Method for detecting target nucleic acid in sample by HTO cleavage and self-extension assay

Abstract

The present disclosure relates to a method for detecting a target nucleic acid in a sample by using a hairpin-tagging oligonucleotide (HTO) cleavage and self-extension assay. The method according to the present disclosure can more accurately and conveniently detect one or more target nucleic acids in real time.

Description

Method for detecting target nucleic acid in a sample by HTO cleavage and self-extension assay

[0001] Cross-reference to related applications

[0002] This application claims the benefit of Republic of Korea Patent Application No. 10-2023-0084829, filed June 30, 2023 with the Korean Intellectual Property Office, the disclosure of which is incorporated herein by reference in its entirety.

[0003] Technology field

[0004] The present disclosure relates to a method for detecting a target nucleic acid in a sample by a hairpin-tagging oligonucleotide (HTO) cleavage and self-extension assay.

[0005]

[0006] Real-time detection methods are widely used to detect target nucleic acids, allowing for real-time monitoring of target amplification. Real-time detection methods typically utilize labeled probes or primers that specifically hybridize with the target nucleic acid.

[0007] Examples of methods utilizing hybridization between labeled probes and target nucleic acids include the molecular beacon method (Tyagi et al., Nature Biotechnology v. 14 MARCH 1996) using dual-labeled probes with hairpin structures, the HyBeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374(2001)), the hybridization probe method using two probes, each labeled as a donor and an acceptor (Bernad et al., 147-148 Clin Chem 2000; 46), and the Lux method (U.S. Pat. No. 7,537,886) using single-labeled oligonucleotides. The TaqMan method (U.S. Patent Nos. 5,210,015 and 5,538,848) utilizing a double-labeled probe and cleavage of the probe by the 5'-nuclease activity of DNA polymerase is widely used in the art.

[0008] Examples of methods utilizing labeled primers include the Sunrise primer method (Nazarenko et al., 2516-2521 Nucleic Acids Research, 1997, v.25 no.12, and U.S. Pat. No. 6,117,635), the Scorpion primer method (Whitcombe et al., 804-807, Nature Biotechnology v.17 AUGUST 1999, and U.S. Pat. No. 6,326,145), and the TSG primer method (WO 2011-078441).

[0009] Since the conventional real-time detection technologies described above can detect only one target nucleic acid using one label, the number of target nucleic acids that can be detected simultaneously in one reaction is limited by the number of available labels (e.g., 5 or less).

[0010] Therefore, there is a need for the development of a novel method or approach that can detect multiple target nucleic acids in real time using a single type of label, as well as a single target nucleic acid in real time.

[0011]

[0012] Numerous references and patents are cited and cited throughout this specification. The disclosures of these references and patents are incorporated herein by reference in their entirety to further clarify the state of the art and the scope of the present invention.

[0013]

[0014] The present inventors have sought to develop a method capable of detecting multiple target nucleic acids using a single type of label. As a result, a novel protocol has been established for detecting target nucleic acids using the cleavage reaction of a hairpin-tagged oligonucleotide (HTO) dependent on the presence of the target nucleic acid and the self-extension reaction of the cleaved HTO fragment. The protocol according to the present disclosure offers improved accuracy and convenience. Furthermore, it can detect not only a single target nucleic acid but also multiple target nucleic acids.

[0015]

[0016] Accordingly, an object of the present disclosure is to provide a method for detecting a target nucleic acid in a sample by an HTO Cleavage and Self-Extension assay.

[0017] Another object of the present disclosure is to provide a composition for detecting a target nucleic acid in a sample by HTO cleavage and self-extension assay.

[0018] Another object of the present disclosure is to provide a method for detecting n target nucleic acids in a sample using a composition that generates a signal according to an HTO cleavage and self-extension assay.

[0019]

[0020] Other objects and advantages of the present disclosure will become more apparent from the detailed description below taken together with the appended claims.

[0021]

[0022] According to one aspect of the present disclosure, a method for detecting a target nucleic acid in a sample by an HTO Cleavage and Self-Extension assay is provided, comprising:

[0023] (a) A step of hybridizing the target nucleic acid with a primer and a hairpin-tagging oligonucleotide (HTO);

[0024] The primer comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid,

[0025] The above HTO comprises a 5'-tagging portion and a 3'-targeting portion in 5' to 3' order,

[0026] The 5'-tagging portion comprises (i) a templating portion comprising a nucleotide sequence that non-hybridizes to the target nucleic acid and (ii) an initial hairpin structure comprising an initial double-stranded stem and a single-stranded loop,

[0027] The 3'-targeting portion comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0028] The above primer is located upstream of the HTO;

[0029] (b) a step of contacting the resultant of step (a) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the HTO;

[0030] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the HTO, which cleavage releases a fragment containing the 5'-tagging portion of the HTO;

[0031] (c) a step of self-extension of the fragment using a DNA polymerase having the 5' nuclease activity under conditions in which the initial hairpin structure is maintained;

[0032] The 3'-end of the fragment extends along the templating region to generate an extended sequence complementary to the templating region, thereby generating a self-extended hairpin structure comprising an extended double-stranded stem and the single-stranded loop,

[0033] The self-extended hairpin structure has a Tm that is controllable by the sequence and / or length of the fragment,

[0034] The Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure,

[0035] The above HTO has a reporter molecule and a quencher molecule,

[0036] The reporter molecule and the quencher molecule are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state; and

[0037] (d) a step of detecting the presence of the self-extended hairpin structure by measuring a signal provided from the self-extended hairpin structure;

[0038] The presence of the self-extended hairpin structure indicates the presence of the target nucleic acid.

[0039] According to one embodiment of the present disclosure, the reporter molecule and the quencher molecule are positioned such that (i) when the templating portion of the HTO exists as a single strand, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the templating portion of the HTO forms a double strand by hybridization with the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

[0040] According to one embodiment of the present disclosure, the reporter molecule and the quencher molecule are both linked to the templating portion of the HTO, or one of the reporter molecule and the quencher molecule is linked to the single-stranded loop and the other of the reporter molecule and the quencher molecule is linked to the templating portion of the HTO.

[0041] According to one embodiment of the present disclosure, the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which the self-extended hairpin structure can be maintained.

[0042] According to one embodiment of the present disclosure, (i) the reporter molecule and the quencher molecule are positioned such that (i-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenches a signal from the reporter molecule, and (i-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are positioned close to each other so that the quencher molecule quenches a signal from the reporter molecule; Or (ii) the reporter molecule and the quencher molecule are in a position such that (ii-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

[0043] According to one embodiment of the present disclosure, the reporter molecule and the quencher molecule are linked to the initial hairpin structure.

[0044] According to one embodiment of the present disclosure, the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which (i) the self-extended hairpin structure is maintained and (ii) the initial hairpin structure dissociates into a single-stranded state.

[0045] According to one embodiment of the present disclosure, the method is performed in the presence of a Labeled Portion Hybridizing Oligonucleotide (LPHO) comprising a nucleotide sequence that hybridizes to a labeled portion, wherein the labeled portion is a nucleotide sequence comprising a nucleotide to which the reporter molecule is linked and a nucleotide to which the quencher molecule is linked.

[0046] According to one embodiment of the present disclosure, the labeling portion is included in the templating portion of the HTO.

[0047] According to one embodiment of the present disclosure, the reporter molecule and the quencher molecule are positioned such that (i) when the label moiety is single-stranded, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the label moiety forms a double-stranded molecule by hybridization with the LPHO or the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

[0048] According to one embodiment of the present disclosure, when the target nucleic acid is present in the sample, the self-extended hairpin structure is generated to prevent the formation of an HTO / LPHO hybrid between the labeling portion of the HTO and the LPHO, whereas when the target nucleic acid is not present in the sample, the self-extended hairpin structure is not generated, but instead the HTO / LPHO hybrid is formed.

[0049] According to one embodiment of the present disclosure, the formation of the self-extended hairpin structure prevents the formation of the HTO / LPHO hybrid by favoring hybridization between the label portion of the self-extended hairpin structure and the extended sequence over hybridization between the label portion of the HTO and the LPHO.

[0050] According to one embodiment of the present disclosure, the formation of the self-extended hairpin structure prevents the formation of the HTO / LPHO hybrid by cleaving the LPHO during the self-extension of step (c).

[0051] According to one embodiment of the present disclosure, the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which (i) the self-extended hairpin structure is maintained, and (ii) the HTO / LPHO hybrid dissociates into a single-stranded state.

[0052] According to another aspect of the present disclosure, a composition for detecting a target nucleic acid in a sample by an HTO Cleavage and Self-Extension assay is provided, comprising:

[0053] (a) primer;

[0054] The primer comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid; and

[0055] (b) Hairpin-Tagging Oligonucleotide (HTO);

[0056] The above HTO comprises a 5'-tagging portion and a 3'-targeting portion in 5' to 3' order,

[0057] The 5'-tagging portion comprises (i) a templating portion comprising a nucleotide sequence that non-hybridizes to the target nucleic acid and (ii) an initial hairpin structure comprising an initial double-stranded stem and a single-stranded loop,

[0058] The 3'-targeting portion comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0059] The above primer is located upstream of the above HTO,

[0060] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the HTO, which cleavage releases a fragment containing the 5'-tagging portion of the HTO;

[0061] The 3'-end of the fragment extends along the templating region to generate an extended sequence complementary to the templating region, thereby generating a self-extended hairpin structure comprising an extended double-stranded stem and the single-stranded loop,

[0062] The self-extended hairpin structure has a Tm that is controllable by the sequence and / or length of the fragment,

[0063] The Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure,

[0064] The above HTO has a reporter molecule and a quencher molecule,

[0065] The reporter molecule and the quencher molecule are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state; and

[0066] The self-extended hairpin structure provides a signal indicating the presence of the target nucleic acid.

[0067] According to one embodiment of the present disclosure, the composition has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the target nucleic acid is present.

[0068] According to one embodiment of the present disclosure, the reporter molecule and the quencher molecule are positioned such that (i) when the templating portion of the HTO exists as a single strand, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the templating portion of the HTO forms a double strand by hybridization with the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

[0069] According to one embodiment of the present disclosure, the composition has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and a signal-constant temperature range (SCoTR) in which the signal is constant even when the target nucleic acid is present.

[0070] According to one embodiment of the present disclosure, the composition is an Under-Signal-Change-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range.

[0071] According to one embodiment of the present disclosure, (i) the reporter molecule and the quencher molecule are positioned such that (i-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenches a signal from the reporter molecule, and (i-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are positioned close to each other so that the quencher molecule quenches a signal from the reporter molecule; Or (ii) the reporter molecule and the quencher molecule are in a position such that (ii-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

[0072] According to one embodiment of the present disclosure, the composition has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the target nucleic acid is present.

[0073] According to one embodiment of the present disclosure, the composition is an InterSC-Signal-Change-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

[0074] According to one embodiment of the present disclosure, the composition further comprises a Labeled Portion Hybridizing Oligonucleotide (LPHO) comprising a nucleotide sequence that hybridizes to a labeled portion, wherein the labeled portion is a nucleotide sequence comprising a nucleotide to which the reporter molecule is linked and a nucleotide to which the quencher molecule is linked.

[0075] According to one embodiment of the present disclosure, the reporter molecule and the quencher molecule are positioned such that (i) when the label moiety is single-stranded, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the label moiety forms a double-stranded molecule by hybridization with the LPHO or the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

[0076] According to one embodiment of the present disclosure, the composition has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the target nucleic acid is present.

[0077] According to one embodiment of the present disclosure, the composition is an InterSC-Signal-Change-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

[0078] According to another aspect of the present disclosure, a method for detecting n target nucleic acids in a sample is provided, comprising:

[0079] (a) a step of incubating a sample suspected of containing one or more of the n target nucleic acids with n target nucleic acid detection compositions in one reaction vessel, and detecting a signal at n detection temperatures;

[0080] The above n is an integer greater than or equal to 2,

[0081] The above incubation comprises multiple reaction cycles, and the detection of the signal is performed in one or more of the multiple reaction cycles,

[0082] Each of the above n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the above n detection temperatures in the presence of the corresponding target nucleic acid,

[0083] Among the above n target nucleic acid detection compositions, the i target nucleic acid detection composition provides a change in a signal indicating the presence of the i target nucleic acid at the i detection temperature among the n detection temperatures in the presence of the i target nucleic acid, and provides a constant signal at other detection temperatures.

[0084] The above i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature.

[0085] Within the temperature range including all of the above n detection temperatures, the composition for detecting the i-th target nucleic acid has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the i-th target nucleic acid is present.

[0086] The composition for detecting the above target nucleic acid is,

[0087] (i) an UnderSC-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range;

[0088] (ii) an InterSC-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges, and

[0089] (iii) any one of the OverSC-type compositions having a melting characteristic in the signal-change temperature range higher than the signal-constant temperature range;

[0090] At least one of the above n target nucleic acid detection compositions is an HTOCE composition that generates a signal according to the HTOCE assay, and;

[0091] (b) A step of determining the presence of n target nucleic acids from the signals detected in the above step (a), wherein the step of determining the presence of the i-th target nucleic acid is determined by a change in the signal detected at the i-th detection temperature.

[0092] According to one embodiment of the present disclosure, the i detection temperature is selected within a signal-change temperature range of the i target nucleic acid detection composition, and the i detection temperature is not included in a signal-change temperature range of another target nucleic acid detection composition.

[0093] According to one embodiment of the present disclosure, the signal-change temperature range of the composition for detecting the i-th target nucleic acid may partially overlap with the signal-change temperature range of the composition for detecting the target nucleic acid having an adjacent detection temperature, and does not overlap with the signal-change temperature range of the composition for detecting the target nucleic acid having a non-adjacent detection temperature.

[0094] According to one embodiment of the present disclosure, when n is 2, the first target nucleic acid detection composition is an UnderSC-type or InterSC-type composition, and the second target nucleic acid detection composition is an InterSC-type or OverSC-type composition.

[0095] According to one embodiment of the present disclosure, when n is 3 or more, the first target nucleic acid detection composition is an UnderSC-type or InterSC-type composition, the n-th target nucleic acid detection composition is an InterSC-type or OverSC-type composition, and each of the target nucleic acid detection compositions other than the first target nucleic acid and the n-th target nucleic acid is an InterSC-type composition.

[0096]

[0097] The features and advantages of the present disclosure are summarized as follows:

[0098] (a) The first feature of the present disclosure is that a target nucleic acid is detected using an oligonucleotide comprising a hairpin structure. Specifically, the oligonucleotide (i.e., HTO) comprising the (initial) hairpin structure is cleaved by a cleavage reaction dependent on the presence of the target nucleic acid to release a fragment comprising the hairpin structure. Subsequently, the hairpin structure of the fragment participates in a self-extension reaction to produce a self-extended hairpin structure, and the self-extended hairpin structure provides a signal indicating the presence of the target nucleic acid.

[0099] (b) A second feature of the present disclosure is that the self-extended hairpin structure generated from the fragment can have a sequence unrelated to the target nucleic acid. This means that the self-extended hairpin structure can have a Tm value that can be adjusted by the sequence and / or length of the HTO fragment, and this feature can be utilized to more accurately and conveniently detect one or more target nucleic acids in real time.

[0100] (c) A third feature of the present disclosure is that the Tm of the initial hairpin structure of HTO, which is cleaved in a target nucleic acid-dependent manner, differs from the Tm of the self-extended hairpin structure generated in a target nucleic acid-dependent manner. By controlling this difference in Tm values ​​and the position of the label, the method according to the present disclosure can be applied to signal generation methods of the UnderSC type or the InterSC type.

[0101] (d) As described above, the present disclosure can be applied to the InterSC signal generation method, which enables the detection of multiple target nucleic acids using a single type of label. In particular, it has the advantage of dramatically reducing analysis time compared to conventional techniques that require melting analysis after target amplification to detect multiple target nucleic acids using a single type of label.

[0102] (e) Conventional target nucleic acid detection methods utilizing direct hybridization between a labeled probe and a target nucleic acid are highly likely to generate false positive signals due to non-specific hybridization of the probe. In contrast, the present disclosure can overcome the problem of false positive signals by utilizing not only a hybridization reaction but also enzymatic cleavage and self-extension.

[0103]

[0104] FIG. 1 illustrates a specific structure of an embodiment of HTO and its cut form used in the present disclosure.

[0105] Figure 2 illustrates various examples of HTO depending on the positions of the reporter molecule and the quencher molecule.

[0106] Figure 3 schematically illustrates an HTOCE assay using HTO in which a reporter molecule and a quencher molecule are linked to the templating portion of HTO.

[0107] Figure 4 schematically illustrates an HTOCE assay utilizing HTO, in which a reporter molecule is linked to a single-stranded loop of HTO and a quencher molecule is linked to the templating portion of HTO.

[0108] Figure 5 schematically illustrates an HTOCE assay utilizing HTO, where a reporter molecule is linked to the single-stranded loop of HTO and a quencher molecule is linked to the initial double-stranded stem of HTO.

[0109] Figure 6 schematically illustrates an HTOCE assay utilizing HTO in which a reporter molecule and a quencher molecule are linked to the initial double-stranded stem of HTO.

[0110] Figure 7 schematically illustrates an HTOCE assay utilizing HTO in which a reporter molecule and a quencher molecule are linked to a single-stranded loop of HTO.

[0111] Figure 8 schematically illustrates an HTOCE assay using HTO and LPHO, in which a reporter molecule and a quencher molecule are linked to the templating portion of HTO.

[0112] Figure 9 illustrates various examples of LPHOs hybridizing to the labeling portion of HTO.

[0113] Figure 10 shows the conformational change of HTO in (i) a signal-change temperature range and (ii) a signal-constant temperature range before reaction between a target nucleic acid and a composition comprising HTO in which a reporter molecule and a quencher molecule are linked to the templating portion of HTO, or in the absence of a target nucleic acid.

[0114] Figure 11 shows the conformational changes of a self-extended hairpin structure in (i) a signal-change temperature range and (ii) a signal-constant temperature range after a reaction between a composition comprising HTO and a target nucleic acid, wherein a reporter molecule and a quencher molecule are linked to the templating portion of HTO.

[0115] Figure 12A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the initial, middle and late cycles of steps (a)-(d) of the HTOCE assay using HTO with reporter and quencher molecules linked to the templating portion of HTO.

[0116] Figure 12B shows a plot where the three melt curves of Figure 12A are merged.

[0117] Figure 13 shows the conformational changes of HTO at temperatures within (i) a signal-change temperature range and (ii) a signal-constant temperature range prior to reaction between a target nucleic acid and a composition comprising HTO in which a reporter molecule is linked to a single-stranded loop of HTO and a quencher molecule is linked to a templating portion, in the absence of a target nucleic acid or within a temperature range within (i) a signal-change temperature range and (ii) a signal-constant temperature range.

[0118] Figure 14 shows the conformational changes of a self-extended hairpin structure in (i) a signal-change temperature range and (ii) a signal-constant temperature range after a reaction between a composition comprising HTO and a target nucleic acid, wherein a reporter molecule is linked to a single-stranded loop of HTO and a quencher molecule is linked to a templating site.

[0119] Figure 15A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the early, middle and late cycles of steps (a)-(d) of the HTOCE assay using HTO with a reporter molecule linked to the single-stranded loop of HTO and a quencher molecule linked to the templating site.

[0120] Figure 15B shows a plot where the three melt curves of Figure 15A are merged.

[0121] FIG. 16 illustrates conformational changes of HTO in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range prior to reaction between a target nucleic acid and a composition comprising HTO in which a reporter molecule is linked to a single-stranded loop of HTO and a quencher molecule is linked to a nascent double-stranded stem, in the absence of a target nucleic acid, or in which the target nucleic acid is present.

[0122] Figure 17 shows the conformational changes of a self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after a reaction between a composition comprising HTO and a target nucleic acid, wherein a reporter molecule is linked to a single-stranded loop of HTO and a quencher molecule is linked to a nascent double-stranded stem.

[0123] Figure 18A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the early, middle and late cycles of steps (a)-(d) of the HTOCE assay using HTO with a reporter molecule linked to the single-stranded loop of HTO and a quencher molecule linked to the nascent-double-stranded stem.

[0124] Figure 18B shows a plot where the three melt curves of Figure 18A are merged.

[0125] FIG. 19 illustrates the conformational changes of HTO in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, prior to reaction between a target nucleic acid and a composition comprising HTO in which a reporter molecule and a quencher molecule are linked to the initial double-stranded stem of HTO, or in the absence of a target nucleic acid, and the target nucleic acid.

[0126] FIG. 20 shows the conformational changes of a self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after a reaction between a composition comprising HTO and a target nucleic acid, wherein a reporter molecule and a quencher molecule are linked to the initial double-stranded stem of HTO.

[0127] Figure 21A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the early, middle and late cycles of steps (a)-(d) of the HTOCE assay using HTO with reporter and quencher molecules linked to the initial double-stranded stem of HTO.

[0128] Figure 21B shows a plot where the three melt curves of Figure 21A are merged.

[0129] FIG. 22 shows the conformational changes of HTO in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, before reaction between a target nucleic acid and a composition comprising HTO in which a reporter molecule and a quencher molecule are linked to a single-stranded loop of HTO, or in the absence of a target nucleic acid, and the target nucleic acid.

[0130] Figure 23 shows the conformational changes of a self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after a reaction between a composition comprising HTO and a target nucleic acid in which a reporter molecule and a quencher molecule are linked to a single-stranded loop of HTO.

[0131] Figure 24A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the early, middle and late cycles of steps (a)-(d) of the HTOCE assay using HTO with a reporter molecule and a quencher molecule linked to a single-stranded loop of HTO.

[0132] Figure 24B shows a plot where the three melt curves of Figure 24A are merged.

[0133] FIG. 25 shows the conformational changes of HTO and LPHO in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range before the reaction between the target nucleic acid and the composition comprising HTO and LPHO in which a reporter molecule and a quencher molecule are linked to the templating portion of HTO, or in the absence of the target nucleic acid.

[0134] Figure 26 shows the conformational changes of a self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after a reaction between a composition comprising HTO and LPHO, in which a reporter molecule and a quencher molecule are linked to the templating portion of HTO, and a target nucleic acid.

[0135] Figure 27A shows the content (or abundance) ratios of HTO / LPHO hybrids and self-extended hairpin structures and their melt curves in the early, middle and late cycles of steps (a)-(d) of the HTOCE assay using HTO and LPHO with reporter and quencher molecules linked to the templating portion of HTO.

[0136] Figure 27B shows a plot where the three melt curves of Figure 27A are merged.

[0137] Figure 28 shows the real-time PCR results in Example 1-1.

[0138] Figure 29 shows the real-time PCR results in Example 1-2.

[0139] Figure 30 shows the real-time PCR results in Example 1-3.

[0140] Figure 31 shows the real-time PCR results in Example 1-4.

[0141] Figure 32 schematically shows the signal generation principle of two compositions used in Example 2, the UnderSC-type HTOCE composition and the InterSC-type HTOCE composition.

[0142] Figure 33 shows the multiplex real-time PCR results in Example 2.

[0143]

[0144] The present inventors have sought to develop a method capable of detecting multiple target nucleic acids using a single type of label. As a result, a novel protocol has been established for detecting target nucleic acids using the cleavage reaction of a hairpin-tagged oligonucleotide (HTO) dependent on the presence of the target nucleic acid and the self-extension reaction of the cleaved HTO fragment. The protocol according to the present disclosure offers improved accuracy and convenience. Furthermore, it can detect not only a single target nucleic acid but also multiple target nucleic acids.

[0145]

[0146] I. Method for detecting target nucleic acid in a sample by HTOCE assay

[0147] In one aspect, the present disclosure provides a method for detecting a target nucleic acid in a sample by an HTO Cleavage and Self-Extension assay, comprising:

[0148] (a) A step of hybridizing the target nucleic acid with a primer and a hairpin-tagging oligonucleotide (HTO);

[0149] The primer comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid,

[0150] The above HTO comprises a 5'-tagging portion and a 3'-targeting portion in 5' to 3' order,

[0151] The 5'-tagging portion comprises (i) a templating portion comprising a nucleotide sequence that non-hybridizes to the target nucleic acid and (ii) an initial hairpin structure comprising an initial double-stranded stem and a single-stranded loop,

[0152] The 3'-targeting portion comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0153] The above primer is located upstream of the HTO;

[0154] (b) a step of contacting the resultant of step (a) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the HTO;

[0155] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the HTO, which cleavage releases a fragment containing the 5'-tagging portion of the HTO;

[0156] (c) a step of self-extension of the fragment using a DNA polymerase having the 5' nuclease activity under conditions in which the initial hairpin structure is maintained;

[0157] The 3'-end of the fragment extends along the templating region to generate an extended sequence complementary to the templating region, thereby generating a self-extended hairpin structure comprising an extended double-stranded stem and the single-stranded loop,

[0158] The self-extended hairpin structure has a Tm that is controllable by the sequence and / or length of the fragment,

[0159] The Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure,

[0160] The above HTO has a reporter molecule and a quencher molecule,

[0161] The reporter molecule and the quencher molecule are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state; and

[0162] (d) a step of detecting the presence of the self-extended hairpin structure by measuring a signal provided from the self-extended hairpin structure;

[0163] The presence of the self-extended hairpin structure indicates the presence of the target nucleic acid.

[0164]

[0165] In describing the components of the present disclosure, terms such as first, second, A, B, (a), (b), (i), (ii), etc. may be used. These terms are only intended to distinguish the components from other components, and the nature, order, or sequence of the components are not limited by the terms.

[0166] The method according to the present disclosure utilizes sequential events occurring upon probe hybridization, namely, cleavage and self-extension of a Hairpin-Tagging Oligonucleotide (HTO); generation of a self-extended hairpin structure; and detection of the self-extended hairpin structure, which is referred to as the HTO Cleavage and Self-Extension (HTOCE) assay.

[0167] HTO and its truncated structures used in the present disclosure are illustrated in FIG. 1, and FIG. 2 illustrates examples of HTOs with reporter and quencher molecules linked at various locations. Furthermore, specific implementation examples of HTOCE assays depending on the locations at which the reporter and quencher molecules are linked are schematically illustrated in FIGS. 3 to 8.

