Assessing and treating cancer

Abstract

This document relates to methods and materials for assessing and / or treating mammals (e.g., humans) having a cancer (e.g., a pancreatic cancer, such as pancreatic ductal adenocarcinoma (PDAC), or a breast cancer). For example, methods and materials that can be used for assessing if a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) is likely to be successfully treated are provided. This document also provides methods and materials for treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer).

Description

[0001]Attorney Docket No.07039-2207WO1 / 2022-500 ASSESSING AND TREATING CANCER CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Patent Application Serial No.63 / 524,450, filed on June 30, 2023. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application. STATEMENT REGARDING FEDERAL FUNDING This invention was made with government support under CA078383, CA150190, and HL140411 awarded by the National Institutes of Health. The government has certain rights in the invention. SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically as an XML file named “07039-2207WO1_SL.xml.” The XML file, created on April 30, 2024, is 18,615 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. TECHNICAL FIELD This document relates to methods and materials for assessing and / or treating mammals (e.g., humans) having a cancer (e.g., a pancreatic cancer, such as pancreatic ductal adenocarcinoma (PDAC), or a breast cancer). For example, methods and materials provided herein can be used to determine if a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) is likely to respond to a particular treatment. This document also provides methods and materials for treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). BACKGROUND INFORMATION PDAC is currently the third leading cause of cancer-associated death in the United States, and its 5-year survival rate is less than 10%. PDAC is associated with extensive early Attorney Docket No.07039-2207WO1 / 2022-500 dissemination and high invasiveness. More than 90% of patients do not qualify for surgery due to late-stage diagnosis when tumor(s) have already spread to encroach upon crucial arteries. At this point in disease progression, viable treatment options are limited and include neoadjuvant therapy. Gemcitabine with nab-paclitaxel (e.g., ABRAXANE®) or FOLFIRINOX (a combination of leucovorin, 5-fluorouracil, irinotecan, and oxaliplatin) are the current front-line treatments for PDAC. See, for example, Papadatos-Pastos et al., Expert Rev. Anticancer Ther.14(10):1115 (2014); and Goldstein, et al., J. Natl. Cancer Inst., 107(2) (2015). However, these conventional treatments often fail due to drug resistance and / or the avascular and immunosuppressive nature of the tumor microenvironment. See, for example, Goldstein, et al., J. Natl. Cancer Inst., 107(2) (2015); and Kindler, Seminars in Oncology., 32(9):33-36 (2005). SUMMARY This document provides methods and materials for assessing and / or treating mammals (e.g., humans) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). For example, the methods and materials provided herein can be used to determine whether or not a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In some cases, a sample (e.g., a tissue sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed to determine if a candidate anti-cancer treatment is likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer, or a breast cancer) based, at least in part, on the presence or absence of one or more altered nanomechanical properties in a sample obtained from that mammal and contacted with a candidate anti-cancer treatment. For example, a sample (e.g., a tissue sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed to determine if a candidate anti-cancer treatment is likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer, or a breast cancer) based, at least in part, on comparing one or more nanomechanical properties (e.g., one, two, three, Attorney Docket No.07039-2207WO1 / 2022-500 four, five, six, or more nanomechanical properties) of a first portion of a sample obtained from the mammal contacted with the candidate anti-cancer treatment with one or more nanomechanical properties (e.g., one, two, three, four, five, six, or more nanomechanical properties) of a second portion of the sample not contacted with the candidate anti-cancer treatment. This document also provides methods and materials for treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) where the treatment is selected based, at least in part, on whether or not a candidate anti-cancer treatment is likely to be effective in treating that mammal (e.g., that human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). For example, a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be administered an anti-cancer treatment that is selected based, at least in part, on the presence or absence of one or more altered nanomechanical properties in a sample obtained from that mammal and contacted with a candidate anti-cancer treatment. As demonstrated herein, if one or more nanomechanical properties of a sample from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) contacted with a candidate anti-cancer treatment are altered, then the candidate anti- cancer treatment can be classified as being likely to be effective in treating that mammal (e.g., that human). In some cases, if one or more nanomechanical properties of a first portion of a sample from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) contacted with a candidate anti-cancer treatment are altered as compared to one or more nanomechanical properties of a second portion of that sample that was not contacted with a candidate anti-cancer treatment, then the candidate anti-cancer treatment can be classified as being likely to be effective in treating that mammal (e.g., that human). For example, if one or more of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D) of a first portion of a sample obtained from a mammal and contacted with a candidate anti-cancer treatment are altered as compared to the same of a second portion of that sample not contacted with the candidate anti-cancer treatment, then the candidate anti- Attorney Docket No.07039-2207WO1 / 2022-500 cancer treatment can be classified as being likely to be effective in treating the mammal (e.g., the human). Having the ability to identify whether a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) is likely to respond to a particular anti-cancer treatment as described herein (e.g., based, at least in part, on the presence or absence of one or more altered nanomechanical properties in a sample obtained from a mammal (e.g., a human) having a cancer and contacted with a candidate anti-cancer treatment) provides a unique and unrealized opportunity to provide an individualized approach for selecting cancer therapies based on the likelihood of success, thus providing cost-effective care with better outcomes. In general, one aspect of this document features methods for determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal having a cancer. The methods can include, or consist essentially of (a) contacting a first portion of a sample obtained from a mammal having a cancer with the candidate anti-cancer treatment; (b) comparing one or more nanomechanical properties of the first portion following the contacting step (a) to one or more nanomechanical properties of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment; and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the one or more nanomechanical properties of the first portion are altered as compared to the one or more nanomechanical properties of the second portion; or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the one or more nanomechanical properties of the first portion are not altered as compared to the one or more nanomechanical properties of the second portion. In some cases, the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D). In some cases, the method further comprises comparing an expression level of one or more polypeptides of the first portion following the contacting step (a) to an expression level of the one or more polypeptides of a second portion of the sample, wherein the one or more polypeptides are selected from the group consisting of a TGF?1 polypeptide, an IL-8 polypeptide, a CCL2 polypeptide, and a CXCL2 polypeptide. In some cases, the method Attorney Docket No.07039-2207WO1 / 2022-500 comprises classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the first portion is higher than the expression level of the TGF?1 polypeptide and / or the IL-8 polypeptide of the second portion. In some cases, the method comprises classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the first portion is not higher than the expression level of each of a TGF?1 polypeptide and / or an IL-8 polypeptide of the second portion. In some cases, the method comprises classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the first portion is lower than the expression level of a CCL2 polypeptide and / or the CXCL2 polypeptide of the second portion. In some cases, the method comprises classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the first portion is not lower than the expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the second portion. In some cases, the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy. In some cases, the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND- PEG)-irinotecan, ND-PEG-doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin-bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab. In some cases, the sample is a tissue sample. In some cases, the cancer is selected from the group consisting of a pancreatic cancer, a breast cancer, a lung cancer, a glioblastoma, and a lymph node cancer. In some cases, the pancreatic cancer is PDAC. In some cases, the mammal is a human. In some cases, the first portion of the sample and the second portion of the sample comprise cancer cells. In some cases, the method comprises classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal. In some cases, the method further comprises administering the candidate anti- cancer treatment to the mammal. Attorney Docket No.07039-2207WO1 / 2022-500 In another aspect, this document features methods for treating a mammal having a cancer. The methods can include, or consist essentially of, (a) contacting a first portion of a sample obtained from a mammal having a cancer with a candidate anti-cancer treatment; (b) determining that one or more nanomechanical properties of the first portion following the contacting step (a) are altered as compared to the one or more nanomechanical properties of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment; and (c) administering the candidate anti-cancer treatment to the mammal. In some cases, the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D). In some cases, the method further comprises determining that an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the first portion following the contacting step (a) are increased as compared to an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of a second portion of the sample. In some cases, the method further comprises determining that an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the first portion following the contacting step (a) are decreased as compared to an expression level of a CCL2 polypeptide and / or a CXCL2 of a second portion of the sample. In some cases, the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy. In some cases, the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)- irinotecan, ND-PEG-doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin-bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab. In some cases, the sample is a tissue sample. In some cases, the cancer is selected from the group consisting of a pancreatic cancer, a breast cancer, a lung cancer, a glioblastoma, and a lymph node cancer. In some cases, the pancreatic cancer is a PDAC. In some cases, the mammal is a human. In some cases, the first portion of the sample and the second portion of the sample comprise cancer cells. Attorney Docket No.07039-2207WO1 / 2022-500 In another aspect, this document features methods for treating a mammal having a cancer. The methods can include, or consist essentially of, (a) contacting a first portion of a sample obtained from a mammal having a cancer with a candidate anti-cancer treatment; (b) determining that one or more nanomechanical properties of the first portion following the contacting step (a) are not altered as compared to the one or more nanomechanical properties of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment, and (c) administering an anti-cancer treatment different from the candidate anti-cancer treatment to the mammal. In some cases, the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D). In some cases, the method further comprises determining that an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the first portion following the contacting step (a) are increased as compared to an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of a second portion of the sample. In some cases, the method further comprises determining that an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the first portion following the contacting step (a) are decreased as compared to an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of a second portion of the sample. In some cases, the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy. In some cases, the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG- doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin- bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, and oxaliplatin. In some cases, the sample is a tissue sample. In some cases, the cancer is selected from the group consisting of a pancreatic cancer, a breast cancer, a lung cancer, a glioblastoma, and a lymph node cancer. In some cases, the pancreatic cancer is a pancreatic ductal adenocarcinoma. In some cases, the mammal is a human. In some cases, the first portion of the sample and the second portion of the sample comprise cancer cells. Attorney Docket No.07039-2207WO1 / 2022-500 In another aspect, this document features methods for treating a mammal having a cancer. The methods can include, or consist essentially of, administering an anti-cancer treatment to a mammal having a cancer, where a first portion of a sample obtained from the mammal was determined to have one or more nanomechanical properties that were altered as compared to the one or more nanomechanical properties of a second portion of the sample, where the first portion was contacted with the anti-cancer treatment, and where the second portion was not contacted with the anti-cancer treatment. In some cases, the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D). In some cases, the first portion of the sample obtained from the mammal was determined to have a higher expression level a TGF?1 polypeptide and / or an IL-8 polypeptide as compared to an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the second portion of the sample. In some cases, the first portion of the sample obtained from the mammal was determined to have a lower expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide as compared to an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the second portion of the sample. In some cases, the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy. In some cases, the anti- cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG-doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin-bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab. In some cases, the sample is a tissue sample. In some cases, the cancer is pancreatic cancer. In some cases, the pancreatic cancer is pancreatic ductal adenocarcinoma. In some cases, the cancer is breast cancer. In some cases, the mammal is a human. In some cases, the first portion of the sample and the second portion of the sample comprise cancer cells. In another aspect, this document features methods for treating a mammal having a cancer. The methods can include, or consist essentially of, administering an anti-cancer Attorney Docket No.07039-2207WO1 / 2022-500 treatment different from a candidate anti-cancer treatment to a mammal having a cancer, where a first portion of a sample obtained from the mammal was determined to lack one or more nanomechanical properties that were altered as compared to the one or more nanomechanical properties of a second portion of the sample, where the first portion was contacted with the candidate anti-cancer treatment, and where the second portion was not contacted with the candidate anti-cancer treatment. In some cases, the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D). In some cases, the first portion of the sample obtained from the mammal was determined to lack a higher expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide as compared to an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the second portion of the sample. In some cases, the first portion of the sample obtained from the mammal was determined to lack a lower expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide as compared to an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the second portion of the sample. In some cases, the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy. In some cases, the anti- cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG-doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin-bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab. In some cases, the sample is a tissue sample. In some cases, the cancer is pancreatic cancer. In some cases, the pancreatic cancer is pancreatic ductal adenocarcinoma. In some cases, the cancer is breast cancer. In some cases, the mammal is a human. In some cases, the first portion of the sample and the second portion of the sample comprise cancer cells. