embodiments, the CH2 and CH3 are the CH2 and CH3 of human IgG Fc, such as the CH2 and CH3 of IgG4.

[0154] Therefore, in one or more embodiments, the nucleic acid construct comprises the coding sequences of the CAR and the PD-1 binding molecule. In one or more embodiments, the nucleic acid construct comprises an expression cassette for the chimeric antigen receptor and an expression cassette for the PD-1 binding molecule. The two expression cassettes are contained in one or two vectors. Alternatively, the nucleic acid construct is an expression cassette, wherein the coding sequence of the chimeric antigen receptor and the coding sequence of the PD-1 binding molecule are in the expression cassette.

[0155] In certain embodiments, the nucleic acid construct is a vector. The term "vector" can transfer a gene sequence to a target cell. Generally, "vector construct," "expression vector," and "gene transfer vector" mean any nucleic acid construct that can direct the expression of a gene of interest and can transfer a gene sequence to a target cell, which can be achieved by genome integration of the entire or partial vector, or by transient or heritable maintenance of the vector as an extrachromosomal element. Therefore, the term includes cloning vectors, expression vectors, and integration vectors. Typically, the polynucleotide sequence of the present invention is operably connected to a promoter, and the construct is incorporated into an expression vector to achieve expression of the polynucleotide sequence of the present invention. The vector can be suitable for replicating and integrating eukaryotic cells. Typical cloning vectors include transcription and translation terminators, initiation sequences, and promoters that can be used to regulate the expression of the desired nucleic acid sequence. The nucleic acid construct can be one or more vectors, each of which includes one or two or three expression cassettes described in any one of the embodiments herein.

[0156] The polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, they can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector can be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses and lentiviruses.

[0157] Typically, suitable vectors contain an origin of replication functional in at least one organism, a promoter sequence, convenient restriction enzyme sites, and one or more selectable markers (eg, WO 01 / 96584; WO 01 / 29058; and US Pat. No. 6,326,193).

[0158] The nucleic acid construct may be a cloning vector or an expression vector. The expression vector is preferably a constitutive expression vector, such as a transposition vector (or "transposon vector"). In certain embodiments, the transposon vector is a eukaryotic expression vector containing a transposable element selected from piggybac, sleeping beauty, frog prince, Tn5 or Ty. This type of transposon vector contains the 5' inverted terminal repeat (5'ITR) of the corresponding transposon and the 3' inverted terminal repeat (3'ITR) of the corresponding transposon. Therefore, in some embodiments of the present invention, the nucleic acid construct further comprises a coding sequence for a transposase, which is used to transpose the coding sequence of the chimeric antigen receptor and / or PD-1 binding molecule, for example, integrating the coding sequence or expression cassette of the chimeric antigen receptor and / or PD-1 binding molecule into the genome. The transposase may be any transposase known in the art suitable for human cells, for example, a transposase from the piggybac, sleeping beauty, frog prince, Tn5 or Ty transposition system. When using transposases from different transposition systems, the sequences of the 5'ITR and 3'ITR in the vector are also changed accordingly to sequences compatible with the transposition system, which can be easily determined by those skilled in the art. The expression cassette of the CAR or antibody of the present invention is contained between the 5'ITR and 3'ITR, including the corresponding promoter sequence, the coding sequence of the CAR or antibody, and the polyA tailing signal sequence. An exemplary transposase is a PBase. In certain embodiments, the 5' inverted terminal repeat sequence of the transposon is shown in SEQ ID NO: 1 of CN105154473A (the contents of which are incorporated herein by reference). In certain embodiments, the 3' inverted terminal repeat sequence of the transposon is shown in SEQ ID NO: 4 of CN105154473A. In certain embodiments, the piggybac transposase is a transposase containing a c-myc nuclear localization signal coding sequence. In certain embodiments, the coding sequence of the piggybac transposase is shown in SEQ ID NO: 5 of CN 201510638974.7. Exemplary vector backbones are pNB338B and pS338B described in CN111206043A and CN114729361A.

[0159] Therefore, in one or more embodiments, the nucleic acid construct comprises the coding sequence of CAR and transposase. In one or more embodiments, the nucleic acid construct contains the expression cassette of the chimeric antigen receptor and the expression cassette of the transposase. The two expression cassettes are contained in one or two vectors. Alternatively, the nucleic acid construct is an expression cassette, wherein the coding sequence of the chimeric antigen receptor and the coding sequence of the transposase are in the expression cassette.

[0160] In some cases, the nucleic acid construct described herein comprises the coding sequences of CAR, transposase and PD-1 binding molecule. The nucleic acid construct may contain three expression cassettes, namely the expression cassette of the chimeric antigen receptor, the expression cassette of the transposase and the expression cassette of the PD-1 binding molecule; the three expression cassettes may be contained in one, two or three vectors. Alternatively, the nucleic acid construct contains two expression cassettes, one of which comprises the coding sequence of the chimeric antigen receptor, the coding sequence of the transposase and the coding sequence of the PD-1 binding molecule, and the other comprises the remaining coding sequences; the two expression cassettes may be contained in one or two vectors; or, the nucleic acid construct contains an expression cassette, wherein the coding sequence of the chimeric antigen receptor, the expression cassette of the transposase and the coding sequence of the PD-1 binding molecule are in the expression cassette.

[0161] In one or more embodiments, the nucleic acid construct comprises: one vector comprising (a) an expression cassette for a CAR and optionally (b) an expression cassette for a transposase and / or an expression cassette for a PD-1 binding molecule; two vectors, wherein the two vectors (a) respectively comprise an expression cassette for a CAR and an expression cassette for a PD-1 binding molecule, optionally, either of the two vectors further comprises an expression cassette for a transposase, or (b) one comprises an expression cassette for a transposase and the other comprises an expression cassette for a CAR and an expression cassette for a PD-1 binding molecule; or three vectors comprising an expression cassette for a CAR, an expression cassette for a PD-1 binding molecule, and an expression cassette for a transposase, respectively.