[0168] The HTOCE assay is described in detail as follows:

[0169]

[0170] Step (a): Hybridization of target nucleic acid with primer and HTO

[0171] According to the present disclosure, first, a target nucleic acid in a sample is hybridized with a primer and a hairpin-tagging oligonucleotide (HTO).

[0172] The terms “target nucleic acid,” “target nucleic acid sequence,” or “target sequence,” as used herein, mean a nucleic acid sequence to be detected, which anneals or hybridizes with a probe or primer under hybridization, annealing, or amplification conditions.

[0173] The target nucleic acid includes both double-stranded and single-stranded nucleic acids. The target nucleic acid sequence includes sequences initially present in the nucleic acid sample as well as sequences newly generated in the reaction.

[0174] The target nucleic acid includes all DNA (gDNA and cDNA), RNA molecules, and hybrids thereof (chimeric nucleic acids). The sequence may be double-stranded or single-stranded.

[0175] The term "sample" as used herein means a cell, tissue, or fluid from a biological source, or any other medium that can be beneficially evaluated according to the present disclosure, and includes viruses, bacteria, tissues, cells, blood, serum, plasma, lymph, milk, urine, feces, ocular fluid, saliva, semen, brain extracts, spinal fluid, appendix, spleen, and tonsil tissue extracts, amniotic fluid, ascites, and non-biological samples (e.g., food and water). The sample also includes natural-occurring nucleic acid molecules isolated from a biological source, and synthetic nucleic acid molecules.

[0176] The term "primer," as used herein, refers to an oligonucleotide capable of acting as an initiator of synthesis when the conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (template) are present: the presence of nucleotides and a polymerization agent, such as DNA polymerase, and an appropriate temperature and pH. The primer must be sufficiently long to prime the synthesis of the extension product in the presence of the polymerization agent. The exact length of the primer will vary depending on many factors, including temperature, application, and the source of the primer.

[0177] The term "probe" as used herein refers to a single-stranded nucleic acid molecule containing a hybridization site(s) for a target nucleic acid sequence. In the present invention, HTO serves as a probe.

[0178] In particular, the probe and primer are single-stranded deoxyribonucleotide molecules. The probe or primer used in the present disclosure may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. The probe or primer may also include ribonucleotides.

[0179] The term "annealing" or "priming" as used herein means the juxtaposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to produce a nucleic acid molecule complementary to the template nucleic acid or a portion thereof.

[0180] The terms "hybridize," "hybridizing," or "hybridization," as used herein, refer to the formation of a double strand by non-covalent association between two complementary single-stranded polynucleotides under specific hybridization conditions or stringent conditions. Hybridization can occur when the complementarity between the two nucleic acid strands is perfect (a perfect match), or even when some bases mismatches are present. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

[0181] Hybridization of primers and HTO with target nucleic acids can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridization and washing cycles, buffer components, and their pH and ionic strength can vary depending on various factors, including the length and GC content of the oligonucleotides (primer and HTO) and the target nucleotide sequence. For example, when using relatively short oligonucleotides, it is preferable to select low stringency conditions. Detailed conditions for hybridization can be found in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and M. L. M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. NY (1999).

[0182] The terms “annealing” and “hybridization” are not different and are used interchangeably in this specification.

[0183] In the present disclosure, the primer and HTO comprise nucleotide sequences that hybridize to a target nucleic acid. Specifically, the primer comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid, and the HTO comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid.

[0184] The expression herein that an oligonucleotide (e.g., a primer or HTO) "comprises a nucleotide sequence that hybridizes" to another oligonucleotide (e.g., a target nucleic acid) means that all or part of the sequence of said oligonucleotide comprises a complementary nucleotide sequence necessary for hybridization with all or part of the sequence of the other oligonucleotide. Furthermore, when referring to hybridization between a portion within an oligonucleotide and another oligonucleotide herein, the portion may be regarded as an individual oligonucleotide and hybridization between the other oligonucleotides may be expressed.

[0185] The term "complementary" as used herein means sufficiently complementary to allow a primer or probe to selectively hybridize to a target nucleic acid under certain annealing conditions or stringent conditions, and includes both "substantially complementary" and "perfectly complementary," specifically, perfectly complementary.

[0186] The 5'-tagging portion of HTO comprises a nucleotide sequence that non-hybridizes to a target nucleic acid. The expression herein that one oligonucleotide (e.g., the 5'-tagging portion of HTO) "comprises a nucleotide sequence that non-hybridizes" to another oligonucleotide (e.g., the target nucleic acid) means that the one oligonucleotide and the other oligonucleotide comprise a non-complementary nucleotide sequence necessary for non-hybridization with each other. The term "non-complementary" as used herein means sufficiently non-complementary such that a primer or probe does not selectively hybridize to a specific sequence under a given annealing or stringent condition, and has a meaning encompassing both "substantially non-complementary" and "perfectly non-complementary," and specifically means completely non-complementary.

[0187] The term "Hairpin-Tagging Oligonucleotide (HTO)" as used herein refers to an oligonucleotide comprising a 5'-tagging portion and a 3'-targeting portion in a 5' to 3' order, specifically, the 5'-tagging portion comprises (i) a templating portion comprising a nucleotide sequence that non-hybridizes to the target nucleic acid and (ii) an initial hairpin structure comprising an initial double-stranded stem and a single-stranded loop, and the 3'-targeting portion comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid. Fig. 1 (a) schematically illustrates HTO.

[0188] In one embodiment, the hybridization in step (a) is performed under stringent conditions in which the 3'-targeting portion of HTO hybridizes to the target nucleic acid and the 5'-tagging portion of HTO does not hybridize to the target nucleic acid.

[0189] HTO does not require any specific length. For example, the length of HTO is 15-300 nucleotides, 15-250 nucleotides, 15-200 nucleotides, 15-150 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-300 nucleotides, 20-250 nucleotides, 20-200 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, 30-300 nucleotides, 30-200 nucleotides, 30-250 nucleotides, 30-150 nucleotides, It may have a length of 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, 30-40 nucleotides, 35-300 nucleotides, 35-200 nucleotides, 35-250 nucleotides, 35-150 nucleotides, 35-100 nucleotides, 35-80 nucleotides, 35-60 nucleotides or 35-40 nucleotides.

[0190] The 3'-targeting portion of HTO can have any length, as long as it specifically hybridizes to the target nucleic acid. For example, the 3'-targeting portion of HTO can have a length of 5-100 nucleotides, 5-80 nucleotides, 5-50 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-50 nucleotides, 20-40 nucleotides or 20-30 nucleotides.

[0191] The 5'-tagging portion of HTO is not particularly limited in length. For example, the 5'-tagging portion of HTO may have a length of 15-200 nucleotides, 15-150 nucleotides, 15-100 nucleotides, 20-200 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 15-80 nucleotides, 20-80 nucleotides, and specifically, may have a length of 10-70 nucleotides, 15-70 nucleotides, 20-70 nucleotides, 25-50 nucleotides, or 30-50 nucleotides. In the 5'-tagging region, the templating region is not particularly limited in length, for example, the templating region may have a length of 5-50 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides or 15-20 nucleotides. In the 5'-tagging region, the initial hairpin structure may have any length as long as it can form a hairpin structure. For example, the initial hairpin structure can have a length of 8-50 nucleotides, 8-40 nucleotides, 8-30 nucleotides, 8-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides or 15-20 nucleotides.

[0192] In one embodiment, the initial hairpin structure of the 5'-tagging portion can include any sequence as long as it can form a hairpin structure.

[0193] In the present disclosure, a hairpin structure comprises a sequence forming a double-stranded stem and a sequence forming a single-stranded loop. Specifically, the hairpin structure comprises, in 5' to 3' order, a 5'-arm, a single-stranded loop, and a 3'-arm capable of forming a double-stranded stem with the 5'-arm.

[0194] In one embodiment, the initial hairpin structure may comprise a 5'-terminal portion of a 3'-targeting portion of HTO. That is, one arm forming a stem in the initial hairpin structure may comprise a 5'-terminal portion of a 3'-targeting portion of HTO. In one embodiment, the 5'-terminal portion of a 3'-targeting portion of HTO included in the initial hairpin structure is 1-10 nucleotides in length, specifically, 1-5 nucleotides in length, and more specifically, 1-2 nucleotides in length.

[0195] In one embodiment, the length of the initial double-stranded stem of the initial hairpin structure is 1-30 nucleotides, 1-20 nucleotides, 1-10 nucleotides or 1-5 nucleotides.

[0196] In one embodiment, the length of the single-stranded loop of the initial hairpin structure is 1-20 nucleotides, 1-10 nucleotides, 1-5 nucleotides or 1-3 nucleotides.

[0197] In one embodiment, the initial hairpin structure may comprise a nucleic acid molecule or a non-nucleic acid molecule. In one embodiment, the single-stranded loop of the initial hairpin structure may comprise a universal base such as deoxyinosine, inosine, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, and 5-nitroindole.

[0198] In one embodiment, the single-stranded loop of the initial hairpin structure may comprise a non-nucleic acid molecule. For example, the non-nucleic acid molecule comprises spacers or bioconjugates. Specific examples of spacers include: polyethers (e.g., polyethylene glycol, polyalcohol, polypropylene glycol or mixtures of ethylene and propylene glycol), polyamine groups (e.g., spennine, spermidine and polymeric derivatives thereof), polyesters (e.g., poly(ethyl acrylate)), polyphosphodiesters, alkylenes, and combinations thereof. Specific examples of bioconjugates include: peptides, glycosides, lipids, cholesterol, phospholipids, diacylglycerols and dialkylglycerols, fatty acids, hydrocarbons, enzyme substrates, steroids, biotin, digoxigenin, carbohydrates, Polysaccharides.

[0199] In a specific embodiment, the non-nucleic acid molecule is an alkylene chain spacer containing 3-12 carbon atoms.

[0200] In a specific embodiment, when the single-stranded loop comprises a non-nucleic acid molecule, the non-nucleic acid molecule is 2-30, 2-25, 3-25, 3-15 or 3-12 nucleotides in length.

[0201] In one embodiment, the 3'-terminus of HTO may have a 3'-OH terminal.

[0202] In one embodiment, the 3'-end of the HTO can be blocked to prevent its extension. Blocking can be achieved by conventional methods. For example, blocking can be achieved by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be achieved by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as a dideoxynucleotide.

[0203] In one embodiment, the HTO comprises a label (e.g., a single label, an interactive label, etc.). In a specific embodiment, the HTO comprises an interactive dual label comprising a reporter molecule and a quencher molecule.

[0204] A fluorescence resonance energy transfer (FRET) labeling system is a representative example of an interactive labeling system, which includes a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule). In FRET, the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent. In another type of interactive labeling system, the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent. In yet another type of interactive labeling system, the energy donor is luminescent, such as bioluminescent, chemiluminescent, or electrochemiluminescent, and the acceptor is fluorescent. The donor molecule and acceptor molecules may be referred to as reporter molecules and quencher molecules, respectively, in the present disclosure. Interactive labels comprise a pair of labels that provide a detectable signal based on contact-mediated quenching (Salvatore et al., Nucleic Acids Research, 2002 (30) no. 21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). In the present disclosure, the interactive label system encompasses all instances where a signal change is induced by an interaction between at least two molecules (e.g., dyes).

[0205] Reporter molecules and quencher molecules useful as interactive markers may include any molecules known in the art. Examples include: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Phycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). Numbers in parentheses are maximum emission wavelengths in nanometers. Specifically, reporter molecules and quencher molecules include JOE, FAM, TAMRA, ROX, and fluorescein-based labels.

[0206] Suitable reporter-quencher pairs are described in various references, including: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, RP, Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patent Nos. 3,996,345 and 4,351,760.

[0207] In the present disclosure, non-fluorescent black quencher molecules capable of quenching fluorescence of a broad wavelength or a specific wavelength may be utilized. Examples of non-fluorescent black quencher molecules include BHQ (Black Hole Quencher) and DABCYL.

[0208] In the FRET label applicable to the present disclosure, the reporter molecule comprises the FRET donor and the quencher molecule comprises the remaining partner (acceptor) of the FRET. For example, a fluorescein dye is used as the reporter and a rhodamine dye is used as the quencher molecule.

[0209] In one embodiment, the HTO comprises a reporter molecule and a quencher molecule. The reporter molecule and the quencher molecule of the HTO are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure, which is generated in a manner dependent on the presence of the target nucleic acid, is maintained or dissociated into a single-stranded state. The positions of the reporter molecule and the quencher molecule that can induce quenching and unquenching are described in more detail in step (d) described below.

[0210] The primer used in the present disclosure refers to an upstream primer located upstream of an HTO. When the target nucleic acid is double-stranded, the primer and the HTO hybridize to one strand of the double-stranded target nucleic acid, and the HTO is located downstream of the primer. The primer hybridizes to a specific region (i.e., a first region of the target nucleic acid) located in the 3' direction compared to the region of the target nucleic acid strand to which the HTO hybridizes (i.e., a second region of the target nucleic acid).

[0211] In one embodiment, when the target nucleic acid is double-stranded, one strand of the double-stranded target nucleic acid comprises a first region of the target nucleic acid and a second region of the target nucleic acid. Specifically, the target nucleic acid comprises, in 3' to 5' order, (i) a first region to which the primer can hybridize and (ii) a second region to which the HTO can hybridize (see FIGS. 3 to 8).

[0212] In one embodiment, the method is performed in the presence of an additional primer that pairs with the primer to amplify the target nucleic acid. The additional primer generates additional target nucleic acids that hybridize to HTO, thereby improving the sensitivity of target detection. The additional primer may be referred to as a downstream primer.

[0213] In one embodiment, when using a primer and an additional primer, a DNA polymerase having 5' nuclease activity, as used in step (b) described below, is used for extension of the two primers, or a template-dependent nucleic acid polymerase is additionally used. The primer and the additional primer may be referred to as a forward primer and a reverse primer, respectively.

[0214] In one embodiment, the primer and / or additional primer have a dual priming oligonucleotide (DPO) structure. Oligonucleotides having a DPO structure exhibit significantly improved target specificity compared to conventional primers and probes (see WO 2006 / 095981; Chun et al., Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene, Nucleic Acid Research, 35:6e40 (2007)).

[0215]

[0216] Step (b): Release of fragments from HTO

[0217] Next, the resultant of step (a) is contacted with a DNA polymerase having 5' nuclease activity under conditions for cleavage of HTO. The primer is extended by the DNA polymerase having 5' nuclease activity, thereby inducing cleavage of the HTO, which releases a fragment comprising a 5'-tagging portion of the HTO. Fig. 1 (b) schematically shows an HTO fragment comprising a 5'-tagging portion. As shown in Fig. 1 (b), the HTO fragment comprises an initial hairpin structure and a templating portion.

[0218] In one embodiment, the primer is hybridized away from the HTO, a DNA polymerase having 5' nuclease activity promotes extension of the primer, and a DNA polymerase having 5' nuclease activity bound to the extension product of the primer cleaves the HTO.

[0219] In another embodiment, the primer hybridizes proximately to the HTO to induce cleavage of the HTO by a DNA polymerase having 5' nuclease activity, and the DNA polymerase having 5' nuclease activity bound to the primer cleaves the HTO without an extension reaction.

[0220] Therefore, cleavage of HTO can be achieved in two ways: (i) primer extension-dependent cleavage induction; and (ii) primer extension-independent cleavage induction.

[0221] Depending on the two cleavage modes described above, the primer can be positioned relative to the HTO. The primer can be positioned at a position sufficiently distant from the HTO to induce HTO cleavage in an extension-dependent manner. That is, the first and second regions of the target nucleic acid can be positioned at positions that are distant from each other. Alternatively, the primer can be positioned at a position sufficiently close to the HTO to induce HTO cleavage in an extension-independent manner. That is, the first and second regions of the target nucleic acid can be positioned at positions that are close to each other.

[0222] The term "adjacent" as used herein when referring to positions or locations means that the primer is positioned immediately adjacent to the 3'-targeting portion of the HTO to form a nick. The term also means that the primer is positioned 1-30 nucleotides, 1-20 nucleotides, or 1-15 nucleotides away from the 3'-targeting portion of the HTO.

[0223] The term "distant" as used herein when referring to a point or location includes any location or place sufficiently distant for an extension reaction to occur.

[0224] In one embodiment, the primer is positioned sufficiently distant from the HTO to induce cleavage of the HTO in an extension-dependent manner.

[0225] In one embodiment, prior art techniques for primer-mediated cleavage reactions may be applied to the present disclosure, as long as a primer hybridizing to a first region of a target nucleic acid induces cleavage of an HTO hybridized to a second region of the target nucleic acid to release a fragment comprising the 5'-tagging portion of the HTO or a portion of the 5'-tagging portion of the HTO. For example, U.S. Patent Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069, 7,381,532, and U.S. Application Publication No. 2008-0241838 may be applied to the present disclosure.

[0226] The term "conditions for cleavage of HTO" as used herein refers to conditions sufficient to cleave HTO hybridized to a target nucleic acid by a DNA polymerase having 5' nuclease activity, such as temperature, pH, ionic strength, buffer, length and sequence of oligonucleotide, and enzyme. For example, when Taq DNA polymerase is used as a DNA polymerase having 5' nuclease activity, the conditions for cleavage of HTO include Tris-HCl buffer, KCl, MgCl2, and temperature.

[0227] When HTO hybridizes to a target nucleic acid, its 3'-targeting portion participates in hybridization, and its 5'-tagging portion does not hybridize to the target nucleic acid (see (a) of FIG. 3). In this way, oligonucleotides comprising both single-stranded and double-stranded structures can be cleaved using an enzyme having 5'-nuclease activity by various techniques known in the art. In one embodiment, HTO hybridized to a target nucleic acid can be cleaved by an enzyme having 5'-nuclease activity, and specifically, by a DNA polymerase having 5'-nuclease activity.

[0228] The cleavage site of HTO varies depending on the type of primer, the hybridization position of the primer, and the cleavage conditions (see U.S. Patent Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069, and 7,381,532 or U.S. Application Publication No. 2008-0241838). Considering the cleavage position of HTO according to the cleavage method, it is necessary to design HTO (especially the 5'-tagging portion of HTO) so that the cleavage fragment of HTO can maintain a self-extending hairpin structure (i.e., the initial hairpin structure).

[0229] Many conventional techniques can be used for the cleavage reaction of HTO to release fragments containing the 5'-tagging moiety or a portion of the 5'-tagging moiety.

[0230] In summary, there may be three cleavage sites in the cleavage reaction of step (b). The first cleavage site is the junction site between the hybridization site (3'-targeting site) and the non-hybridization site (5'-tagging site) of HTO. The second cleavage site is a site located several nucleotides away in the 3'-direction from the 3'-end of the 5'-tagging site of HTO. The second cleavage site may be located at the 5'-end part of the 3'-targeting site of HTO. The third cleavage site is a site located several nucleotides away in the 5'-direction from the 3'-end of the 5'-tagging site of HTO.

[0231] In one embodiment, the position at which cleavage of HTO by a DNA polymerase having 5' nuclease activity begins as the primer is extended is at the start of the double strand between HTO and the target nucleic acid or at a position 1-3 nucleotides away from the start of the double strand.

[0232] In this regard, the phrase "an HTO fragment comprising a 5'-tagging portion of HTO or a part of a 5'-tagging portion" in the context of cleavage of HTO by a DNA polymerase having a 5' nuclease activity used herein means (i) a 5'-tagging portion, (ii) a 5'-terminal portion of the 5'-tagging portion and a 3'-targeting portion (e.g., the first nucleotide at the 5'-terminus of the 3'-targeting portion, the first to second nucleotides at the 5'-terminus of the 3'-targeting portion, the first to third nucleotides at the 5'-terminus of the 3'-targeting portion, the first to fourth nucleotides at the 5'-terminus of the 3'-targeting portion, or the first to fifth nucleotides at the 5'-terminus of the 3'-targeting portion), and (iii) a 5'-tagging portion. Used to include a portion. The phrase "a fragment comprising the 5'-tagging portion of HTO or a portion of the 5'-tagging portion" may be referred to as a "fragment" or an "HTO fragment".

[0233] The term "part" when used in reference to HTO, such as a portion of the 5'-tagging portion of HTO and a portion of the 5'-terminal portion of the 3'-targeting portion of HTO, means a nucleotide sequence consisting of 1-40, 1-30, 1-20, 1-15, 1-10 or 1-5 nucleotides, specifically 1, 2, 3 or 4 nucleotides.

[0234] In one embodiment, the HTO has a blocker moiety comprising a blocker that is resistant to cleavage by a DNA polymerase having 5' nuclease activity, and the blocker moiety is used to control the initial cleavage site and / or subsequent cleavage.

[0235] For example, to induce cleavage at the junction site between the hybridization portion (3'-targeting portion) and the non-hybridization portion (5'-tagging portion) of HTO, the 5'-end portion of the 3'-targeting portion of HTO can be blocked with a blocker.

[0236] In one embodiment, the DNA polymerase having 5' nuclease activity is a thermostable DNA polymerase having 5' nuclease activity.

[0237] In the present disclosure, a suitable DNA polymerase having 5' nuclease activity is a thermostable DNA polymerase obtained from various bacterial species, which are Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus, and Aquifex aeolieus. Most preferably, the thermostable DNA polymerase is Taq polymerase.

[0238] Alternatively, the present disclosure may utilize a DNA polymerase having 5' nuclease activity that is modified to have less polymerase activity.

[0239] In one embodiment, the conditions for cleavage of HTO include an extension reaction of the primer.

[0240] In one embodiment, a template-dependent polymerase is used for extension of the primer, and the template-dependent polymerase is the same enzyme as a DNA polymerase having 5' nuclease activity.

[0241] Alternatively, a template-dependent polymerase is used for extension of the primer, and the template-dependent polymerase is an enzyme different from a DNA polymerase having 5'nuclease activity.

[0242]

[0243] Step (c): Self-extension of HTO fragments and generation of self-extended hairpin structures.

[0244] A fragment released from HTO self-extends using a DNA polymerase having the 5' nuclease activity under conditions that maintain the initial hairpin structure of the fragment. The 3'-end of the fragment extends along the templating region to generate an extension sequence complementary to the templating region, thereby generating a self-extended hairpin structure comprising an extended double-stranded stem and the single-stranded loop. That is, the templating region of the fragment serves as a template for self-extension of the fragment. The fragment self-extends under conditions that maintain the initial hairpin structure to generate a self-extended hairpin structure.

[0245] The templating portion may contain any sequence, as long as it contains a non-complementary sequence to the target nucleic acid. Furthermore, the templating portion may contain any sequence, as long as it can serve as a template for self-extension of the fragment released from the HTO. In one embodiment, the templating portion, separate from the initial hairpin structure, may also contain a sequence that forms a hairpin structure on its own.

[0246] In the present disclosure, HTO hybridized to a target nucleic acid is cleaved, and the resulting fragment self-extends to form a self-extended hairpin structure. Conversely, in the absence of a target nucleic acid, HTO is not cleaved, and thus a self-extended hairpin structure is not formed.

[0247] The expression "the hairpin structure is maintained" used in reference to the hairpin structure in this specification means that the hairpin structure is not disrupted and forms (or is maintained) the hairpin structure by forming a double-stranded stem and a single-stranded loop.

[0248] In the present disclosure, it is sufficient that the formation of the hairpin structure of the initial hairpin structure occurs prior to the self-extension reaction of the fragment. The initial hairpin structure of the HTO may or may not form a hairpin structure during the step of hybridizing the HTO to the target nucleic acid or the step of cleaving the HTO.

[0249] The term "self-extension" as used herein refers to a reaction in which an oligonucleotide itself is extended using a portion of the oligonucleotide as a template.

[0250] The term "self-extended hairpin structure" as used herein refers to a hairpin structure generated by the self-extension reaction in one oligonucleotide. The self-extended hairpin structure generated by the present disclosure includes a double-stranded stem (i.e., an extended double-stranded stem) longer than the initial double-stranded stem of the initial hairpin structure due to the templating portion and the extended sequence generated using the templating portion as a template. Therefore, the Tm of the initial hairpin structure and the Tm of the self-extended hairpin structure are different from each other, and specifically, the Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure.

[0251] In one embodiment, the Tm of the self-extended hairpin structure is 8°C or more, 10°C or more, 15°C or more, 20°C or more, 25°C or more, or 28°C or more higher than the Tm of the initial hairpin structure. Specifically, the Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure by 8°C to 30°C, 10°C to 30°C, 15°C to 30°C, 20°C to 30°C, 25°C to 30°C, 8°C to 28°C, 10°C to 28°C, 15°C to 28°C, 20°C to 28°C, or 25°C to 28°C, and more specifically, by 25°C to 30°C, 25°C to 29°C, 25°C to 28°C, 27°C to 30°C, 27°C to 29°C, or 27°C to 28°C.

[0252] The Tm of the self-extended hairpin structure can be controlled by (i) the sequence and / or length of the initial hairpin structure, (ii) the sequence and / or length of the templating portion, or (iii) the sequence and / or length of the initial hairpin structure and the sequence and / or length of the templating portion.

[0253] In one embodiment, the self-extended hairpin structure has a Tm that is controllable by the sequence and / or length of the fragment.

[0254] The term "Tm" as used herein refers to the melting temperature at which half of the population of double-stranded nucleic acid molecules dissociates into single-stranded molecules. The Tm value is determined by the length and G / C content of the hybridizing nucleotides. The Tm value can be calculated by conventional methods such as the Wallace rule (RB Wallace et al., Nucleic Acids Research, 6:3543-3547 (1979)) and the nearest-neighbor method (SantaLucia J. Jr. et al., Biochemistry, 35:3555-3562 (1996)); Sugimoto N. et al., Nucleic Acids Res., 24:4501-4505 (1996)).

[0255] As used herein, the term "Tm of the self-extended hairpin structure" refers to the Tm of the extended double-stranded stem. The term "Tm of HTO" refers to the Tm of the initial hairpin structure of HTO and / or the Tm of the 3'-targeting portion of HTO. The term "Tm of the initial hairpin structure" refers to the Tm of the initial double-stranded stem of the initial hairpin structure. The term "Tm of the 3'-targeting portion of HTO" refers to the Tm of the hybridization between the 3'-targeting portion of HTO and the target nucleic acid.

[0256] In one embodiment, Tm means the actual Tm under the reaction conditions actually used.