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can Attorney Docket No.07039-2207WO1 / 2022-500 be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. DESCRIPTION OF THE DRAWINGS Figures 1A-1F show dynamic alteration in nanomechanical properties of Panc-1 cells upon various treatments. Normalized linear nanomechanical properties measured included membrane stiffness (Figure 1A), deformation (Figure 1B), and adhesion (Figure 1C). Normalized non-linear nanomechanical properties measured included drained Poisson’s ratio (Figure 1D), diffusion coefficient (Figure 1E), and pore dimension (Figure 1F). (n = 7 cells). NDP: ND-PEG and NDI: ND-PEG-IRT. Statistical analysis was performed by One Way ANOVA. ns: p > 0.05; ****: p < 0.0001. Figures 2A-2F show dynamic alteration in nanomechanical properties of AsPC-1 cells upon various treatments. Normalized linear nanomechanical properties measured included membrane stiffness (Figure 2A), deformation (Figure 2B), and adhesion (Figure 2C). Normalized non-linear nanomechanical properties measured included drained Poisson’s ratio (Figure 2D), diffusion coefficient (Figure 2E), and pore dimension (Figure 2F). (n = 7 cells). NDP: ND-PEG and NDI: ND-PEG-IRT. Statistical analysis was performed by One Way ANOVA. ns: p > 0.05; ****: p < 0.0001. Figures 3A-3B show dynamic alterations in relative cytokine expressions upon treatment with NDP or NDI in Panc-1 cells (Figure 3A) and AsPC-1 cells (Figure 3B) for the indicated amount of time. UT: untreated, NDP: biocompatible nanodiamonds conjugated with poly(ethylene glycol), and NDI: biocompatible nanodiamonds that are pegylated and conjugated with irinotecan. “1h”: cultured with or without treatment for 1 hour, “24h”: Attorney Docket No.07039-2207WO1 / 2022-500 cultured with or without treatment for 24 hours. Statistical analysis was performed by T-test; *: p < 0.05, **: p < 0.01, and ***: p < 0.001. Figures 4A-4B show heat maps indicating correlation between nanomechanical properties and cytokine profiles due to various biocompatible nanodiamonds (Bio-ND) treatments in Panc-1 (Figure 4A) and AsPC-1 (Figure 4B). D_P: drained Poisson’s ratio, D_C: diffusion coefficient and P_D: pore dimensions. Figures 5A-5E show cytokine expression of Panc-1 influenced poroelastic parameters. Relative mRNA Expression of IL-8 (Figure 5A) and TGF?-1 (Figure 5B) in IL8- depleted and TGF?-1 depleted Panc1 cells, respectively. Non-linear nanomechanical properties influenced by the IL-8 and TGF?-1 depletion in Panc-1 measured included D_P (Figure 5C), D_C (Figure 5D), and P_D (Figure 5E). D_P: drained Poisson’s ratio, D_C: diffusion coefficient and P_D: pore dimensions. Statistical significance for Figures 5A and 5B were performed by T-test. Statistical analyses for Figures 5C-5E were performed by One Way ANOVA. ns: not significant, **: p < 0.01, ***: p < 0.001; ****: p < 0.0001. Figures 6A-6H show cytokine expression of Panc-1 cells influenced nanomechanical properties upon dose-dependent Bortezomib treatment. Normalized linear nanomechanical properties tested included membrane stiffness (Figure 6A), deformation (Figure 6B), and adhesion (Figure 6C). Normalized nonlinear nanomechanical properties tested included drained Poisson’s ratio (Figure 6D), diffusion coefficient, (Figure 6E), and pore dimensions (Figure 6F). Relative mRNA expression of various cytokines in Panc-1 upon dose dependent Bortezomib treatment (Figure 6G). Heat map indicating correlation between nanomechanical properties and various cytokines (Figure 6H). D_P: drained Poisson’s ratio, D_C: diffusion coefficient and P_D: pore dimensions. Statistical analysis was performed by One Way ANOVA; ns: not significant, **: p < 0.01, ***: p < 0.001; ****: p < 0.0001. Figures 7A-7H show prediction of relative cytokine expression levels based on nanomechanical properties in Panc-1 cells in the presence or absence of Bio-NDs. CCL2 (Figure 7A), CXCL1 (Figure 7B), CXCL2 (Figure 7C), CXCL3 (Figure 7D), IL8 (Figure 7E, IL11 (Figure 7F), IL18 (Figure 7G), TGF?1 (Figure 7H). Figures 8A-8H show prediction of relative cytokine expression levels based on nanomechanical properties in AsPC-1 cells in the presence or absence of Bio-NDs. CCL2 Attorney Docket No.07039-2207WO1 / 2022-500 (Figure 8A), CXCL1 (Figure 8B), CXCL2 (Figure 8C), CXCL3 (Figure 8D), IL8 (Figure 8E), IL11 (Figure 8F), IL18 (Figure 8G), TGF?1 (Figure 8H). Figure 9 is an exemplary schematic diagram that represents the nanoparticle induced cytokine regulations that can influence cellular nanomechanical properties of PDAC cells. Figures 10A-10I show nanomechanical properties of 350µm thick PDAC tissue sections under various treatment conditions. Representative heat maps of untreated PDAC tissue are shown for stiffness (Figure 10A), deformation (Figure 10B), and adhesion (Figure 10C). Representative heat maps of ND-PEG-irinotecan (ND-PEG-Ir, biocompatible nanodiamonds that are pegylated and conjugated with irinotecan) treated PDAC tissue are shown for stiffness (Figure 10D), deformation (Figure 10E), and adhesion (Figure 10F). Comparative quantifications of PDAC tissue are shown for stiffness (Figure 10G), deformation (Figure 11H), and adhesion (Figure 10I). Sample size of (n = 150). Statistical analysis was performed using One-Way ANOVA and indicated by ****, p < 0.0001. Figures 11A-11O show nanomechanical properties of PDAC tissue sections (350 µm thick) with a scan region of 120x120 µm2under various treatments. Nanomechanical properties of control tissue shown include stiffness (Figure 11A), deformation (Figure 11B), and adhesion (Figure 11C). Nanomechanical properties of ATMi (ataxia telangiectasia mutant (ATM) kinase inhibitor) treated tissue shown include stiffness (Figure 11D), deformation (Figure 11E), and adhesion (Figure 11F). Nanomechanical properties of olaparib treated tissue shown include stiffness (Figure 11G), deformation (Figure 11H), and adhesion (Figure 11I). Nanomechanical properties of tissue subjected to combination treatment shown include stiffness (Figure 11J), deformation (Figure 11K), and adhesion (Figure 11L). Comparative nanomechanical properties are shown for stiffness (Figure 11M), deformation (Figure 11N), and adhesion (Figure 11O). (n = 225). Statistical analysis was performed using One-Way ANOVA and indicated by ****, p < 0.0001. Figures 12A-12C show a comparative study demonstrating nanomechanical properties of ex vivo treated tissue sections with varying concentrations (0.1X, 0.01X and 0.001X) and in vivo treatment (1X). Nanomechanical properties measured include stiffness (Figure 12A), deformation (Figure 12B), and adhesion (Figure 12C). All datasets corresponding to different ex vivo concentration treatments significantly vary as compared to Attorney Docket No.07039-2207WO1 / 2022-500 in vivo concentration with p<0.0001, unless otherwise mentioned. Statistical significance was determined using One-Way ANOVA with ns, p < 0.05; *, p < 0.05). (n = 225). Figures 13A-13C show the combined anti-tumor effects of ATMi (azd1390) and olaparib treatments in a pancreatic xenograft animal model: Mice with 4535 orthotopic pancreatic tumors were given four different treatments (n = 5): vehicles (Control), ATMi (azd1390) (8 mg / kg), olaparib (40 mg / kg), and a combination of ATMi (azd1390) (8 mg / kg) and olaparib (40 mg / kg). Figure 13A shows images of tumors from treated mice. Figure 13B is a graph of tumor volume of tumors from treated mice. Figure 13C is a graph of tumor weights from treated mice. Figure 14 is a probability of survival curve demonstrating improved survival in combination treatment (olaparib + ATMi) as compared to either olaparib, ATMi, or control (vehicles). Figures 15A-15C is a series of graphs of tissue stiffness (Figure 15A), tissue deformation (Figure 15B), and tissue adhesion (Figure 15C) after treatment with gemcitabine (Gem), paclitaxel (Pac), and gemcitabine + paclitaxel (Gem+Pac) in vivo. (n=225) Figures 16A-16C is a series of graphs of tissue stiffness (Figure 16A), tissue deformation (Figure 16B), and tissue adhesion (Figure 16C) after treatment for 6, 12, or 24 hours with gemcitabine (Gem), paclitaxel (Pac), and gemcitabine + paclitaxel (Gem+Pac) ex vivo. (n=225) Figures 17A-17B is a series of graphs showing tumor volume (Figure 17A) and tumor weight (Figure 17B) of orthotopic Panc-1 tumors after treatment with gemcitabine (Gem), paclitaxel (Pac), and gemcitabine + paclitaxel (Gem+Pac). Figure 18 is a graph of relative mRNA expression values normalized to 18S expression values after treatment of Panc-1 tumor tissue with gemcitabine (Gem), paclitaxel (Pac), and gemcitabine + paclitaxel (Gem+Pac). Figure 19 is a graph of relative mRNA expression values normalized to 18S expression values after treatment of 4535 tumor tissue with ATMi (azd1390), olaparib (40 mg / kg), and ATMi (azd1390) + olaparib (40 mg / kg). Figures 20A-20B are heat maps of a NanoString expression analysis showing fold change alterations in cytokine release profiles in untreated Panc-1 cells relative to Panc-1 Attorney Docket No.07039-2207WO1 / 2022-500 cells after Bio-ND treatment (NDP or NDI treatment) at 1 hour (1h) and 24 hour (24h) post- treatment time points. Figures 21A-21C is a series of heat maps showing correlation coefficients of non- linear nanomechanical attributes and cytokine expression levels in Panc-1 cells after various Bio-NDs treatments. Figure 22 depicts the results of a string interaction network analysis. Figures 23A-23H is a series of graphs showing observed (O) and predicted (P) cytokine expression levels from nanomechanical properties of Panc-1 and AsPC-1 (combined) treated with ND+ / -IRT using Support Vector Machine (SVM) regression. Figures 24A-24D is a series of pie charts depicting machine learning validations of atomic force microscopy (AFM) data between in vivo and ex vivo time points in Panc-1 tumor tissue after treatment with gemcitabine (Gem), paclitaxel (Pac), and gemcitabine + paclitaxel (Gem+Pac). Figures 25A-25C is a series of graphs of relative mRNA expression values normalized to 18S expression values depicting alterations in cytokine expression patterns in 350µm thick tissue sections of Panc-1 tumor tissue upon treatment for 6 (Figure 25A), 12 (Figure 25B), and 24 (Figure 25C) hours with gemcitabine (Gem), paclitaxel (Pac), and gemcitabine + paclitaxel (Gem+Pac) ex vivo. Figures 26A-26D is a series of pie charts depicting machine learning validations of RT-PCR data between in vivo and ex vivo time points in Panc-1 tumor tissue after treatment with gemcitabine (Gem), paclitaxel (Pac), and gemcitabine + paclitaxel (Gem+Pac). Figures 27A-27C is a series of graphs of tissue stiffness (Figure 27A), tissue deformation (Figure 27B), and tissue adhesion (Figure 27C) in 350µm thick tissue sections of 4535 tumor tissue after treatment for 6, 12, and 24 hours with ATMi (azd1390), olaparib, and ATMi (azd1390) + olaparib (ATMi+Ola) ex vivo compared to in vivo treatments. Figures 28A-28C is a series of graphs of relative mRNA expression values normalized to 18S expression values depicting alterations in cytokine expression patterns in 350µm thick tissue sections of 4535 tumor tissue upon treatment for 6 (Figure 28A), 12 (Figure 28B), and 24 (Figure 28C) hours with ATMi (azd1390), olaparib, and ATMi (azd1390) + olaparib (ATMi+Ola) ex vivo. Attorney Docket No.07039-2207WO1 / 2022-500 Figures 29A-29C is a series of graphs of tissue stiffness (Figure 29A), tissue deformation (Figure 29B), and tissue adhesion (Figure 29C) in 350µm thick tissue sections of 4T1 tumor tissue after treatment with breast cancer specific vaccine (Vaccine), anti-PD-1 antibody (PD-1), and anti-PD-1 antibody + breast cancer specific vaccine (PD-1 + Vaccine) in vivo. Figure 30 is a graph of relative mRNA expression values normalized to 18S expression values depicting alterations in cytokine expression patterns in 350µm thick tissue sections of 4T1 tumor tissue upon treatment with breast cancer specific vaccine (Vaccine), anti-PD-1 antibody (PD-1), and anti-PD-1 antibody + breast cancer specific vaccine (PD-1 + Vaccine) in vivo. Figures 31A-31C is a series of graphs of tissue stiffness (Figure 31A), tissue deformation (Figure 31B), and tissue adhesion (Figure 31C) in 350µm thick tissue sections of TUBO tumor tissue after treatment with breast cancer specific vaccine (Vaccine), anti-PD- 1 antibody (PD-1), and anti-PD-1 antibody + breast cancer specific vaccine (PD-1 + Vaccine) in vivo. Figure 32 is a graph of relative mRNA expression values normalized to 18S expression values depicting alterations in cytokine expression patterns in 350µm thick tissue sections of TUBO tumor tissue upon treatment with breast cancer specific vaccine (Vaccine), anti-PD-1 antibody (PD-1), and anti-PD-1 antibody + breast cancer specific vaccine (PD-1 + Vaccine) in vivo. Figures 33A-33C is a series of graphs of tissue stiffness (Figure 33A), tissue deformation (Figure 33B), and tissue adhesion (Figure 33C) in 350µm thick tissue sections of 4T1 tumor tissue after treatment with rapamycin + vinorelbine (R+V) and liposomal formulation containing rapamycin and vinorelbine (RLV) in vivo. Figure 34 is a graph of relative mRNA expression values normalized to 18S expression values depicting alterations in cytokine expression patterns in 350µm thick tissue sections of 4T1 tumor tissue upon treatment with rapamycin + vinorelbine (R+V) and liposomal formulation containing rapamycin and vinorelbine (RLV) in vivo. Figures 35A-35C is a series of graphs of tissue stiffness (Figure 35A), tissue deformation (Figure 35B), and tissue adhesion (Figure 35C) in 350µm thick tissue sections Attorney Docket No.07039-2207WO1 / 2022-500 of TUBO tumor tissue after treatment with rapamycin + vinorelbine (R+V) and liposomal formulation containing rapamycin and vinorelbine (RLV) in vivo. Figure 36 is a graph of relative mRNA expression values normalized to 18S expression values depicting alterations in cytokine expression patterns in 350µm thick