[0162] An example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive any polynucleotide sequence high-level expression that can be operably connected thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). Another example of a suitable promoter is the promoter driven by IFNγ. However, other constitutive promoter sequences can also be used, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter and human gene promoter, such as but not limited to actin promoter, myosin promoter, heme promoter and creatine kinase promoter. Further, it is also contemplated to use an inducible promoter. The use of an inducible promoter provides a molecular switch that can turn on expression of a polynucleotide sequence operably linked to the inducible promoter when expression is desired, and turn off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0163] In order to evaluate the expression of the CAR polypeptide or its portion, the expression vector introduced into the cell may also include any one or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a cell population that is sought to be transfected or infected by a viral vector. In other aspects, selectable markers can be carried on a single DNA segment and used for co-transfection procedures. Both selectable markers and reporter genes may be flanked by appropriate regulatory sequences to enable expression in host cells. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

[0164] The reporter gene is used to identify the cells of potential transfection and to evaluate the functionality of the regulatory sequence. After DNA has been introduced into the recipient cells, the expression of the reporter gene is measured at the appropriate time. Suitable reporter genes can include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase or green fluorescent protein genes. Suitable expression systems are known and can utilize known technology to prepare or commercially obtain.

[0165] Methods for introducing genes into cells and expressing genes in cells are known in the art. Vectors can be easily introduced into host cells, for example, mammalian, bacterial, yeast, or insect cells, by any method known in the art. For example, expression vectors can be transferred into host cells by physical, chemical, or biological means.

[0166] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0167] T cells suitable for the present invention can be various types of T cells from various sources. For example, T cells can be derived from PBMCs of tumor patients. In certain embodiments, after obtaining T cells, they can be first stimulated and activated with an appropriate amount (e.g., 30-80 ng / ml, such as 50 ng / ml) of CD3 antibody, and then cultured in a medium containing an appropriate amount (e.g., 30-80 IU / ml, such as 50 IU / ml) of IL-2 for further use.

[0168] Therefore, in certain embodiments, the present invention provides a genetically modified T cell, the genetically modified T cell containing a polynucleotide sequence as described herein, or containing a nucleic acid construct as described herein, or prepared using the method described herein, or stably expressing CAR as described herein and optional anti-PD-1 binding molecules. The cells described herein (e.g., T cells) may further include or express a transposase or its coding sequence.

[0169] The CAR-T cells of the present invention can undergo robust in vivo T cell expansion and persist at high levels in the blood and bone marrow for an extended period of time, and form specific memory T cells. Without wishing to be bound by any particular theory, upon encountering and subsequently eliminating target cells expressing alternative antigens, the CAR-T cells of the present invention can differentiate into a central memory-like state in vivo.

[0170] The present invention also includes a type of cell therapy in which T cells are genetically modified to express a CAR described herein and optionally an anti-PD-1 binding molecule, and the CAR-T cells are infused into a recipient in need thereof. The infused cells are capable of killing the recipient's tumor cells. Unlike antibody therapies, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

[0171] The anti-tumor immune response elicited by CAR-T cells can be an active or passive immune response. In addition, the CAR-mediated immune response can be part of an adoptive immunotherapy procedure, in which the CAR-T cells induce an immune response specific for the antigen-binding portion of the CAR.

[0172] Therefore, the disease that can be treated with the CAR, its coding sequence, nucleic acid construct, expression vector, and CAR-T cell of the present invention is preferably mesothelin-mediated cancer. Preferably, the disease also benefits from anti-PD-1 antibody therapy and is PD-1-mediated cancer.

[0173] Specifically, herein, "mesothelin-mediated cancers" include, among others, various types of ovarian cancer, pleural mesothelioma (such as epithelial mesothelioma), pancreatic cancer, and squamous cell carcinoma of the cervix, endometrium, head, neck, vagina, lung, and esophagus. In certain embodiments, the mesothelin-mediated disease is malignant pleural mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, and lung adenocarcinoma. Diseases that "benefit from anti-PD-1 antibody therapy" or "PD-1-mediated cancers" include gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, and the like.

[0174] The CAR-modified T cells of the present invention can be administered alone or as a pharmaceutical composition in combination with a diluent and / or with other components such as related cytokines or cell groups. Briefly, the pharmaceutical composition of the present invention may include CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable adjuvants (e.g., carriers, diluents, or excipients). Such compositions may include buffers such as neutral buffered saline, sulfate-buffered saline, etc.; carbohydrates such as glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.

[0175] In some embodiments, the pharmaceutical composition comprises the CAR-T cells described in any embodiment herein and excipients.

[0176] In some embodiments, excipients in the pharmaceutical composition include diluents and cryoprotectants.

[0177] The diluent preferably maintains the pH, osmotic pressure, and other balances of the pharmaceutical composition while performing a diluting effect. For example, the diluent may be selected from one or more of compound electrolyte injection, 0.9% NaCl injection, and sodium lactate Ringer's injection. The concentration of the diluent in the pharmaceutical composition may be 40-80% v / v, preferably 60-70% v / v.

[0178] The ingredients of the compound electrolyte injection are well known in the art and may include sodium chloride, sodium gluconate, sodium acetate, potassium chloride, magnesium chloride, etc.

[0179] Cryoprotectants can prevent cell damage during cryopreservation of the pharmaceutical composition, and can be selected from, for example, one or more of dextran glucose injection, human albumin solution, dimethyl sulfoxide, ethylene glycol, trehalose, sucrose, glucose, and the like. The concentration of the cryoprotectant in the pharmaceutical composition can be 20-60% v / v, preferably 30-40% v / v.

[0180] Dextran is also known as dextran. Specific models of dextran include dextran-40 (also known as dextran 40, Dextran-40) and dextran-70 (also known as dextran 70, Dextran-70). Preferably, the dextran is dextran-40.