[0257]

[0258] Step (d): Detection of the presence of self-extended hairpin structures

[0259] According to the present disclosure, since a self-extended hairpin structure is generated only when a target nucleic acid is present, the presence of the self-extended hairpin structure indicates the presence of the target nucleic acid. Accordingly, step (d) detects the presence of the self-extended hairpin structure by measuring a signal provided from the self-extended hairpin structure, thereby detecting the presence of the target nucleic acid.

[0260] The presence of a self-extended hairpin structure is detected by measuring a signal provided by a label (e.g., a single label, an interactive label) incorporated into the self-extended hairpin structure. In one embodiment, the label may be derived from HTO and / or incorporated into the self-extending dimer during the self-extension reaction.

[0261] In one embodiment, the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which the self-extended hairpin structure can be maintained.

[0262] In one embodiment, the self-extended hairpin structure comprises a reporter molecule and a quencher molecule, and the signal is provided from the reporter molecule and the quencher molecule included in the self-extended hairpin structure.

[0263] In one embodiment, the reporter molecule and quencher molecule of the self-extended hairpin structure are derived from the HTO, specifically, an HTO fragment.

[0264] In one embodiment, the reporter molecule and quencher molecule derived from the HTO are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state.

[0265] The term "quenching" as used herein refers to a phenomenon in which a signal (e.g., fluorescence) from a reporter molecule is reduced by a quencher molecule. The term "unquenching" as used herein refers to a phenomenon in which a quenched signal from a reporter molecule is restored. For example, if a signal from a reporter molecule increases again, this can be expressed as unquenching. The terms "quenching" and "unquenching" as used herein are interpreted as relative concepts. For example, "unquenching" can be interpreted as a lower efficiency or level of quenching compared to "quenching." In other words, quenching of a signal from a reporter molecule does not only mean complete disappearance of the signal, but also encompasses a relative decrease in the signal compared to a case in which the quenching phenomenon does not occur. In addition, unquenching of a signal from a reporter molecule does not only mean complete recovery of the signal, but also encompasses a relative increase in the signal compared to a case in which the quenching phenomenon occurs.

[0266] The applicable locations of reporter molecules and quencher molecules and the principle of signal generation according to them are described in more detail through specific implementation examples, but are not limited thereto.

[0267]

[0268] Implementation Example 1. Location where quenching or unquenching is induced depending on whether the templating site is single-stranded or double-stranded.

[0269] In one embodiment, quenching or unquenching between the reporter molecule and the quencher molecule can be induced depending on whether the templating portion of the HTO is single-stranded or double-stranded.

[0270] In one embodiment, when the target nucleic acid is absent, the templating portion of the HTO exists in a single-stranded form. On the other hand, when the target nucleic acid is present, the templating portion of the HTO can form a double-stranded structure by hybridizing with an extension sequence generated by the formation of a self-extended hairpin structure dependent on the presence of the target nucleic acid.

[0271] In one embodiment, the reporter molecule and the quencher molecule are positioned such that (i) when the templating portion of the HTO exists as a single strand, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the templating portion of the HTO forms a double strand by hybridization with the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

[0272] The expression "a reporter molecule and a quencher molecule are in close proximity to each other" as used herein means that (i) an oligonucleotide containing both a reporter molecule and a quencher molecule forms a specific conformational structure, such as a random coil or hairpin structure, so that the reporter molecule and the quencher molecule therein are three-dimensionally adjacent to each other, or (ii) an oligonucleotide containing a reporter molecule and an oligonucleotide containing a quencher molecule form a double strand so that the reporter molecule and the quencher molecule are in close proximity to each other.

[0273] The expression "the reporter molecule and the quencher molecule are separated from each other" as used herein means that (i) an oligonucleotide having both a reporter molecule and a quencher molecule forms a double strand with another oligonucleotide, thereby changing a specific conformational structure of the oligonucleotide, such as uncoiling a random coil or disruption of a hairpin structure, thereby separating the reporter molecule and the quencher molecule from each other, or (ii) an oligonucleotide having a double stranded reporter molecule and an oligonucleotide having a quencher molecule dissociate from each other, thereby separating the reporter molecule and the quencher molecule from each other.

[0274] In a specific embodiment, the reporter molecule and the quencher molecule are both linked to the templating portion of the HTO (see (i) of FIG. 2 and FIG. 3). In another specific embodiment, one of the reporter molecule and the quencher molecule is linked to the single-stranded loop and the other of the reporter molecule and the quencher molecule is linked to the templating portion of the HTO (see (ii) of FIG. 2 and FIG. 4).

[0275] When the templating portion exists as a single strand, the templating portion forms a random coil structure, so that the reporter molecule and the quencher molecule are close to each other, and the quencher molecule quenches the signal from the reporter molecule. On the other hand, when the templating portion forms a double strand, the reporter molecule and the quencher molecule are spaced apart from each other, so that the quencher molecule unquenchs the signal from the reporter molecule.

[0276] In another specific embodiment, one of the reporter molecule and the quencher molecule may be linked to the templating portion and the other may be linked to a nucleotide immediately adjacent to the 3'-end of the templating portion or may be linked to a position spaced apart by some nucleotides, for example, 1-5 nucleotides, specifically, 1-3 nucleotides, and more specifically, 1-2 nucleotides (i.e., a portion of the 5'-end of the initial hairpin structure) (see (iii) of FIG. 2 ). In this case, even if the initial hairpin structure forms a hairpin structure, the single-stranded templating portion forms a random coil structure such that one of the reporter molecule and the quencher molecule linked to the templating portion and the other one linked to the initial hairpin structure are positioned in close proximity to each other, thereby inducing quenching between the reporter molecule and the quencher molecule.

[0277] In one embodiment, the reporter molecule and the quencher molecule are separated from each other by 10 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, 10 to 20 nucleotides, or 10 to 15 nucleotides.

[0278] In one embodiment, the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which the self-extended hairpin structure can be maintained. For example, when a target nucleic acid is present, the extended double-stranded stem of the self-extended hairpin structure, which is generated depending on the presence of the target nucleic acid, exists as a double strand, and the reporter molecule and the quencher molecule of the self-extended hairpin structure are spaced apart from each other, so that the quencher molecule unquenches the signal from the reporter molecule. On the other hand, when the target nucleic acid is absent, the self-extended hairpin structure is not generated, and the templating portion of HTO exists as a single strand, forming a random coil structure, whereby the reporter molecule and the quencher molecule come into close proximity to each other, so that the quencher molecule quenches the signal from the reporter molecule (see FIGS. 3 and 4 ). That is, the quenching or unquenching between the reporter molecule and the quencher molecule changes depending on the presence or absence of the target nucleic acid at the temperature at which the signal is measured, and by measuring this change, only the signal provided from the self-extended hairpin structure can be measured.

[0279]

[0280] Implementation Example 2. Location where quenching or unquenching is induced depending on whether the hairpin structure is maintained or dissociated into a single-stranded state.

[0281] In one embodiment, quenching or unquenching between the reporter molecule and the quencher molecule can be induced depending on whether the initial hairpin structure is maintained or dissociated into a single-stranded state.

[0282] In one embodiment, the reporter molecule and the quencher molecule are positioned such that (i) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are spaced apart from each other such that the quencher molecule unquenches a signal from the reporter molecule, and (ii) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are positioned close to each other such that the quencher molecule quenches a signal from the reporter molecule.

[0283] In a specific embodiment, the reporter molecule and the quencher molecule are both linked to the initial hairpin structure. More specifically, one of the reporter molecule and the quencher molecule is linked to the single-stranded loop, and the other of the reporter molecule and the quencher molecule is linked to the initial double-stranded stem (e.g., a portion of the 5'-end of the 5'-arm) (see (iv) of FIG. 2 and FIG. 5 ).

[0284] When the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are spaced apart from each other, so that the quencher molecule unquenches the signal from the reporter molecule, and when the initial hairpin structure dissociates into a single-stranded state, the hairpin structure forms a random coil structure, so that the reporter molecule and the quencher molecule are close to each other, so that the quencher molecule quenches the signal from the reporter molecule.

[0285] In another embodiment, the reporter molecule and the quencher molecule are positioned such that (i) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are in close proximity to each other such that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are spaced apart from each other such that the quencher molecule unquenchs a signal from the reporter molecule.

[0286] In a specific embodiment, the reporter molecule and the quencher molecule are both linked to the initial hairpin structure. More specifically, the reporter molecule and the quencher molecule are linked to the 5'-arm and the 3'-arm, respectively, forming an initial double-stranded stem of the initial hairpin structure (see (v) of FIG. 2 and FIG. 6 ). More specifically, in the initial double-stranded stem, one of the reporter molecule and the quencher molecule is linked to a nucleotide on the 5'-arm (i.e., the strand adjacent to the templating site), and the other of the reporter molecule and the quencher molecule is linked to a nucleotide on the 3'-arm (i.e., the strand adjacent to the targeting site) located opposite the nucleotide to which the reporter molecule or the quencher molecule is linked. Here, the opposite portion is a position where, when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are close to each other so that the quencher molecule can quench a signal from the reporter molecule. For example, the opposite portion is a portion that includes 1 to 9 nucleotides, 1 to 8 nucleotides, 1 to 7 nucleotides, or 1 to 6 nucleotides on either side of the nucleotide complementary to the nucleotide to which the reporter molecule or the quencher molecule is linked, and specifically, a portion that includes 1 to 8 nucleotides, and more specifically, 1 to 6 nucleotides.

[0287] In another specific embodiment, the reporter molecule and the quencher molecule are each linked to a portion of both ends of the single-stranded loop (see (vi) of FIG. 2 and FIG. 7).

[0288] In another specific embodiment, one of the reporter molecule and the quencher molecule is linked to the 3'-arm (specifically, the 3'-terminal portion of the 3'-arm) forming the initial double-stranded stem, and the other is linked to the 3'-terminal portion of the templating portion (see (vii) of FIG. 2).

[0289] When the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are in close proximity to each other, and the quencher molecule quenches the signal from the reporter molecule. On the other hand, when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are separated from each other, and the quencher molecule unquenches the signal from the reporter molecule.

[0290] In one embodiment, an HTO comprising a reporter molecule and a quencher molecule in an initial hairpin structure is cleaved in a manner dependent on the presence of a target nucleic acid to release a fragment comprising the hairpin structure, and the released fragment undergoes a self-extension reaction to produce a self-extended hairpin structure comprising the reporter molecule and the quencher molecule. Here, both the initial hairpin structure (HTO or HTO fragment) and the self-extended hairpin structure comprise the reporter molecule and the quencher molecule. That is, in the initial hairpin structure of HTO, the initial hairpin structure of HTO fragment, and the self-extended hairpin structure, the reporter molecule and the quencher molecule are all quenched or unquenched by the same principle (i.e., depending on whether their hairpin structures are maintained or dissociated into a single-stranded state) (see FIGS. 5, 6, and 7). In this case, it is difficult to measure only the signal provided from the self-extended hairpin structure in the low temperature range where both the initial hairpin structure and the self-extended hairpin structure exist as double strands. Furthermore, it is also difficult to measure only the signal provided from the self-extended hairpin structure in the high temperature range where both the initial hairpin structure and the self-extended hairpin structure dissociate into a single strand state. In other words, it is difficult to distinguish whether the signal measured in the two temperature ranges is a signal provided from the initial hairpin structure of HTO or a signal provided from the self-extended hairpin structure. To distinguish this, the present disclosure utilizes the fact that the Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure.

[0291] In one embodiment, the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which (i) the self-extended hairpin structure is maintained and (ii) the initial hairpin structure dissociates into a single-stranded state. For example, when a target nucleic acid is present, the self-extended hairpin structure generated dependently on the presence of the target nucleic acid is maintained, such that the reporter molecule and the quencher molecule of the self-extended hairpin structure are in close proximity to each other, such that the quencher molecule quenches the signal from the reporter molecule. On the other hand, when the target nucleic acid is absent, the self-extended hairpin structure is not generated, and the initial hairpin structure of HTO dissociates into a single-stranded state, such that the reporter molecule and the quencher molecule of HTO are separated from each other, such that the quencher molecule unquenchs the signal from the reporter molecule. That is, the quenching or unquenching between the reporter molecule and the quencher molecule changes depending on the presence or absence of the target nucleic acid at the temperature at which the signal is measured, and by measuring this change, only the signal provided from the self-extended hairpin structure can be measured.

[0292]

[0293] Implementation Example 3. Locations where quenching or unquenching is induced depending on whether the labeled portion is single-stranded or double-stranded.

[0294] In one embodiment, the method is performed in the presence of a Labeled Portion Hybridizing Oligonucleotide (LPHO) comprising a nucleotide sequence that hybridizes to a labeled portion.

[0295] The term "labeled portion" as used herein refers to a nucleotide sequence including a nucleotide to which a reporter molecule is linked, a nucleotide to which a quencher molecule is linked, and intervening nucleotides. For example, when a quencher molecule and a reporter molecule are linked to the 2nd nucleotide and the 12th nucleotide from the 5'-end of the templating portion of an HTO, respectively, the labeled portion refers to a total of 11 nucleotide sequences including the 2nd nucleotide to which the quencher molecule is linked, the intervening nucleotides from the 3rd nucleotide to the 11th nucleotide, and the 12th nucleotide to which the reporter molecule is linked.

[0296] In one embodiment, quenching or unquenching between the reporter molecule and the quencher molecule can be induced depending on whether the labeling portion of the HTO is single-stranded or double-stranded.

[0297] In one embodiment, the label moiety is included in the templating portion of the HTO. In this case, the reporter molecule and the quencher molecule are positioned so that (i) when the label moiety exists as a single strand, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the label moiety forms a double strand by hybridization with the LPHO or the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule (see FIG. 8). In a specific embodiment, the quencher molecule and the reporter molecule may be linked to each of the two terminal portions of the templating portion. In another specific embodiment, the quencher molecule and the reporter molecule can be linked to the 5'-terminal portion of the templating region and the 5'-terminal portion of the 5'-arm of the initial hairpin structure, respectively (see FIG. 9).

[0298] The term "Labeled Portion Hybridization Oligonucleotide (LPHO)" as used herein refers to an oligonucleotide comprising a nucleotide sequence that hybridizes to the label portion and which provides a signal of different intensity depending on whether the LPHO hybridizes to the label portion. For example, when the LPHO hybridizes to the label portion of an HTO, the reporter molecule and the quencher molecule of the HTO are spaced apart, thereby causing the quencher molecule to unquench a signal from the reporter molecule, whereas when the LPHO is not hybridized to the label portion of an HTO and the label portion of the HTO is not hybridized with any other oligonucleotide, the reporter molecule and the quencher molecule of the HTO are in close proximity to each other, thereby causing the quencher molecule to quench a signal from the reporter molecule.

[0299] As long as the LPHO used in the present disclosure provides signals of different intensities depending on whether it hybridizes with the labeling moiety of the HTO, the LPHO may hybridize to the entire sequence of the labeling moiety or only to a portion of the sequence. Accordingly, the LPHO comprises a nucleotide sequence that hybridizes to the entire or a portion of the sequence of the labeling moiety (see FIG. 9).

[0300] In one embodiment, the nucleotide sequence of the LPHO should be designed to include a nucleotide sequence that hybridizes to the labeling moiety. Those skilled in the art will appreciate that the LPHO may have additional nucleotide sequences in addition to the nucleotide sequence that hybridizes to the aforementioned labeling moiety.

[0301] In one embodiment, the 3'-end of the LPHO can be blocked to prevent its extension. Blocking can be achieved by conventional methods. For example, blocking can be achieved by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane diol, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be achieved by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide lacking a 3'-hydroxyl group, such as a dideoxynucleotide.

[0302] The length of the above LPHO can vary. For example, LPHO can be 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-20 nucleotides, 5-10 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 7-20 nucleotides, 7-10 nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 10-15 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, The length is 15-40 nucleotides, 15-30 nucleotides, 15-20 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides or 20-30 nucleotides.

[0303] The LPHO used in the present disclosure comprises a nucleotide sequence that hybridizes to the labeling portion of HTO.

[0304] When the HTOCE assay is performed in the presence of LPHO, if the target nucleic acid is present in the sample, the self-extended hairpin structure is generated, and the generation of the self-extended hairpin structure prevents the formation of an HTO / LPHO hybrid between the labeling portion of the HTO and the LPHO. On the other hand, if the target nucleic acid is not present in the sample, the self-extended hairpin structure is not generated, but instead the HTO / LPHO hybrid is formed.

[0305] In one embodiment, when the target nucleic acid is present, the self-extended hairpin structure can be generated by (i) self-extending the 3'-end of the fragment prior to hybridization between the label portion of the fragment and the LPHO, (ii) self-extending the 3'-end of the fragment after hybridization between the label portion of the fragment and the LPHO, thereby cleaving the LPHO, or (iii) both (i) and (ii).

[0306] The LPHO can hybridize to the label portion of the fragment before self-extension of the fragment and can participate in the self-extension reaction. In one embodiment, when the LPHO hybridizes to the label portion of the fragment before self-extension of the fragment, the self-extension of the fragment cleaves or displaces the LPHO from the fragment. For example, as the 3'-end of the fragment self-extends, the LPHO hybridized to the label portion of the fragment before self-extension of the fragment can be released (dissociated) from the fragment or cleaved by strand displacement.

[0307] In one embodiment, cleavage and / or strand displacement of LPHO by self-extension of the fragment is affected by the type of enzyme (e.g., DNA polymerase) or reaction conditions.

[0308] In one embodiment, the formation of the self-extended hairpin structure prevents the formation of the HTO / LPHO hybrid by favoring hybridization between the label portion of the self-extended hairpin structure and the extension sequence over hybridization between the label portion of the fragment (or HTO) and the LPHO. That is, depending on the presence of the target nucleic acid, the HTO is cleaved and self-extended, thereby generating the self-extended hairpin structure, while the HTO is consumed. This reduces the possibility of hybridization between the label portion of the HTO and the LPHO.

[0309] In one embodiment, the formation of the self-extended hairpin structure prevents the formation of the HTO / LPHO hybrid due to cleavage of the LPHO during the self-extension of step (c). That is, the LPHO is cleaved and removed, and the possibility of hybridization between HTO and LPHO is reduced.

[0310] In one embodiment, the self-extended hairpin structure has a Tm different from the Tm of the HTO / LPHO hybrid. In particular, the formation of the self-extended hairpin structure can be advantageous over the formation of the HTO / LPHO hybrid by the difference in the stability of the two products, for example, the Tm value. For example, the Tm of the self-extended hairpin structure can be at least 1°C higher, at least 2°C higher, at least 3°C ​​higher, at least 4°C higher, at least 5°C higher, at least 10°C higher, at least 20°C higher, at least 30°C higher, or at least 40°C higher than the Tm of the HTO / LPHO hybrid.

[0311] In one embodiment, the HTO / LPHO hybridization has a Tm that is controllable by the sequence and / or length of the LPHO.

[0312] Considering the numerous factors and issues described above, a suitable LPHO must be designed. Details on this can be found in International Application No. PCT / KR2024 / 002516.

[0313] In one embodiment, the measurement of the signal provided from the self-extended hairpin structure can be performed at a temperature at which (i) the self-extended hairpin structure is maintained, and (ii) the HTO / LPHO hybrid dissociates into a single-stranded state. For example, when a target nucleic acid is present, a self-extended hairpin structure generated dependently on the presence of the target nucleic acid is maintained, and the reporter molecule and the quencher molecule of the self-extended hairpin structure are separated from each other, such that the quencher molecule unquenches the signal from the reporter molecule. On the other hand, when the target nucleic acid is absent, a self-extended hairpin structure is not generated, but instead, an HTO / LPHO hybrid may be formed, but the HTO / LPHO hybrid dissociates into a single-stranded state, such that the HTO containing the label moiety forms a random coil structure, whereby the reporter molecule and the quencher molecule come into close proximity to each other, such that the quencher molecule quenches the signal from the reporter molecule. That is, the quenching or unquenching between the reporter molecule and the quencher molecule changes depending on the presence or absence of the target nucleic acid at the temperature at which the signal is measured, and by measuring this change, only the signal provided from the self-extended hairpin structure can be measured.

[0314]

[0315] The method of the present disclosure further comprises repeating all or part of steps (a)-(d) including denaturation between the repetition cycles. This repetition amplifies the target nucleic acid and / or a signal indicating the presence of the target nucleic acid. A unit of amplification comprising repetition of the above series of reactions (e.g., all of (a)-(d)) is referred to as a "cycle."

[0316] Denaturation can be accomplished by known techniques, including, but not limited to, heat, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, denaturation can be accomplished by heat treatment at temperatures ranging from 80 to 105°C. General methods for accomplishing such treatments are disclosed in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001)].

[0317] The detection of step (d) above can be performed in real time, at an end-point, or at a predetermined time interval. When the present disclosure further comprises a step of repeating steps (a)-(d), signal detection is performed for each cycle of repetition at a predetermined temperature (i.e., in real time), at the end of the repetition at the predetermined temperature (i.e., in an end-point manner), or at each predetermined time interval during the repetition at the predetermined temperature. Preferably, the detection can be performed for each cycle of repetition in real time to improve detection efficiency and quantification.

[0318] In the above repetition, the method of the present disclosure is carried out in the presence of a downstream primer, and in particular by a real-time PCR method.

[0319] In one embodiment, steps (a)-(d) are performed in one reaction vessel or some of steps (a)-(d) are performed in separate reaction vessels.

[0320] The present disclosure does not require that the target nucleic acid to be detected and / or amplified have any particular sequence or length, including all DNA (gDNA and cDNA) and RNA molecules.

[0321] When using mRNA as a starting material, a reverse transcription step is essential prior to the annealing step, and details of this are disclosed in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, KF et al., Nucleic Acids Res. 16:10366 (1988)]. For the reverse transcription reaction, random hexamers or oligonucleotide dT primers that hybridize to mRNA can be used.

[0322] In one embodiment, the target nucleic acid used in the present disclosure is a pre-amplified nucleic acid. The use of a pre-amplified nucleic acid significantly increases the sensitivity and specificity of target detection in the present disclosure.

[0323] Furthermore, the present disclosure is useful for detecting nucleotide variations. In particular, the target nucleic acid comprises a nucleotide variation. As used herein, the term "nucleotide variation" refers to any single or multiple nucleotide substitutions, deletions, or insertions in a DNA sequence at a specific location among contiguous DNA segments having similar sequences. Such contiguous DNA segments include a gene or any other region of a chromosome. Such nucleotide variations may be mutations or polymorphic allelic variations. For example, nucleotide variations detected in the present disclosure include single nucleotide polymorphisms (SNPs), mutations, deletions, insertions, substitutions, and translocations. Examples of nucleotide variations include various variations in the human genome (e.g., variations in the methylenetetrahydrofolate reductase (MTHFR) gene), variations associated with drug resistance in pathogens, and variations associated with the development of cancer. The term "nucleotide variation" as used herein includes any variation at a specific position within a nucleic acid sequence. That is, the term "nucleotide variation" includes the wild type and any mutant form thereof at a specific position within a nucleic acid sequence.

[0324]

[0325] II. Composition for detecting target nucleic acid in a sample by HTOCE assay

[0326] In another aspect, the present disclosure provides a composition for detecting a target nucleic acid in a sample by an HTO Cleavage and Self-Extension assay, comprising:

[0327] (a) primer;

[0328] The primer comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid; and

[0329] (b) Hairpin-Tagging Oligonucleotide (HTO);

[0330] The above HTO comprises a 5'-tagging portion and a 3'-targeting portion in 5' to 3' order,

[0331] The 5'-tagging portion comprises (i) a templating portion comprising a nucleotide sequence that non-hybridizes to the target nucleic acid and (ii) an initial hairpin structure comprising an initial double-stranded stem and a single-stranded loop,

[0332] The 3'-targeting portion comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid,

[0333] The above primer is located upstream of the above HTO,

[0334] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the HTO, which cleavage releases a fragment containing the 5'-tagging portion of the HTO;

[0335] The 3'-end of the fragment extends along the templating region to generate an extended sequence complementary to the templating region, thereby generating a self-extended hairpin structure comprising an extended double-stranded stem and the single-stranded loop,

[0336] The self-extended hairpin structure has a Tm that is controllable by the sequence and / or length of the fragment,

[0337] The Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure,

[0338] The above HTO has a reporter molecule and a quencher molecule,

[0339] The reporter molecule and the quencher molecule are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state; and

[0340] The self-extended hairpin structure provides a signal indicating the presence of the target nucleic acid.

[0341]

[0342] Since the second aspect of the present disclosure follows the principles of the first aspect described above, common content between them is omitted to avoid excessive duplication that would complicate the present specification.

[0343]

[0344] A composition for detecting a target nucleic acid using the HTOCE assay according to the present disclosure (hereinafter, referred to as the HTOCE composition) reacts with the target nucleic acid and provides a signal dependent on the presence of the target nucleic acid. Specifically, the HTOCE composition provides a change in signal as the target nucleic acid is amplified.

[0345] In one embodiment, the signal dependent on the presence of the target nucleic acid is a signal provided from a self-extended hairpin structure.

[0346] In one embodiment, the reaction with the target nucleic acid may include an amplification reaction, such as a signal amplification reaction and / or a nucleic acid amplification reaction.

[0347] In one embodiment, the HTOCE composition has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal remains constant even when the target nucleic acid is present.

[0348] As used herein, "signal-constant temperature range" refers to a temperature range in which a composition for detecting a target nucleic acid provides a constant signal despite the presence of a target nucleic acid. The signal-constant temperature range is a temperature range in which the composition for detecting a target nucleic acid provides a constant signal even after a reaction time has elapsed, which may also be referred to herein as a temperature range in which the composition for detecting a target nucleic acid does not provide a significant signal, or a temperature range in which the composition does not provide a signal indicating the presence of a target nucleic acid.

[0349] As used herein, "constant signal" means that the signal does not substantially change during a reaction between a target nucleic acid and a composition for detecting the target nucleic acid (e.g., a target nucleic acid amplification reaction). That is, the term "constant signal" means all or any signal pattern excluding a significant signal change that occurs due to amplification of the existing target nucleic acid. In particular, the constant signal means no signal change. For example, if the signal does not exceed the intensity of the background signal or the intensity of the signal that can occur in the absence of the target nucleic acid during the amplification reaction, it can be expressed as "the signal is constant." As used herein, the constant signal may be used interchangeably with a signal that does not change or a signal that does not show a change.