tissue sections of TUBO tumor tissue upon treatment with rapamycin + vinorelbine (R+V) and liposomal formulation containing rapamycin and vinorelbine (RLV) in vivo. DETAILED DESCRIPTION This document provides methods and materials for assessing and / or treating mammals (e.g., humans) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). For example, the methods and materials provided herein can be used to determine whether or not a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In some cases, a sample (e.g., a tissue sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed to determine if a candidate anti-cancer treatment is likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer), based, at least in part, on the presence or absence of one or more altered nanomechanical properties in a sample obtained from that mammal and contacted with a candidate anti-cancer treatment (e.g., as compared to a reference sample). If one or more nanomechanical properties of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment are altered (e.g., as compared to the nanomechanical properties of a reference sample), the candidate anti-cancer treatment can be identified as being likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer). If the nanomechanical properties of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment are not altered (e.g., as compared to a reference sample), the candidate anti-cancer treatment can Attorney Docket No.07039-2207WO1 / 2022-500 be identified as not being likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer). In some cases, a sample (e.g., a tissue sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed to determine if a candidate anti-cancer treatment is likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer) based, at least in part, on comparing one or more nanomechanical properties (e.g., one, two, three, four, five, six, or more nanomechanical properties) of a first portion of a sample obtained from the mammal and contacted with the candidate anti-cancer treatment with one or more nanomechanical properties (e.g., one, two, three, four, five, six, or more nanomechanical properties) of a second portion of the sample not contacted with the candidate anti-cancer treatment. For example, one nanomechanical property can be used as described herein to determine if a candidate anti-cancer treatment is likely to be effective in treating a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In another example, two nanomechanical properties can be used as described herein to determine if a candidate anti-cancer treatment is likely to be effective in treating a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In another example, three nanomechanical properties can be used as described herein to determine if a candidate anti-cancer treatment is likely to be effective in treating a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In yet another example, four or more nanomechanical properties can be used as described herein to determine if a candidate anti-cancer treatment is likely to be effective in treating a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In yet another example, five nanomechanical properties can be used as described herein to determine if a candidate anti-cancer treatment is likely to be effective in treating a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In yet another example, six nanomechanical properties can be used as described herein to determine if a candidate anti-cancer treatment is likely to be effective in treating a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). If one or more nanomechanical properties of the first portion of the obtained sample are altered as compared to the nanomechanical properties of the second portion of the obtained sample, the candidate anti-cancer treatment can be identified as being likely to be Attorney Docket No.07039-2207WO1 / 2022-500 effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer). If the nanomechanical properties of the first portion of the obtained sample are not altered as compared to the nanomechanical properties of the second portion of the obtained sample, the candidate anti-cancer treatment can be identified as not being likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer). In some cases, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include comparing one or more nanomechanical properties of a sample obtained from the mammal and contacted with the candidate anti- cancer treatment to a reference level; and classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the one or more nanomechanical properties of the sample are altered as compared to the reference level; or classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the one or more nanomechanical properties of sample are not altered as compared to a reference level. In some cases, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with the candidate anti-cancer treatment; (b) comparing one or more nanomechanical properties of the first portion following the contacting step (a) to one or more nanomechanical properties of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment; and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the one or more nanomechanical properties of the first portion are altered as compared to the one or more nanomechanical properties of the second portion; or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the one or more nanomechanical properties of the first portion are not altered as compared to the one or more nanomechanical properties of the second portion. Identifying if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast Attorney Docket No.07039-2207WO1 / 2022-500 cancer) can include comparing one or more nanomechanical properties of a sample obtained from the mammal and contacted with the candidate anti-cancer treatment to a reference level; and classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the one or more nanomechanical properties of the sample are altered as compared to the reference level. In some cases, identifying if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with the candidate anti-cancer treatment; (b) determining that one or more nanomechanical properties of the first portion following the contacting step (a) are altered as compared to one or more nanomechanical properties of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment; and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal. Identifying a candidate anti-cancer treatment as being unlikely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include comparing one or more nanomechanical properties of a sample obtained from the mammal and contacted with the candidate anti-cancer treatment to a reference level; and classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the one or more nanomechanical properties of sample are not altered as compared to the reference level. In some cases, identifying a candidate anti- cancer treatment as being unlikely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with the candidate anti- cancer treatment; (b) determining that one or more nanomechanical properties of the first portion following the contacting step (a) is not altered as compared to one or more nanomechanical properties of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment; and (c) classifying the candidate anti- cancer treatment as being unlikely to be effective in treating the mammal. Any appropriate method can be used to contact a sample (e.g., a first portion of a sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, Attorney Docket No.07039-2207WO1 / 2022-500 such as PDAC, or a breast cancer) with a candidate anti-cancer treatment. In cases where a candidate anti-cancer treatment includes administration of one or more anti-cancer compounds, contacting a sample (e.g., a first portion of a sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) with the candidate anti-cancer compound(s) can include culturing the sample in a solution (e.g., a culture medium) containing the candidate anti-cancer treatment. In cases where a candidate anti-cancer treatment includes one or more anti-cancer therapies (e.g., a radiation therapy), contacting a sample (e.g., a first portion of a sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) with the candidate anti-cancer treatment can include subjecting the sample to the candidate anti-cancer therapies. A sample (e.g., a first portion of a sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be contacted with one or more candidate anti-cancer treatments for any appropriate amount of time. In some cases, a sample (e.g., a first portion of a sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be contacted with a candidate anti-cancer treatment for the amount of time necessary to determine whether the obtained sample has an altered level of one or more nanomechanical properties. For example, contacting a sample (e.g., a first portion of a sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) with a candidate anti-cancer treatment can occur over a minute, an hour, several hours, a day, or several days. In some cases, contacting a sample (e.g., a first portion of a sample) with a candidate anti-cancer treatment can occur over 6 hours. In some cases, contacting a sample (e.g., a first portion of a sample) with a candidate anti-cancer treatment can occur over 12 hours. In some cases, contacting a sample (e.g., a first portion of a sample) with a candidate anti-cancer treatment can occur over 24 hours. Any appropriate mammal having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed and / or treated as described herein. Examples of mammals that can have cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and can be assessed and / or treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, and rats. In some cases, Attorney Docket No.07039-2207WO1 / 2022-500 a human having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed and / or treated as described herein. When assessing and / or treating a mammal (e.g., a human) having a cancer as described herein, the cancer can be any type of cancer. In some cases, a cancer can include one or more solid tumors. In some cases, a cancer can be a blood cancer. Examples of cancers that can be assessed and / or treated as described herein include, without limitation, pancreatic cancers (e.g., PDAC), breast cancers, lung cancers, glioblastomas, and lymph node cancers (e.g., lymphomas). In some cases, a cancer can be an adenocarcinoma. Adenocarcinomas can include cancerous tumors (e.g., a neoplasm of epithelial tissue) that have glandular origins, glandular characteristics, or both. In some cases, an adenocarcinoma can be an exocrine adenocarcinoma. An adenocarcinoma can be at any location of a mammal (e.g., a human) being assessed and / or treated as described herein. For example, an adenocarcinoma can be in the pancreas or a part of the pancreas (e.g., in the pancreatic duct). In some cases, an adenocarcinoma can be a PDAC. In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). Any appropriate method can be used to identify a mammal as having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). For example, imaging techniques (e.g., X-rays, computerized tomography (CT) scanning, and positron emission tomography (PET)), and / or laboratory examination (e.g., of a skin sample obtained by biopsy) can be used to identify a mammal (e.g., a human) as having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). As described herein, a candidate anti-cancer treatment can be identified as being likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) by comparing one or more nanomechanical properties of an obtained sample from the mammal following the contacting step to one or more reference levels of the one or more nanomechanical properties. In some cases, a candidate anti-cancer treatment can be identified as being likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) by comparing one or more nanomechanical properties of a first portion of an Attorney Docket No.07039-2207WO1 / 2022-500 obtained sample from the mammal following the contacting step to one or more nanomechanical properties of a second portion of the obtained sample, where the second portion was not contacted with the candidate anti-cancer treatment. In some cases, a sample obtained from a mammal (e.g., a human) having cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti- cancer treatment can have an altered level of any appropriate one or more nanomechanical properties (e.g., linear nanomechanical properties and / or non-linear nanomechanical properties) as compared to a reference level in that sample obtained from a mammal (e.g., a human) having the cancer (e.g., the pancreatic cancer, such as PDAC, or the breast cancer). In some cases, a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment can have an altered level of any appropriate one or more nanomechanical properties (e.g., linear nanomechanical properties and / or non-linear nanomechanical properties) as compared to a second portion of the sample not contacted with the candidate anti-cancer treatment. Examples of nanomechanical properties that can be assessed to determine if an altered level is observed when a sample obtained from a mammal (e.g., a human) having a cancer is contacted with a candidate anti-cancer treatment as compared to a second portion of the obtained sample when not contacted with a candidate anti-cancer treatment (or as compared to a reference level) include, without limitation, membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), pore dimensions (P_D), viscoelasticity, and cell surface roughness. In some cases, contacting a first portion of the obtained sample with a candidate anti- cancer treatment can result in an altered nanomechanical property in the first portion of the sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment, or in some cases, as compared to a reference level for that nanomechanical property. The term “altered” as used herein with respect to a nanomechanical property in a first portion of an obtained sample contacted with a candidate anti-cancer treatment refers to Attorney Docket No.07039-2207WO1 / 2022-500 a level of that nanomechanical property that is decreased or increased as compared to that nanomechanical property observed in a second portion of the sample not contacted with the candidate anti-cancer treatment. In some cases, contacting at least a portion of the obtained sample with a candidate anti-cancer treatment can result in an altered nanomechanical property in that contacted portion of the sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as compared to a reference level of that nanomechanical property. In such cases, the term “altered” as used herein with respect to a nanomechanical property in an obtained sample contacted with a candidate anti-cancer treatment refers to a level of that nanomechanical property that is decreased or increased as compared to that reference level. In some cases, a reference level can be a level of one or more nanomechanical properties in an obtained sample that was not contacted with a candidate anti-cancer treatment. It will be appreciated that levels of nanomechanical properties from comparable samples are used when determining whether or not a particular level is an altered level of a nanomechanical property. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be a decreased level of membrane stiffness as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, a decreased level of membrane stiffness for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) less than that observed in the second portion. In some cases, a decreased level of membrane stiffness for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold less than that observed in the second portion. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti- cancer treatment as described herein can be an increased level of membrane stiffness as compared to that nanomechanical property observed in a second portion of the obtained Attorney Docket No.07039-2207WO1 / 2022-500 sample not contacted with the candidate anti-cancer treatment. For example, an increased level of membrane stiffness for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) more than that observed in the second portion. In some cases, an increased level of membrane stiffness for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold more than that observed in the second portion. Any appropriate method can be used to measure the level of membrane stiffness in a sample. In some cases, the membrane stiffness of a sample can be calculated from force-separation (F-S) curves produced from atomic force microscopy (AFM), elastography analyses, optical tweezer analyses, and / or microfluidic analyses. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be a decreased level of membrane deformation as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, a decreased level of membrane deformation for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) less than that observed in the second portion. In some cases, a decreased level of membrane deformation for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold less than that observed in the second portion. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti- cancer treatment as described herein can be an increased level of membrane deformation as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, an increased level of membrane deformation for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, Attorney Docket No.07039-2207WO1 / 2022-500 about 90%, about 95%, or more) more than that observed in the second portion. In some cases, an increased level of membrane deformation for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold more than that observed in the second portion. Any appropriate method can be used to measure the level of membrane deformation in a sample. In some cases, the membrane deformation of a sample can be calculated from F-S curves produced from AFM, differential edge tracking analyses, and / or ektacytometry analyses. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be a decreased level of membrane adhesion as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, a decreased level of membrane adhesion for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) less than that observed in the second portion. In some cases, a decreased level of membrane adhesion for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold less than that observed in the second portion. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti- cancer treatment as described herein can be an increased level of membrane adhesion as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, an increased level of membrane adhesion for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) more than that observed in the second portion. In some cases, an increased level of membrane adhesion for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold more than that observed in the second portion. Any appropriate method can be used to Attorney Docket No.07039-2207WO1 / 2022-500 measure the level of membrane adhesion in a sample. In some cases, the membrane adhesion of a sample can be calculated from F-S curves produced from AFM, hydrodynamic shear flow assays, micropipette aspiration analyses, reflection interference contrast microscopy (RICM) analyses, and / or flow chamber analyses. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be a decreased level of D_P as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, a decreased level of D_P for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) less than that observed in the second portion. In some cases, a decreased level of D_P for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold less than that observed in the second portion. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be an increased level of D_P as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, an increased level of D_P for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) more than that observed in the second portion. In some cases, an increased level of D_P for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold more than that observed in the second portion. Any appropriate method can be used to measure the level of D_P in a sample. In some cases, the D_P of a sample can be calculated from F-S curves produced from AFM. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, Attorney Docket No.07039-2207WO1 / 2022-500 such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be a decreased level of D_C as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, a decreased level of D_C for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) less than that observed in the second portion. In some cases, a decreased level of D_C for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold less than that observed in the second portion. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be an increased level of D_C as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, an increased level of D_C for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) more than that observed in the second portion. In some cases, an increased level of D_C for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold more than that observed in the second portion. Any appropriate method can be used to measure the level of D_C in a sample. In some cases, the D_C of a sample can be calculated from F-S curves produced from AFM, pervaporation analyses, and / or dual-focus fluorescence correlation spectroscopy. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be a decreased level of P_D as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, a decreased level of P_D for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about Attorney Docket No.07039-2207WO1 / 2022-500 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) less than that observed in the second portion. In some cases, a decreased level of P_D for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold less than that observed in the second portion. In some cases, an altered level of a nanomechanical property in a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment as described herein can be an increased level of P_D as compared to that nanomechanical property observed in a second portion of the obtained sample not contacted with the candidate anti-cancer treatment. For example, an increased level of P_D for the first portion can be at least 5% (e.g., about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more) more than that observed in the second portion. In some cases, an increased level of P_D for the first portion can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold more than that observed in the second portion. Any appropriate method can be used to measure the level of P_D in a sample. In some cases, the P_D of a sample can be calculated from F-S curves produced from AFM, electron microscopy analyses, capillary flow porometry analyses, and / or sonoporation analysis. Any appropriate sample from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed as described herein (e.g., for the presence or absence of an altered level of one or more nanomechanical properties when contacted with a candidate anti-cancer treatment). In some cases, a sample can be a biological sample. In some cases, a sample can contain one or more cancer cells (e.g., one or more adenocarcinoma cells, or pancreatic cancer cells, such as PDAC). Examples of samples that can be assessed as described herein include, without limitation, tissue samples and blood samples. A sample can be a fresh sample. In some cases, the particular one or more nanomechanical properties used to determine whether or not a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be selected based on the cell type(s) present in a sample. Attorney Docket No.07039-2207WO1 / 2022-500 In some cases, a candidate anti-cancer treatment identified as being likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as described herein (e.g., based, at least in part, on the presence of an altered level of one or more nanomechanical properties) can be selected to be administered to the mammal (e.g., a human) to treat the mammal’s cancer. For example, a candidate anti-cancer treatment identified as being likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) by having one or more altered nanomechanical properties of a first portion of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with the candidate anti-cancer treatment, as compared to those one or more nanomechanical properties of a second portion of the sample not contacted with the candidate anti-cancer treatment (or a reference level) can be selected to be administered to the mammal to treat the mammal’s cancer. Examples of anti-cancer treatments that can be used as a candidate anti-cancer treatment and can be assessed as described herein (and / or that can be administered to a mammal if identified as being effective for that particular mammal as described herein) include administrations of one or more anti-cancer compounds, radiation therapies, and tumor treating fields (TTF) therapies. Anti-cancer compounds can include, without limitation, chemotherapeutic agents, targeted cancer drugs, and immunotherapy drugs. Examples of anti-cancer compounds that can be used as a candidate anti-cancer treatment and can be assessed as described herein (and / or that can be administered to a mammal if identified as being effective for that particular mammal as described herein) include, without limitation, irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG-doxorubicin, bortezomib, rapamycin, olaparib, ATMi (azd1390), gemcitabine (e.g., GEMZAR®, optionally with paclitaxel protein-bound particles (e.g., Abraxane®)), 5-fluorouracil, oxaliplatin (e.g., ELOXATIN®), paclitaxel, docetaxel, albumin-bound paclitaxel (e.g., ABRAXANE®), capecitabine, cisplatin, irinotecan, liposomal irinotecan (e.g., ONIVYDE®), a combination of leucovorin, 5-fluorouracil, irinotecan, and oxaliplatin (e.g., FOLFIRINOX), carboplatin (e.g., PARAPLATIN®), and pembrolizumab (e.g., KEYTRUDA®)and combinations thereof. In some cases, an anti-cancer compound that can be used as a candidate anti-cancer treatment Attorney Docket No.07039-2207WO1 / 2022-500 and can be assessed as described herein (and / or that can be administered to a mammal if identified as being effective for that particular mammal as described herein) can be as described elsewhere. See, for example, Madamsetty, et al., Nanomedicine.18, 112 (2019); Benson and Amini, Cancer Drug Resistance.3 (4), 854 (2020); Mochalin et al., Nature Nanotechnology.7 (1),11 (2011); Reina et al., Angewandte Chemie International Edition.58 (50), 17918 (2019); Yuan et al., J Nanobiotechnology.17 (1),110 (2019); Zhu et al., Theranostics.2 (3), 302 (2012); Pentecost et al., Biomater. Sci.5 (10), 2131 (2017); and Huang et al. J. Biophotonics.10(10), 1315(2017). In some cases, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include assessing the expression level of one or more polypeptides. For example, a sample (e.g., a tissue sample) obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be assessed to determine if a candidate anti-cancer treatment is likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer), based, at least in part, on the expression level of one or more polypeptides in a sample obtained from that mammal and contacted with a candidate anti-cancer treatment (e.g., as compared to a reference sample). If an expression level of one or more polypeptides in a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment is altered (e.g., higher or lower as compared to expression level of that polypeptide in a reference sample), the candidate anti-cancer treatment can be identified as being likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer). If an expression level of one or more polypeptides in a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and contacted with a candidate anti-cancer treatment is not altered (e.g., as compared to a reference sample), the candidate anti-cancer treatment can be identified as not being likely to be effective in treating that mammal having a cancer (e.g., that human having a pancreatic cancer, such as PDAC, or a breast cancer). Examples of polypeptides that can be assessed to determine if an altered level of expressed is Attorney Docket No.07039-2207WO1 / 2022-500 observed when a sample obtained from a mammal (e.g., a human) having a cancer is contacted with a candidate anti-cancer treatment as compared to a second portion of the obtained sample when not contacted with a candidate anti-cancer treatment (or as compared to a reference level) include, without limitation, TGF?1 polypeptides, IL-8 polypeptides, CCL2 polypeptides, and CXCL2 polypeptides. In some cases, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) comparing an expression level of one or more polypeptides (e.g., TGF?1 polypeptides and / or IL-8 polypeptides) of the first portion following the contacting step to an expression level of the one or more polypeptides of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or to a reference level of expression); and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of the one or more polypeptides of the first portion is higher than the expression level of the one or more polypeptides of the second portion (or the reference level of expression); or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of the one or more polypeptides of the first portion is not higher than the expression level of the one or more polypeptides of the second portion (or the reference level of expression). For example, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) comparing an expression level of a TGF?1 polypeptide of the first portion following the contacting step to an expression level of the TGF?1 polypeptide of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or to a reference level of expression); and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of the TGF?1 polypeptide of the first portion is higher than the expression level of the TGF?1 polypeptide of the second portion (or the reference level of Attorney Docket No.07039-2207WO1 / 2022-500 expression); or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of the TGF?1 polypeptide of the first portion is not higher than the expression level of the TGF?1 polypeptide of the second portion (or a reference level of expression). In some cases, a higher expression level of a TGF?1 polypeptide in a first portion of a sample obtained from a mammal and contacted with a candidate anti-cancer treatment can be at least 3.5-fold (e.g., about 3.5-fold, about 3.8- fold, about 4-fold, about 4.5-fold, or more) higher as compared to the expression level of the TGF?1 polypeptide in a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or as compared to a reference level of expression). For example, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) comparing an expression level of an IL-8 polypeptide of the first portion following the contacting step to an expression level of the IL-8 polypeptide of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or to a reference level of expression); and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of the IL-8 polypeptide of the first portion is higher than the expression level of the IL-8 polypeptide of the second portion (or a reference level of expression); or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of the IL-8 polypeptide of the first portion is not higher than the expression level of the IL-8 polypeptide of the second portion (or the reference level of expression). In some cases, a higher expression level of an IL-8 polypeptide in a first portion of a sample obtained from a mammal and contacted with a candidate anti-cancer treatment can be least 2.2-fold (e.g., about 2.2-fold, about 2.5-fold, about 2.8-fold, about 3-fold, or more) higher as compared to the expression level of the IL-8 polypeptide in a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or as compared to a reference level of expression). Attorney Docket No.07039-2207WO1 / 2022-500 As another example, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) comparing an expression level of one or more polypeptides (e.g., CCL2 polypeptides and / or CXCL2 polypeptides) of the first portion following the contacting step to an expression level of the one or more polypeptides of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or to a reference level of expression); and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of the one or more polypeptides of the first portion is lower than the expression level of the one or more polypeptides of the second portion (or the reference level of expression); or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of the one or more polypeptides of the first portion is not lower than the expression level of the one or more polypeptides of the second portion (or the reference level of expression). For example, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) comparing an expression level of a CCL2 polypeptide of the first portion following the contacting step to an expression level of a CCL2 polypeptide of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or to a reference level of expression); and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of the CCL2 polypeptide of the first portion is lower than the expression level of the CCL2 polypeptide of the second portion (or the reference level of expression); or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of the CCL2 polypeptide of the first portion is not lower than the expression level of the CCL2 polypeptide of the second portion (or the reference level of expression). In some cases, a lower expression level of a CCL2 polypeptide in a first portion of a sample obtained from a mammal and contacted with a Attorney Docket No.07039-2207WO1 / 2022-500 candidate anti-cancer treatment can be at least 0.5-fold (e.g., about 0.5-fold, about 0.6-fold, about 0.7-fold, about 0.8-fold, or more) lower as compared to the expression level of the CCL2 polypeptide in a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or as compared to a reference level of expression). For example, determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can include (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) comparing an expression level of a CXCL2 polypeptide of the first portion following the contacting step to an expression level of a CXCL2 polypeptide of a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or to a reference level of expression); and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the expression level of the CXCL2 polypeptide of the first portion is lower than the expression level of the CXCL2 polypeptide of the second portion (or the reference level of expression); or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the expression level of the CXCL2 polypeptide of the first portion is not lower than the expression level of the CXCL2 polypeptide of the second portion (or the reference level of expression). In some cases, a lower expression level of a CXCL2 polypeptide in a first portion of a sample obtained from a mammal and contacted with a candidate anti-cancer treatment can be at least 0.5-fold (e.g., about 0.5-fold, about 0.6-fold, about 0.7-fold, about 0.8-fold, or more) lower as compared to the expression level of the CXCL2 polypeptide in a second portion of the sample, where the second portion was not contacted with the candidate anti-cancer treatment (or as compared to a reference level of expression). In some cases, the step of comparing can include comparing one or more nanomechanical properties and an expression level of one or more polypeptides of a first portion contacted with a candidate anti-cancer treatment of a sample obtained from a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) with one or more nanomechanical properties and an expression level of one or more polypeptides of a second portion not contacted with the candidate anti-cancer treatment of Attorney Docket No.07039-2207WO1 / 2022-500 the sample. In some cases, the step of comparing can include comparing one or more nanomechanical properties and an expression level of one or more polypeptides of a portion contacted with a candidate anti-cancer treatment of a sample obtained from a mammal (e.g., a human) having a cancer to reference levels for the one or more nanomechanical properties and the expression level of the one or more polypeptides. In some cases, the comparing can be performed as described in Example 1. In some cases, if a candidate anti-cancer treatment is classified and / or determined to be unlikely to be effective, one or more additional candidate anti-cancer treatments can be tested (e.g., a second candidate anti-cancer treatment, a third candidate anti-cancer treatment, etc.). This document also provides methods for treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer). In some cases, a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) that is assessed as described herein (e.g., to determine whether or not a candidate anti-cancer treatment is likely to be effective in treating that mammal) can be administered or instructed to self-administer one or more (e.g., one, two, three, four, five, or more) anti- cancer treatments, where the one or more anti-cancer treatments are determined to be effective to treat the cancer (e.g., the pancreatic cancer, such as PDAC, or the breast cancer) within the mammal (e.g., a human) as described herein (e.g., based, at least in part, on the presence of one or more altered nanomechanical properties in a sample obtained from a mammal (e.g., a human) having a cancer and contacted with the anti-cancer treatment). For example, a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) can be administered or instructed to self-administer one or more anti-cancer treatments that are selected based, at least in part, on whether or not the anti- cancer treatments are likely to be effective in treating the mammal (e.g., the human) having the cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) (e.g., based, at least in part, on the presence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the anti-cancer treatment). Attorney Docket No.07039-2207WO1 / 2022-500 In some cases, when a candidate anti-cancer treatment is determined to be likely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) based, at least in part, on the presence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the candidate anti-cancer treatment, the mammal can be administered or can be instructed to self-administer that candidate anti-cancer treatment. In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) with an anti-cancer treatment that is identified as likely to be effective in treating that mammal as described herein (e.g., based, at least in part, on the presence of an altered level of one or more nanomechanical properties), that anti-cancer treatment can be the sole anti-cancer treatment used to treat the mammal. In some cases, when a candidate anti-cancer treatment is determined to be unlikely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) based, at least in part, on the absence of an altered level (e.g., a decreased level) level of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the candidate anti-cancer treatment, the mammal can be administered or instructed to self-administer one or more alternative anti-cancer treatments (e.g., one or more anti-cancer treatments that are different from the candidate anti- cancer treatment). For example, when a candidate anti-cancer treatment is determined to be unlikely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) based, at least in part, on the absence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the candidate anti-cancer treatment, the mammal can be administered or can be instructed to self-administer one or more anti- cancer compounds that are different from the candidate anti-cancer treatment. For example, when a candidate anti-cancer treatment is determined to be unlikely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) based, at least in part, on the absence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the candidate anti-cancer treatment, the mammal can be administered or can Attorney Docket No.07039-2207WO1 / 2022-500 be instructed to self-administer one or more anti-cancer therapies that are different from the candidate anti-cancer treatment. For example, when a candidate anti-cancer treatment is determined to be unlikely to be effective in treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) based, at least in part, on the absence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the candidate anti- cancer treatment, the mammal can undergo surgery to remove at least a portion (e.g., one or more tumors) of the cancer. In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) with an alternative anti-cancer treatment as described herein (e.g., an anti-cancer treatment that is different than a candidate anti-cancer treatment that is identified as being unlikely to be effective based, at least in part, on the absence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the candidate anti- cancer treatment), the alternative anti-cancer treatment can be the sole cancer treatment used to treat the mammal. In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as described herein, the mammal also can be administered or instructed to self-administer one or more (e.g., one, two, three, four, five or more) additional agents / therapies used to treat cancer. For example, a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) that is administered or instructed to self-administer an anti-cancer treatment that is identified as being likely to be effective in treating that mammal as described herein (e.g., based, at least in part, on the presence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with that anti-cancer treatment) can be administered or instructed to self-administer one or more (e.g., one, two, three, four, five, or more) additional agents / therapies used to treat cancer. For example, a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) that is administered or instructed to self-administer an alternative anti-cancer treatment (e.g., an anti-cancer treatment that is different than a candidate anti- Attorney Docket No.07039-2207WO1 / 2022-500 cancer treatment that is identified as being unlikely to be effective based, at least in part, on the absence of an altered level (e.g., a decreased level) of one or more nanomechanical properties in a sample obtained from the mammal and contacted with the candidate anti- cancer treatment), can be administered or instructed to self-administer one or more (e.g., one, two, three, four, five, or more) additional agents / therapies used to treat cancer. In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as described herein, the treatment can be effective to treat the cancer. For example, the number of cancer cells present within a mammal can be reduced using the methods and materials described herein. In some cases, the methods and materials described herein can be used to reduce the number of cancer cells present within a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as described herein, the treatment can be effective to prevent an increase in the number of cancer cells present within the mammal receiving the treatment. In some cases, the number of cancer cells present within a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and being treated as described herein can be monitored. Any appropriate method can be used to determine whether or not the number of cancer cells present within a mammal is reduced. For example, imaging techniques can be used to assess the number of cancer cells present within a mammal. In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as described herein, the treatment can be effective to reduce the size of a tumor present in the mammal receiving the treatment. In some cases, the methods and materials described herein can be used to reduce the size of one or more tumors present within a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the size (e.g., volume) of one or more tumors present within a mammal does not increase. Any appropriate method can be used to determine Attorney Docket No.07039-2207WO1 / 2022-500 whether or not the size of the tumor present within a mammal is reduced. For example, imaging techniques can be used to assess the size of the tumor present within a mammal. In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as described herein, the treatment can be effective to improve survival of the mammal. For example, the methods and materials described herein can be used to improve disease-free survival (e.g., relapse-free survival). For example, the methods and materials described herein can be used to improve overall survival. For example, the methods and materials described herein can be used to improve the survival of a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the methods and materials described herein can be used to improve the survival of a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) by, for example, at least 4 months (e.g., about 4 months, about 6 months, about 8 months, about 10 months, about 1 year, about 1.5 years, about 2 years, about 2.5 years, or about 3 years). In some cases, when treating a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) as described herein, the treatment can be effective to reduce or eliminate one or more symptoms of the cancer (e.g., the PDAC). Examples of symptoms of a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) that can be reduced or eliminated using the methods and materials described herein can include, without limitation, jaundice, dark urine, light-colored stools, greasy stools, itchy skin, stomach pain, back pain, weight loss, poor appetite, nausea, vomiting, gallbladder enlargement, liver enlargement, blood clots, and diabetes. For example, the methods and materials described herein can be used to reduce one or more symptoms of a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) within a mammal (e.g., a human) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the number of cancer cells present within a mammal (e.g., a human) having a cancer (e.g., a pancreatic cancer, such as PDAC, or a breast cancer) and being treated as described herein can be monitored. For example, imaging techniques can be used to assess the number of cancer cells present within a mammal. Attorney Docket No.07039-2207WO1 / 2022-500 The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES Example 1: Prediction of Cytokine Modulation in Pancreatic Cancer Cells from Therapy- induced Alterations in Nanomechanical Properties. This example describes the identification of a correlation between nanomechanical properties of cancer cells (e.g., PDAC cells) response of nano-formulations of cancer treatments. Materials and Methods Cell culture Immortalized pancreatic cancer cell lines such as Panc-1 (catalog no. CRL-1420) and AsPC-1 (catalog no. CRL-1682) were purchased from American Type Culture Collection (ATCC) and used without further validations. Panc-1 was cultured in complete DMEM media. AsPC-1 was cultured in complete RMPI media. Both Panc-1 and AsPC-1 cells were supplemented with 10% FBS and 1% penicillin-streptomycin. Both cell lines were cultured and maintained in a humidified 5% CO2 atmosphere. For all the AFM experiments, cells were cultured in 60-mm petri dish at ~70% confluency and maintained in the incubator at least 1-day prior to the experiment. For cytokine expression, cells were cultured in a 96-well plate with each well consisting of ~5000 cells and incubated for