[0181] The human albumin solution is, for example, a human albumin injection, the ingredients of which are well known in the art and may include human albumin and optional other excipients (e.g., sodium octanoate, acetyltryptophan, sterile water for injection, etc.). In the human albumin solution, the concentration of human albumin is generally in the range of 5-25% (w / v). For example, human albumin injection can be used in different specifications, such as 2g (albumin concentration 5%), 40ml / bottle; 5g (20%), 25ml / bottle; 5g (10%), 50ml / bottle; 10g (20%), 50ml / bottle, etc.; 12.5g (25%), 50ml / bottle, etc. In some embodiments, the human albumin solution is 25% human albumin (i.e., the concentration of human albumin is 5-25% w / v).

[0182] In some embodiments, the cryoprotectant includes dextran glucose injection, human serum albumin solution, and dimethyl sulfoxide.

[0183] In some embodiments, the excipients include: 40-80% v / v compound electrolyte injection, 5-20% v / v dextran 40 glucose injection, 10-30% v / v human albumin solution (25% human albumin), and 5-10% v / v dimethyl sulfoxide. The human albumin solution may also be selected from other concentrations of human albumin, and its concentration in the excipients can be adjusted accordingly. In some embodiments, the excipients include: 60-70% v / v compound electrolyte injection, 5-15% v / v dextran 40 glucose injection, 15-25% v / v human albumin solution (25% human albumin), and 5-10% v / v dimethyl sulfoxide. In some embodiments, the excipients include: 65% v / v compound electrolyte injection, 10% v / v dextran 40 glucose injection, 20% v / v human albumin solution (25% human albumin) and 5% v / v dimethyl sulfoxide.

[0184] In some embodiments, the excipients may also include vitamins. Adding vitamins can further enhance the survival rate and proliferation of cells after recovery. Preferably, the vitamins include (but are not limited to): vitamin A, vitamin B, vitamin C, vitamin D, vitamin E, vitamin K, or a combination thereof. More preferably, the vitamin is vitamin C. Preferably, the concentration of the vitamins in the pharmaceutical composition is 1-20 mg / ml, preferably 1-15 mg / ml, and even more preferably 5-10 mg / ml.

[0185] In a preferred embodiment, the excipients include the following components in percentage by volume and concentration:

[0186] Preferably, the excipient includes the following components in the following concentrations:

[0187] More preferably, the excipient comprises the following components in the following concentrations:

[0188] In another preferred embodiment, the weight ratio of sodium chloride, sodium gluconate, sodium acetate, potassium chloride and magnesium chloride is (4.5-5.5): (4.5-5.5): (3.2-4.2): (0.32-0.42): (0.26-0.34).

[0189] In another preferred embodiment, the ratio of human serum albumin to dimethyl sulfoxide is (45-65 mg): (0.05-0.075 ml), preferably (37.5-45 mg): (0.05-0.055 ml).

[0190] In another preferred embodiment, the weight ratio of human serum albumin to dimethyl sulfoxide is 400-1000:1, preferably 680-900:1.

[0191] In another preferred embodiment, the weight ratio of human serum albumin to dextran is 3-12:1, preferably 4-10:1, and more preferably 5.5-7.5:1.

[0192] In another preferred embodiment, the weight ratio of dextran to glucose is 0.8-1.6, preferably 1.0-1.5.

[0193] In another preferred embodiment, the weight ratio of glucose to sodium chloride is 0.5-6:1, preferably 0.6-5:1.

[0194] In another preferred embodiment, the water is purified water or water for injection.

[0195] In some embodiments, the amount of CAR-T cells in the pharmaceutical composition can be adjusted according to the target dose (i.e., the number of CAR-T cells per kg of patient body weight). In some embodiments, the amount of CAR-T cells can be 0.5×10 6 ~2×10 8 / mL, for example 0.5×10 6 / mL, 1×10 6 / mL, 2×10 6 / mL, 3×10 6 / mL, 4×10 6 / mL, 5×10 6 / mL, 6×10 6 / mL, 7×10 6 / mL, 8×10 6 / mL, 9×10 6 / mL, 1×107 / mL, 2×10 7 / mL, 3×10 7 / mL, 4×10 7 / mL, 5×10 7 / mL, 6×10 7 / mL, 7×10 7 / mL, 8×10 7 / mL, 9×10 7 / mL, 1×10 8 / mL, 2×10 8 / mL, preferably 1×10 6 ~1×10 8 / mL, more preferably 5×10 6 ~2×10 7 pieces / mL.

[0196] In some embodiments, the pharmaceutical composition can be obtained by mixing the prepared CAR-T cells with excipients. The CAR-T cell stock solution preparation process is divided into four steps: sorting process, activation process, electroporation process, and culture process. The sorting process can be a single blood collection, washed, and then CD3 + T cells, CD3 antibody / 4-1bbL protein as the first / second activation signal to activate CD3 + T cells are activated and then gene transduced by electroporation. After transduction, they are cultured and expanded, and the infusion dose is reached and centrifuged to obtain the prepared CAR-T cells (total viable cells). The density of the total viable cells in the pharmaceutical composition can be adjusted according to the target dose of CAR-T cells administered to the patient. In some embodiments, the density of viable cells in the pharmaceutical composition = (patient weight × target dose × loss multiple) ÷ CAR-positive cell ratio ÷ pharmaceutical composition volume. The loss multiple refers to the loss of cells during the preparation process and / or cryopreservation recovery of the pharmaceutical composition. Therefore, when preparing the composition, the target amount is multiplied by the loss multiple, for example, 1-1.5, for example, 1, 1.1, 1.2, 1.3, 1.4, 1.5. The proportion of CAR-positive cells can be detected by conventional methods in the art, such as flow cytometry.

[0197] In some embodiments, the CAR-T cells herein are prepared from a single blood draw from a single individual through a single process, and the specifications of all subpackages prepared from a single batch are the same as the batch size produced in this batch. Due to individual differences in patients, the CD3 + There are differences in the number of T cells and the proliferation of CAR-T cells during culture. The number of viable cells and CD3 +MSLN CAR + The T cell ratio is also different, and the amount of freezing solution (excipients) added during the final preparation process is not consistent, so the batch size of each aPD1-MSLN-CAR T cell production is inconsistent.