[0350] As used herein, the term "signal-change temperature range" refers to a temperature range over which a composition for detecting a target nucleic acid provides a signal that changes dependently on the presence of a target nucleic acid. The signal-change temperature range is a temperature range over which a composition for detecting a target nucleic acid provides a signal that changes over time, and may also be referred to herein as a temperature range over which a composition for detecting a target nucleic acid provides a significant signal, or a temperature range over which a signal indicating the presence of a target nucleic acid is provided.

[0351] International Application Publication No. WO2022-265463 discloses that various signal generation methods known in the art for detecting target nucleic acids have a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal does not change even when the target nucleic acid is present.

[0352] In addition, WO2022-265463 discloses that various conventional signal generation methods can be classified into the following three types according to the number and order of signal-changing temperature ranges and signal-constant temperature ranges:

[0353] (i) UnderSC-type signal generation method having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range;

[0354] (ii) an InterSC-type signal generation method having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges; and

[0355] (iii) An OverSC-type signal generation method having a melting characteristic in which the signal-change temperature range is higher than the signal-constant temperature range.

[0356] Compositions for implementing the above three types of signal generation methods can be classified into UnderSC-type compositions, InterSC-type compositions, and OverSC-type compositions, respectively.

[0357] The method for detecting a target nucleic acid by the HTOCE assay according to the present disclosure and the HTOCE composition according to the present disclosure can also be applied to the contents described in WO2022-265463. In the present disclosure, a self-extended hairpin structure is linked to a reporter molecule and a quencher molecule derived from an HTO fragment, thereby providing a signal indicating the presence of a target nucleic acid. The reporter molecule and the quencher molecule can be linked to various positions as long as quenching or unquenching can be induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state. The number and order of the signal-changing temperature range and the signal-constant temperature range change depending on the position at which the reporter molecule and the quencher molecule are linked. That is, the HTOCE assay according to the present disclosure can be applied as any one of the three signal generation methods (UnderSC-type, InterSC-type, and OverSC-type) described in WO2022-265463 depending on the label position. In this regard, the contents of the first embodiment to the third embodiment described above together with the drawings will be described in more detail, but are not limited thereto.

[0358]

[0359] HTOCE assay and composition for generating underSC-type signals

[0360] The UnderSC-type signal generation method has a signal-changing temperature range (SChTR) in which a signal changes depending on the presence of a target nucleic acid and a signal-constant temperature range (SCoTR) in which a signal remains constant even when the target nucleic acid is present. The UnderSC-type signal generation method has a melting characteristic in which the signal-changing temperature range is lower than the signal-constant temperature range. Among the various embodiments of the HTOCE assay according to the present disclosure, the aforementioned embodiment 1 is classified as an UnderSC-type signal generation method.

[0361] Specific embodiments of the UnderSC-type HTOCE composition are described in more detail with reference to FIGS. 10 to 15.

[0362] In one embodiment, the reporter molecule and the quencher molecule are positioned such that (i) when the templating portion of the HTO is single-stranded, the reporter molecule and the quencher molecule are in close proximity to each other such that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the templating portion of the HTO forms a double strand by hybridization with the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other such that the quencher molecule unquenchs a signal from the reporter molecule. For example, the reporter molecule and the quencher molecule are both linked to the templating portion of the HTO. In another example, one of the reporter molecule and the quencher molecule is linked to the single-stranded loop and the other of the reporter molecule and the quencher molecule is linked to the templating portion of the HTO.

[0363]

[0364] (UnderSC-type HTOCE composition 1) A composition comprising HTO in which a reporter molecule and a quencher molecule are linked to a templating portion of HTO

[0365] In one embodiment, an HTOCE composition comprising an HTO (e.g., (i) of FIG. 2) in which a reporter molecule and a quencher molecule are linked to the templating portion of the HTO can be used as an UnderSC-type composition.

[0366] Figure 10 shows the conformational changes of HTO in (i) a signal-change temperature range and (ii) a signal-constant temperature range, in the absence of a target nucleic acid or prior to a reaction between the HTOCE composition and the target nucleic acid.

[0367] In one embodiment, the initial hairpin structure of HTO does not necessarily need to form a hairpin structure throughout the signal-change temperature range, but specifically, (i) of FIG. 10 shows the HTO morphology at a temperature where the initial hairpin structure of HTO is maintained even within the signal-change temperature range.

[0368] As shown in (i) and (ii) of Fig. 10, the templating portion of HTO exists as a single strand in both the signal-changing temperature range and the signal-constant temperature range. The single-stranded templating portion forms a random coil structure, thereby bringing the reporter molecule and the quencher molecule into close proximity, causing the quencher molecule to quench the signal from the reporter molecule.

[0369] Figure 11 shows the morphological changes of the self-extended hairpin structure in (i) a signal-change temperature range and (ii) a signal-constant temperature range after the reaction between the HTOCE composition and the target nucleic acid.

[0370] As shown in (i) of Fig. 11, at a temperature within the signal-changing temperature range, the self-extended hairpin structure is maintained so that the templating portion forms a double strand, thereby causing the reporter molecule and the quencher molecule to separate from each other, and the quencher molecule to unquench a signal from the reporter molecule. As shown in (ii) of Fig. 11, at a temperature within the signal-constant temperature range, the self-extended hairpin structure dissociates into a single-stranded state. The self-extended hairpin structure dissociated into a single-stranded state forms a random coil structure, thereby causing the reporter molecule and the quencher molecule to approach each other, and the quencher molecule to quench a signal from the reporter molecule.

[0371] In the signal-change temperature range, when the target nucleic acid is not present ((i) of FIG. 10), the quencher molecule quenches the signal from the reporter molecule, whereas when the target nucleic acid is present ((i) of FIG. 11), the quencher molecule unquenchs the signal from the reporter molecule. That is, the HTOCE composition provides a signal change dependent on the presence of the target nucleic acid in the signal-change temperature range.

[0372] In a signal-constant temperature range, the quencher molecule quenches the signal from the reporter molecule in the absence of the target nucleic acid ((ii) of FIG. 10) and in the presence of the target nucleic acid ((ii) of FIG. 11). That is, the HTOCE composition provides a constant signal even in the presence of the target nucleic acid in the signal-constant temperature range.

[0373] Figure 12A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the initial, middle, and late cycles of steps (a)-(d) of an HTOCE assay using HTO with reporter and quencher molecules linked to the templating portion of HTO. Figure 12B shows a plot in which the three melt curves of Figure 12A are merged.

[0374] Specifically, the numbers in row (i) in FIG. 12A, "100", "50" and "0" represent the content ratio of HTO existing in the forms (i) and (ii) of FIG. 10, and the numbers in row (ii) in FIG. 12A, "0", "50" and "100" represent the content ratio of self-extended hairpin structures existing in the forms (i) and (ii) of FIG. 11. The content ratios in rows (i) and (ii) above change as the cycle increases, i.e., as the target nucleic acid is amplified. In particular, a graph such as FIG. 12B can be obtained by merging melt curves for each of the early, middle and late cycles.

[0375] As shown in FIG. 12B, the HTOCE composition has a signal-change temperature range in which a signal changes depending on the presence of a target nucleic acid and a signal-constant temperature range in which a signal is constant even when the target nucleic acid is present. In addition, the HTOCE composition is an Under-Signal-Change-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range.

[0376] In one embodiment, the signal-change temperature range and the signal-constant temperature range are determined dependently on the Tm of the self-extended hairpin structure. Therefore, the signal-change temperature range and the signal-constant temperature range can be controlled by adjusting the Tm of the self-extended hairpin structure.

[0377]

[0378] (UnderSC-type HTOCE composition 2) A composition comprising HTO in which a reporter molecule is linked to a single-stranded loop of HTO and a quencher molecule is linked to a templating site.

[0379] In one embodiment, an HTOCE composition comprising an HTO (e.g., (ii) of FIG. 2) in which a reporter molecule is linked to a single-stranded loop of the HTO and a quencher molecule is linked to a templating portion can be used as an UnderSC-type composition.

[0380] Figure 13 shows the conformational changes of HTO at temperatures within (i) a signal-change temperature range and (ii) a signal-constant temperature range, in the absence of a target nucleic acid or prior to a reaction between the HTOCE composition and the target nucleic acid.

[0381] In one embodiment, the initial hairpin structure of HTO does not necessarily need to form a hairpin structure throughout the signal-change temperature range, but specifically, (i) of FIG. 13 shows the HTO morphology at a temperature where the initial hairpin structure of HTO is maintained even within the signal-change temperature range.

[0382] As shown in (i) and (ii) of Fig. 13, the templating portion of HTO exists as a single strand in both the signal-changing temperature range and the signal-constant temperature range. The single-stranded templating portion forms a random coil structure, thereby bringing the reporter molecule and the quencher molecule into close proximity, causing the quencher molecule to quench the signal from the reporter molecule.

[0383] Figure 14 shows the morphological changes of the self-extended hairpin structure in (i) a signal-change temperature range and (ii) a signal-constant temperature range after the reaction between the HTOCE composition and the target nucleic acid.

[0384] As shown in (i) of Fig. 14, at a temperature within the signal-changing temperature range, the self-extended hairpin structure is maintained so that the templating portion forms a double strand, thereby causing the reporter molecule and the quencher molecule to separate from each other, and the quencher molecule to unquench a signal from the reporter molecule. As shown in (ii) of Fig. 14, at a temperature within the signal-constant temperature range, the self-extended hairpin structure dissociates into a single-stranded state. The self-extended hairpin structure dissociated into a single-stranded state forms a random coil structure, thereby causing the reporter molecule and the quencher molecule to approach each other, and the quencher molecule to quench a signal from the reporter molecule.

[0385] In the signal-change temperature range, when the target nucleic acid is not present ((i) of FIG. 13), the quencher molecule quenches the signal from the reporter molecule, whereas when the target nucleic acid is present ((i) of FIG. 14), the quencher molecule unquenchs the signal from the reporter molecule. That is, the HTOCE composition provides a signal change dependent on the presence of the target nucleic acid in the signal-change temperature range.

[0386] In a signal-constant temperature range, the quencher molecule quenches the signal from the reporter molecule in the absence of the target nucleic acid ((ii) of FIG. 13) and in the presence of the target nucleic acid ((ii) of FIG. 14). That is, the HTOCE composition provides a constant signal even in the presence of the target nucleic acid in the signal-constant temperature range.

[0387] Figure 15A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the initial, middle, and late cycles of steps (a)-(d) of an HTOCE assay using HTO with reporter and quencher molecules linked to the templating portion of HTO. Figure 15B shows a plot in which the three melt curves of Figure 15A are merged.

[0388] Specifically, the numbers in row (i) in FIG. 15A, "100", "50" and "0" represent the content ratio of HTO existing in the forms (i) and (ii) of FIG. 13, and the numbers in row (ii) in FIG. 15A, "0", "50" and "100" represent the content ratio of self-extended hairpin structures existing in the forms (i) and (ii) of FIG. 14. The content ratios in rows (i) and (ii) above change as the cycle increases, i.e., as the target nucleic acid is amplified. In particular, a graph such as FIG. 15B can be obtained by merging melt curves for each of the early, middle and late cycles.

[0389] As shown in FIG. 15B, the HTOCE composition has a signal-change temperature range in which a signal changes depending on the presence of a target nucleic acid and a signal-constant temperature range in which a signal is constant even when the target nucleic acid is present. In addition, the HTOCE composition is an Under-Signal-Change-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range.

[0390] In one embodiment, the signal-change temperature range and the signal-constant temperature range are determined dependently on the Tm of the self-extended hairpin structure. Therefore, the signal-change temperature range and the signal-constant temperature range can be controlled by adjusting the Tm of the self-extended hairpin structure.

[0391]

[0392] HTOCE assay and composition using InterSC-type signal generation method

[0393] The InterSC-type signal generation method has a signal-changing temperature range (SChTR) in which a signal changes depending on the presence of a target nucleic acid, and two signal-constant temperature ranges (SCoTR) in which a signal is constant even when the target nucleic acid is present. The InterrSC-type signal generation method has a melting characteristic in which the signal-changing temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges. Among the various embodiments of the HTOCE assay according to the present disclosure, the aforementioned Embodiment 2 and Embodiment 3 are classified as the InterSC-type signal generation method.

[0394] Specific embodiments of the InterSC-type signal HTOCE composition are described in more detail with reference to FIGS. 16 to 27.

[0395] In one embodiment, (i) the reporter molecule and the quencher molecule are positioned such that (i-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenches a signal from the reporter molecule, and (i-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are positioned close to each other so that the quencher molecule quenches a signal from the reporter molecule; Or (ii) the reporter molecule and the quencher molecule are such that (ii-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are in close proximity to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule. For example, the reporter molecule and the quencher molecule are both connected to the initial hairpin structure.

[0396] In another embodiment, the HTOCE composition further comprises a Labeled Portion Hybridizing Oligonucleotide (LPHO) comprising a nucleotide sequence that hybridizes to a labeled portion. The reporter molecule and the quencher molecule are positioned such that (i) when the labeled portion is single-stranded, the reporter molecule and the quencher molecule are in close proximity to each other such that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the labeled portion forms a duplex by hybridizing with the LPHO or the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other such that the quencher molecule unquenchs a signal from the reporter molecule.

[0397]

[0398] (InterSC-type HTOCE composition 1) A composition comprising HTO in which a reporter molecule is linked to a single-stranded loop of HTO and a quencher molecule is linked to a nascent double-stranded stem

[0399] In one embodiment, an HTOCE composition comprising an HTO (e.g., (iv) of FIG. 2) in which a reporter molecule is linked to a single-stranded loop of the HTO and a quencher molecule is linked to a nascent double-stranded stem can be used as an InterSC-type composition.

[0400] FIG. 16 shows the conformational changes of HTO in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, in the absence of a target nucleic acid or prior to a reaction between the HTOCE composition and the target nucleic acid.

[0401] As shown in (i) of Fig. 16, the initial hairpin structure of HTO is maintained at a temperature within the first signal-constant temperature range, and the reporter molecule and the quencher molecule are spaced apart from each other, so that the quencher molecule unquenches a signal from the reporter molecule. As shown in (ii) and (iii) of Fig. 16, the initial hairpin structure dissociates into a single-stranded state at a temperature within the signal-change temperature range and the second signal-constant temperature range. The initial hairpin structure dissociated into the single-stranded state forms a random coil structure, whereby the reporter molecule and the quencher molecule come into close proximity to each other, so that the quencher molecule quenches a signal from the reporter molecule.

[0402] Figure 17 shows the morphological changes of the self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after the reaction between the HTOCE composition and the target nucleic acid.

[0403] As shown in (i) and (ii) of Fig. 17, the self-extended hairpin structure is maintained at a temperature within the first signal-constant temperature range and the signal-changing temperature range, and the reporter molecule and the quencher molecule are spaced apart from each other, such that the quencher molecule unquenches a signal from the reporter molecule. As shown in (iii) of Fig. 17, the self-extended hairpin structure dissociates into a single-stranded state at a temperature within the second signal-constant temperature range. The self-extended hairpin structure dissociated into a single-stranded state forms a random coil structure, such that the reporter molecule and the quencher molecule come into close proximity to each other, such that the quencher molecule quenches a signal from the reporter molecule.

[0404] In the first signal-constant temperature range, the quencher molecule unquenches the signal from the reporter molecule when the target nucleic acid is absent ((i) of FIG. 16) and when the target nucleic acid is present ((i) of FIG. 17). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the first signal-constant temperature range.

[0405] In the second signal-constant temperature range, the quencher molecule quenches the signal from the reporter molecule when the target nucleic acid is not present ((iii) of FIG. 16) and when the target nucleic acid is present ((iii) of FIG. 17). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the second signal-constant temperature range.

[0406] In the signal-change temperature range, when the target nucleic acid is not present ((ii) of FIG. 16), the quencher molecule quenches the signal from the reporter molecule, whereas when the target nucleic acid is present ((ii) of FIG. 17), the quencher molecule unquenchs the signal from the reporter molecule. That is, the HTOCE composition provides a signal change dependent on the presence of the target nucleic acid in the signal-change temperature range.

[0407] Figure 18A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the early, middle, and late cycles of steps (a)-(d) of an HTOCE assay using HTO with a reporter molecule linked to the single-stranded loop of HTO and a quencher molecule linked to the nascent double-stranded stem. Figure 18B shows a plot merging the three melt curves of Figure 18A.

[0408] Specifically, the numbers in row (i) in FIG. 18A, "100", "50" and "0" represent the content ratio of HTO existing in the forms (i) to (iii) of FIG. 16, and the numbers in row (ii) in FIG. 18A, "0", "50" and "100" represent the content ratio of self-extended hairpin structures existing in the forms (i) to (iii) of FIG. 17. The content ratios in rows (i) and (ii) change as the cycle increases, i.e., as the target nucleic acid is amplified. In particular, a graph such as FIG. 18B can be obtained by merging melt curves for each of the early, middle and late cycles.

[0409] As shown in FIG. 18B, the HTOCE composition has a signal-change temperature range in which a signal changes depending on the presence of a target nucleic acid and two signal-constant temperature ranges in which a signal is constant even when the target nucleic acid is present. In addition, the HTOCE composition is an InterSC-type composition having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

[0410] In one embodiment, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range are determined dependently on the Tm of the initial hairpin structure and the Tm of the self-extended hairpin structure. Therefore, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range can be controlled by adjusting the Tm of the initial hairpin structure and the Tm of the self-extended hairpin structure.

[0411]

[0412] (InterSC-type HTOCE composition 2) A composition comprising HTO in which a reporter molecule and a quencher molecule are linked to the initial double-stranded stem of HTO

[0413] In one embodiment, an HTOCE composition comprising an HTO (e.g., (v) of FIG. 2) in which a reporter molecule and a quencher molecule are linked to the initial double-stranded stem of the HTO can be used as an InterSC composition.

[0414] FIG. 19 shows the conformational changes of HTO in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, in the absence of a target nucleic acid or prior to a reaction between the HTOCE composition and the target nucleic acid.

[0415] As shown in (i) of Fig. 19, the initial hairpin structure of HTO is maintained at a temperature within the first signal-constant temperature range, and the reporter molecule and the quencher molecule are brought into close proximity to each other, such that the quencher molecule quenches the signal from the reporter molecule. As shown in (ii) and (iii) of Fig. 19, the initial hairpin structure dissociates into a single-stranded state at a temperature within the signal-change temperature range and the second signal-constant temperature range. As a result, the reporter molecule and the quencher molecule are separated from each other, such that the quencher molecule unquenches the signal from the reporter molecule.

[0416] FIG. 20 shows the morphological changes of the self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after the reaction between the HTOCE composition and the target nucleic acid.

[0417] As shown in (i) and (ii) of FIG. 20, the self-extended hairpin structure is maintained at a temperature within the first signal-constant temperature range and the signal-changing temperature range, and the reporter molecule and the quencher molecule are brought into close proximity to each other, such that the quencher molecule quenches a signal from the reporter molecule. As shown in (iii) of FIG. 20, the self-extended hairpin structure dissociates into a single-stranded state at a temperature within the second signal-constant temperature range. As a result, the reporter molecule and the quencher molecule are separated from each other, such that the quencher molecule unquenchs a signal from the reporter molecule.

[0418] In the first signal-constant temperature range, the quencher molecule quenches the signal from the reporter molecule when the target nucleic acid is not present ((i) of FIG. 19) and when the target nucleic acid is present ((i) of FIG. 20). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the first signal-constant temperature range.

[0419] In the second signal-constant temperature range, the quencher molecule unquenches the signal from the reporter molecule when the target nucleic acid is not present ((iii) of FIG. 19) and when the target nucleic acid is present ((iii) of FIG. 20). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the second signal-constant temperature range.

[0420] In the signal-change temperature range, when the target nucleic acid is not present ((ii) of FIG. 19), the quencher molecule unquenches the signal from the reporter molecule, whereas when the target nucleic acid is present ((ii) of FIG. 20), the quencher molecule quenches the signal from the reporter molecule. That is, the HTOCE composition provides a signal change dependent on the presence of the target nucleic acid in the signal-change temperature range.

[0421] Figure 21A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the early, middle, and late cycles of steps (a)-(d) of an HTOCE assay using HTO with a reporter molecule and a quencher molecule linked to the initial double-stranded stem of HTO. Figure 21B shows a plot merging the three melt curves of Figure 21A.

[0422] Specifically, the numbers in row (i) in FIG. 21A, "100", "50" and "0" represent the content ratio of HTO existing in the forms (i) to (iii) of FIG. 19, and the numbers in row (ii) in FIG. 21A, "0", "50" and "100" represent the content ratio of self-extended hairpin structures existing in the forms (i) to (iii) of FIG. 20. The content ratios in rows (i) and (ii) change as the cycle increases, i.e., as the target nucleic acid is amplified. In particular, a graph such as FIG. 21B can be obtained by merging melt curves for each of the early, middle and late cycles.

[0423] As shown in FIG. 21B, the HTOCE composition has a signal-change temperature range in which a signal changes depending on the presence of a target nucleic acid and two signal-constant temperature ranges in which a signal is constant even when the target nucleic acid is present. In addition, the HTOCE composition is an InterSC-type composition having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

[0424] In one embodiment, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range are determined dependently on the Tm of the initial hairpin structure and the Tm of the self-extended hairpin structure. Therefore, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range can be controlled by adjusting the Tm of the initial hairpin structure and the Tm of the self-extended hairpin structure.

[0425]

[0426] (InterSC-type HTOCE composition 3) Composition comprising HTO with a reporter molecule and a quencher molecule linked to a single-stranded loop of HTO

[0427] In one embodiment, an HTOCE composition comprising an HTO (e.g., (vi) of FIG. 2) in which a reporter molecule and a quencher molecule are linked to a single-stranded loop of the HTO can be used as an InterSC-type composition.

[0428] FIG. 22 shows the conformational changes of HTO in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range, in the absence of a target nucleic acid or prior to a reaction between the HTOCE composition and the target nucleic acid.

[0429] As shown in (i) of Fig. 22, the initial hairpin structure of HTO is maintained at a temperature within the first signal-constant temperature range, and the reporter molecule and the quencher molecule are brought into close proximity to each other, such that the quencher molecule quenches the signal from the reporter molecule. As shown in (ii) and (iii) of Fig. 22, the initial hairpin structure dissociates into a single-stranded state at a temperature within the signal-change temperature range and the second signal-constant temperature range. As a result, the reporter molecule and the quencher molecule are separated from each other, such that the quencher molecule unquenches the signal from the reporter molecule.

[0430] Figure 23 shows the morphological changes of the self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after the reaction between the HTOCE composition and the target nucleic acid.

[0431] As shown in (i) and (ii) of Fig. 23, the self-extended hairpin structure is maintained at a temperature within the first signal-constant temperature range and the signal-changing temperature range, and the reporter molecule and the quencher molecule are brought into close proximity to each other, such that the quencher molecule quenches a signal from the reporter molecule. As shown in (iii) of Fig. 23, the self-extended hairpin structure dissociates into a single-stranded state at a temperature within the second signal-constant temperature range. As a result, the reporter molecule and the quencher molecule are separated from each other, such that the quencher molecule unquenchs a signal from the reporter molecule.

[0432] In the first signal-constant temperature range, the quencher molecule quenches the signal from the reporter molecule when the target nucleic acid is not present ((i) of FIG. 22) and when the target nucleic acid is present ((i) of FIG. 23). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the first signal-constant temperature range.

[0433] In the second signal-constant temperature range, the quencher molecule unquenches the signal from the reporter molecule when the target nucleic acid is absent ((iii) of FIG. 22) and when the target nucleic acid is present ((iii) of FIG. 23). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the second signal-constant temperature range.

[0434] In the signal-change temperature range, when the target nucleic acid is not present ((ii) of FIG. 22), the quencher molecule unquenches the signal from the reporter molecule, whereas when the target nucleic acid is present ((ii) of FIG. 23), the quencher molecule quenches the signal from the reporter molecule. That is, the HTOCE composition provides a signal change dependent on the presence of the target nucleic acid in the signal-change temperature range.

[0435] Figure 24A shows the content (or abundance) ratios of HTO and self-extended hairpin structures and their melt curves in the early, middle, and late cycles of steps (a)-(d) of an HTOCE assay using HTO with reporter and quencher molecules linked to the single-stranded loop of HTO. Figure 24B shows a plot merging the three melt curves of Figure 24A.

[0436] Specifically, the numbers in row (i) in FIG. 24A, "100", "50" and "0" represent the content ratio of HTO existing in the forms (i) to (iii) of FIG. 22, and the numbers in row (ii) in FIG. 24A, "0", "50" and "100" represent the content ratio of self-extended hairpin structures existing in the forms (i) to (iii) of FIG. 23. The content ratios in rows (i) and (ii) change as the cycle increases, i.e., as the target nucleic acid is amplified. In particular, a graph such as FIG. 21B can be obtained by merging melt curves for each of the early, middle and late cycles.

[0437] As shown in FIG. 24B, the HTOCE composition has a signal-change temperature range in which a signal changes depending on the presence of a target nucleic acid and two signal-constant temperature ranges in which a signal is constant even when the target nucleic acid is present. In addition, the HTOCE composition is an InterSC-type composition having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

[0438] In one embodiment, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range are determined dependently on the Tm of the initial hairpin structure and the Tm of the self-extended hairpin structure. Therefore, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range can be controlled by adjusting the Tm of the initial hairpin structure and the Tm of the self-extended hairpin structure.

[0439]

[0440] (InterSC-type HTOCE composition 4) Composition comprising HTO and LPHO, in which a reporter molecule and a quencher molecule are linked to the templating portion of HTO

[0441] In one embodiment, an HTOCE composition comprising an HTO (e.g., (i) of FIG. 2) in which a reporter molecule and a quencher molecule are linked to a templating portion of the HTO and an LPHO that hybridizes to the labeling portion (i.e., the templating portion) of the HTO can be used as an InterSC-type composition.

[0442] FIG. 25 shows the conformational changes of HTO and LPHO (i.e., HTO / LPHO hybrid) in the absence of target nucleic acid or prior to reaction between the HTOCE composition and the target nucleic acid in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range.