at least 1-day prior to the treatment. Synthesis of Bio-NDs PEGylated ND nanoparticles were synthesized as described elsewhere. See, for example, Wang et al., Diamond and Related Materials, 36, 26 (2013). Briefly, the NDs at 1.0 mg / mL concentration were sonicated using probe sonicator for 5 minutes. EDC (8.35 µg) and sulfo-NHS (9.5 µg) dissolved in Milli-Q water were then added into the ND suspension mixture. Post 30 minutes stirring, the mPEG-Amine (200 µg dissolved in water) solution was added to the activated ND solution and the resulting mixture was kept overnight at room Attorney Docket No.07039-2207WO1 / 2022-500 temperature under the influence of constant stirring. The amine groups of PEG reacted with the activated carboxyl groups to form stable amide bonds. The excess reagents were removed by centrifuging at 14K rpm for 2 hours and samples followed by thorough washing with Milli-Q water. Irinotecan (IRT) was then loaded onto PEGylated NDs. Briefly, ND-PEG was dispersed in 2.5 mM NaOH at 1 mg / mL concentration by probe-sonication for 5 minutes. IRT solution from 50 mg / mL DMSO stock was added to 1 mL ND-PEG suspension followed by overnight incubation subjected to rotating shaker at room temperature. IRT was adsorbed on ND-PEG to yield ND-PEG-IRT complex. It was then purified from fee IRT and 2.5 mM NaOH by centrifugation of the resultant mixture at 14K rpm for 2 hours followed by washing the pellet thoroughly with Milli-Q water. Comprehensive characterization of this complex in terms of drug loading efficiency and absorbance spectra was performed. Atomic Force Microscopy (AFM) AFM experiments were performed using Dimension Fastscan with ScanAsyst incorporating ICON head scanner (Bruker Corp, Santa Barbara, CA) for linear and non-linear NMPs evaluation. LC CAL A probes designed specifically for cell related studies were incorporated. Nominal spring constant (K) and tip radius recommended by the manufacturer is 0.1 N / m and 70 nm, respectively. Laser alignments were performed to yield maximum signal strength. Foremost, the probe was calibrated on a blank petri dish in fluid medium to account for alterations in NMPs due to hydrodynamic drag resulting from the fluid medium. The calibration process concluded the spring constant to be 0.08 N / m and the deflection sensitivity to be 26.9 nm / V along with the amplitude sensitivity of 772 nm / V at 1 KHz tapping frequency. The peak force amplitude was set to 300 nm for accurate tip-sample interaction and protect tip from damage during initial approach towards the sample. AFM is a surface mapping tool. The measurements over a 500 x 50 nm2region over the nuclear membrane were restricted to overcome heterogeneity in its surface roughness owing to the presence of actin fibers, microtubules and lipid bilayer. A custom-built petri dish holder held the culture dish firmly during all the AFM experiments. Cells in the culture dish were identified using an optical microscope attached to the ICON head scanner. Further, nanoindentation and force ramp script experiments evaluated linear and non-linear NMPs, Attorney Docket No.07039-2207WO1 / 2022-500 respectively. The ramping parameters were optimized. Nanoindentation technique involves the approach of the tip followed by indenting into the sample driven by the applied force and finally, retracting from the sample, resulting into a force-separation (F-S) curve. The entire nanoindentation process at a single point occurs over a few milliseconds’ duration. For ramp script analysis the experimental protocol involved rapidly indenting into the sample to a desired depth (10% of the cellular height) and thereon maintaining the depth while monitoring relaxation in the force levels up to a few seconds followed by retracting the tip from the sample. See, for example, Kulkarni et al., ACS Applied Bio Materials, 4(1), 984 (2021); Kulkarni et al., Biochimica et Biophysica Acta (BBA) - General Subjects 1863(5), 802 (2019); or Kulkarni et al., Journal of Nanobiotechnology, 20(1), 1 (2022). The ramp script process occurs over a 10 second time frame for each data point resulting into individual force-relaxation (F-R) curve. For both nanoindentation and ramp script procedures, at least 7 cells each with 10 data points assigned to nanoindentation and at least 5 data points assigned to ramp script procedure were incorporated for each treatment. Finally, all the experiments were conducted at 37°C maintained using a temperature-controlled AFM stage. Data analysis of AFM experiments Each individual F-S and F-R was passed through a boxcar filter to reduce noise and improve signal strength. It was then baseline corrected to complete the pre-processing of data. The corrected F-S and F-R curves were then subjected to individual mathematical models to extract linear and non-linear NMPs. See, for example, Kulkarni et al., ACS Applied Bio Materials, 4(1), 984 (2021); or Kulkarni et al., Journal of Nanobiotechnology, 20(1), 1(2022). A Derjaguin-Muller-Toporov (DMT) model was used to analyze F-S curve given as follows: …. (1) Where, is the force from the F-S curve, is the adhesion force, is the effective Young’s modulus given by, Attorney Docket No.07039-2207WO1 / 2022-500 …. (2) given by, …. (3) given by, are Poisson’s ratio ad modulus of the probe whereas, and are that of the sample, respectively. and are the radius of the probe and sample, respectively. A poroelasticity model was used to evaluate non-linear NMPs. Drained Poisson’s ratio ( ) is evaluated as follows, …. (5) In the F-R experiments, as the force levels reach plateau, the interstitial fluid pressure build up from rapid indentation redistributes in the cell commonly termed as drained condition and given by, …. (6) and can be extracted from the F-R curve. and can be further extracted from the poroelasticity model given by, …. Attorney Docket No.07039-2207WO1 / 2022-500 Where, ‘ ’ is the characteristic poroelastic time required for the force to relax. was evaluated from ‘ ’ as follows, …. (8) . NanoString Analysis NanoString analysis was performed using the protocol described elsewhere using nCounterTMHuman Inflammation v2 Panel (cat# XT-CSO-HIN2-12) purchased from NanoString. (See, for example, Norton et al., PloS one, 8 (11), e81925 (2013).) Briefly, RNA was isolated from cultured Panc-1 cells treated with Bio-NDs using RNeasy Kit (purchased from Qiagen). Gene expression was evaluated with NanoString Cancer Gene panel comprising of 255 genes known to be differentially expressed in PDAC.200 ng of each total RNA sample was prepared per manufacturer protocol. Post gene expression quantification on the NanoString nCounterTM, raw counts were generated with nSolverTM. Raw counts / gene were extracted using the nSolverTMsoftware into Microsoft excel file and were further analyzed. Evaluation of cytokine expression using qRT-PCR To evaluate mRNA expression analysis of the cytokine expressions, total RNA was extracted using RNeasy Kit (purchased from Qiagen). Following which, 1 µg of total RNA was reverse transcribed using an iScript™ cDNA synthesis kit (purchased from Bio-Rad) according to the manufacturer’s protocol. PCR was then performed using 0.1 µg of cDNA in a 10 µL of PCR mix containing 500 nM of each primer and power SYBR™master mix (purchased form Life Technologies). The reaction was performed using 7500 PCR system Attorney Docket No.07039-2207WO1 / 2022-500 (purchased from Applied Biosystems) and the parameters applied were 40 cycles of amplification at 95 °C for 15 seconds and 57 °C for 1 minute. The PCR primers and their sequences are shown in Table 1. Table 1. Exemplary Primer Sequences. Gene Target Forward Primer Reverse Primer 18s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG To evaluate the feasibility of a machine learning-based regression approach to predict cytokine expression levels from nanomechanical properties measured with AFM in Panc-1 and AsPC1, a Support Vector Machine (SVM) regression algorithm was trained to predict expression levels of eight cytokines, CCL2, CXCL1, CXCL2, CXCL3, IL8, IL11, IL18, and TGF?1. SVM is a non-parametric regression technique, and it relies on a kernel function. Unlike standard regression models that try to minimize the error between the observed and the predicted values, SVM regression aims to fit the best possible line / hyperplane within a known threshold value due to its robustness to outliers and high prediction accuracy. The dataset consisted of 10 replicates of nanomechanical properties from 7 individual Panc-1 and AsPC-1 cells (total 70 data points per treatment condition for each cell line), and cytokine expression had been evaluated with NanoString sequencing (3 replicates). Since, Attorney Docket No.07039-2207WO1 / 2022-500 there were 70 AFM observations, but only 3 cytokine outputs per treatment group, one observed cytokine level per AFM observation was randomly selected. AFM variables that were used for prediction were stiffness, deformation, adhesion, and nonlinear parameters D_P, D_C, and P_S. All these six attributes were part of the input, which made it a 6-dimensional input. SVM can easily handle inputs of that dimension. Six scenarios were evaluated – untreated (UT1), untreated for 24 hours (UT24), ND-PEG treated for 1 hour (NDP1), ND-PEG treated for 24 hours (NDP24), and ND-PEG-IRT treated for 1 and 24 hours (NDI1 and NDI24). Expression and AFM values were normalized by dividing by the mean values for UT1. Training and validation happened separately for each treatment group and each cytokine expression. In the experiments, a Gaussian kernel, where the kernel scale had been set to 0.61, was used. For combined validation of the employed SVM regression technique in predicting the cytokine expression, the k-fold cross validation technique, where k=5 was used. Due to the small data size, k-fold cross validation was perfectly suited to evaluate the quality of the learning model. In this validation technique, the data was first randomly shuffled and divided into k subsets. One of these subsets was used for validation while the remaining (k-1) subsets were used for training the SVM model. This process was repeated k times where each subset was used exactly once for validation. The average model performance was reported at the end of the training phase. The trained models were saved. The performance was evaluated based on the Mean Square Error (MSE) between the predicted and the observed cytokine expression levels. To test the performance of the trained SVM models for each treatment group and each cytokine on the individual cell lines, the saved trained models from the k-fold cross validation step and predicted the cytokine expression were used.20 AFM observations from each cell line out of the 70 available observations were randomly selected for such testing. Similar to the training step, MSE was used to evaluate the testing performance on Panc-1 and AsPC-1 cell lines individually. The implementation was done in MATLAB. Animal experimental plan For orthotopic syngenic model in C57BL6 mice, 5000 KPC cells isolated from genetically engineered spontaneous PDAC models stably transfected with luciferase- Attorney Docket No.07039-2207WO1 / 2022-500 expressing vectors were implanted in the pancreas head of mouse using a survival surgery. After one week of tumor initiation mice were treated two times per week for three weeks with BioND-IRT. Each mouse received 100 mg / kg of nanodiamond and 5 mg / kg of IRT. Control group received PBS. Further, primary cells isolated from patient derived xenograft (4535 cell line) were used to develop orthotopic PDAC xenograft in NSG-SCID mice. After a week of tumor initiation, these mice were imaged followed by treatments with ATMi (8 mg / kg), olaparib (40 mg / kg) and combination of both these drugs. All drug treatments were performed twice per week for 3 weeks. Mouse with vehicle treatment alone was used as control. These mice were then euthanized when tumor burden impaired their ability to move freely inside the cage. Pancreatic ductal adenocarcinoma (PDAC) tumor tissue was harvested using a 6-mm hole puncher at the endpoint after sacrificing the mice. Immediately, following the harvesting, tumor tissue was stored in HypoThermosol®(purchased from BioLife Solutions Inc.) tissue storage buffer and sliced into 2-4 mm in diameter and 350 µm thick sections using a vibratome (VF-300-0Z vibrating microtome, Compresstome, Precisionary Instruments LLC). These thin sections were then glued onto a 60-mm petri dish using a 3M VetbondTM / MCtissue adhesive.3 mL of tissue storage buffer was added to the petri dish such that the entire section of tissue was submerged in the buffer. AFM was then performed on the prepare sample. For ex vivo tissue treatments, post sectioning of the tumor tissue, were subjected to varying concentrations (0.1X, 0.01X and 0.001X) of ATMi, olaparib and their combination treatment as compared to in vivo (1X). Tissue sections were treated for 72 hours with respective concentrations and stored in an incubator maintained at 37°C and 5% CO2. AFM parameter for tissue experiments Bruker’s Dimension Fast Scan with ICON head was employed to characterize tissue stiffness in these sections in fluid environment. The probe incorporated had a tip radius in the form of 5 µm bead bearing a nominal cantilever spring constant, k=0.185 N / m along with a resonant frequency of 21.87 kHz and a long cantilever length of 115 µm making it ideal for tissue characterization. Foremost, the laser was aligned on the back of the tip to optimize the signal to noise ratio using thermal tuning method in air. Afterwards, the tip was engaged in fluid medium in an empty 60-mm petri dish and performed ramping to determine the Attorney Docket No.07039-2207WO1 / 2022-500 deflection sensitivity. The calibrated deflection sensitivity and cantilever stiffness were observed to be 133.5nm / V and 0.1 N / m, respectively. The calibrated deflection sensitivity incorporates the effect of hydrodynamic drag during the actual experiments. The calibration method further yielded a peak force amplitude of 304.7 nm / V at 1 kHz operating frequency. Post identification of the tissue sample and engagement of the tip, nanoindentation mode of experiment was performed in which, the probe rapidly indented into the sample according to the applied force followed by immediate retraction, which resulted in a force-separation (F- S) curve. The ramping parameters such as ramp size of 5 µm, ramp rate of 1 Hz, samples / ramp of 256 and trigger force of 5 nN were maintained consistent throughout the nanoindentation experiments. For ND-PEG-IRT treatment, 5 different regions, each comprising of 25 data points were scanned to give 125 data points. For ATMi, olaparib and their combination, 9 regions each with 25 data points were incorporated, yielding 225 data points. All the experiments were performed at 37°C maintained using a temperature- controlled AFM stage. Statistical significance Origin Pro Lab software was used to evaluate statistical significance and plotting the AFM data. Foremost, each dataset was analyzed for normality distribution criteria and upon successful implementation it was subjected to One-Way ANOVA test. Statistical differences were determined to be significant at P > 0.05. Results Bio-NDs alter linear and non-linear nanomechanical properties in Panc-1 cells. Commonly derived linear NMPs of cell membrane using AFM include membrane stiffness, deformation and adhesion from force-separation (F-S) curves. NMPs of Panc-1 cells treated with bio-ND formulations (NDP and NDI) after 1 hour and 24 hours (NDP1, NDP24 and NDI1, NDI24, respectively) were calculated. For simplicity, the treatment data with untreated Panc-1 were normalized and fold change were calculated (Figure 1). Membrane stiffness, deformation and adhesion parameters of untreated Panc-1 remained similar for 1 hour and 24 hour time points as seen from Figures 1A-1C. In Panc-1 treated with NDP, a 3.21 ± 0.04-fold increase