[0198] In some embodiments, the final formulation (pharmaceutical composition) is calculated based on the patient's weight to calculate the number of CAR-T positive cells required for each transfusion. The transfusion volume is 25 mL. The formula for calculating the viable cell density of the formulation filling is as follows: Viable cell density of the formulation filling = (patient weight × target dose × 1.2 times) ÷ CD3 + MSLN CAR + Calculate the T cell ratio by 25 mL and fill the bag at 1.2 times the target dose. Add the corresponding volume of freezing solution and fill each bag at 25 mL.

[0199] In some embodiments, the dose is 1×10 6 ~2×10 7 CAR-positive T cells / kg patient weight, for example, 5×10 6 CAR positive T cells / kg patient weight. The production batch size can be 2 to 16 bags. If calculated based on 16 bags, the CD3 + The number of CAR-T cells was 2.64×10 9 ~7.68×10 9 The patient's weight is expected to be 33 kg to 96 kg, and the number of CAR-T positive cells per bag is 1.65 × 10 8 ~4.80×10 8 indivual.

[0200] CD3 + MSLN CAR + The proportion of T cells can be detected by conventional methods in the art, such as flow cytometry.

[0201] The present invention also provides a use of the pharmaceutical composition described in any embodiment herein in the preparation of a medicament or kit for treating cancer, the pharmaceutical composition comprising the CAR-T cells described in any embodiment herein and excipients, the excipients comprising a diluent and a cryoprotectant. The cancer is a cancer associated with mesothelin expression, preferably one or more selected from mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma.

[0202] The pharmaceutical composition of the present invention can be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by factors such as the patient's condition, and the type and severity of the patient's disease.

[0203] When an "immunologically effective amount," "anti-tumor effective amount," "tumor-inhibitory effective amount," or "therapeutic amount" is indicated, the precise amount of the composition of the present invention to be administered can be determined by a physician, who takes into account individual differences in the patient's (subject's) age, weight, tumor size, degree of infection or metastasis, and condition. It can be generally stated that a pharmaceutical composition comprising the T cells described herein can be administered in an amount of 10 4 to 10 9 The dose of cells / kg body weight is preferably 10 5 to 10 6 The T cell composition can be administered multiple times at these doses. The cells can be administered using infusion techniques well known in immunotherapy (see, for example, Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dosage and treatment regimen for a particular patient can be readily determined by one skilled in the medical field by monitoring the patient for signs of disease and adjusting treatment accordingly.

[0204] Provided herein are methods of treating or preventing cancer, comprising administering to a patient in need thereof the cells or pharmaceutical composition described in any embodiment herein, thereby delivering a dose of the cells to the patient.

[0205] In some embodiments, the patient meets the following conditions: tumor tissue cells positively express mesothelin, preferably mesothelin expression is greater than 50%. Optionally, the patient also meets any one or more of the following conditions:

[0206] (1) The patient has positive expression of PD-L1,

[0207] (2) The patient is diagnosed with one or more of malignant pleural or peritoneal mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma;

[0208] (3) The patient has received standard therapy and the treatment has failed.

[0209] Further optionally, the patient also meets any one or more of the following conditions:

[0210] (4) The patient's age is between 18 and 70 years old,

[0211] (5) Expected survival time > 3 months,

[0212] (6) ECOG score of 0 or 1.

[0213] In some embodiments, the pharmaceutical composition can be prepared some time before administration to the patient (e.g., 15 to 30 days). After preparation, the pharmaceutical composition can be frozen (e.g., stored below -120°C) and resuscitated when needed so that the pharmaceutical composition can be infused when the patient is ready.

[0214] In some embodiments, a pharmaceutical composition according to any embodiment of the present invention is administered to a patient in need thereof, thereby delivering a dose of CAR-T cells to the patient. The dose may be 0.5×10 6 ~2×10 8 CAR-T cells / kg patient weight, for example 0.5×10 6 , 1×10 6 , 2×10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 , 7×10 6 , 8×10 6 , 9×10 6 , 1×10 7 , 1.5×10 7 , 2×10 7 , 3×10 7 , 4×10 7 , 5×10 7 , 6× 10 7 , 7×10 7 , 8×10 7 , 9×10 7 , 1×10 8 , 2×10 8 CAR-T cells / kg patient body weight. In a preferred embodiment, the dose is 1×10 6 ~2×10 7 CAR-T cells / kg patient weight, more preferably 5×10 6 ~2×10 7 CAR-T cells / kg patient body weight.

[0215] Administration of the pharmaceutical composition can be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to the patient subcutaneously, intradermally, intratumorally, intranodally, intraspinal, intramuscularly, by intravenous injection or intraperitoneally. In one embodiment, the pharmaceutical composition of the present invention is administered to the patient by intradermal or subcutaneous injection. In another embodiment, the pharmaceutical composition of the present invention is preferably administered by intravenous injection. The pharmaceutical composition can be injected directly into the tumor, lymph node or infection site.

[0216] In some embodiments, the treatment method comprises administering a single dose of the pharmaceutical composition to the patient, or administering the pharmaceutical composition multiple times. Optionally, the multiple administrations may be administered in an ascending dose or equal dose mode. The dosing interval may be selected based on actual conditions, preferably being at least 7 days, for example, 7 to 28 days. The number of administrations may be 1 to 3 times.

[0217] A period of time before administration of the pharmaceutical composition (e.g., 5-7 days before administration) may be preceded by a lymphocyte depletion regimen. In some embodiments, the lymphocyte depletion regimen comprises administering cyclophosphamide and / or fludarabine to the patient, e.g., administering 300 mg / m2 of cyclophosphamide to the patient. 2 / day and fludarabine 30 mg / m 2 / day for three days.