[0443] As shown in (i) of Fig. 25, at a temperature within the first signal-constant temperature range, the label portion of HTO forms a double strand by hybridization with LPHO. As a result, the reporter molecule and the quencher molecule are separated from each other, and the quencher molecule unquenches the signal from the reporter molecule. In the first signal-constant temperature range, the formation of an HTO / LPHO hybrid between the label portion of HTO and LPHO is essential, but the maintenance of the initial hairpin structure of HTO is not essential.

[0444] As shown in (ii) and (iii) of FIG. 25, at temperatures within the signal-change temperature range and the second signal-constant temperature range, the labeling moiety of HTO exists as a single strand to form a random coil structure, thereby bringing the reporter molecule and the quencher molecule into close proximity to each other, and the quencher molecule quenches the signal from the reporter molecule.

[0445] Figure 26 shows the morphological changes of the self-extended hairpin structure in (i) a first signal-constant temperature range, (ii) a signal-change temperature range, and (iii) a second signal-constant temperature range after the reaction between the HTOCE composition and the target nucleic acid.

[0446] As shown in (i) and (ii) of FIG. 26, the self-extended hairpin structure is maintained at a temperature within the first signal-constant temperature range and the signal-changing temperature range, so that the label moiety forms a double strand, whereby the reporter molecule and the quencher molecule are separated from each other, so that the quencher molecule unquenches a signal from the reporter molecule. As shown in (iii) of FIG. 26, the self-extended hairpin structure dissociates into a single-stranded state at a temperature within the second signal-constant temperature range, so that the label moiety also exists as a single strand. The self-extended hairpin structure dissociated into a single-stranded state forms a random coil structure, whereby the reporter molecule and the quencher molecule come into close proximity to each other, so that the quencher molecule quenches a signal from the reporter molecule.

[0447] In the first signal-constant temperature range, the quencher molecule unquenches the signal from the reporter molecule when the target nucleic acid is not present ((i) of FIG. 25) and when the target nucleic acid is present ((i) of FIG. 26). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the first signal-constant temperature range.

[0448] In the second signal-constant temperature range, the quencher molecule quenches the signal from the reporter molecule when the target nucleic acid is not present ((iii) of FIG. 125) and when the target nucleic acid is present ((iii) of FIG. 26). That is, the HTOCE composition provides a constant signal even when the target nucleic acid is present in the second signal-constant temperature range.

[0449] In the signal-change temperature range, when the target nucleic acid is not present ((ii) of FIG. 25), the quencher molecule quenches the signal from the reporter molecule, whereas when the target nucleic acid is present ((ii) of FIG. 26), the quencher molecule unquenchs the signal from the reporter molecule. That is, the HTOCE composition provides a signal change dependent on the presence of the target nucleic acid in the signal-change temperature range.

[0450] Figure 27A shows the content (or abundance) ratios of HTO / LPHO hybrids and self-extended hairpin structures and their melt curves in the initial, middle, and late cycles of steps (a)-(d) of the HTOCE assay using HTO and LPHO, in which reporter and quencher molecules are linked to the templating portion of HTO. Figure 27B shows a plot in which the three melt curves of Figure 27A are merged.

[0451] Specifically, the numbers in row (i) in FIG. 27A, "100", "50" and "0" represent the content ratio of HTO / LPHO hybrids existing in the forms (i) to (iii) of FIG. 25, and the numbers in row (ii) in FIG. 27A, "0", "50" and "100" represent the content ratio of self-extended hairpin structures existing in the forms (i) to (iii) of FIG. 26. The content ratios in rows (i) and (ii) change as the cycle increases, i.e., as the target nucleic acid is amplified. In particular, a graph such as FIG. 27B can be obtained by merging melt curves for each of the early, middle and late cycles.

[0452] As shown in FIG. 27B, the HTOCE composition has a signal-change temperature range in which a signal changes depending on the presence of a target nucleic acid and two signal-constant temperature ranges in which a signal is constant even when the target nucleic acid is present. In addition, the HTOCE composition is an InterSC-type composition having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

[0453] In one embodiment, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range are determined dependently on the Tm of the HTO / LPHO hybrid and the Tm of the self-extended hairpin structure. Therefore, the first signal-constant temperature range, the signal-change temperature range, and the second signal-constant temperature range can be controlled by adjusting the Tm of the HTO / LPHO hybrid and the Tm of the self-extended hairpin structure.

[0454]

[0455] In one embodiment, the HTOCE composition according to the present disclosure provides a signal dependent on the presence of a target nucleic acid (i.e., a signal indicating the presence of a self-extended hairpin structure) at any temperature within the signal-change temperature range.

[0456] In one embodiment, the HTOCE composition additionally comprises a DNA polymerase having 5'nuclease activity.

[0457] In one embodiment, the HTOCE composition further comprises an additional primer.

[0458] The HTOCE composition according to the present disclosure may optionally include reagents necessary for performing a target nucleic acid amplification reaction (e.g., a PCR reaction), such as a buffer, a DNA polymerase cofactor, and deoxyribonucleotide-5-triphosphate. Optionally, the composition may also include various polynucleotide molecules, a reverse transcriptase enzyme, various buffers and reagents, and an antibody that inhibits DNA polymerase activity. The composition may also include reagents necessary for performing positive control and negative control reactions. The optimal amount of reagents to be used in a particular reaction can be readily determined by one of ordinary skill in the art having the benefit of the present disclosure. The components of the composition may be present in separate containers, or multiple components may be present in a single container.

[0459]

[0460] III. Method for detecting multiple target nucleic acids using HTOCE composition

[0461] In another aspect, the present disclosure provides a method for detecting n target nucleic acids in a sample, comprising:

[0462] (a) a step of incubating a sample suspected of containing one or more of the n target nucleic acids with n target nucleic acid detection compositions in one reaction vessel, and detecting a signal at n detection temperatures;

[0463] The above n is an integer greater than or equal to 2,

[0464] The above incubation comprises multiple reaction cycles, and the detection of the signal is performed in one or more of the multiple reaction cycles,

[0465] Each of the above n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the above n detection temperatures in the presence of the corresponding target nucleic acid,

[0466] Among the above n target nucleic acid detection compositions, the i target nucleic acid detection composition provides a change in a signal indicating the presence of the i target nucleic acid at the i detection temperature among the n detection temperatures in the presence of the i target nucleic acid, and provides a constant signal at other detection temperatures.

[0467] The above i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature.

[0468] Within the temperature range including all of the above n detection temperatures, the composition for detecting the i-th target nucleic acid has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the i-th target nucleic acid is present.

[0469] The composition for detecting the above target nucleic acid is,

[0470] (i) an UnderSC-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range;

[0471] (ii) an InterSC-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges, and

[0472] (iii) any one of the OverSC-type compositions having a melting characteristic in the signal-change temperature range higher than the signal-constant temperature range;

[0473] At least one of the above n target nucleic acid detection compositions is an HTOCE composition that generates a signal according to the above-described HTOCE assay, and;

[0474] (b) A step of determining the presence of n target nucleic acids from the signals detected in the above step (a), wherein the step of determining the presence of the i-th target nucleic acid is determined by a change in the signal detected at the i-th detection temperature.

[0475]

[0476] Since the third aspect of the present disclosure utilizes the method of the first aspect and the composition of the second aspect described above, common contents between them are omitted to avoid excessive duplication that would complicate the present specification.

[0477]

[0478] A method for detecting n target nucleic acids according to the present disclosure uses (i) various combinations of an UnderSC-type HTOCE composition and an InterSC-type HTOCE composition, and (ii) various combinations of an HTOCE composition according to the present disclosure with one or more of an UnderSC-type, an InterSC-type, and an OverSC-type composition that employs various signal generation methods known in the art for target nucleic acid detection.

[0479] In particular, by controlling the signal-change temperature ranges of n compositions for detecting n target nucleic acids so that only signals indicating the presence of the corresponding target nucleic acid are provided at each detection temperature, the presence of a specific target nucleic acid can be confirmed by a signal change measured only at a specific detection temperature.

[0480]

[0481] Hereinafter, the present disclosure will be described in detail as follows.

[0482]

[0483] Step (a): Incubation and signal detection

[0484] First, a sample suspected of containing one or more of the n target nucleic acids is mixed with n target nucleic acid detection compositions in one reaction vessel and incubated.

[0485] In one embodiment, the n target nucleic acids may comprise nucleotide variations. For example, one of the n target nucleic acids may comprise one type of nucleotide variation, and the other may comprise a different type of nucleotide variation.

[0486] The n target nucleic acids herein may be genes from n different organisms, n different genes from the same organism, or a combination thereof.

[0487] In the present invention, the incubation reaction means any reaction that induces a change in signal dependent on the presence of the corresponding target nucleic acid at the corresponding detection temperature, as each target nucleic acid reacts with the corresponding target nucleic acid detection composition.

[0488] In the present disclosure, incubation comprises multiple cycles.

[0489] In one embodiment, the step (a) incubation may comprise an amplification reaction, for example, a signal amplification reaction and / or a nucleic acid amplification reaction.

[0490] In one embodiment, the amplification reaction comprises multiple cycles.

[0491] In one embodiment, the incubation of step (a) is performed under conditions that allow target amplification along with signal changes by the composition for detecting target nucleic acids. These conditions include the temperature, salt concentration, and pH of the solution.

[0492] In one embodiment, the incubation of step (a) is performed in a signal amplification process without nucleic acid amplification.

[0493] In one embodiment, the signal may be amplified simultaneously with target amplification. Alternatively, the signal may be amplified without target amplification.

[0494] In one embodiment, the signal change occurs during a process that includes signal amplification and target amplification.

[0495] In one embodiment, amplification of the target nucleic acid can be performed by polymerase chain reaction (PCR). PCR is widely used in the art for amplifying target nucleic acids and includes cycles of denaturation of the target nucleic acid, annealing (hybridization) between the target nucleic acid and a primer, and primer extension (Mullis et al., U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).

[0496] A variety of DNA polymerases can be used in the amplification reaction, including the "Klenow" fragment of E. coli DNA polymerase I, thermostable DNA polymerases and bacteriophage T7 DNA polymerase, Vent® polymerase, Terminator™ polymerase, and the like. Specifically, the polymerases are thermostable DNA polymerases that can be obtained from various bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermus flavus, Thermococcus litoralis, and Pyrococcus furiosus (Pfu). Most of these polymerases can be isolated from the bacteria themselves or purchased commercially.

[0497] The amplification method described above can amplify target nucleic acids and / or signals through repetition of a series of reactions with or without temperature changes. The unit of amplification comprising repetition of the series of reactions is expressed as a "cycle." Depending on the amplification method used, the cycle can be expressed as the number of repetitions or time.

[0498] In one embodiment, the above series of reactions may be performed sequentially. For example, in the case of PCR, a denaturation reaction of the target nucleic acid (i.e., template) may be followed by a primer annealing reaction, followed by a primer extension reaction, which may be performed sequentially. In this case, a cycle may be expressed as the number of repetitions.

[0499] In one embodiment, the incubation can be performed for multiple cycles to measure changes in signal dependent on the presence of the target nucleic acid. For example, the number of the plurality of cycles is 2 to 100 cycles, 2 to 90 cycles, 2 to 80 cycles, 2 to 70 cycles, 2 to 60 cycles, 2 to 50 cycles, 2 to 40 cycles, 2 to 30 cycles, 2 to 20 cycles, 2 to 10 cycles, 5 to 100 cycles, 5 to 90 cycles, 5 to 80 cycles, 5 to 70 cycles, 5 to 60 cycles, 5 to 50 cycles, 5 to 40 cycles, 5 to 30 cycles, 5 to 20 cycles, 5 to 10 cycles, 10 to 100 cycles, 10 to 90 cycles, 10 to 80 cycles, 10 to 70 cycles, 10 to 60 cycles, 10 to 50 cycles, 10 to 40 cycles, 10 to 30 cycles, It may be 10 to 20 cycles, 20 to 100 cycles, 20 to 90 cycles, 20 to 80 cycles, 20 to 70 cycles, 20 to 60 cycles, 20 to 50 cycles, 20 to 40 cycles or 20 to 30 cycles, and specifically, it may be 10 cycles, 15 cycles, 20 cycles, 25 cycles, 30 cycles, 35 cycles, 40 cycles, 45 cycles or 50 cycles.

[0500] In one embodiment, detection of the signal can be performed at each cycle, selected portions of the cycles, or an end-point of an incubation reaction comprising multiple cycles.

[0501] In one embodiment, the amplification reaction of the target nucleic acid may be a multiple target nucleic acid sequence amplification reaction.

[0502] The term "multiple target nucleic acid amplification reaction" as used herein refers to a reaction that targets two or more nucleic acids and amplifies them in a single reaction vessel. A multiple target nucleic acid amplification reaction refers to a reaction that amplifies two or more nucleic acids together. For example, a multiple target nucleic acid amplification reaction can amplify two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, twenty or more, thirty or more, forty or more, or fifty or more target nucleic acids together in a single reaction.

[0503] In one embodiment, the method according to the present disclosure comprises using a single type of label in one reaction vessel to produce 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 15, 2 to 12, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 3 to 50, 3 to 40, 3 to 30, 3 to 20, 3 to 15, 3 to 12, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 4 to 50, 4 to 40, 4 to 30, 4 to 20, 4 to 15, 4 to 12, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6 or 4 to 5 target nucleic acids can be detected.

[0504] A method according to the present disclosure is used to determine whether at least one of n target nucleic acids is present in a sample. For example, when n is 2, the present disclosure can be used to determine whether at least one of a first target nucleic acid and a second target nucleic acid is present in the sample. As another example, when n is 3, the present disclosure can be used to determine whether at least one of a first target nucleic acid, a second target nucleic acid, and a third target nucleic acid is present in the sample.

[0505] In one embodiment, n is an integer greater than or equal to 2. For example, n may be, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50.

[0506] The present disclosure provides a method for detecting n target nucleic acid detection compositions, wherein a combination of n target nucleic acid detection compositions is used to detect n target nucleic acids (where n is an integer greater than or equal to 2). That is, a combination of first to n target nucleic acid detection compositions is used to detect first to n target nucleic acids.

[0507] As used herein, the term "combination of first through n-th target nucleic acid detection compositions" refers to a compilation or mixture of compositions that are specific for each of the first through n-th target nucleic acids. As used herein, one target nucleic acid detection composition is specific for one corresponding target nucleic acid. The expression "one target nucleic acid detection composition is specific for one corresponding target nucleic acid" means that the target nucleic acid detection composition is involved in the detection of the one corresponding target nucleic acid but is not involved in the detection of other target nucleic acids. In other words, the expression means that the target nucleic acid detection composition interacts with one corresponding target nucleic acid but does not interact with other target nucleic acids.

[0508] In the present invention, the composition for detecting the nth target nucleic acid is specific to the nth target nucleic acid, for example, the composition for detecting the first target nucleic acid is specific to the first target nucleic acid, the composition for detecting the second target nucleic acid is specific to the second target nucleic acid, and the composition for detecting the third target nucleic acid is specific to the third target nucleic acid.

[0509] The combination of the first to nth target nucleic acid detection compositions used herein is used together in a single reaction. That is, the first to nth target nucleic acid detection compositions exist together in a single reaction solution or reaction vessel.

[0510] The term "composition for detecting a target nucleic acid" as used herein means a composition containing components used to detect a target nucleic acid.

[0511] According to the method of the present disclosure, each of the first to nth target nucleic acid detection compositions includes a label that provides a signal dependent on the presence of a corresponding target nucleic acid among the first to nth target nucleic acids, and the signals provided from each of the first to nth target nucleic acid detection compositions are not distinguished from each other by a single detection channel.

[0512] A composition for detecting a target nucleic acid may include various oligonucleotides involved in amplification and / or detection of the target nucleic acid.

[0513] The label herein may be linked to the oligonucleotide or present in a free form. Alternatively, the label may be incorporated into the oligonucleotide during the incubation.

[0514] It should be noted that the above-mentioned labels and oligonucleotides are only mentioned as core elements in the composition for detecting the first to nth target nucleic acids, and that various components may be additionally included in addition to the labels and oligonucleotides.

[0515] Examples of components included in the composition for detecting the target nucleic acid include, but are not limited to, an oligonucleotide set used to amplify or detect the target nucleic acid, a label, a nucleic acid polymerase, a buffer, a polymerase cofactor, and deoxyribonucleotide-5-triphosphate. Optionally, the composition may also include various polynucleotide molecules, a reverse transcriptase, various buffers and reagents, and an antibody that inhibits DNA polymerase activity. The composition may also include reagents necessary for conducting positive control and negative control reactions. The optimal amount of reagents to be used in a particular reaction can be readily determined by one of ordinary skill in the art having the benefit of the present disclosure. The components of the composition may be present in separate containers, or multiple components may be present in a single container.

[0516] The n target nucleic acid detection compositions used in the present disclosure are each one of (i) an UnderSC-type composition, (ii) an InterSC-type composition, and (iii) an OverSC-type composition, and at least one of the n target nucleic acid detection compositions is an HTOCE composition that generates a signal according to the HTOCE assay described above. For example, when n is 2, at least one of the first target nucleic acid detection composition and the second target nucleic acid detection composition is an HTOCE composition. Specifically, when n is 2, exemplary combinations of the first target nucleic acid detection composition and the second target nucleic acid detection composition are as shown in Table 1 below. When n is 3, exemplary combinations of the first to third target nucleic acid detection compositions are as shown in Table 2.

[0517] In Tables 1 and 2, “UnderSC,” “InterSC,” and “OverSC” refer to UnderSC-type, InterSC-type, and OverSC-type compositions, respectively.

[0518] n=2 Composition for detecting first target nucleic acid Composition for detecting second target nucleic acid 1 HTOCE (UnderSC) HTOCE (InterSC) 2 HTOCE (UnderSC) InterSC 3 HTOCE (UnderSC) OverSC 4 UnderSCHTOCE (InterSC) 5 HTOCE (InterSC) HTOCE (InterSC) 6 HTOCE (InterSC) InterSC 7 HTOCE (InterSC) OverSC

[0519] n=3 First target nucleic acid detection composition Second target nucleic acid detection composition Third target nucleic acid detection composition 1 HTOCE (UnderSC) HTOCE (InterSC) HTOCE (InterSC) 2 HTOCE (UnderSC) HTOCE (InterSC) InterSC 3 HTOCE (UnderSC) HTOCE (InterSC) OverSC 4 HTOCE (UnderSC) InterSCHTOCE (InterSC) 5 HTOCE (UnderSC) InterSC OverSC 6 HTOCE (UnderSC) InterSC InterSC 7 UnderSCHTOCE (InterSC) HTOCE (InterSC) 8 UnderSCHTOCE (InterSC) InterSC 9 UnderSCHTOCE (InterSC) OverSC 10 UnderSCHTOCE (InterSC) 11 HTOCE (InterSC) HTOCE (InterSC) HTOCE (InterSC) 12 HTOCE (InterSC) HTOCE (InterSC) InterSC 13 HTOCE (InterSC) HTOCE (InterSC)OverSC14HTOCE (InterSC)InterSCHTOCE (InterSC)15HTOCE (InterSC)InterSCInterSC16HTOCE (InterSC)InterSCOverSC17InterSCHTOCE (InterSC)HTOCE (InterSC)18InterSCHTOCE (InterSC)InterSC19InterSCHTOCE (InterSC)OverSC20InterSCInterSCHTOCE (InterSC)

[0520] A specific description of the above UnderSC-type, InterSC-type and OverSC-type compositions can be found in WO2022-265463, which is incorporated herein by reference in its entirety.

[0521] In one embodiment, each of the n target nucleic acid detection compositions provides a change in a signal indicating the presence of a corresponding target nucleic acid at a corresponding detection temperature among the n detection temperatures.

[0522] For example, the composition for detecting the i-th target nucleic acid among the n target nucleic acids provides a signal change at the i-th detection temperature among the n detection temperatures in the presence of the i-th target nucleic acid, and provides a constant signal at other detection temperatures.

[0523] In one embodiment, i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature. In one embodiment, when i is n, the i+1 detection temperature (i.e., the n+1 detection temperature) does not exist. For example, when n is 3, i represents an integer from 1 to 3, a first detection temperature, a second detection temperature, and a third detection temperature exist, and the first detection temperature is lower than the second detection temperature, and the second detection temperature is lower than the third detection temperature.

[0524] In one embodiment, the composition for detecting the i-th target nucleic acid provides a signal change (i.e., a change in the i-th signal) according to the amplification of the target nucleic acid at the i-th detection temperature when the i-th target nucleic acid is present, whereas at detection temperatures other than the i-th detection temperature, the composition does not provide a signal change (i.e., the signal is constant) even if the target nucleic acid is amplified. That is, the composition for detecting the i-th target nucleic acid has a signal-change temperature range in which the signal changes according to the amplification of the i-th target nucleic acid and a signal-constant temperature range in which the signal is constant even when the i-th target nucleic acid is amplified.

[0525] The term "i signal" used herein means a signal provided by a composition for detecting i target nucleic acid at an i detection temperature, and is used interchangeably with "signal at the i detection temperature."

[0526] In one embodiment, when detecting n target nucleic acids, the i signal may mean a signal provided by n target nucleic acid detection compositions including the i target nucleic acid detection composition at the i detection temperature.

[0527] In one embodiment, the composition for detecting the i-th target nucleic acid provides a constant signal without changing the signal at the i-th detection temperature during an incubation reaction (e.g., a target nucleic acid amplification reaction) when the i-th target nucleic acid is not present.

[0528] In one embodiment, the signal-change temperature range is a temperature range in which a difference in signal value (e.g., signal intensity) occurs depending on the presence or absence of a target nucleic acid.

[0529] In one embodiment, the signal-change temperature range is a temperature range in which the signal value changes depending on the degree of amplification of the target nucleic acid (e.g., the amount of amplified target nucleic acid).

[0530] In one embodiment, the signal-constant temperature range is a temperature range in which the signal value does not change regardless of the presence of the target nucleic acid. In other words, the signal-constant temperature range is a temperature range in which there is no difference between the signal value when the target nucleic acid is present and the signal value when the target nucleic acid is not present.

[0531] In one embodiment, the i detection temperature may be selected within the signal change temperature range of the i target nucleic acid detection composition. In this case, the i target nucleic acid detection composition is referred to herein as having the i detection temperature. Furthermore, the i target nucleic acid corresponding to the i target nucleic acid detection composition may be referred to as a target nucleic acid having the i detection temperature.

[0532] In one embodiment, one detection temperature determined by the corresponding target nucleic acid detection composition is assigned to one target nucleic acid.

[0533] In a specific implementation example, when n is 2, the first target nucleic acid detection composition provides a change in signal at a first detection temperature in the presence of the first target nucleic acid, and a constant signal at another detection temperature, i.e., a second detection temperature; and the second target nucleic acid detection composition provides a change in signal at a second detection temperature in the presence of the second target nucleic acid, and a constant signal at another detection temperature, i.e., the first detection temperature.

[0534] In another specific embodiment, when n is 3, the first target nucleic acid detection composition provides a change in signal at a first detection temperature in the presence of the first target nucleic acid, and provides a constant signal at other detection temperatures, i.e., a second detection temperature and a third detection temperature; the second target nucleic acid detection composition provides a change in signal at a second detection temperature in the presence of the second target nucleic acid, and provides a constant signal at other detection temperatures, i.e., a first detection temperature and a third detection temperature; and the third target nucleic acid detection composition provides a change in signal at a third detection temperature in the presence of the third target nucleic acid, and provides a constant signal at other detection temperatures, i.e., a first detection temperature and a second detection temperature.

[0535] In one embodiment, the i detection temperature is selected within the signal-change temperature range of the i target nucleic acid detection composition, and the i detection temperature is not included in the signal-change temperature range of another target nucleic acid detection composition.

[0536] In one embodiment, the signal-change temperature range of any one of the target nucleic acid detection compositions may overlap with the signal-change temperature range of a target nucleic acid detection composition having an adjacent detection temperature, but may not overlap with the signal-change temperature range of a target nucleic acid detection composition having a non-adjacent detection temperature. In this case, the detection temperature of the target nucleic acid detection composition having a signal-change temperature range overlapping with the signal-change temperature range of another target nucleic acid detection composition is selected from a temperature range among the signal-change temperature ranges that does not overlap with the signal-change temperature range of the other target nucleic acid detection composition. By selecting the detection temperature in a temperature range where the signal-change temperature ranges do not overlap, only a signal indicating the presence of one specific target nucleic acid can be provided at one detection temperature.

[0537] In one embodiment, the signal-change temperature range of one of the target nucleic acid detection compositions may overlap with the signal-change temperature range of a target nucleic acid detection composition having an adjacent detection temperature, but neither of the two signal-change temperature ranges is completely contained within the other signal-change temperature range.

[0538] The term "adjacent detection temperature" is used to refer to consecutive detection temperatures among n detection temperatures, for example, the adjacent detection temperature of the i-th detection temperature is the i-1-th detection temperature or the i+1-th detection temperature.

[0539] In one embodiment, the signal-change temperature range of the i-target nucleic acid detection composition may partially overlap with the signal-change temperature range of the target nucleic acid detection composition having an adjacent detection temperature, but does not overlap with the signal-change temperature range of the target nucleic acid detection composition having a non-adjacent detection temperature.

[0540] In one embodiment, the composition for detecting the i-target nucleic acid comprises a label that provides a signal dependent on the presence of the i-target nucleic acid.

[0541] In one embodiment, the label may be linked to the oligonucleotide or may be present in a free form. Alternatively, the label may be incorporated into the oligonucleotide during the incubation (e.g., a nucleic acid amplification reaction). That is, the composition for detecting a target nucleic acid may initially include an oligonucleotide to which the label is linked, or the label may be incorporated into a newly generated oligonucleotide (e.g., an extended strand) during the incubation reaction, thereby providing a labeled oligonucleotide.

[0542] In one embodiment, the composition for detecting the i-target nucleic acid comprises an incorporating label that is incorporated into the oligonucleotide during incubation and provides a signal dependent on the presence of the i-target nucleic acid.

[0543] In one embodiment, the composition for detecting the i-target nucleic acid provides a label-linked oligonucleotide that serves to provide a signal dependent on the presence of the i-target nucleic acid.