in membrane stiffness at the end of 1 hour was Attorney Docket No.07039-2207WO1 / 2022-500 observed. The highest change in membrane stiffness of Panc-1 cells (4.45 ± 0.07-fold) was observed upon treatment with NDI (Figure 1A). Other NMPs include deformation in which, when Panc-1 cells were treated with NDP and NDI, a decrease in the deformation of 0.83 ± 0.02-fold and 0.66 ± 0.02-fold, respectively was observed (Figure 1B). Lastly, adhesion parameter varied with treatments. Upon NDP and NDI treatments in Panc-1 cells, a slight increase in their adhesion value corresponding to 1.19 ± 0.02-fold and 1.16 ± 0.02-fold, respectively, was observed (Figure 1C). NMPs 24 hours after the Bio-NDs treatments were also monitored. Membrane stiffness of Panc-1, 24 hours post NDP treatment altered as compared to 1 hour and was observed to be 17.86 ± 0.34-fold more than the untreated Panc- 1. Also, upon NDI treatment it was observed that a 9.48±0.31-fold increase in membrane stiffness (Figure 1A). Deformation decreased significantly 24 hours after the treatments corresponding to NDP (0.56 ± 0.01-fold) and NDI (0.57 ± 0.01-fold), respectively (Figure 1B). The adhesion parameter increased with NDP and NDI, both 24 hours post treatment corresponding to 1.47 ± 0.04-fold and 1.87 ± 0.05-fold, respectively (Figure 1C). In summary, 24 hours treatment time induced prominent alteration in Panc-1’s linear NMPs as compared to 1 hour treatment time. Non-linear NMPs such as Drained Poisson’s ratio (D_P), diffusion coefficient (D_C) and pore size (P_S) were also evaluated from individual force-relaxation (F-R) curves. Similar to linear NMPs, non-linear NMPs exhibited no significant variations in their properties in untreated Panc-1 cells post 1 hour and 24 hours treatment durations. Upon NDP treatment in Panc-1 cells, D_P shows a slight increase after 1 hour, which was 1.08 ± 0.03- fold. Also, 1 hour of NDI treatment exhibited 1.14 ± 0.02-fold increase in D_P as compared to untreated Panc-1 (Figure 1D). D_C on the other hand, increased significantly and was observed to be 1.9 ± 0.03-fold and 2.27 ± 0.04-fold elevated (as compared to untreated Panc- 1) corresponding to NDP and NDI treatments, respectively (Figure 1E). P_S of Panc-1 when treated with NDP and NDI was also observed to increase by 2.49 ± 0.08-fold and 3.15 ± 0.11-fold, respectively after 1 hour (Figure 1F). Alteration in non-linear NMPs 24 hours after respective treatments was also observed. D_P was observed to be higher in the NDP and NDI treatment group as compared to the untreated Panc-1 cells by 1.5 ± 0.03 and 1.52 ± 0.02, respectively (Figure 1D). Similarly, D_C also exhibited elevated fold change in NDP and Attorney Docket No.07039-2207WO1 / 2022-500 NDI treatment groups and was observed to be 4.06 ± 0.07-fold and 4.38 ± 0.07-fold, respectively (Figure 1E). Lastly, P_S exhibited more increase in NDP treatment group and was observed to be 5.64 ± 0.25-fold more (than the untreated Panc-1 cells) as compared to NDI treatment, which exhibited 3.96 ± 0.14-fold increase (as compared to the untreated Panc-1) (Figure 1F). In summary, similar to linear NMPs, non-linear NMPs also exhibited higher fold change in 24 hours treatment as compared to 1 hour treatment for respective bio- NDs. Bio-NDs alter linear and non-linear nanomechanical properties in AsPC-1 cells. The impact of bio-NDs on linear and non-linear NMPs in AsPC-1 cells, which belong to the metastasized PDAC tumor, was evaluated. The experimental parameters were maintained coherently with the Panc-1 cells. Similar to Panc-1 cells, AsPC-1 cells exhibited no significant change in their linear NMPs at 1 hour and 24 hour time points (Figures 2A- 2C). However, NDP treatment after 1 hour increased the membrane stiffness by 3.16 ± 0.14- fold, whereas NDI enhanced the membrane stiffness by 4.80±0.29-fold at the end of 1 hour time point (Figure 2A). Deformation attribute decreased. NDP treatment decreased the deformation by 0.87 ± 0.04-fold, whereas NDI treatment reduced the deformation in AsPC-1 cells by 0.78 ± 0.12-fold after 1 hour treatment (Figure 2B). Adhesion parameter in AsPC-1 cells varied significantly with NDP and NDI treatments inducing a 1.29 ± 0.13-fold and 1.3 ± 0.11-fold change, respectively at the end of 1 hour time point (Figure 2C). These attributes were also measured at the 24 hour time point. Membrane stiffness increased further by 7.27 ± 0.62-fold and 7.22 ± 0.45-fold with NDP and NDI treatments, respectively (Figure 2A). Deformation decreased further with treatment time and found to be 0.56 ± 0.02-fold and 0.62 ± 0.1-fold corresponding to NDP and NDI treatments, respectively (Figure 2B). Finally, adhesion in AsPC-1 cells at the 24 hour time point was observed to be 1.4 ± 0.05-fold higher for NDP treatment and 1.59 ± 0.07-fold higher for NDI treatment as compared to the corresponding 24 hour time point of untreated cells (Figure 2C). Non-linear NMPs of AsPC-1 with different bio-ND treatments were measured at 1 hour and 24 hour time points. No significant alterations in the non-linear NMPs were observed at 1 hour and 24 hours treatment time for untreated AsPC-1 cells (Figures 2D-2F). Attorney Docket No.07039-2207WO1 / 2022-500 However, D_P increased by 1.13 ± 0.05-fold with NDP treatment and 1.27 ± 0.06-fold with NDI treatment at the end of 1 hour (Figure 2D). D_C was elevated by 1.2 ± 0.03-fold and 1.46 ± 0.44-fold with NDP and NDI treatments, respectively (Figure 2E). An increase in P_S was also observed, corresponding to 1.3 ± 0.04-fold and 1.48 ± 0.04-fold when treated with NDP and NDI, respectively at the end of 1 hour time point (Figure 2F). These attributes were also monitored for a 24 hour time window. It was observed that D_P increased further by 1.35 ± 0.12-fold and 1.48 ± 0.13-fold for NDP and NDI treatments, respectively, as compared to the untreated AsPC-1 cells (Figure 2D). D_C was also increased by 1.82 ± 0.07- fold and 2.72 ± 0.08-fold upon NDP and NDI treatments, respectively at the end of the 24 hour time frame as compared to untreated cells (Figure 2E). Finally, P_S was monitored in AsPC-1 cells at the end of 24 hours treatment time for NDP and NDI and was elevated by 1.93 ± 0.06-fold and 2.16 ± 0.05-fold, respectively (Figure 2F). In AsPC-1 cells treated with bio-NDs, a consistent rise in their linear and non-linear NMPs was observed when treated with bio-NDs for 1 hour and 24 hours, respectively. Moreover, NDI treatment resulted in more NMPs alteration as compared to NDP treatment except in membrane stiffness, where the change was non-significant. In summary, higher multi-fold alterations in both Panc-1 and AsPC-1 cell lines were observed at 24 hours than 1 hour treatment time exhibiting the effect of bio-NDs treatment in NMPs paradigm. Cytokine profiling in PDAC cells upon various Bio-NDs treatment. A pilot analysis evaluated the differential expression of cytokines of Panc-1 cells treated with Bio-NDs for 1 hour and 24 hour time points using NanoString (Figures 20A- 20B). Time dependent alteration of a pool of pro-tumorigenic and anti-tumorigenic cytokines expression patterns was monitored. Cells treated with NDI was included to determine any cumulative effect of irinotecan on cytokines expression. Various levels of fold change were observed in both pro- and anti-tumorigenic cytokine expression resulting from Bio-ND’s treatment (Figures 20A-20B). To validate the findings from NanoString, an exhaustive analysis was performed of alteration in short-listed cytokines expressions in PDAC cells resulting from Bio-NDs treatment using quantitative RT-PCR (qRT-PCR) (Figure 3). Here, treatments such as untreated cells after 24 hours (UT24) and NDI24 were included to Attorney Docket No.07039-2207WO1 / 2022-500 complete the comprehensive analysis. In Panc-1 cells, qRT-PCR confirmed a decreasing trend in mRNA expressions levels in upon NDP and NDI treatments as compared to the untreated at the end of 1 hour treatment time. While CCL2 and CXCL1 did not show significant change in the mRNA levels upon NDP treatment post 1 hour; but a significant decrease in CXCL2 and CXCL3, IL-8, and IL 11 expression post 1 hour NDP treatment in Panc-1 was observed. TGF?1 did not show any significant variation from 1 hour treatment of NDP and NDI as seen from Figure 3A. Further, upon 24 hours post Bio-NDs treatment, more significant decrease in relative mRNA expressions in these cytokines was observed as compared to 1 hour for respective treatments including TGF?1. All the cytokines exhibited a decreasing trend with NDI treatment inducing more decrease than NDP, albeit CCL2 as seen from Figure 3A. Although a significant decrease in relative mRNA expression in CCL2 upon Bio-NDs treatment was observed as compared to the untreated, its differential expression with NDP and NDI treatments was not significant. Unlike in Panc-1 cell line, varying alteration in mRNA expression levels in AsPC-1 cells upon Bio-NDs treatment was observed. Within respective cytokine groups, consistent decrease in their expression levels was observed upon NDP treatment for 1 hour, however, NDI treatment for 1 hour did not cause significant decrease in their expression levels as seen from Figure 3B. Upon 24 hours treatment with NDP and NDI, a consistent decrease in mRNA expression levels for respective cytokines was observed as compared to UT24 group. Unlike NDI1 treatment, NDI24 treatment caused significant decrease in mRNA expression levels for all cytokines as seen from Figure 3B. Complete list of primers used in this study is given in Table 1. Correlation between linear and non-linear nanomechanical properties and regulated cytokines under various Bio-NDs treatments Correlations between comprehensive list of cytokine expression levels and non-linear NMPs were calculated (Figures 21A-21C). The value of correlation coefficients ranges from -1 (perfect inverse relationship) to 1 (perfect positive relationship). A value of zero indicates no correlation at all. For same Bio-NDs treatment, from this pool additional cytokines were assessed for their correlation with linear and non-linear NMPs. Short-listing criteria for Attorney Docket No.07039-2207WO1 / 2022-500 additional assessment were 1) cytokines exhibited distinct decrease in their expressions with time duration (for instance, CCL2, CXCL3 from Figures 20A-20B), 2) down regulation of cytokine expression in NDI treatment as compared to the untreated, UT (for instance, CXCL1, CXCL2 from Figures 20A-20B). Both criteria worked in case of IL8, IL11, and IL18. Cytokines that did not express significant alteration in their expressions such as TGF?1 were also included (Figures 20A-20B). Correlation studies were performed with cytokine expression from RT-PCR experiments and NMPs of both Panc-1 and AsPC1 treated with Bio-NDs. For simplicity, the presented the correlation analysis in the form of a heat map for Panc-1 and AsPC-1 (Figure 4A and 4B, respectively). This difference may be attributed to the genetic variance between these two cell lines subject to further validation in other cell lines. While most of the nanomechanical properties follow inverse correlation with CCL2, CXCL1 CXCL 2, IL8, IL11, IL18 and TGF?1 due to treatment with Bio-NDs, ‘deformation’ shows positive correlation with these cytokines for both Panc-1 and AsPC-1 cells. For Panc- 1, CCL2 and IL-18 showed the best correlation among the pool of shortlisted cytokines as shown in Figure 4A. Whereas for AsPC-1, TGF?-1 exhibited the best correlation between cytokines and nanomechanical properties as shown in Figure 4B. Similar observations were made for heat map indicating correlations between linear and non-linear NMPs and cytokine expressions for various Bio-NDs treatment in AsPC-1 cells as shown in Figure 4B. Validation of the correlation between IL8 and TGF?1 with non-linear NMPs using AFM The non-linear NMPs of the membrane of IL8 depleted and TGF?1 depleted Panc-1 cells were also studied. The selection of IL8 and TGF?1 depleted Panc-1 cells here stem from their differential alterations in expression during Bio-ND treatment, which was confirmed with NanoString sequencing (Figures 20A-20B), qRT-PCR (Figure 3A), and correlation analysis (Figure 4A). Figures 5A and 5B show the mRNA expression of IL8 and TGF?1 shRNA treated Panc-1 cells confirming 50% and 90% knockdown, respectively. Non-linear NMPs of Panc-1 cells demonstrate similar changes in Panc-1 cells with depletion of IL8 in as compared to control shRNA treated cells. There were no significant alterations of non-linear NMPs in Attorney Docket No.07039-2207WO1 / 2022-500 TGF?1 knockdown cells as compared to control shRNA treated cells. Additionally, NDP treatment imparts equivalent alteration of these NMPs in both control and TGF?1 shRNA treated Panc-1 cells, but not in IL8 knockout cells, as shown in Figures 5C-5E. This corroborates that while IL8 plays a central role in regulation of non-linear NMPs, TGF?1 has moderate effects. Validation of correlation between the cytokine expression and nanomechanical properties upon Bortezomib treatment in Panc-1 A web-based string network pathway analysis using the short-listed cytokines identified that the NFKB pathway (Figure 22) is involved in Bio-ND treated Panc-1 cells. Bortezomib (BTZ) is a known immunomodulatory drug that influence NFKB pathway. Hence, to validate correlations between cytokine expressions and NMPs, Panc-1 cells were treated with two different doses of BTZ (1nM and 10nM) and as compared with untreated Panc-1 group. BTZ caused the membrane stiffness to increase systematically with increasing dose concentration (Figure 6A). Membrane stiffness increased 5.52 ± 0.09-fold and 12.37 ± 0.21-fold with 1 nM and 10 nM treatment, respectively. At the same time, a continuous decrease in deformation (0.7 ± 0.01-fold and 0.52 ± 0.01-fold, respectively) with increasing dose of BTZ was observed (Figure 6B). Lastly, adhesion was also observed to increase with BTZ treatment dose as compared to the untreated Panc-1 cells (Figure 6C), which was calculated to be 1.6 ± 0.03-fold and 2.36 ± 0.06-fold more in case of 1 nM and 10 nM treatment dose, respectively, than untreated Panc-1 group. Non-linear NMPs, exhibited similar increasing trend in their trend with BTZ dose as compared to the untreated Panc-1 group (Figures 6D-6F). D_P was observed to increase by 1.52 ± 0.01-fold and 1.65 ± 0.01-fold with 1 nM and 10 nM BTZ treatment, respectively. D_C was also observed to increase by 4.29 ± 0.03-fold and 6.4 ± 0.01-fold as compared to untreated Panc-1 and with increasing dose of BTZ, respectively. Finally, P_D had the highest fold increase with BTZ 1 nM and 10 nM dose and was observed to be 5.26 ± 0.15-fold and 9.6 ± 0.17-fold more than untreated Panc-1, respectively. BTZ exhibited similar cytokines alteration to Bio-NDs in Panc-1 with exception for IL11, IL18 and TGF?1 (Figure 6G). Using NMPs and the cytokine expressions for varying Attorney Docket No.07039-2207WO1 / 2022-500 BTZ dose treatment, their correlation was plotted using a heat map (Figure 6H). The highest correlation was observed between NMPs and IL8, IL11 and TGF?1 cytokines (Figure 6H). NMPs of Panc-1 were influenced by the observed cytokines. Machine Learning (ML) modeling to predict cytokine expression from nanomechanics of live cells To investigate the performance of the employed Support Vector Machine (SVM) regression technique in predicting the cytokine expressions from the nanomechanical properties of the cells, the metric used to quantify the performance is Mean Square Error (MSE), which calculates the difference between the observed and the predicted data. MSE can be formalized as follows: where, n is the number of observations, yi is the observed, and is the predicted i-th output value respectively. A higher MSE value represents a worse prediction quality. Figures 23A-23H show the corresponding observed and predicted cytokine expression levels using the proposed SVM regression technique in boxplots. As can be observed from these