[0218] In some embodiments of the present invention, the CAR-T cells or compositions thereof of the present invention may be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiotherapy, and immunosuppressive agents. For example, treatment may be combined with radiotherapy or chemotherapy agents known in the art for treating mesothelin-mediated diseases.

[0219] As used herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

[0220] "Patient," "subject," "individual," and the like are used interchangeably herein to refer to a living organism, such as a mammal, in which an immune response can be elicited. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

[0221] The present invention is further described in detail with reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, the present invention should in no way be construed as being limited to the following examples, but rather should be construed to include any and all variations that become apparent as a result of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise stated, conventional methods and reagents in the art.

[0222] Example

[0223] Clinical trial design

[0224] This study is a phase I, open-label, single-arm, multicenter clinical trial. The inclusion criteria are as follows: (1) age 18 to 70 years; (2) diagnosed with one or more of the following: pleural or peritoneal mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma, and failed standard treatment; (3) at least one measurable lesion; 4) MSLN expression ≥50% and PD-L1 positivity assessed by IHC; 5) expected survival time >3 months; (6) Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1; and (7) major organ function meets the requirements. Exclusion criteria included: (1) disease progression after previous treatment with the same targeted CAR-T therapy; (2) HBS, HCB, or HIV-positive patients; (3) active autoimmune diseases requiring immunosuppressive therapy; (4) active serious infections; (5) history of other malignancies; and (6) ineligibility or lack of ability to comply with the study.

[0225] As shown in Figures 1 and 2, 11 patients with malignant peritoneal mesothelioma (MPM) (numbered BZ-01 to BZ-11) and 2 patients with cervical cancer (CC) (numbered BZ-12 and BZ-13) signed informed consent and were enrolled in the study. Five infusion doses (1×10 6 , 6×10 6 , 1×10 7 , 1.5×10 7 or 2.0×10 7 Most patients received two infusions separated by at least 28 days, with only one patient (BZ-03) receiving the second infusion on day 14.

[0226] The specific conditions of the patients are shown in Table 2 below:

[0227] Table 2 Patients' conditions

[0228] Perform apheresis and CAR-T preparation 15 to 30 days before infusion (see "CAR-T preparation" below). Perform lympholysis on day -5 (5 days before infusion): give cyclophosphamide 300 mg / m 2 / day, fludarabine 30 mg / m 2 / day for three days.

[0229] Reaction assessment

[0230] Treatment response was assessed by RECIST 1.1 or mRECIST, with tumor thickness and metastatic lesions assessed by CT scan. Pleural thickness was measured at the same location and level. A complete response (CR) was defined as the disappearance of all target lesions with no evidence of tumor elsewhere. A partial response (PR) was defined as a decrease of at least 30% in total tumor measurements. Progressive disease (PD) was defined as an increase of at least 20% in total tumor measurements compared to the last measurement, or the appearance of one or more new lesions. Stable disease (SD) was defined as disease that did not meet the criteria for PR or PD. Duration of response was calculated from the first documented response until disease progression, initiation of non-study treatment, or the last documented ongoing response.

[0231] Assessment and grading of CRS

[0232] CRS was assessed and graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events (NCI-CTCAE) version 5.0 based on changes in body temperature, systolic blood pressure, and SaO2 oxygen demand.

[0233] Assessment and grading of AEs

[0234] During lymphodepletion and CAR-T cell infusion, patients were hospitalized and closely monitored. Physical and clinical laboratory tests were recorded during hospitalization to assess treatment toxicity. Neurologic and other toxicities were assessed according to CTCAE 5.0.

[0235] Immunohistochemistry for patient screening

[0236] Immunohistochemistry (IHC) analysis was used to screen patients and assess the tumor microenvironment (on formalin-fixed, paraffin-embedded tissue sections). Briefly, sections were deparaffinized in xylene and rehydrated in a graded alcohol series, and endogenous peroxidases were eliminated using 3% hydrogen peroxide. Antigen retrieval was performed in EDTA buffer (pH 9.0). After blocking nonspecific binding with 3% goat serum in PBS, sections were probed with antibodies against human MSLN (Cell Signaling Technology, clone D9R5G, Cat#99966), PD-L1 (Abcam, clone 73-10, Cat#ab228415), CD3 (Cell Signaling Technology, Cat#85061), and CD8 (Cell Signaling Technology, Cat#85336). The procedure was performed on an automated immunostainer (Leica Bond-III, Dako Autostainer Link 48) using the Bond Polymer Refine Detection system.

[0237] CAR-T preparation

[0238] The gene encoding the anti-MSLN CAR (whose structure is human CD8α signal peptide, anti-MSLN VHH, human CD8α hinge region, human CD28 transmembrane region and intracellular costimulatory signal region, CD3ζ intracellular immune activation motif, and its amino acid sequence is shown in SEQ ID NO: 122) was cloned into pC23S (SEQ ID NO: 135) containing a PB transposon to construct a recombinant pC23S-meso plasmid. The gene encoding the anti-PD-1 VHH (whose amino acid sequence is shown in SEQ ID NO: 131) was cloned into pC24S (SEQ ID NO: 136) containing a PB transposon to construct a recombinant pC24S-α-PD1 plasmid.