[0544] In one embodiment, the composition for detecting the i-target nucleic acid comprises, from the outset, a labeled oligonucleotide that provides a signal dependent on the presence of the i-target nucleic acid. The HTO is an example of the labeled oligonucleotide herein.

[0545] Alternatively, the composition for detecting the i-th target nucleic acid may include a label and an oligonucleotide that provide a signal dependent on the presence of the i-th target nucleic acid, and the label may be incorporated into the oligonucleotide during an incubation reaction (e.g., a nucleic acid amplification reaction) to provide a label-linked oligonucleotide that serves to provide a signal dependent on the presence of the i-th target nucleic acid.

[0546] The term "label-linked oligonucleotide" as used herein is an oligonucleotide that is involved in the generation of a detectable signal.

[0547] In one embodiment, the label-linked oligonucleotide may comprise an oligonucleotide (e.g., a probe or a primer) that specifically hybridizes to a target nucleic acid; when the probe or primer hybridized to the target nucleic acid is cleaved to release a fragment, the label-linked oligonucleotide may comprise a capture oligonucleotide that specifically hybridizes to the fragment; when the fragment hybridized to the capture oligonucleotide is extended to form an extended strand, the label-linked oligonucleotide may comprise an oligonucleotide that specifically hybridizes to the extended strand, an oligonucleotide generated by insertion of a label during extension of the fragment, an oligonucleotide that specifically hybridizes to the capture oligonucleotide, and combinations thereof.

[0548] In one embodiment, the label-linked oligonucleotide comprises an oligonucleotide that is involved in actual signal generation. For example, hybridization or non-hybridization of the label-linked oligonucleotide with another oligonucleotide (e.g., the label-linked oligonucleotide or an oligonucleotide comprising a nucleotide sequence complementary to the target nucleic acid) determines signal generation.

[0549] In one embodiment, the oligonucleotide to which the label is linked may be a "probe" known in the art. In one embodiment, the 3'-end of the probe is "blocked" to prevent its extension. Blocking can be achieved using conventional methods.

[0550] In one embodiment, the label-linked oligonucleotide may be comprised of at least one oligonucleotide. In another embodiment, if the label-linked oligonucleotide is comprised of multiple oligonucleotides, the label-linked oligonucleotide may be labeled in various ways. For example, all or some of the multiple oligonucleotides may have at least one label.

[0551] In one embodiment, the label may be a single label or an interactive label.

[0552] For example, the single label includes a fluorescent label, a luminescent label, a chemiluminescent label, an electrochemical label, and a metal label. In one embodiment, the single label provides different signals (e.g., different signal intensities) depending on whether it is present in a double strand or a single strand. In one embodiment, the single label is a fluorescent label. Preferred types and binding sites of the single fluorescent labels used in the present disclosure are disclosed in U.S. Patent Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein by reference in their entirety. For example, the single fluorescent labels include JOE, FAM, TAMRA, ROX, and fluorescein-based labels. The single label can be linked to the oligonucleotide by various methods. For example, the label is linked to the probe via a spacer comprising a carbon atom (e.g., a 3-carbon spacer, a 6-carbon spacer, or a 12-carbon spacer).

[0553] In one embodiment, the interaction label may be an interaction label comprising at least one reporter molecule and at least one quencher molecule. Specifically, the interaction label may be an interaction dual label comprising one reporter molecule and one quencher molecule. Alternatively, the interaction label may be an interaction label comprising one reporter molecule and two quencher molecules.

[0554] Reporter molecules and quencher molecules useful in the present disclosure may include any molecules known in the art, for detailed descriptions of which see the section describing reporter molecules and quencher molecules in the first aspect described above.

[0555] In one embodiment, when the label is an interaction label, the interaction label may be an interaction label comprising at least one reporter molecule and at least one quencher molecule, and the interaction labels may be all linked to one oligonucleotide, or may be linked to each of a plurality of oligonucleotides.

[0556] In one embodiment, the insertion label can be used in a process of generating a signal by inserting the label during primer extension (e.g., the Plexor method, Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-45569 (2004)). The insertion label can also be used in signal generation by a duplex formed in a manner dependent on the cleavage of an intermediate oligonucleotide hybridized to the target nucleic acid sequence.

[0557] In one embodiment, the insertion marker may generally be linked to a nucleotide. Additionally, nucleotides having non-natural bases may also be used.

[0558] As used herein, the term "non-natural base" refers to derivatives of natural bases such as adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U), which can form hydrogen-bonded base pairs. The term "non-natural base" as used herein includes bases that have base pairing patterns that are different from those of natural bases as their mother compounds, and are described, for example, in U.S. Patent Nos. 5,432,272, 5,965,364, 6,001,983, and 6,037,120. Base pairing between non-natural bases involves two or three hydrogen bonds, like natural bases. Base pairing between non-natural bases also occurs in specific ways. Specific examples of unnatural bases include the following base pair combinations: iso-C / iso-G, iso-dC / iso-dG, Z / P, V / J, K / X, H / J, Pa / Ds, Pa / Q, Pn / Ds, Pn / Dss, Px / Ds, NaM / 5SICS, 5FM / 5SICS, and M / N (see US Pat. Nos. 5,432,272; 5,965,364; 6,001,983; 6,037,120; 6,140,496; 6,627,456; 6,617,106; and 7,422,850; and Filip Wojciechowski et al., Chem. Soc. Rev., 2011, 40, 5669-5679).

[0559] Conventional methods for detecting multiple target nucleic acids have the disadvantage of requiring the use of different types of fluorescent labels for different target nucleic acids, or requiring additional analysis, such as melting curve analysis, even when using a single type of fluorescent label. In contrast, the method according to the present disclosure utilizes a composition for detecting target nucleic acids that provides a dimer, thereby enabling the real-time detection of multiple target nucleic acids using a single type of label (e.g., one fluorescent label) without the need for additional analysis, such as melting curve analysis.

[0560] In one embodiment, each of the n target nucleic acid detection compositions provides one or more dimers.

[0561] The term "duplex" as used herein refers to a double-stranded nucleic acid molecule formed by hybridization under hybridization conditions of two single-stranded nucleic acid molecules having partially or fully complementary sequences. The two single-strands forming the duplex may exist in an associated form (i.e., a double-stranded molecule) or a dissociated form (i.e., two single-stranded molecules) depending on the temperature (particularly, the detection temperature). In this respect, with respect to the expression "a composition for detecting a target nucleic acid provides a duplex," the term "duplex" may be used to encompass both an associated form of the duplex and a dissociated form of the duplex.

[0562] In one embodiment, the dimer may be referred to as a “hybrid.”

[0563] As described above, the expression "the composition for detecting a target nucleic acid provides a dimer" as used herein may mean providing a dimer in an associated form and / or a dissociated form. Similarly, the expression "the composition for detecting a target nucleic acid generates a dimer during incubation" as used herein may mean generating a dimer in an associated form and / or a dissociated form during the incubation reaction.

[0564] In one embodiment, at least one of the dimers provided by the composition for detecting the target nucleic acid is a dimer that provides a signal. In particular, the dimer is a dimer that provides a signal change. That is, the composition for detecting the i-th target nucleic acid provides a dimer that provides a signal, and specifically, the composition for detecting the i-th target nucleic acid provides a dimer that provides a signal change dependent on the presence of the i-th target nucleic acid.

[0565] The term "signal-providing dimer" as used herein refers to a dimer capable of providing a signal that can be distinguished depending on whether the dimer is in a bound or dissociated state. For example, this means that the bound form of the dimer generates (or extinguishes) a signal, and the dissociated form of the dimer extinguishes (or generates) a signal.

[0566] In one embodiment, the signal-providing dimer may comprise at least one label.

[0567] The term "dimer providing a signal change" as used herein refers to a dimer whose content changes depending on the presence of the target nucleic acid, thereby providing a signal change indicating the presence of the target nucleic acid. For example, the self-extended hairpin structure according to the present disclosure, the initial hairpin structure of HTO described in Embodiment 2, and / or the HTO / LPHO hybrid are examples of dimers providing a signal change as described herein.

[0568] In one embodiment, the dimer providing the signal change comprises a label. Specifically, at least one label is linked to at least one of the two single strands constituting the dimer. For example, the dimer providing the signal change comprises a single label, in which case the single label is linked to either one of the two single strands constituting the dimer. In another example, the dimer providing the signal change comprises an interaction label, in which case the interaction label is linked to both of the two strands constituting the dimer providing the signal change, or one of the interaction labels is linked to either one of the two single strands and the other of the interaction labels is linked to the other of the two single strands.

[0569] In one embodiment, the association and dissociation of the dimer may be caused by temperature.

[0570] In one embodiment, the dimer providing the signal change may be a dimer that is originally included in the composition for detecting a target nucleic acid.

[0571] In one embodiment, when the dimer providing the signal change is included in the composition for detecting a target nucleic acid, the dimer can be generated by hybridization between an oligonucleotide to which a label is linked and an oligonucleotide capable of hybridizing with the oligonucleotide to which the label is linked. A double-stranded nucleic acid hybridization probe known as a Yin-Yang probe (U.S. Patent No. 7,799,522) is an example of a dimer providing a signal change that is included in the composition for detecting a target nucleic acid from the beginning. In the present disclosure, an HTO / LPHO hybrid is an example of a dimer providing a signal change that is included in the composition for detecting a target nucleic acid from the beginning.

[0572] In one embodiment, when the dimer providing the signal change is initially included in the composition for detecting the target nucleic acid, the content of the dimer providing the signal change varies depending on the presence of the target nucleic acid, specifically, the content decreases, thereby providing the signal change. For example, the content of the HTO / LPHO hybrid decreases depending on the presence of the target nucleic acid as a self-extended hairpin structure is formed, thereby providing a signal change depending on the presence of the target nucleic acid.

[0573] In one embodiment, the dimer providing the change in the signal may be a dimer newly provided during the incubation reaction by the composition for detecting the target nucleic acid.

[0574] In one embodiment, the duplexer providing the signal change generated during the incubation reaction may be provided by hybridization between the label-linked oligonucleotide and the target nucleic acid.

[0575] The signal by the formation of a dimer between the label-linked oligonucleotide and the target nucleic acid can be obtained by the Scorpion method (Whitcombe et al., Nature Biotechnology 17:804-807 (1999)), the Sunrise (or Amplifluor) method (Nazarenko et al., Nucleic Acids Research, 25(12):2516-2521 (1997), and U.S. Patent No. 6,117,635), the Lux method (U.S. Patent No. 7,537,886), the Plexor method (Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-4556 (2004)), the molecular beacon method (Tyagi et al., Nature Biotechnology v. 14 MARCH 1996), and the Hybeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374(2001)), adjacent hybridization probe method (Bernard PS et al., Anal. Biochem., 273:221(1999)), and LNA method (U.S. Patent No. 6,977,295).

[0576] In one embodiment, the signal change is caused by a duplex formed in a manner dependent on the cleavage of an intermediate oligonucleotide that hybridizes specifically to the target nucleic acid.

[0577] The term "mediation oligonucleotide" as used herein is an oligonucleotide that mediates the formation of a duplex that does not include a target nucleic acid.

[0578] In one embodiment, cleavage of the intermediate oligonucleotide itself does not generate a signal, but rather, after hybridization and cleavage of the intermediate oligonucleotide, the fragment (cleavage product) generated by the cleavage participates in a continuous reaction for signal generation.

[0579] In one embodiment, hybridization or cleavage of the intermediate oligonucleotide itself does not generate a signal.

[0580] In one embodiment, the mediating oligonucleotide comprises an oligonucleotide that mediates the formation of a duplex by hybridizing to a target nucleic acid and cleaving it to release a fragment.

[0581] In one embodiment, the fragment mediates the formation of a duplex by extension of the fragment onto a capture oligonucleotide.

[0582] In one embodiment, the intermediate oligonucleotide comprises (i) a targeting moiety comprising a nucleotide sequence that hybridizes to a target nucleic acid and (ii) a tagging moiety comprising a nucleotide sequence that non-hybridizes to the target nucleic acid.

[0583] In one embodiment, the composition for detecting the target nucleic acid comprises a tagging oligonucleotide that hybridizes to the target nucleic acid, and the cleavage reaction dependent on the presence of the target nucleic acid may comprise cleavage of the tagging oligonucleotide. The tagging oligonucleotide corresponds to an example of the aforementioned intermediate oligonucleotide.

[0584] In one embodiment, cleavage of the intermediate oligonucleotide releases a fragment that specifically hybridizes to the capture oligonucleotide and extends onto the capture oligonucleotide. If the capture oligonucleotide comprises a label, the capture oligonucleotide is an example of an oligonucleotide to which a label is linked herein.

[0585] In one embodiment, a mediating oligonucleotide hybridized to a target nucleic acid is cleaved to release a fragment, which specifically hybridizes to a capture oligonucleotide, which extends to produce an extended strand, which causes formation of an extended duplex between the extended strand and the capture oligonucleotide, thereby providing a signal indicating the presence of the target nucleic acid.

[0586] In one embodiment, a third oligonucleotide comprising a nucleotide sequence that hybridizes to the extended strand may be additionally used. When the third oligonucleotide is used, hybridization of the third oligonucleotide and the extended strand forms a different type of duplex, thereby providing a signal indicating the presence of the target nucleic acid (e.g., PCE-SH). In this case, the different type of duplex is the duplex that provides the signal change.

[0587] The signal by the dimer generated in a manner dependent on the cleavage of the above-mentioned intermediate oligonucleotide can be generated by various methods including the PTO cleavage and extension (PTOCE) method (WO 2012 / 096523), the PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization (PCE-SH) method (WO 2013 / 115442), and the PTO Cleavage and Extension-Dependent Non-Hybridization (PCE-NH) method (WO 2014 / 104818).

[0588] In connection with the terms disclosed in the above-mentioned references, corresponding examples of oligonucleotides are as follows: the intermediate oligonucleotide corresponds to a probing and tagging oligonucleotide (PTO), the capture oligonucleotide corresponds to a capturing and templating oligonucleotide (CTO), and the third oligonucleotide corresponds to a signaling oligonucleotide (SO) or a hybridization oligonucleotide (HO). The SO, HO, CTO, the extension strand, or a combination thereof can serve as the oligonucleotide to which the label is linked.

[0589] In one embodiment, the dimer providing the signal change may be a single-type dimer or a multi-type dimer. Specifically, when the dimer providing the signal change is a single-type dimer, the number of the dimers may be 1, and when the dimer providing the signal change is a multi-type dimer, the number of the dimers may be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20, more specifically, 2, 3, or 4, and even more specifically, 2 or 3.

[0590] In one embodiment, either the single-type dimer or the multi-type dimer comprises a label.

[0591] In one embodiment, when the dimer providing the signal change is a single-type dimer, the content of the single-type dimer changes depending on the presence of the target nucleic acid, thereby changing the signal.

[0592] In one embodiment, when the dimer is a multi-type dimer, the content ratio between the multi-type dimers changes depending on the presence of the target nucleic acid, thereby changing the signal.

[0593] In one embodiment, the Tm values ​​of the multiple-type dimers are different from each other. For example, the Tm values ​​between the dimers are different from each other by at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, or 20°C.

[0594] In one embodiment, the content of the dimer means the sum of the amount of the dimer in a state where the two nucleic acid strands constituting the dimer are dissociated (i.e., the dimer in a dissociated form) and the amount of the dimer in a state where the two nucleic acid strands are hybridized (i.e., the dimer in a bound form).

[0595] In one embodiment, at least two of the multi-type duplexers comprise the same single strand. When the multi-type duplexers comprise the same single strand, the same single strand is included in the first duplex that is initially included in the composition for detecting a target nucleic acid, and a new second duplex comprising the same single strand is generated during the incubation reaction. In this case, the same single strand that was included in the first duplex may be considered to be consumed during the incubation reaction to generate the second duplex, and thus, the content of the first duplex comprising the same single strand may be considered to decrease, and the content of the second duplex comprising the same single strand may be considered to increase.

[0596] In one embodiment, the signal-change temperature range of the composition for detecting the i-target nucleic acid can be determined depending on the length and / or sequence of the dimer providing the signal change.

[0597] In one embodiment, when the composition for detecting the i-th target nucleic acid provides a single-type duplex, the composition for detecting the i-th target nucleic acid may have one signal-change temperature range and one signal-constant temperature range. The signal-change range and the signal-constant temperature range may be determined depending on the length and / or sequence of the single-type duplex.

[0598] In one embodiment, when the composition for detecting the i-th target nucleic acid provides multiple types of dimers, specifically, two types of dimers, the composition for detecting the i-th target nucleic acid may have one signal-change temperature range and two signal-constant temperature ranges. The signal-change range and the signal-constant temperature range may be determined depending on the length and / or sequence of the two types of dimers.

[0599] In one embodiment, any one of the n target nucleic acid detection compositions may include an amplification oligonucleotide that serves to amplify the corresponding target nucleic acid. In one embodiment, the amplification oligonucleotide may be identical to the oligonucleotide to which the label is linked.

[0600] In this application, “amplification oligonucleotide” refers to a general term for oligonucleotides that serve to amplify a target nucleic acid.

[0601] In one embodiment, the amplification oligonucleotide may be a 'primer' known in the art.

[0602] The primer may comprise a forward primer (also referred to as an upstream primer or upstream oligonucleotide), a reverse primer (also referred to as a downstream primer or downstream oligonucleotide), or both. The amplification oligonucleotide may be an oligonucleotide having a structure known in the art, or may be synthesized by a method known in the art.

[0603] The fact that the amplifying oligonucleotide and the labeled oligonucleotide are identical means that one oligonucleotide functions both as an amplifying oligonucleotide that amplifies the target nucleic acid and as a labeled oligonucleotide that generates a signal in the presence of the target nucleic acid. For example, a labeled oligonucleotide can hybridize with the target nucleic acid, extending the target nucleic acid and generating a signal.

[0604] It should be noted that the composition for detecting a target nucleic acid used in the present disclosure does not provide a signal at all temperatures in the presence of the target nucleic acid.

[0605] In one embodiment, even if the signal generation methods of the target nucleic acid detection compositions are the same, target nucleic acid detection compositions containing oligonucleotides of different sequences may be considered different from each other. The different target nucleic acid detection compositions have different detection temperatures.

[0606] In one embodiment, the detection temperature according to the present disclosure can be determined in advance by considering the signal-change temperature ranges of each of the n target nucleic acid detection compositions.

[0607] In one embodiment, the signal-change temperature range of any one of the n target nucleic acid detection compositions can be determined dependently on the length and / or sequence of the dimer. That is, by controlling the Tm value of the dimer, the signal-change temperature range can be determined in advance.

[0608] In one embodiment, when the signal change is caused by a label-linked oligonucleotide (e.g., a molecular beacon) that specifically hybridizes to the target nucleic acid, detection of the signal can be successfully achieved at a predetermined detection temperature by controlling the Tm value of the label-linked oligonucleotide.

[0609] In one embodiment, when the signal is generated by a dimer generated in response to the presence of the target nucleic acid, detection of the signal is successfully achieved at a predetermined temperature by controlling the Tm value of the dimer.

[0610] As described above, the detection temperature is determined by considering the signal-change temperature range that depends on the dimer provided by the composition for detecting target nucleic acid.

[0611] In one embodiment, the detection temperature of any one of the n compositions for detecting n target nucleic acids can be predetermined within a signal-change temperature range that does not overlap with the signal-change temperature ranges of the other compositions.

[0612] In one embodiment, the detection temperatures assigned to the composition for detecting target nucleic acid differ from each other by at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 15°C or 20°C.

[0613] In one embodiment, the n detection temperatures are 45°C to 97°C, 45°C to 96°C, 45°C to 95°C, 45°C to 94°C, 45°C to 93°C, 45°C to 92°C, 45°C to 91°C, 45°C to 90°C, 46°C to 97°C, 46°C to 96°C, 46°C to 95°C, 46°C to 94°C, 46°C to 93°C, 46°C to 92°C, 46°C to 91°C, 46°C to 90°C, 47°C to 97°C, 47°C to 96°C, 47°C to 95°C, 47°C to 94°C, 47°C to 93°C, 47°C to 92°C, 47°C to 91°C, 47℃ to 90℃, 48℃ to 97℃, 48℃ to 96℃, 48℃ to 95℃, 48℃ to 94℃, 48℃ to 93℃, 48℃ to 92℃, 48℃ to 91℃, 48℃ to 90℃, 49℃ to 97℃, 49℃ to 96℃, 49℃ to 95℃, 49℃ to 94℃, 49℃ to 93℃, 49℃ to 92℃, 49℃ to 91℃, 49℃ to 90℃, 50℃ to 97℃, 50℃ to 96℃, 50℃ to 95℃, 50℃ to 94℃, 50℃ to 93℃, 50℃ to 92℃, 50℃ to 91℃ or 50℃ to It can be selected from a temperature range of 90℃.

[0614] For example, the highest detection temperature among the above detection temperatures (i.e., the nth detection temperature) is 70°C to 97°C, 70°C to 95°C, 70°C to 93°C, 70°C to 90°C, 73°C to 97°C, 73°C to 95°C, 73°C to 93°C, 73°C to 90°C, 75°C to 97°C, 75°C to 95°C, 75°C to 93°C, 75°C to 90°C, 78°C to 97°C, 78°C to 95°C, 78°C to 93°C, 78°C to 90°C, 80°C to 97°C, 80°C to 95°C, 80°C to 93°C, 80°C to 90°C, 83°C to 97°C, 83°C to 95°C, It can be selected from a temperature range of 83°C to 93°C, 83°C to 90°C, 85°C to 97°C, 85°C to 95°C, 85°C to 93°C or 85°C to 90°C.

[0615] For example, among the n detection temperatures, the lowest detection temperature (i.e., the first detection temperature) may be selected from a temperature range of 45°C to 70°C, 45°C to 68°C, 45°C to 65°C, 45°C to 63°C, 45°C to 60°C, 45°C to 58°C, 45°C to 55°C, 48°C to 70°C, 48°C to 68°C, 48°C to 65°C, 48°C to 63°C, 48°C to 60°C, 48°C to 58°C, 48°C to 55°C, 50°C to 70°C, 50°C to 68°C, 50°C to 65°C, 50°C to 63°C, 50°C to 60°C, 50°C to 58°C, 50°C to 55°C.

[0616] For example, among the above n detection temperatures, the intermediate detection temperatures (e.g., the second detection temperature to the n-1th detection temperature) are 55°C to 85°C, 55°C to 83°C, 55°C to 80°C, 55°C to 78°C, 55°C to 7.5°C, 55°C to 73°C, 55°C to 70°C, 55°C to 68°C, 55°C to 65°C, 55°C to 63°C, 55°C to 60°C, 58°C to 85°C, 5.8°C to 83°C, 58°C to 80°C, 58°C to 78°C, 58°C to 75°C, 58°C to 73°C, 58°C to 70°C, 58°C to 68°C, 58°C to 65°C, 58°C to 63°C, 58℃ to 60℃, 60℃ to 85℃, 60℃ to 83℃, 60℃ to 80℃, 60℃ to 78℃, 60℃ to 75℃, 60℃ to 73℃, 60℃ to 70℃, 60℃ to 68℃, 60℃ to 65℃, 60℃ to 63℃, 63℃ to 85℃, 63℃ to 83℃, 63℃ to 80℃, 63℃ to 78℃, 63℃ to 75℃, 63℃ to 73℃, 63℃ to 70℃, 63℃ to 68℃, 63℃ to 65℃, 65℃ to 85℃, 65℃ to 83℃, 65℃ to 80℃, 65℃ to 78℃, 65℃ to The temperature range may be selected from 75°C, 65°C to 73°C, 65°C to 70°C, 65°C to 68°C, 68°C to 85°C, 68°C to 83°C, 68°C to 80°C, 68°C to 78°C, 68°C to 75°C, 68°C to 73°C, 68°C to 70°C, 70°C to 85°C, 70°C to 83°C, 70°C to 80°C, 70°C to 78°C, 70°C to 75°C or 70°C to 73°C.

[0617] In one embodiment, n target nucleic acids are each assigned to n detection temperatures, and then n compositions for detecting n target nucleic acids suitable for the detection temperatures are prepared, and then step (a) can be performed.

[0618] In one embodiment, when n is 3, the first detection temperature may be selected from a temperature range of 50°C to 60°C, the second detection temperature may be selected from a temperature range of 65°C to 75°C, and the third detection temperature may be selected from a temperature range of 80°C to 95°C.

[0619] In step (a), the signal is detected at n detection temperatures during incubation.

[0620] In one embodiment, detection of a signal can be performed at each cycle, at a selected cycle, or at the end-point of the reaction.

[0621] In one embodiment, the detection of the signal can be performed in at least one cycle. For example, the signal can be detected at n detection temperatures in one selected cycle, or can be detected at n detection temperatures in two selected cycles, respectively. For example, when n is 3 and the signal is detected in cycle 1 and cycle 30, the signal (i.e., the first signal, the second signal, and the third signal) is detected at the first detection temperature, the second detection temperature, and the third detection temperature in cycle 1, and the signal is detected at the first detection temperature, the second detection temperature, and the third detection temperature in cycle 30.

[0622] In one embodiment, detection of the signal can be performed in at least two cycles.

[0623] In one embodiment, the signal change can be measured using the signal detected in the at least two cycles. For example, nucleic acid amplification can be performed for 30 cycles, 40 cycles, 45 cycles, or 50 cycles of PCR, and signals can be measured at n detection temperatures for each cycle. Then, the signal values ​​detected at each detection temperature in the plurality of cycles can be plotted as an amplification curve (a set of data points consisting of RFU and cycle) at each detection temperature. As a specific example, when n is 3, when each target nucleic acid is present, an amplification curve at a first detection temperature, an amplification curve at a second detection temperature, and an amplification curve at a third detection temperature can be obtained, and the signal change can be confirmed from the amplification curves.

[0624] As used herein, the term "amplification curve" refers to a curve obtained through a signal-generating reaction of a target analyte (specifically, a target nucleic acid), particularly an amplification reaction. The amplification curve includes a curve obtained when the target nucleic acid is present in the sample during the amplification reaction, and a curve or line obtained when the target nucleic acid is not present in the sample during the amplification reaction.

[0625] In one embodiment, a signal change or a constant signal can be measured as an indicator of amplification of a target nucleic acid.

[0626] The term "indicator indicating amplification" as used herein refers to an indicator that is closely related to the occurrence of amplification of a target nucleic acid, which can be obtained from the signal provided in step (a). The indicator may refer to a value generated depending on the amplification of the target nucleic acid. The indicator may be an indicator that provides a larger value as the amplification of the target nucleic acid increases (i.e., an increase in the amount of the target nucleic acid), or an indicator that provides a smaller value as the amplification increases. The indicator may be any indicator that indicates amplification.

[0627] In one embodiment, the indicator may include something obtained from an amplification curve or a melting curve. In particular, the indicator may include a value of a signal at a specific cycle in an amplification curve (e.g., RFU), a value of a signal at each cycle, a difference in a signal value between specific cycles, or a difference in a signal value between a reference signal value and a specific cycle, or a height, width, or area of ​​a maximum melting peak in a melting curve. In one embodiment, the indicator may be, but is not limited to, a Ct (cycle threshold) value, ΔRFU (e.g., a difference in RFU between two cycles or a difference in RFU between a reference RFU and an RFU at a specific cycle, etc.), an RFU ratio (e.g., a ratio of RFU between two cycles or a ratio of RFU between a reference RFU and an RFU at a specific cycle, etc.), and a melting peak height / area / width (e.g., a height / area / width of a maximum peak in a melting curve).

[0628] In one embodiment, the indicator representing amplification is a Ct value or a Cq value. The concepts of Ct value and Cq value are widely known in the art.

[0629] In one embodiment, the indicator representing amplification is the ΔRFU or RFU ratio of the RFU values ​​obtained in the amplification reaction. For example, the indicator is the difference (subtraction) or ratio between the RFUs of two cycles, or the difference (subtraction) or ratio between the RFU of a reference RFU and the RFU of a specific cycle.

[0630] The method according to the present disclosure utilizes the fact that the composition for detecting a target nucleic acid provides a signal change dependent on the presence of the target nucleic acid only at a corresponding detection temperature. In one embodiment, the method according to the present disclosure can measure the signal change using signal values ​​detected at the detection temperature in at least two cycles. In another embodiment, the method according to the present disclosure can measure the signal change using the signal value at the detection temperature detected in one cycle (i.e., the signal value detected in step (a)) and a reference signal value.

[0631] In one embodiment, when detecting a signal in a plurality of cycles in step (a), the first cycle and the last cycle for detecting the signal may be selected to be separated from each other by at least 1 cycle to 20 cycles. Specifically, the first cycle and the last cycle for detecting the signal may be selected to be separated from each other by 1 cycle, 2 cycles, 3 cycles, 4 cycles, 5 cycles, 6 cycles, 7 cycles, 8 cycles, 9 cycles, 10 cycles, 11 cycles, 12 cycles, 13 cycles, 14 cycles, 15 cycles, 16 cycles, 17 cycles, 18 cycles, 19 cycles or 20 cycles, and more specifically, may be selected to be separated from each other by 5 cycles, 10 cycles, 15 cycles, 20 cycles or 30 cycles or more.

[0632] In one embodiment, the detection of the signal may be performed in any cycle of the intermediate cycle including the exponential phase region or in any cycle of the late cycle including the plateau region. For example, when detecting a signal in two cycles, one may be performed in any one of the early cycles including the baseline region, and the other may be performed in any one of the intermediate or late cycles, or one may be performed in any one of the intermediate cycles, and the other may be performed in any one of the intermediate or late cycles.

[0633] In one embodiment, the initial cycle includes cycles up to and including the end cycle divided by 3. For example, if the end cycle is 45, since 45 divided by 3 is 15, the initial cycle may be determined as 1 to 20 cycles, 1 to 15 cycles, 1 to 10 cycles, or 1 to 5 cycles. The intermediate cycle may be determined as the end cycle divided by 2 and including cycles. For example, if the end cycle is 45, since 45 divided by 2 is 22.5, the intermediate cycle may be determined as 16 to 30 cycles, 18 to 30 cycles, 20 to 30 cycles, 16 to 27 cycles, 18 to 27 cycles, 20 to 27 cycles, 16 to 25 cycles, 18 to 25 cycles, or 20 to 25 cycles. The terminal cycle may be determined as the final cycle of the amplification reaction or a cycle adjacent to the final cycle. For example, if the final cycle is 45 cycles, the terminal cycle may be between 31 and 45 cycles, 35 and 45 cycles, 38 and 45 cycles, 40 and 45 cycles, or 43 and 45 cycles. The initial cycle, middle cycle, and terminal cycle may vary depending on the number of final cycles of the amplification reaction.

[0634] In one embodiment, the signal change can be measured using the signal detected in at least one cycle and a "reference signal value." The reference signal value can refer to a value that can confirm a signal change dependent on the presence of a target nucleic acid through a separate reaction.

[0635] In one embodiment, the reference signal value can be obtained from a reaction in which the corresponding target nucleic acid is absent at the corresponding detection temperature. For example, the reference signal value may be a "signal value at the detection temperature" in the absence of the target nucleic acid.

[0636] In one implementation, there are n reference signal values ​​for n detected temperatures.

[0637] In one embodiment, the "signal value at the detection temperature (e.g., the i-th detection temperature)" detected when the target nucleic acid (e.g., the i-th target nucleic acid) is not present can be obtained through a separate negative control reaction.

[0638] In one embodiment, the reference signal value can be obtained by performing a negative control reaction simultaneously or separately from the method according to the present disclosure.

[0639] In one embodiment, the reference signal value can be obtained through a negative control reaction. According to a specific embodiment, the reference signal value at the ith detection temperature can be obtained by mixing a sample (e.g., distilled water) that does not contain the ith target nucleic acid with n target nucleic acid detection compositions, amplifying the nucleic acid, and detecting the signal at the ith detection temperature. At this time, the signal detection can be performed in any cycle. Specifically, a signal value detected in any one of the early cycles of the negative control reaction can be used as the reference signal value, or a signal value detected in any one of the late cycles of the negative control reaction can be used as the reference signal value. More specifically, a signal value detected in the same cycle as the cycle in which the signal is detected in step (a) can be used as the reference signal value.

[0640] In one embodiment, the reference signal value can be obtained through a positive control reaction. According to a specific embodiment, a sample containing the i target nucleic acid is mixed with a composition for detecting the i target nucleic acid (specifically, n compositions for detecting n target nucleic acids), and the nucleic acid is amplified while detecting a signal at the i detection temperature.

[0641] When a reference signal value is obtained through the above positive control reaction, the cycle in which the signal value is detected may be a cycle in the baseline region of the positive control reaction. The baseline region refers to a region in which a signal (e.g., a fluorescent signal) remains substantially constant during the initial cycle of an amplification reaction (e.g., PCR). Since the level of the amplification product in this region is not sufficient to be detected, most of the fluorescent signal in this region is due to a background signal including the fluorescent signal of the reaction sample itself and the fluorescent signal of the measurement system itself. That is, a signal value detected in a cycle in the baseline region of the positive control reaction will be substantially the same as a reference signal value obtained from a reaction in which the target nucleic acid is absent (e.g., a negative control reaction).

[0642] In one embodiment, a signal change can be measured through the difference between the reference signal value and the signal value detected in step (a).

[0643] In one embodiment, the reference signal value may be a threshold value determined in advance from a negative control reaction, taking into account the background signal and sensitivity of the detector, or the characteristics of the label used. The significance of the signal change can be determined using the threshold value. The threshold value can be determined using a known threshold value setting method. For example, the threshold value can be determined by taking into account the background signal, sensitivity, label characteristics, signal deviation or error range of the detector, etc.

[0644] In one implementation example, when a threshold value is used as the reference signal value, if the signal value detected in step (a) is equal to or greater than the threshold value, it can be determined that the signal has changed.

[0645] In one embodiment, signal detection at each of the n detection temperatures can be performed using a single type of detector.

[0646] In one embodiment, the single type of detector is one detector. In one embodiment, the signals generated from the labels of the oligonucleotides linked to each label included in the n target nucleic acid detection composition are not distinguished from each target nucleic acid by the single type of detector.

[0647] As used herein, a single or one type of fluorescent label means a fluorescent label having identical or substantially identical signal characteristics (e.g., optical characteristics, emission wavelength, and electrical signal). For example, FAM and CAL Fluor 610 provide different types of signals.

[0648] As used herein, a single or one type of fluorescent label means that the signals from the fluorescent labels are indistinguishable from each other using a detection channel. This single or one type of fluorescent label is not dependent on the chemical structure of the fluorescent label. Therefore, even if two fluorescent labels have different chemical structures, they are considered to be of one type if they are indistinguishable using a detection channel.

[0649] According to the present disclosure, signals generated from n target nucleic acid detection compositions that commonly include one type of fluorescent label are not distinguished by one detection channel.

[0650] The term "detection channel" as used herein refers to a means for detecting a signal from a single type of fluorescent label. Thermocyclers available in the art, such as the ABI 7500 (Applied Biosystems), QuantStudio (Applied Biosystems), CFX96 (Bio-Rad Laboratories), Cobas z 480 (Roche), LightCycler (Roche), etc., include several channels (e.g., photodiodes) for detecting signals from several different types of fluorescent labels, and such channels correspond to detection channels herein.

[0651] The detection channel used in the present disclosure includes a means for detecting a signal. For example, the detection channel may be a photodiode capable of detecting a fluorescent signal of a specific wavelength.

[0652] In one embodiment, the signals detected at each of the n detection temperatures are not distinguished from each other by the single type of detector.

[0653]

[0654] Step (b): Determination of the presence of target nucleic acid

[0655] After detection of the signal, the presence of n target nucleic acids is determined from the signal detected in step (a).

[0656] In one embodiment, the presence of the i-th target nucleic acid is determined by a change in a signal detected at the i-th detection temperature. For example, the presence of the i-th target nucleic acid is determined by measuring a change in a signal from a signal detected at the i-th detection temperature.

[0657] In one embodiment, if a change in signal is measured at the i detection temperature, it can be determined that the i target nucleic acid is present.

[0658] In one implementation example, if the signal is constant at the i detection temperature, it can be determined that the i target nucleic acid is absent.

[0659] In one embodiment, the signal change can be measured using a signal detected in at least two cycles, or using a signal detected in at least one cycle and a reference signal value.

[0660] Determining the presence of a target nucleic acid from the signal detected at each detection temperature can be performed by a method of measuring a signal change as described in step (a), for example, a method using an indicator indicating amplification, and various methods known in the art.

[0661] In a specific embodiment, n is 3, and when detecting signals at 10 cycles, 20 cycles, and 30 cycles, the presence of the first target nucleic acid can be determined from signals detected at a first detection temperature (a first signal at 10 cycles, a first signal at 20 cycles, and a first signal at 30 cycles), the presence of the second target nucleic acid can be determined from signals detected at a second detection temperature (a second signal at 10 cycles, a second signal at 20 cycles, and a second signal at 30 cycles), and the presence of the third target nucleic acid can be determined from signals detected at a third detection temperature (a third signal at 10 cycles, a third signal at 20 cycles, and a third signal at 30 cycles).

[0662] In a specific embodiment, n is 4, and when detecting a signal at 30 cycles, the presence of the first target nucleic acid is determined from a signal detected at a first detection temperature (i.e., a first signal at 30 cycles) and a reference signal value, the presence of the second target nucleic acid is determined from a signal detected at a second detection temperature (i.e., a second signal at 30 cycles) and a reference signal value, and the presence of the third target nucleic acid is determined from a signal detected at a third detection temperature (i.e., a third signal at 30 cycles) and a reference signal value.

[0663] In one embodiment, the reference signal value can be obtained through a separate negative control reaction or positive control reaction.

[0664] In one embodiment, the method according to the present disclosure can be performed in conjunction with a negative control reaction. The signal value detected in the negative control reaction can be used as a reference signal value. For example, in a reaction comprising a composition for detecting an i-th target nucleic acid, a signal detected in one cycle (e.g., the last cycle) at an i-th detection temperature can be compared with a signal detected in the same cycle (e.g., the last cycle) at the same detection temperature (i.e., the i-th detection temperature) in a negative control reaction to determine whether there is a change in the signal.

[0665] In a specific embodiment, n is 3, and when detecting a signal at 30 cycles, the presence of the first target nucleic acid can be determined from a signal detected at a first detection temperature (i.e., a first signal at 30 cycles) and a first reference signal value (e.g., a signal at the first detection temperature detected at 30 cycles of the negative control reaction), the presence of the second target nucleic acid can be determined from a signal detected at a second detection temperature (i.e., a second signal at 30 cycles) and a second reference signal value (e.g., a signal at the second detection temperature detected at 30 cycles of the negative control reaction), and the presence of the third target nucleic acid can be determined from a signal detected at a third detection temperature (i.e., a third signal at 30 cycles) and a third reference signal value (e.g., a signal at the third detection temperature detected at 30 cycles of the negative control reaction).

[0666] In one embodiment, the method according to the present disclosure can be performed in conjunction with a positive control reaction. The signal value detected in the positive control reaction can be used as a reference signal value. For example, the first signal detected in cycle 30, which is a signal detected in one cycle, for example, cycle 30, at the i-th detection temperature, can be compared with the signal detected in a cycle prior to cycle 30, for example, cycle 1, at the i-th detection temperature of the positive control reaction to determine whether the signal has changed.

[0667] In one embodiment, when signal detection is performed in one cycle in step (a) and a signal change is measured using a reference signal value obtained through a positive control reaction, signal detection in the positive control reaction may be performed in a cycle at least 30 cycles, 20 cycles, 10 cycles, or 5 cycles prior to the cycle in which the signal is detected in step (a) to obtain the reference signal value.

[0668] In a specific embodiment, n is 3, and when detecting a signal at 30 cycles, the presence of the first target nucleic acid can be determined from a signal detected at a first detection temperature (i.e., a first signal at 30 cycles) and a first reference signal value (e.g., a signal at the first detection temperature detected at 1 cycle of the first target nucleic acid positive control reaction), the presence of the second target nucleic acid can be determined from a signal detected at a second detection temperature (i.e., a second signal at 30 cycles) and a second reference signal value (e.g., a signal at the second detection temperature detected at 1 cycle of the second target nucleic acid positive control reaction), and the presence of the third target nucleic acid can be determined from a signal detected at a third detection temperature (i.e., a third signal at 30 cycles) and a third reference signal value (e.g., a signal at the third detection temperature detected at 1 cycle of the third target nucleic acid positive control reaction).

[0669]

[0670] Hereinafter, the present invention will be described in more detail through examples. These examples are intended to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention, as set forth in the appended claims, is not limited by these examples.

[0671] Example

[0672]

[0673] Example 1: Detection of a single target nucleic acid

[0674] In this example, the HTOCE assay was used to verify whether a target nucleic acid can be detected in real time. The HTOCE assay according to the present disclosure can be implemented in various embodiments (e.g., Embodiments 1 to 3 described above) depending on the positions at which the reporter molecule and quencher molecule are linked. In particular, with reference to FIGS. 3 to 5 , the HTOCE assay of a specific embodiment described above was used to verify whether a target nucleic acid can be detected in real time. To this end, three types of HTO were prepared as follows.

[0675]

[0676] HTO-1: HTO with a reporter molecule (Chamel610) and a quencher molecule (AZOQ2) linked to the templating region of HTO.

[0677] HTO-2: HTO with a reporter molecule (Chamel610) linked to the single-stranded loop of HTO and a quencher molecule (AZOQ2) linked to the templating site.

[0678] HTO-3: HTO with a reporter molecule (Chamel610) linked to the single-stranded loop of HTO and a quencher molecule (AZOQ2) linked to the initial double-stranded stem.

[0679]

[0680] In addition, it was confirmed that the target nucleic acid can be detected in real time using the HTOCE assay of a specific implementation example using the LPHO described above with reference to FIG. 8.

[0681]

[0682] Example 1-1: HTOCE assay using HTO-1

[0683] According to the present disclosure, quenching or unquenching between a reporter molecule and a quencher molecule of HTO-1 can be induced depending on whether the templating portion is single-stranded or double-stranded. In addition, an HTOCE composition comprising HTO-1 is classified as an UnderSC-type composition (see FIGS. 3, 10, 11, and 12).

[0684] To confirm this, target nucleic acids and oligonucleotides were prepared as follows.

[0685] As the target nucleic acid, the genomic DNA of Neisseria gonorrhoeae (NG) (Accession No.: ATCC 700825, Coramdeo Lab Co., Ltd.) was used. To detect the NG target nucleic acid, the NG forward primer, NG reverse primer, and HTO-1 were prepared as shown in Table 3. The 3'-end of the HTO was blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0686]

[0687] Target nucleic acid sequence number Oligotype Tm (℃) Sequence (5'-3') NG1 NG - forward primer 64GGAAGCAGTGGCGGC 2 NG - reverse primer 64AGTAATCAGATGAAACCAGTTCC 3HTO - 180 (PC) [5Chamel610] CGTGGCCGTCCGC / iAZOQ2_T / GATTGCCTACTTTTTTTTTTTTTTTGTAGGCCCCTCATTGGCGTGTTTCG [Spacer C3]

[0688] BOLD: Single-stranded loop of the initial hairpin structure;

[0689] Underline: Initial double-stranded stem of the initial hairpin structure;

[0690] PC: Tm of self-extended hairpin structures generated dependently on the presence of target nucleic acid

[0691]

[0692] Subsequently, real-time polymerase chain reaction was performed using the above oligonucleotides. Taq DNA polymerase with 5' nuclease activity was used for extension of the NG forward primer and NG reverse primer and oligonucleotide cleavage.

[0693] 20 pmoles of NG-forward primer (SEQ ID NO: 1), 20 pmoles of NG-reverse primer (SEQ ID NO: 2), and 10 pmoles of HTO-1 (SEQ ID NO: 3) were mixed with target nucleic acid (Tube 1: 50 pg of NG genomic DNA) and distilled water (Tube 2: negative control), respectively, and then 5 μl of 4X Enzyme master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Tag DNA polymerase) (Enzynomics, Korea) was added to prepare a final 20 μl reaction mixture.

[0694] Tubes 1 and 2 containing the reaction mixtures were each placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by 50 cycles of 57°C for 60 seconds, 72°C for 30 seconds, and 95°C for 30 seconds, to perform real-time PCR.

[0695] Signal detection was performed at two temperatures for each cycle as follows:

[0696] (i) 57°C, which is the temperature at which the self-extended hairpin structure is maintained (i.e., within the signal-change temperature range); and

[0697] (ii) 95°C, the temperature at which the self-extended hairpin structure dissociates into a single-stranded state (i.e., the temperature within the signal-constant temperature range).

[0698] The real-time PCR results are shown in Figure 28.

[0699] In the real-time PCR results for Tube 1, the amplification curve at 95°C within the signal-constant temperature range remained constant without any change in signal even when the target nucleic acid was amplified. In contrast, the amplification curve at 57°C within the signal-change temperature range showed a change in signal as the target nucleic acid was amplified.

[0700] Meanwhile, the negative control reaction (tube 2) provided a constant signal at 57°C and 95°C, i.e., no change in signal was detected.

[0701] These results imply that detection of a target nucleic acid is possible using the HTOCE assay, and in particular, that a composition for detecting an HTO target nucleic acid comprising HTO in which a reporter molecule and a quencher molecule are linked to the templating portion of HTO can be used as an UnderSC-type composition.

[0702] As described above, the HTOCE assay according to the present disclosure can measure a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction. If the signal values ​​at 57°C and 95°C are higher than RFU 100, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal is considered to have changed.

[0703] As a result, as shown in Table 4, in tube 1, a signal change was observed only at 57°C with a Ct value of 34.33, and no signal change was observed at 95°C. On the other hand, in tube 2, the negative control, no signal change was observed at either 57°C or 95°C.

[0704]

[0705] Tube Ct (Cycle threshold)57℃95℃134.33N / A2N / AN / A

[0706] Tube 1: 50 pg of NG genomic DNA;

[0707] Tube 2: Negative control;

[0708] N / A: Not Applicable

[0709]

[0710] Example 1-2: HTOCE assay using HTO-2

[0711] According to the present disclosure, quenching or unquenching between a reporter molecule and a quencher molecule of HTO-2 can be induced depending on whether the templating portion is single-stranded or double-stranded. In addition, an HTOCE composition comprising HTO-2 is classified as an UnderSC-type composition (see FIGS. 4, 13, 14, and 15).

[0712] To confirm this, target nucleic acids and oligonucleotides were prepared as follows.

[0713] As the target nucleic acid, the genomic DNA of Chlamydia trachomatis (CT) (Accession No.: ATCC VR-1500, Coramdeo Lab Co., Ltd.) was used. To detect the CT target nucleic acid, the CT forward primer, CT reverse primer, and HTO-2 were prepared as shown in Table 5. The 3'-end of the HTO was blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0714]

[0715] Target nucleic acid sequence number Oligotype Tm value (℃) Sequence (5'-3') CT4CT-Forward primer 61GGCAAATGACAGAGCCG 5CT-Reverse primer 60CCAATTGTAATAGAAGCATTGG 6HTO-261.5(PC)[5AZOQ2]ATTATAATTGTATCTTT / iChamel610_T / TTTGATACATCAGAAGCTGTCATTTTGGCTGCG[Spacer C3]

[0716] BOLD: Single-stranded loop of the initial hairpin structure;

[0717] Underline: Initial double-stranded stem of the initial hairpin structure;

[0718] PC: Tm of self-extended hairpin structures generated dependently on the presence of target nucleic acid.

[0719]

[0720] Subsequently, real-time polymerase chain reaction was performed using the above oligonucleotides. Taq DNA polymerase with 5' nuclease activity was used for extension of the CT forward primer and CT reverse primer and oligonucleotide cleavage.

[0721] 20 pmoles of CT-forward primer (SEQ ID NO: 4), 20 pmoles of CT-reverse primer (SEQ ID NO: 5), and 10 pmoles of HTO-2 (SEQ ID NO: 6) were mixed with target nucleic acid (Tube 1: 50 pg of CT genomic DNA) and distilled water (Tube 2: negative control), respectively, and then 5 μl of 4X Enzyme master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Tag DNA polymerase) (Enzynomics, Korea) was added to prepare a final 20 μl reaction mixture.

[0722] Tubes 1 and 2 containing the reaction mixtures were each placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by 50 cycles of 57°C for 60 seconds, 72°C for 30 seconds, and 95°C for 30 seconds, to perform real-time PCR.

[0723] Signal detection was performed at two temperatures for each cycle as follows:

[0724] (i) 57°C, which is the temperature at which the self-extended hairpin structure is maintained (i.e., within the signal-change temperature range), and

[0725] (ii) 95°C, the temperature at which the self-extended hairpin structure dissociates into a single-stranded state (i.e., the temperature within the signal-constant temperature range).

[0726] The real-time PCR results are shown in Figure 29.

[0727] In the real-time PCR results for Tube 1, the amplification curve at 95°C within the signal-constant temperature range remained constant without any change in signal even when the target nucleic acid was amplified. In contrast, the amplification curve at 57°C within the signal-change temperature range showed a change in signal as the target nucleic acid was amplified.

[0728] Meanwhile, the negative control reaction (tube 2) provided a constant signal at 57°C and 95°C, i.e., no change in signal was detected.

[0729] These results imply that detection of a target nucleic acid is possible using the HTOCE assay, and in particular, that a composition for detecting an HTO target nucleic acid comprising HTO in which a reporter molecule (Chamel610) is linked to a single-stranded loop of HTO and a quencher molecule (AZOQ2) is linked to a templating portion can be used as an UnderSC-type composition.

[0730] As described above, the HTOCE assay according to the present disclosure can measure a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction. If the signal values ​​at 57°C and 95°C are higher than RFU 100, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal is considered to have changed.

[0731] As a result, as shown in Table 6, in tube 1, a signal change was observed only at 57°C with a Ct value of 24.13, and no signal change was observed at 95°C. On the other hand, in tube 2, the negative control, no signal change was observed at either 57°C or 95°C.

[0732]

[0733] Tube Ct (Cycle threshold)57℃95℃124.13N / A2N / AN / A

[0734] Tube 1: 50 pg of CT genomic DNA;

[0735] Tube 2: Negative control;

[0736] N / A: Not Applicable

[0737]

[0738] Example 1-3: HTOCE assay using HTO-3

[0739] According to the present disclosure, quenching or unquenching between the reporter molecule and the quencher molecule of HTO-3 can be induced depending on whether the hairpin structure is maintained or dissociated into a single-stranded state. In addition, the HTOCE composition comprising HTO-3 is classified as an InterSC-type composition (see FIGS. 5, 16, 17, and 18).

[0740] To confirm this, target nucleic acids and oligonucleotides were prepared as follows.

[0741] As the target nucleic acid, the genomic DNA of Neisseria gonorrhoeae (NG) (Accession No.: ATCC 700825, Coramdeo Lab Co., Ltd.) was used. To detect the NG target nucleic acid, the NG forward primer, NG reverse primer, and HTO-3 were prepared as shown in Table 7. The 3'-end of the HTO was blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0742]

[0743] Target nucleic acid sequence number Oligotype Tm value (℃) Sequence (5' -3') NG1 NG - forward primer 64GGAAGCAGTGGCGGC 2 NG - reverse primer 64AGTAATCAGATGAAACCAGTTCC 7HTO - 375(PC) / 64(NC)CCTGCGC / iAZOQ2_T / CTATATGTAGTTT / iChamel610_T / TTTCTACATATAGAGCCCCTCATTGGCGTGTTTCG[Spacer C3]

[0744] BOLD: Single-stranded loop of the initial hairpin structure;

[0745] Underline: Initial double-stranded stem of the initial hairpin structure;

[0746] PC: Tm of self-extended hairpin structures generated dependently on the presence of target nucleic acid;

[0747] NC: Tm of the initial hairpin structure of HTO

[0748]

[0749] Subsequently, real-time polymerase chain reaction was performed using the above oligonucleotides. Taq DNA polymerase with 5' nuclease activity was used for extension of the NG forward primer and NG reverse primer and oligonucleotide cleavage.