[0239] Fresh PBMCs were collected from the subjects by blood draw. T cells were enriched by magnetic separation using anti-CD4 (Miltenyi Biotec, Cat#170-076-702) and anti-CD8 microbeads (Miltenyi Biotec, Cat#170-076-703) and activated in T175 flasks by coating with anti-CD3 antibody (Miltenyi Biotec, Cat#170-076-116) / 4-1BBL antigen (Acro, Cat#41L-H5256, 5 μg / ml). After 2 days of T cell stimulation, a mixture of hyPB enzyme mRNA (the amino acid sequence of hyPB enzyme is shown in SEQ ID NO: 137, and the nucleotide sequence of the template plasmid for hyPB enzyme mRNA is shown in SEQ ID NO: 138), pC23S-meso, and pC24S-α-PD1 plasmids were electroporated into T cells using the GT flow transfection system (MaxCyte) according to the manufacturer's instructions. After electroporation, cells were transferred for recovery and then culture medium was added. T cells were cultured in AIM-V medium (Thermo Fisher, Cat#A38308-01) supplemented with CTS immune cell serum replacement (Thermo Fisher, Cat#A25961-01) and IL-7 (Primer Gene, Cat#GMP-101-07, 25 ng ml -1 ) and IL-15 (Primer Gene, Cat# GMP-101-15, 25 ng ml -1) for 5-9 days. After the culture period, a portion of the CAR-T cells was collected for quality control, and the remaining cells were prepared into a preparation (pharmaceutical composition) and aliquoted into 25 mL Cryotore bags (Origen Biomedical, Cat# CS50), placed in controlled-rate CryoMed Freezers 7451 (Thermo Scientific), and then stored in liquid nitrogen. The preparation process is as follows:

[0240] ① Preparation of freezing solution

[0241] The maximum number of finished product bags was estimated based on the total cell volume, and the maximum volume of freezing solution was prepared. The freezing solution preparation ratio was: compound electrolyte: dextran glucose injection: 25% human serum albumin: dimethyl sulfoxide (DMSO) = 65:10:20:5.

[0242] ② Preparation: To a 500mL centrifuge cup, add 65mL of compound electrolytes, 10mL of dextran 40% glucose injection, 20mL of 25% human serum albumin, and 5mL of dimethyl sulfoxide per 100mL of cryopreservative solution. Mix thoroughly by pipetting 10-15 times with a 50mL pipette and store at 2-8°C until ready to use.

[0243] ③ Centrifuge and remove the supernatant

[0244] The cell stock solution was centrifuged. After centrifugation, the supernatant in the 500 mL centrifuge tube was discarded using a negative pressure pump.

[0245] ④Add freezing solution to adjust cell density

[0246] Filling viable cell density = (patient weight × target dose × 1.2 times) ÷ CD3 + MSLN CAR + The T cell ratio is divided into 25mL, and the cell volume of the preparation is actually canned at 1.2 times the target dose.

[0247] Use a 10mL pipette to add an appropriate amount of freezing solution to a 500mL centrifuge tube. After mixing thoroughly, transfer 500μL of the sample to a 1.5mL centrifuge tube and transfer it to the CAR-T cell preparation station through the rapid transfer port for counting. Use a pipette to accurately measure the volume of the cell suspension and calculate the total number of cells.

[0248] According to the cell counting results, fill the preparation according to the required live cell density and use a pipette to add freezing solution to adjust the live cell density. 6 ~1.1×10 8 cells / mL, according to 5×10 6 ~1.0×10 8 cells / mL for filling.

[0249] ⑤Filling

[0250] The mixed cell suspension was transferred into the freezing bag using a pipette through a 50 mL sterile syringe at a rate of 25 mL / bag. After filling, the suspension was immediately stored at 4°C.

[0251] Programmed cooling and freezing

[0252] The cells were placed in a programmed cooling apparatus for programmed cooling, and then stored in a liquid nitrogen tank at below -120°C.

[0253] qPCR measurement of CAR T cell expansion and persistence

[0254] At baseline and after infusion, 6 ml of peripheral blood samples were collected from patients using EDTA tubes. Genomic DNA (gDNA) was extracted using the MagMAXDNA Multi-Sample Ultra Kit (Thermo Fisher Scientific A36570), and the copy number of each sample was measured by qPCR. The primer sequences were: forward: AGGGCCGCTTCACCATCAG; reverse: CCAGTCGGGGTCGTAGTCGTT; probe: tacatgccggtgtcctcgggctt. Plasmid was used to establish 1×10 6 A standard curve was drawn between 50 and 50 copies. Results are reported as transgene copies per microgram of genomic DNA.

[0255] Detection of PD-1 nanobodies in peripheral blood or tissues

[0256] We designed a quantitative electrochemiluminescence (ECL) assay to monitor the concentration of PD-1 nanobodies. This assay was used with mouse and human peripheral blood samples, as well as homogenized mouse spleen and tumor tissue samples. Custom MULTI-ARRAY 96 Sm Spot plates (MSD, L45XA-3) were coated with PD-1 antigen (5 μg / ml) overnight, then washed with phosphate-buffered saline with Tween 20 (PBST) and blocked with 3% BSA for 30 minutes. Test controls and serum samples were diluted to 10% serum in assay buffer and added to the plates to allow antigen-antibody complexes to form for 2 hours. After incubation and washing with PBST, SULFO-TAG™-labeled antibodies (0.75 μg / ml) were added to the plates and incubated for an additional 2 hours. Finally, SULFO-TAG Streptavidin (0.25 μg / ml) was added to generate ECL, which was measured as RLU using an MSD QuickPlex SQ 120 plate reader.

[0257] Detection of cytokine levels

[0258] The concentrations of inflammatory cytokines, including INFγ and IL-6, in peripheral blood of treated patients were analyzed using the Human V-PLEX Proinflammatory Panel 1 Kit (MSD, K15049D). Experiments were performed according to the manufacturer's instructions. All assays were performed in duplicate for each sample. ECL signals were detected using an MSD QuickPlex SQ 120 plate reader.

[0259] Flow cytometry

[0260] In the clinical study, the number of CAR-T cells in the patient's peripheral blood was monitored by flow cytometry on the Navios Tetra platform (Beckman Coulter). Blood samples were stained with biotinylated human MSLN protein (GenScript, C4655EH200), CD3-BV510 (BD Bioscience, Cat#564713), CD4-Alexa Fluor 488 (BD Bioscience, 557695), CD8-APC / Cy7 (BD Bioscience, Cat#557834), CD45-Cy5.5 (Biolegend, 304028), CD45RA-APC (BD Bioscience, Cat#550855), and CD197-BV421 (BD Bioscience, Cat#353208) on ice for 30 minutes and then stained with streptavidin-PE (BD Bioscience, Cat#554061). The absolute number of CAR-T cells was calculated using cell counting beads (Beckman Coulter, Cat#7547053).

[0261] The in vitro and animal experiments of CAR-T were conducted with reference to the examples in PCT / CN2022 / 143407, the entire contents of which are incorporated herein by reference.

[0262] Cell infusion regimen:

[0263] CAR-T cells are provided to clinicians in the form of liquid nitrogen cryopreserved (i.e., frozen pharmaceutical compositions). The infusion schedule should be confirmed in advance and the start time of thawing adjusted. Once thawed, CAR-T cells can only be stored at room temperature for a maximum of 2 hours (at room temperature, infusion should be scheduled as soon as possible).

[0264] Infusion preparation:

[0265] Administer antipyretics, analgesics, and antihistamines orally (PO) approximately 30 to 60 minutes before CAR-T infusion. Avoid prophylactic corticosteroids as they may interfere with CAR-T cell activity.

[0266] Subject identity confirmation: Before infusion preparation, the subject's identity should be confirmed to match the subject number on the CAR-T infusion bag. CAR-T is for autologous use only.

[0267] Cell preparation and infusion rate:

[0268] Before thawing, check the infusion bag for damage or cracks. If the packaging is damaged, it cannot be used for infusion.

[0269] Thaw the CAR-T cells at approximately 37°C using a water bath or dry thawing method until there are no visible ice cubes in the infusion bag. Immediately remove the bag from the thawing device and do not continue to store the infusion bag at approximately 37°C. Once the cells are thawed, they should not be stored at room temperature (20-25°C) for more than 2 hours. The infusion process should be completed within 30 minutes (the capacity of the infusion bag is approximately 25 ml). Do not wash and / or resuspend the cells before infusion; mix gently.

[0270] Inspect the contents of the thawed infusion bag for visible cell clumps. If present, gently mix the bag contents. Small cell clumps should be dispersed with gentle manual mixing. If clumps do not disperse, the infusion bag is damaged or leaking, or appears to be damaged, the cells should not be used.

[0271] CAR-T cells are administered via intravenous drip. The rate can be adjusted based on the patient's age, with a lower infusion rate used for younger patients.

[0272] The order of infusion is:

[0273] Before cell infusion, the infusion tube was primed with 50 ml of normal saline;

[0274] Complete the infusion of all contents in the infusion bag;

[0275] While keeping the infusion system closed, flush the infusion tube with 50 ml of normal saline to ensure that as many cells as possible are infused into the subject.

[0276] After infusion, the blood of 11 eligible patients with malignant mesothelioma treated with CAR-T cells and anti-PD-1 VHH showed high growth and peaked on day 7 (Figures 3-4). IFNγ, a key factor in CAR-T cell killing of solid tumors, began to increase from day 4 and peaked on day 7 (Figure 5). The level of IL-6, as cancer cells attacked by CAR-T are damaged in the TME, showed a similar pattern (Figure 6). All patients experienced grade 1 adverse events (AEs), 54% had grade 3 AEs, and 15% had grade 4 AEs. Toxicity was mainly related to hematological adverse events caused by lymphodepletion, and patients with lymphopenia usually recovered with supportive care. In these trials, there were no dose-limiting toxicities, neurological toxicities, pericarditis, or confirmed off-target tumor toxicities.

[0277] The results of 11 MPM patients accessed by mRECIST 1.1 showed that 1 achieved CR, 6 PR, and 4 SD, resulting in an ORR of 63.6% (95% CI, 30.1%-89.1%) (Table 3), and the disease control rate was 100%. Among them, 8 patients (72.7%) with malignant mesothelioma who failed standard treatment survived for more than 18 months after re-infusion, and the longest sustained survival was more than 42 months (Figure 7). The PET-CT in Figure 8 shows that the lesions of patient BZ-02 decreased sharply after the first infusion and disappeared after the second infusion on day 75 (Figures 8 and 9), achieving progression-free survival, and the CR status has reached 40 months. The median progression-free survival (mPFS) was 5 months (95% CI, 3 to 12 months), and mOS was not reached.

[0278] After infusion, one of the two CC patients achieved a PR (Figure 10), and the other had SD. Neither patient experienced any adverse reactions exceeding grade 3. One patient with mesothelin-positive lung adenocarcinoma achieved a PR (Figure 11), with a response lasting 18 months.

[0279] Based on the above inclusion criteria, the efficacy and safety of the drug have also been verified in clinical studies targeting patients with malignant mesothelioma, colorectal cancer, endometrial cancer, cervical cancer, lung adenocarcinoma, ovarian cancer, and esophageal cancer, as shown in Table 3 below.

[0280] Table 3 Treatment status of subjects

Claims

1. A pharmaceutical composition comprising: Cells and pharmaceutically acceptable excipients, wherein the excipients include a diluent and a cryoprotectant, wherein the cells are T cells that contain and / or express a chimeric antigen receptor, and / or contain a coding sequence of a chimeric antigen receptor, wherein the antigen binding domain of the chimeric antigen receptor includes a mesothelin binding molecule containing an anti-mesothelin single domain antibody, wherein the anti-mesothelin single domain antibody includes CDR1, CDR2 and CDR3, wherein the CDR1 includes the sequence shown in SEQ ID NO: 1, the CDR2 includes the sequence shown in SEQ ID NO: 2, and the CDR3 includes the sequence shown in SEQ ID NO:

3.

2. The pharmaceutical composition according to claim 1, wherein the diluent is selected from one or more of compound electrolyte injection, 0.9% NaCl injection, and sodium lactate Ringer's injection, preferably compound electrolyte injection. The cryoprotectant is selected from one or more of dextran glucose injection, human albumin solution, dimethyl sulfoxide, ethylene glycol, trehalose, sucrose, and glucose, preferably dextran glucose injection, human albumin solution, and dimethyl sulfoxide.