[0750] 10 pmoles of NG-forward primer (SEQ ID NO: 1), 10 pmoles of NG-reverse primer (SEQ ID NO: 2), and 5 pmoles of HTO-3 (SEQ ID NO: 7) were mixed with target nucleic acid (Tube 1: 50 pg of NG genomic DNA) and distilled water (Tube 2: negative control), respectively, and then 5 μl of 4X Enzyme master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Tag DNA polymerase) (Enzynomics, Korea) was added to prepare a final 20 μl reaction mixture.

[0751] Tubes 1 and 2 containing the reaction mixtures were each placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by 50 cycles of 57°C for 60 seconds, 72°C for 30 seconds, 70°C for 5 seconds, and 95°C for 30 seconds, to perform real-time PCR.

[0752] Signal detection was performed at three temperatures for each cycle as follows:

[0753] (i) 57°C, which is a temperature at which both the initial hairpin structure and the self-extended hairpin structure are maintained (i.e., a temperature within the first signal-constant temperature range);

[0754] (ii) 70°C, a temperature at which the initial hairpin structure dissociates into a single-stranded state and the self-extended hairpin structure is maintained (i.e., a temperature within the signal-change temperature range); and

[0755] (iii) 95°C, the temperature at which both the initial hairpin structure and the self-extended hairpin structure dissociate into a single-stranded state (i.e., a temperature within the second signal-constant temperature range).

[0756] The real-time PCR results are shown in Figure 30.

[0757] In the real-time PCR results for Tube 1, the amplification curves at 57°C within the first signal-constant temperature range and at 95°C within the second signal-constant temperature range remained constant without signal change even when the target nucleic acid was amplified. In contrast, the amplification curve at 70°C within the signal-change temperature range showed signal change as the target nucleic acid was amplified.

[0758] Meanwhile, the negative control reaction (tube 2) provided a constant signal at 57°C, 70°C, and 95°C, i.e., no change in signal was detected.

[0759] These results imply that detection of a target nucleic acid is possible using the HTOCE assay, and in particular, that a composition for detecting an HTO target nucleic acid comprising an HTO in which a reporter molecule is linked to a single-stranded loop of the HTO and a quencher molecule is linked to an initial double-stranded stem can be used as an InterSC-type composition.

[0760] As described above, the HTOCE assay according to the present disclosure can measure a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction. If the signal values ​​at 57°C, 70°C, and 95°C are higher than RFU 100, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal was considered to have changed.

[0761] As a result, as shown in Table 8, in tube 1, a signal change was observed only at 70°C with a Ct value of 32.59, and no signal change was observed at 57°C and 95°C. On the other hand, in tube 2, the negative control, no signal change was observed at 57°C, 70°C, and 95°C.

[0762]

[0763] Tube Ct (Cycle threshold)57℃70℃95℃1N / A32.59N / A2N / AN / AN / A

[0764] Tube 1: 50 pg of NG genomic DNA;

[0765] Tube 2: Negative control;

[0766] N / A: Not Applicable

[0767]

[0768] Example 1-4: HTOCE assay using LPHO

[0769] The HTOCE assay according to the present disclosure can be performed in the presence of an LPHO that hybridizes to the label portion of HTO. When using an LPHO, quenching or unquenching between the reporter molecule and the quencher molecule can be induced depending on whether the label portion is single-stranded or double-stranded. Furthermore, an HTOCE composition additionally comprising an LPHO is classified as an InterSC-type composition (see FIGS. 8, 25, 26, and 27).

[0770] To confirm this, target nucleic acids and oligonucleotides were prepared as follows.

[0771] As a target nucleic acid, the genomic DNA of Neisseria gonorrhoeae (NG) (Accession No.: ATCC 700825, Coramdeo Lab Co., Ltd.) was used. To detect the NG target nucleic acid, the NG forward primer, NG reverse primer, HTO-1, and LPHO were prepared as shown in Table 9. The 3'-end of the HTO was blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0772]

[0773] Target nucleic acid sequence number Oligo type Tm value (℃) Sequence (5' -3') NG1 NG - forward primer 64GGAAGCAGTGGCGGC 2 NG - reverse primer 64AGTAATCAGATGAAACCAGTTCC 3HTO - 180 (PC) [5Chamel610] CGTGGCCGTCCGC / iAZOQ2_T / GATTGCCTACTTTTTTTTTTTTTTTTTGTAGGCCCCTCATTGGCGTGTTTCG [Spacer C3] 8LPHO60CAGCGGACGGCCACG [Spacer C3]

[0774] BOLD: Single-stranded loop of the initial hairpin structure;

[0775] Underline: Initial double-stranded stem of the initial hairpin structure;

[0776] PC: Tm of self-extended hairpin structures generated dependently on the presence of target nucleic acid

[0777]

[0778] Subsequently, real-time polymerase chain reaction was performed using the above oligonucleotides. Taq DNA polymerase with 5' nuclease activity was used for extension of the NG forward primer and NG reverse primer and oligonucleotide cleavage.

[0779] 20 pmoles of NG-forward primer (SEQ ID NO: 1), 20 pmoles of NG-reverse primer (SEQ ID NO: 2), 10 pmoles of HTO-1 (SEQ ID NO: 3), and 10 pmoles of LPHO (SEQ ID NO: 8) were mixed with target nucleic acid (Tube 1: 50 pg of NG genomic DNA) and distilled water (Tube 2: negative control), respectively, and then 5 μl of 4X Enzyme master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Tag DNA polymerase) (Enzynomics, Korea) was added to prepare a final 20 μl reaction mixture.

[0780] Tubes 1 and 2 containing the reaction mixtures were each placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by real-time PCR, which consisted of 50 cycles of 57°C for 60 seconds, 72°C for 30 seconds, 76°C for 5 seconds, and 95°C for 30 seconds.

[0781] Signal detection was performed at three temperatures for each cycle as follows:

[0782] (i) 57°C, a temperature at which both the HTO / LPHO hybrid and the self-extended hairpin structure are maintained (i.e., a temperature within the first signal-constant temperature range);

[0783] (ii) 76°C, a temperature at which the HTO / LPHO hybrid dissociates into single strands and the self-extended hairpin structure is maintained (i.e., a temperature within the signal-change temperature range); and

[0784] (iii) 95°C, the temperature at which both the HTO / LPHO hybrid and the self-extended hairpin structure dissociate into a single-stranded state (i.e., within the second signal-constant temperature range).

[0785] The real-time PCR results are shown in Figure 31.

[0786] In the real-time PCR results for Tube 1, the amplification curves at 57°C within the first signal-constant temperature range and at 95°C within the second signal-constant temperature range remained constant without signal change even when the target nucleic acid was amplified. In contrast, the amplification curve at 76°C within the signal-change temperature range showed signal change as the target nucleic acid was amplified.

[0787] Meanwhile, the negative control reaction (tube 2) provided a constant signal at 57°C, 76°C, and 95°C, i.e., no change in signal was detected.

[0788] These results imply that detection of target nucleic acids is possible using an HTOCE assay that additionally utilizes LPHO, and that a composition for detecting HTOCE target nucleic acids containing LPHO can be used as an InterSC-type composition.

[0789] As described above, the HTOCE assay according to the present disclosure can measure a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction. If the signal values ​​at 57°C, 76°C, and 95°C are higher than RFU 100, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal was considered to have changed.

[0790] As a result, as shown in Table 10, in tube 1, a signal change was observed only at 76°C with a Ct value of 37.46, and no signal change was observed at 57°C and 95°C. On the other hand, in tube 2, the negative control, no signal change was observed at 57°C, 76°C, and 95°C.

[0791]

[0792] Tube Ct (Cycle threshold)57℃76℃95℃1N / A37.46N / A2N / AN / AN / A

[0793] Tube 1: 50 pg of NG genomic DNA;

[0794] Tube 2: Negative control;

[0795] N / A: Not Applicable

[0796]

[0797] Example 2: Detection of multiple target nucleic acids

[0798] According to the present disclosure, multiple target nucleic acids can be detected in real time using a single type of label in a single reaction vessel by using various combinations of UnderSC-type and InterSC-type HTOCE compositions.

[0799] In this example, it was confirmed whether a combination of an UnderSC-type HTOCE composition and an InterSC-type HTOCE composition could be used to detect multiple target nucleic acids in real time.

[0800] First, CT prepared in Example 1 was used as the first target nucleic acid, and NG was used as the second target nucleic acid. The UnderSC-type HTOCE assay of Example 1-2 was adopted as a method for detecting CT, the first target nucleic acid, and the InterSC-type HTOCE assay of Example 1-3 was adopted as a method for detecting NG, the second target nucleic acid.

[0801] Figure 32 schematically shows the signal generation principle for the UnderSC-type HTOCE composition and InterSC-type HTOCE combination adopted in this embodiment.

[0802] The first detection temperature for detecting a change in a signal indicating the presence of the first target nucleic acid was set to 57°C, and the second detection temperature for detecting a change in a signal indicating the presence of the second target nucleic acid was set to 70°C.

[0803] The sequence and length of the HTO of the composition for detecting the first target nucleic acid are designed to satisfy the following depending on the detection temperature: (1) first detection temperature: a self-extended hairpin structure generated depending on the presence of the first target nucleic acid is maintained (the initial hairpin structure of the HTO can be maintained or dissociated into a single-stranded state); and (2) second detection temperature: the initial hairpin structure of the HTO is dissociated into a single-stranded state, and the self-extended hairpin structure generated depending on the presence of the first target nucleic acid is dissociated into a single-stranded state.

[0804] The sequence and length of the HTO of the composition for detecting the second target nucleic acid are designed to satisfy the following depending on the detection temperature: (1) first detection temperature: both the initial hairpin structure of the HTO and the self-extended hairpin structure generated dependently on the presence of the second target nucleic acid are maintained; and (2) second detection temperature: the initial hairpin structure of the HTO is dissociated into a single-stranded state and the self-extended hairpin structure generated dependently on the presence of the second target nucleic acid is maintained.

[0805] As a result, the first target nucleic acid detection composition provides a change in signal at a first detection temperature in the presence of the first target nucleic acid; and provides a constant signal at a second detection temperature. Meanwhile, the second target nucleic acid detection composition provides a constant signal at the first detection temperature in the presence of the second target nucleic acid; and provides a change in signal at the second detection temperature.

[0806] The oligonucleotides used in this example were prepared as shown in Table 11 below, and are identical to the oligonucleotides used in Examples 1-2 and 1-3.

[0807]

[0808] Target nucleic acid sequence number Oligotype Tm value (℃) Sequence (5'-3') CT4CT-Forward primer 61GGCAAATGACAGAGCCG5CT-Reverse primer 60CCAATTGTAATAGAAGCATTGG6HTO-261.5(PC)[5AZOQ2]ATTATAATTGTATCTTT / iChamel610_T / TTTGATACATCAGAAGCTGTCATTTTGGCTGCG[Spacer C3] NG1NG-Forward primer 64GGAAGCAGTGGCGGC2NG-Reverse primer 64AGTAATCAGATGAAACCAGTTCC7HTO-375(PC) / 64(NC)CCTGCGC / iAZOQ2_T / CTATATGTAGTTT / iChamel610_T / TTTCTACATATAGAGCCCCTCATTGGCGTGTTTCG[Spacer C3]

[0809] BOLD: Single-stranded loop of the initial hairpin structure;

[0810] Underline: Initial double-stranded stem of the initial hairpin structure;

[0811] PC: Tm of self-extended hairpin structures generated dependently on the presence of target nucleic acid;

[0812] NC: Tm of the initial hairpin structure of HTO

[0813]

[0814] Next, real-time polymerase chain reaction was performed using the above oligonucleotides. Taq DNA polymerase with 5' nuclease activity was used for forward and reverse primer extension and oligonucleotide cleavage.

[0815] 20 pmoles of CT-forward primer (SEQ ID NO: 4), 20 pmoles of CT-reverse primer (SEQ ID NO: 5), 10 pmoles of HTO-2 (SEQ ID NO: 6), 10 pmoles of NG-forward primer (SEQ ID NO: 1), 10 pmoles of NG-reverse primer (SEQ ID NO: 2), and 5 pmoles of HTO-3 (SEQ ID NO: 7) were mixed in each of target nucleic acid (Tube 1: 50 pg of CT genomic DNA; Tube 2: 50 pg of NG genomic DNA; Tube 3: 50 pg of CT genomic DNA and 50 pg of NG genomic DNA mixture) and distilled water (Tube 4: negative control), and then 5 μl of 4X Enzyme master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Tag DNA polymerase) (Enzynomics, Korea) was added to the final mixture. 20 μl of reaction mixture was prepared.

[0816] Tubes 1 to 4 containing the reaction mixtures were each placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, followed by 50 cycles of 57°C for 60 seconds, 72°C for 30 seconds, 70°C for 5 seconds, and 95°C for 30 seconds, to perform real-time PCR.

[0817] Signal detection was performed at the first detection temperature (57°C) and the second detection temperature (70°C) for each cycle:

[0818] The real-time PCR results are shown in Figure 33.

[0819] In the real-time PCR results for tube 1 containing only CT target nucleic acids, the amplification curve at the first detection temperature showed a change in signal as the CT target nucleic acids were amplified. In contrast, the amplification curve at the second detection temperature showed no change in signal and remained constant even when the CT target nucleic acids were amplified.

[0820] In the real-time PCR results for tube 2 containing only NG target nucleic acids, the amplification curve at the first detection temperature remained constant without any change in signal even when the NG target nucleic acids were amplified. In contrast, the amplification curve at the second detection temperature showed a change in signal as the NG target nucleic acids were amplified.

[0821] In the real-time PCR results for tube 3 containing CT and NG target nucleic acids, the amplification curves at the first detection temperature and the amplification curves at the second detection temperature showed changes in signal as the CT and NG target nucleic acids were amplified, respectively.

[0822] Meanwhile, the negative control reaction (tube 4) provided a constant signal at 57°C and 70°C, i.e., no change in signal was detected.

[0823] These results imply that various combinations of UnderSC-type and InterSC-type HTOCE compositions can be used to detect multiple target nucleic acids in real time using a single type of label in a single reaction vessel.

[0824] As described above, the HTOCE assay according to the present disclosure can measure a signal (i.e., a change in signal) indicating the presence of a target nucleic acid using a reference signal value obtained from a negative control reaction. If the signal value at 57°C and 70°C is higher than RFU 100, which is a threshold based on the signal value of the negative control reaction (i.e., RFU: 0), the signal was considered to have changed.

[0825] As a result, as shown in Table 12, in tube 1, a signal change was confirmed with a Ct value of 24.13 only at the first detection temperature (57°C), in tube 2, a signal change was confirmed with a Ct value of 32.59 only at the second detection temperature (70°C), and in tube 3, a signal change was confirmed with a Ct value of 24.26 and 31.25 at the first detection temperature (57°C) and the second detection temperature (70°C), respectively. On the other hand, in tube 4, which is the negative control, no signal change was confirmed at either the first detection temperature (57°C) or the second detection temperature (70°C).

[0826]

[0827] Tube Ct (Cycle threshold)57℃70℃124.13N / A2N / A32.59324.2631.254N / AN / A

[0828] Tube 1: 50 pg of CT genomic DNA;

[0829] Tube 2: 50 pg of NG genomic DNA;

[0830] Tube 3: 50 pg of CT genomic DNA and 50 pg of NG genomic DNA;

[0831] Tube 4: Negative control;

[0832] N / A: Not Applicable

[0833]

[0834] In summary, the HTOCE composition according to the present disclosure can detect one or more target nucleic acids using the same type of label in one reaction vessel.

[0835]

[0836] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for detecting a target nucleic acid in a sample by an HTO Cleavage and Self-Extension assay, comprising: (a) A step of hybridizing the target nucleic acid with a primer and a hairpin-tagging oligonucleotide (HTO); The primer comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid, The above HTO comprises a 5'-tagging portion and a 3'-targeting portion in 5' to 3' order, The 5'-tagging portion comprises (i) a templating portion comprising a nucleotide sequence that non-hybridizes to the target nucleic acid and (ii) an initial hairpin structure comprising an initial double-stranded stem and a single-stranded loop, The 3'-targeting portion comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid, The above primer is located upstream of the HTO; (b) a step of contacting the resultant of step (a) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the HTO; The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the HTO, which cleavage releases a fragment containing the 5'-tagging portion of the HTO; (c) a step of self-extension of the fragment using a DNA polymerase having the 5' nuclease activity under conditions in which the initial hairpin structure is maintained; The 3'-end of the fragment extends along the templating region to generate an extended sequence complementary to the templating region, thereby generating a self-extended hairpin structure comprising an extended double-stranded stem and the single-stranded loop, The self-extended hairpin structure has a Tm that is controllable by the sequence and / or length of the fragment, The Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure, The above HTO has a reporter molecule and a quencher molecule, The reporter molecule and the quencher molecule are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state; and (d) a step of detecting the presence of the self-extended hairpin structure by measuring a signal provided from the self-extended hairpin structure; The presence of the self-extended hairpin structure indicates the presence of the target nucleic acid.

2. In the first paragraph, the reporter molecule and the quencher molecule are characterized in that (i) when the templating portion of the HTO exists as a single strand, the reporter molecule and the quencher molecule are close to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the templating portion of the HTO forms a double strand by hybridization with the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

3. A method according to claim 2, wherein the reporter molecule and the quencher molecule are both linked to the templating portion of the HTO, or one of the reporter molecule and the quencher molecule is linked to the single-stranded loop and the other of the reporter molecule and the quencher molecule is linked to the templating portion of the HTO.

4. A method according to claim 1, characterized in that the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which the self-extended hairpin structure can be maintained.

5. In the first paragraph, (i) the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenches a signal from the reporter molecule when (i-1) the initial hairpin structure is maintained, and (i-2) the reporter molecule and the quencher molecule are close to each other so that the quencher molecule quenches a signal from the reporter molecule when the initial hairpin structure dissociates into a single-stranded state; or Or (ii) the reporter molecule and the quencher molecule are characterized in that (ii-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are close to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

6. A method according to claim 5, wherein the reporter molecule and the quencher molecule are linked to the initial hairpin structure.

7. A method according to claim 5, characterized in that the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which (i) the self-extended hairpin structure is maintained and (ii) the initial hairpin structure dissociates into a single-stranded state.

8. In the first paragraph, the method is performed in the presence of a labeled portion hybridizing oligonucleotide (LPHO) comprising a nucleotide sequence that hybridizes to a labeled portion, wherein the labeled portion is a nucleotide sequence comprising a nucleotide to which the reporter molecule is linked and a nucleotide to which the quencher molecule is linked.

9. A method according to claim 8, characterized in that the label portion is included in the templating portion of the HTO.

10. A method according to claim 9, wherein the reporter molecule and the quencher molecule are positioned so that (i) when the label portion exists as a single strand, the reporter molecule and the quencher molecule are close to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the label portion forms a double strand by hybridization with the LPHO or the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

11. A method according to claim 8, characterized in that when the target nucleic acid is present in the sample, the self-extended hairpin structure is generated to prevent the formation of an HTO / LPHO hybrid between the labeling portion of the HTO and the LPHO, whereas when the target nucleic acid is not present in the sample, the self-extended hairpin structure is not generated but instead the HTO / LPHO hybrid is formed.

12. A method according to claim 11, characterized in that the formation of the self-extended hairpin structure prevents the formation of the HTO / LPHO hybrid by preferring hybridization between the label portion of the self-extended hairpin structure and the extended sequence over hybridization between the label portion of the HTO and the LPHO.

13. A method according to claim 11, wherein the formation of the self-extended hairpin structure is characterized in that the formation of the HTO / LPHO hybrid is prevented by cleaving the LPHO during the self-extension of step (c).

14. A method according to claim 11, characterized in that the measurement of the signal provided from the self-extended hairpin structure is performed at a temperature at which (i) the self-extended hairpin structure is maintained and (ii) the HTO / LPHO hybrid dissociates into a single-stranded state.

15. A composition for detecting a target nucleic acid in a sample by an HTO Cleavage and Self-Extension assay, comprising: (a) primer; The primer comprises a nucleotide sequence that hybridizes to a first region of the target nucleic acid; and (b) Hairpin-Tagging Oligonucleotide (HTO); The above HTO comprises a 5'-tagging portion and a 3'-targeting portion in 5' to 3' order, The 5'-tagging portion comprises (i) a templating portion comprising a nucleotide sequence that non-hybridizes to the target nucleic acid and (ii) an initial hairpin structure comprising an initial double-stranded stem and a single-stranded loop, The 3'-targeting portion comprises a nucleotide sequence that hybridizes to a second region of the target nucleic acid, The above primer is located upstream of the above HTO, The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the HTO, which cleavage releases a fragment containing the 5'-tagging portion of the HTO; The 3'-end of the fragment extends along the templating region to generate an extended sequence complementary to the templating region, thereby generating a self-extended hairpin structure comprising an extended double-stranded stem and the single-stranded loop, The self-extended hairpin structure has a Tm that is controllable by the sequence and / or length of the fragment, The Tm of the self-extended hairpin structure is higher than the Tm of the initial hairpin structure, The above HTO has a reporter molecule and a quencher molecule, The reporter molecule and the quencher molecule are positioned such that quenching or unquenching is induced depending on whether the self-extended hairpin structure is maintained or dissociated into a single-stranded state; and The self-extended hairpin structure provides a signal indicating the presence of the target nucleic acid.

16. In claim 15, the composition is characterized in that it has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the target nucleic acid is present.

17. A composition according to claim 15, wherein (i) when the templating portion of the HTO exists as a single strand, the reporter molecule and the quencher molecule are close to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the templating portion of the HTO forms a double strand by hybridization with the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

18. In claim 17, the composition is characterized in that it has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and a signal-constant temperature range (SCoTR) in which the signal is constant even when the target nucleic acid is present.

19. A composition according to claim 18, characterized in that the composition is an Under-Signal-Change-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range.

20. In paragraph 15, (i) the reporter molecule and the quencher molecule are positioned so that (i-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenches a signal from the reporter molecule, and (i-2) when the initial hairpin structure is dissociated into a single-stranded state, the reporter molecule and the quencher molecule are positioned so that the quencher molecule quenches a signal from the reporter molecule; Or (ii) the reporter molecule and the quencher molecule are characterized in that (ii-1) when the initial hairpin structure is maintained, the reporter molecule and the quencher molecule are close to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii-2) when the initial hairpin structure dissociates into a single-stranded state, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

21. In claim 20, the composition is characterized in that it has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the target nucleic acid is present.

22. In claim 21, the composition is characterized in that the composition is an InterSC-Signal-Change-type composition having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

23. In claim 15, the composition further comprises a labeled portion hybridizing oligonucleotide (LPHO) comprising a nucleotide sequence that hybridizes to a labeled portion, wherein the labeled portion is a nucleotide sequence comprising a nucleotide to which the reporter molecule is linked and a nucleotide to which the quencher molecule is linked.

24. A composition according to claim 23, wherein the reporter molecule and the quencher molecule are positioned so that (i) when the label portion exists as a single strand, the reporter molecule and the quencher molecule are close to each other so that the quencher molecule quenches a signal from the reporter molecule, and (ii) when the label portion forms a double strand by hybridization with the LPHO or the extended sequence, the reporter molecule and the quencher molecule are spaced apart from each other so that the quencher molecule unquenchs a signal from the reporter molecule.

25. In claim 23, the composition is characterized in that it has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the target nucleic acid and two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the target nucleic acid is present.

26. In claim 23, the composition is characterized in that the composition is an InterSC-Signal-Change-type composition having a melting characteristic in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges.

27. A method for detecting n target nucleic acids in a sample, comprising: (a) a step of incubating a sample suspected of containing one or more of the n target nucleic acids with n target nucleic acid detection compositions in one reaction vessel, and detecting a signal at n detection temperatures; The above n is an integer greater than or equal to 2, The above incubation comprises multiple reaction cycles, and the detection of the signal is performed in one or more of the multiple reaction cycles, Each of the above n target nucleic acid detection compositions provides a change in a signal indicating the presence of the corresponding target nucleic acid at a corresponding detection temperature among the above n detection temperatures in the presence of the corresponding target nucleic acid, Among the above n target nucleic acid detection compositions, the i target nucleic acid detection composition provides a change in a signal indicating the presence of the i target nucleic acid at the i detection temperature among the n detection temperatures in the presence of the i target nucleic acid, and provides a constant signal at other detection temperatures. The above i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature. Within the temperature range including all of the above n detection temperatures, the composition for detecting the i-th target nucleic acid has a signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th target nucleic acid and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant even when the i-th target nucleic acid is present. The composition for detecting the above target nucleic acid is, (i) an UnderSC-type composition having a melting characteristic in which the signal-change temperature range is lower than the signal-constant temperature range; (ii) an InterSC-type composition having a melting property in which the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other of the two signal-constant temperature ranges, and (iii) any one of the OverSC-type compositions having a melting characteristic in the signal-change temperature range higher than the signal-constant temperature range; At least one of the above n target nucleic acid detection compositions is a composition that generates a signal according to the method of any one of claims 1 to 14, and; (b) A step of determining the presence of n target nucleic acids from the signals detected in the above step (a), wherein the step of determining the presence of the i-th target nucleic acid is determined by a change in the signal detected at the i-th detection temperature.

28. A method according to claim 27, wherein the i-th detection temperature is selected within the signal-change temperature range of the i-th target nucleic acid detection composition, and the i-th detection temperature is not included in the signal-change temperature range of another target nucleic acid detection composition.

29. In the 27th paragraph, the signal-change temperature range of the i-target nucleic acid detection composition may partially overlap with the signal-change temperature range of the target nucleic acid detection composition having an adjacent detection temperature, and is characterized in that it does not overlap with the signal-change temperature range of the target nucleic acid detection composition having a non-adjacent detection temperature.

30. A method according to claim 27, wherein when n is 2, the first target nucleic acid detection composition is an UnderSC-type or InterSC-type composition, and the second target nucleic acid detection composition is an InterSC-type or OverSC-type composition.

31. A method according to claim 27, wherein, when n is 3 or more, the first target nucleic acid detection composition is an UnderSC-type or InterSC-type composition, the n-th target nucleic acid detection composition is an InterSC-type or OverSC-type composition, and each of the target nucleic acid detection compositions other than the first target nucleic acid and the n-th target nucleic acid is an InterSC-type composition.

Images