3. The pharmaceutical composition according to claim 1 or 2, wherein the concentration of the diluent is 40-80% v / v, and the concentration of the cryoprotectant is 20-60% v / v.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the excipients include: 40-80% v / v compound electrolyte injection, 5-20% v / v dextran 40 glucose injection, 10-30% v / v human albumin solution and 5-10% v / v dimethyl sulfoxide.

5. The pharmaceutical composition according to claim 1, wherein the excipients include the following components: Preferably, the auxiliary materials include the following components: More preferably, the auxiliary material comprises the following components: Further preferably, the auxiliary material comprises the following components:

6. The pharmaceutical composition according to claim 5, characterized in that The dextran is selected from: dextran 40, dextran 70, or a combination thereof, preferably dextran 40.

7. The pharmaceutical composition according to any one of claims 1 to 6, characterized in that The auxiliary material also includes vitamins. Preferably, the concentration of the vitamins is 1-20 mg / ml, more preferably 1-15 mg / ml, and more preferably 5-10 mg / ml.

8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the content of the cells is a therapeutically effective amount, preferably, the content is 0.5×10 6 ~2×10 8 / mL, preferably 1.5×10 6 ~5×10 7 Pieces / mL.

9. The pharmaceutical composition according to any one of claims 1 to 8, characterized in that The mesothelin binding molecule is a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or an antigen binding fragment thereof, an antibody or an antigen binding fragment thereof comprising one, two or more of the single domain antibodies.

10. The pharmaceutical composition according to any one of claims 1 to 9, characterized in that The CDR1 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 4-27, 73; and / or The CDR2 of the anti-mesothelin single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 28-47, 74; and / or The CDR3 of the anti-mesothelin single-domain antibody comprises a sequence shown in any one of SEQ ID NOs: 48-72 and 75, Preferably, the anti-mesothelin single domain antibody contains CDR1, CDR2 and CDR3 shown in any one of the following groups a1 to a26: More preferably, the amino acid sequence of the anti-mesothelin single domain antibody is as shown in any one of SEQ ID NOs: 76-120.

11. The pharmaceutical composition according to any one of claims 1 to 10, characterized in that The chimeric antigen receptor comprises a mesothelin binding molecule containing an anti-mesothelin single domain antibody, a hinge region, a transmembrane region, and an intracellular region. The chimeric antigen receptor also has one or more characteristics selected from the following: The chimeric antigen receptor further comprises a signal peptide, The signal peptide includes a CD8 signal peptide, a CD28 signal peptide, a CD4 signal peptide or a light chain signal peptide, The hinge region includes a CD8 hinge region, an IgD hinge region, an IgG1 Fc CH2CH3 hinge region or an IgG4 Fc CH2CH3 hinge region, The transmembrane region includes a CD28 transmembrane region, a CD8 transmembrane region, a CD3ζ transmembrane region, a CD134 transmembrane region, a CD137 transmembrane region, an ICOS transmembrane region or a DAP10 transmembrane region, The intracellular region includes an intracellular co-stimulatory domain and / or an intracellular signaling domain. The intracellular co-stimulatory domain includes the intracellular domain of CD28, CD134 / OX40, CD137 / 4-1BB, lymphocyte-specific protein tyrosine kinase, inducible T cell co-stimulator (ICOS) or DNAX activation protein 10, The intracellular signaling domain includes a CD3ζ intracellular signaling domain or a FcεRIγ intracellular signaling domain.

12. The pharmaceutical composition according to any one of claims 1 to 11, characterized in that The cell further comprises, expresses and / or secretes a PD-1 binding molecule, and / or contains a coding sequence for a PD-1 binding molecule, Preferably, the PD-1 binding molecule comprises an anti-PD-1 single domain antibody, More preferably, the CDR1 of the anti-PD-1 single domain antibody is shown as SEQ ID NO: 124 or 128, the CDR2 is shown as SEQ ID NO: 125 or 129, and the CDR3 is shown as SEQ ID NO: 126 or 130.

13. A method for treating or preventing cancer, the method comprising administering the pharmaceutical composition of any one of claims 1 to 12 to a patient in need thereof, thereby delivering a dose of the cells to the patient.

14. The method according to claim 13, characterized in that The dose included 0.1×10 6 ~2×10 8 cells / kg patient body weight, preferably 1×10 6 ~2×10 7 cells / kg patient body weight, more preferably 5×10 6 ~2×10 7 cells / kg patient body weight.

15. The method of claim 13 or 14, wherein the cancer is a cancer associated with mesothelin expression, preferably one or more selected from mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma.

16. The method according to any one of claims 13 to 15, characterized in that The patient's tumor tissue cells positively express mesothelin, preferably the mesothelin expression is more than 50%, Optionally, the patient also meets any one or more of the following conditions: (1) The patient has positive expression of PD-L1, (2) The patient is diagnosed with one or more of malignant pleural or peritoneal mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma; (3) The patient has received standard therapy and the treatment has failed.

17. The method according to any one of claims 13 to 16, characterized in that Before administering the pharmaceutical composition, a lymphocyte clearance regimen is performed. Preferably, the lymphocyte clearance regimen comprises administering cyclophosphamide and / or fludarabine to the patient. More preferably, 300 mg / m cyclophosphamide is administered to the patient. 2 / day and fludarabine 30 mg / m 2 / day for three days.

18. The method according to any one of claims 13 to 17, characterized in that The pharmaceutical composition is administered to the patient by intravenous infusion.

19. The method according to any one of claims 13 to 18, characterized in that The method comprises administering the pharmaceutical composition to the patient once, or administering the pharmaceutical composition multiple times, optionally in a dose escalation pattern or an isodose pattern.

20. Use of the pharmaceutical composition according to any one of claims 1 to 12 in the preparation of a drug or a kit for treating cancer, Preferably, the cancer is a cancer associated with mesothelin expression, More preferably, the cancer is selected from one or more of mesothelioma, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, esophageal cancer, bile duct cancer, lung adenocarcinoma, gastric cancer, melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, and non-Hodgkin's lymphoma.

Images