plots, primary cytokine expression modeling was captured from the nanomechanical properties. Furthermore, smaller box sizes of the predicted data as compared to that of the observed data denote high confidence in the prediction model. This in turn was validated by the low MSE values in Error! Reference source not found. when the Panc-1 and AsPC-1 cell observations were trained and tested together. In general, it was observed that for the UT1 treatment group, the MSE was lower, i.e., the prediction quality was better than UT24 and NDP1. On average, across eight tested cytokines, the prediction performance is the highest for UT1 – the average being 0.0080, whereas the worst being the UT24 treatment group – the average being 0.0465 albeit a relatively small error. On the other hand, Attorney Docket No.07039-2207WO1 / 2022-500 across all the treatment groups, the prediction performance was the highest for IL18 – the average MSE being 0.0155 where the MSE was the highest, 0.0343, for TGF?1. Table 2: MSE in predicting the considered cytokine expression from nanomechanics data of Panc-1 and AsPC-1 (combined) treated with ND+ / -IRT using SVM regression 1 Table 3 shows the MSE values when Panc-1 and AsPC-1 cells were trained together, and the saved trained model was used to predict cytokine expressions of 20 random nanomechanical property observations for these two cell lines individually. In this test setting, it was observed that for Panc-1 in general, NDI24 was the best performing treatment group in terms of MSE – the average MSE across eight tested cytokines being 0.0010, whereas UT24 was the worst performing treatment group among the six treatment groups with the average MSE across the cytokines being 0.0830. For AsPC-1, it was observed that NDP24 was the lowest MSE yielding treatment group – the average MSE across the cytokines for NDP24 was 0.0004 and the highest was for ND1 (0.0135). Table 3: MSE in predicting the considered cytokine expression from nanomechanical 1 Attorney Docket No.07039-2207WO1 / 2022-500 NDP10.0192 0.0424 0.0272 0.0085 0.0017 0.0221 0.0171 0.0015 NDP24 00084 00003 00005 00070 00003 00088 00034 01856 e correspond ng observed and predcted cyto ne express ons us ng t e proposed SVM regression technique for individually tested cell line data are presented in Figures 7A- 7H (Panc-1 cells) and in Figures 8A-8H (AsPC-1 cells). Note that this result was based on the predictions made by the saved training models on the 20 random nanomechanical property data of Panc-1 cells or AsPC-1 cells. Following training phase, it was observed in Figures 7A-7H that the box sizes were relatively smaller overall for predicted data than the observed data demonstrating a compactness. Similar to the previous results, for AsPC-1 cells (shown in Figures 8A-8H), it was observed that in most of the scenarios, the box sizes were smaller for the predicted data than in the observed data. The medians and the spreads were also similar for the observed and the predicted data, which was supported by the MSE values in Error! Reference source not found.. AFM’s nanoindentation technique was employed to characterize live PDAC tissues with or without ND-PEG-Irinotecan (ND-PEG-Ir) as shown in the Figures 10A-10I. The overall scan size was optimized to 40x40 µm2to avoid tip contamination due to tissue topography. The experimental parameters caused the surface area of contact made by the tip with the tissue sample to be 8 µm. Owing to which, the total scan region was divided into 25 pixels, each pixel measuring 8x8 µm2. Untreated PDAC tumor tissue was softer as compared Attorney Docket No.07039-2207WO1 / 2022-500 to ND-PEG-Ir treated PDAC tumor tissue as seen from the heat map in Figure 10A and 10D, respectively. Deformation for untreated PDAC tissue was significantly more as compared to ND- PEG-Ir tissue as shown in Figures 10B-10E. Lastly, adhesion displayed a significant increase in its value in ND-PEG-Ir treated tissue as compared to untreated tissue. The adhesion values encompassed a wide range of values in ND-PEG-Ir treated tissue, which was seen otherwise in untreated PDAC tissue sample as seen from Figures 10C and 10F. A comparative analysis of nanomechanical properties between untreated and ND- PEG-Ir treated PDAC tissue is shown in Figures 10G-10I. The average tissue stiffness for untreated was observed to be 11.72 ± 0.88 kPa, which was significantly stiffer than ND- PEG-Ir treated PDAC tissue observed to be 4.21 ± 0.67 kPa as shown in Figure 10G. Deformation was observed to be 1.19 ± 0.22 µm for untreated, which was significantly more as compared to ND-PEG-Ir treated PDAC tissue and observed to be 0.55 ± 0.11 µm. Adhesion was quantified to be 402.17 ± 142.61 pN for untreated PDAC, which was significantly more than ND-PEG-Ir treated PDAC tissue observed to be 19.07 ± 9.92 pN. These results distinguish alterations in nanomechanical properties of tissue under various treatment conditions. Further, tumors treated with ATMi, olaparib, and their combination were studied under the AFM following the same experimental parameters as mentioned previously to evaluate their nanomechanical properties. Here, a series of 40X40 µm2scans were incorporated such that when stitched together yielded 120x120 µm2scan region and cumulatively yielded 225 data points. It was observed that control group exhibited an average stiffness of 6.59 ± 0.84 kPa along with average deformation and adhesion attributes to be 0.45 ± 0.02 µm and 1.05 ± 0.2 nN, respectively as seen from Figures 11A-11C. Upon treatment with ATMi, average tissue stiffness was observed to be 5.43 ± 0.38 kPa with average deformation and adhesion values corresponding to 0.46 ± 0.02 µm and 0.15 ± 0.3 nN as seen from Figures 11D-11F. Similarly, treatment with olaparib yielded average tissue stiffness, deformation, and adhesion corresponding to 4.27 ± 0.72 kPa, 0.45 ± 0.03 µm, and 0.16 ± 0.2 nN, respectively as shown in in Figures 11G-11I. Combination treatment however, increased the average tissue stiffness ~5-fold as compared to single drugs and was observed Attorney Docket No.07039-2207WO1 / 2022-500 to be 26.93 ± 1.67 kPa. Deformation value decreased ~2-fold times as compared to single drug treatment and was observed to be 0.23 ± 0.02 µm, whereas adhesion was observed to increase ~20-fold times as compared to single drug treatment and observed to be 3.08 ± 0.29 nN as seen from Figures 11J-11O. To correlate tissue nanomechanical properties observed in in vivo treated tumors with ex vivo treatments, tissue sections (350 µm) thick were cultured in a 6-well plate and subjected them to various concentrations of ATMi, olaparib, and their combination treatments for 72 hours before performing AFM studies. It was observed that in the case of ex vivo control treatments, tissue stiffness corresponding to 1 / 10thand 1 / 100thexhibited a slight decrease in their stiffness as compared to in vivo treatment with values corresponding to 6.02 ± 0.45 kPa, 6.08 ± 0.63 kPa, respectively as compared to in vivo (6.58 ± 0.84 kPa) as shown in. However, 1 / 1000thof in vivo concentration treatment in ex vivo tissue section yielded an increase in tissue stiffness corresponding to 7.57 ± 0.72 kPa (Figure 12A). Deformation was observed to be consistently decreased in 1 / 10th, 1 / 100thand 1 / 1000thconcentrations as compared to the in vivo treatment (0.45 ± 0.03 µm) with values corresponding to 0.28 ± 0.02 µm, 0.23 ± 0.02 µm and 0.2 ± 0.02 µm, respectively as seen from Figure 12B. Adhesion attribute was observed to be increased with 1 / 10thof in vivo concentration when treated in ex vivo tissue section with value corresponding to 3.63 ± 0.32 nN as compared to in vivo (1.05 ± 0.2 nN). However, for 1 / 100thand 1 / 1000thconcentration, it was observed a significant decrease in the adhesion values corresponding to 0.36 ± 0.03 nN and 0.13 ± 0.03 nN, respectively as compared to in vivo as seen from Figure 12C. In the case of ATMi treatment with various concentrations, it was observed an increase in tissue stiffness corresponding to 1 / 10thand 1 / 1000thdrug concentration with values corresponding to 7.06 ± 0.38 kPa and 7.57 ± 0.71 kPa, respectively as compared to in vivo (5.43 ± 0.38 kPa). Treatment corresponding to 1 / 100thconcentration of in vivo did not alter the tissue stiffness significantly and was observed to be 5.53 ± 0.39 kPa as seen from Figure 12A. Deformation was observed to decrease in varying quantities with concentrations. Least decrease was observed for 1 / 100thconcentration with value corresponding to 0.43 ± 0.02 µm, whereas most decrease was observed at 1 / 1000thconcentration with value corresponding to 0.2 ± 0.02 µm as compared to in vivo treatment (0.46 ± 0.02 µm). Attorney Docket No.07039-2207WO1 / 2022-500 Deformation as compared to 1 / 10thconcentration of in vivo was observed to be 0.28 ± 0.02 µm as seen from Figure 12B. Adhesion attribute was observed to be elevated in 1 / 10thand 1 / 100thof in vivo concentration as compared to in vivo treatment (0.15 ± 0.02 nN) and observed to be 1.05 ± 0.39 nN and 0.22 ± 0.04 nN, respectively. However, 1 / 1000thof in vivo concentration induced decrease in adhesion with value corresponding to 0.06 ± 0.01 nN as compared to in vivo treatment as seen from Figure 12C. For olaparib treatment, it was observed an increase in all concentration dose as compared to in vivo (4.27 ± 0.72 kPa). Stiffness for 1 / 10th, 1 / 100th, and 1 / 1000thconcentration was observed to be 6.49 ± 0.41 kPa, 6.09 ± 0.38 kPa, and 11.61 ± 0.67 kPa, respectively as seen from Figure 12A. Deformation was observed to be systematically decreasing with reduction in olaparib dosage in ex vivo sections as compared to in vivo (0.44 ± 0.03 µm). Values corresponding to deformation were observed to be 0.28 ± 0.01 µm, 0.26 ± 0.02 µm, and 0.15 ± 0.02 µm, respectively with 1 / 10th, 1 / 100th, and 1 / 1000thas seen from Figure 12B. Adhesion attribute was observed to be significantly decreased with ex vivo treatments as compared to in vivo (0.15 ± 0.02 nN) with values corresponding to 1.31 ± 0.43 nN, 0.03 ± 0.009 nN, and 0.08 ± 0.01 nN for 1 / 10th, 1 / 100thand 1 / 1000th, respectively as seen from Figure 12C. Lastly, for combination drug, it was observed a systematic increase in tissue stiffness corresponding to 9.88 ± 0.54 kPa, 11.84 ± 0.79 kPa, and 15.95 ± 0.67 kPa for 1 / 10th, 1 / 100thand 1 / 1000thconcentration dose, respectively. However, these values were significantly lower than that of tissue stiffness observed with in vivo treatment (26.93 ± 1.67 kPa) as seen from Figure 12A. Deformation exhibited decrease in its attribute for ex vivo tissue treated with 1 / 10thand 1 / 100thof in vivo concentration with values corresponding to 0.21 ± 0.02 µm and 0.16 ± 0.01 µm, respectively.1 / 1000thdose did not alter deformation significantly as compared to in vivo (0.23 ± 0.02 µm) and the values was observed to be 0.21 ± 0.03 µm as seen from Figure 12B. Finally, adhesion was observed to be several-fold decreased in ex vivo treated sections as compared to the in vivo treatment (3.08 ± 0.29 nN). Values corresponding to ex vivo treatments were observed to be 0.11 ± 0.02 nN, 0.02 ± 0.07 nN, and 0.21 ± 0.03 nN for 1 / 10th, 1 / 100thand 1 / 1000th, respectively as seen from Figure 12C. From the ex vivo studies, it was observed that among the panel of ex vivo dosage, nanomechanical properties Attorney Docket No.07039-2207WO1 / 2022-500 corresponding to 1 / 1000thof in vivo concentrations closely match with parameters observed with in vivo tissue treated samples. When compared to individual treatment groups or control groups, the anticancer effectiveness of ATMi and olaparib combination significantly suppressed tumor development (Figures 13A-13C). As seen from Figure 13A, which is a qualitative representation of the excised tumors after various treatments, the combination of ATMi and olaparib alter tumor size compared to either the individual treatments or the control. This was confirmed by the quantitative analysis of these tumors exhibiting significant reduction in tumor volume (Figure 13B) and weight (Figure 13C) for the combined ATMi + olaparib drug treatment. Figure 14 shows the survival curve in which, the combination treatment significantly improved median survival (corresponding to 50% probability of survival) by 32 days compared to the untreated and 23 and 19 days compared to ATMi and Olaparib, respectively. Figures 15A-15C show an alteration in Panc-1 tumor tissue nanomechanical properties after treatment with candidate anti-cancer treatments gemcitabine (Gem), paclitaxel (Pac), and Gem+Pac in vivo. Figures 16A-16C show alteration in tissue nanomechanical properties measured ex vivo after treatment for various durations, 6, 12 and 24 hours, as compared to in vivo treatments. Figures 17A-17B show tumor regression of Panc-1 tumor tissue after treatment with gemcitabine (Gem), paclitaxel (Pac), and Gem+Pac as compared to control. Figure 18 shows an alteration in cytokine expression levels of Panc1 tumor tissue subjected to various drug treatments in vivo such as ATMi, olaparib and ATMi+olaparib. Figure 19 shows an alteration in cytokine expression levels of 4535 tumor tissue subjected to various drug treatments in vivo such as ATMi, olaparib and ATMi+olaparib. Example 2: Prediction of Cytokine Modulation in Breast Cancer Cells from Therapy-induced Alterations in Nanomechanical Properties. This example describes the identification of a correlation between nanomechanical properties of cancer cells (e.g., breast cancer cells) response of nano-formulations of cancer treatments. Attorney Docket No.07039-2207WO1 / 2022-500 Materials and Methods Cell culture Immortalized breast cancer cell lines 4T1 (catalog no. CRL-2539) and TUBO (catalog no. CRL-3461) were purchased from American Type Culture Collection (ATCC) and used without further validations.4T1 and TUBO cells were cultured in complete RMPI media. Both cells were supplemented with 10% FBS and 1% penicillin-streptomycin. Both cell lines were cultured and maintained in a humidified 5% CO2 atmosphere. For all the AFM experiments, cells were cultured in 60-mm petri dish at ~70% confluency and maintained in the incubator at least 1-day prior to the experiment. For cytokine expression, cells were cultured in a 96-well plate with each well consisting of ~5000 cells and incubated for at least 1-day prior to the treatment. Synthesis of liposomal formulation containing rapamycin and vinorelbine (RLV) A liposomal formulation containing rapamycin and vinorelbine (RLV) was synthesized as described elsewhere (see, e.g., U.S. Patent Application 2022 / 0257515 A1). Synthesis of breast cancer specific vaccine A vaccine designed to stimulate an immune response against breast cancer cells was used as described herein. Atomic Force Microscopy (AFM) AFM experiments were performed using Dimension Fastscan with ScanAsyst incorporating ICON head scanner (Bruker Corp, Santa Barbara, CA) for linear and non-linear NMPs evaluation. LC CAL A probes designed specifically for cell related studies were incorporated. Nominal spring constant (K) and tip radius recommended by the manufacturer is 0.1 N / m and 70 nm, respectively. Laser alignments were performed to yield maximum signal strength. Foremost, the probe was calibrated on a blank petri dish in fluid medium to account for alterations in NMPs due to hydrodynamic drag resulting from the fluid medium. The calibration process concluded the spring constant to be 0.08 N / m and the deflection sensitivity to be 26.9 nm / V along with the amplitude sensitivity of 772 nm / V at 1 KHz tapping frequency. The peak force amplitude was set to 300 nm for accurate tip-sample Attorney Docket No.07039-2207WO1 / 2022-500 interaction and protect tip from damage during initial approach towards the sample. AFM is a surface mapping tool. The measurements over a 500 x 50 nm2region over the nuclear membrane were restricted to overcome heterogeneity in its surface roughness owing to the presence of actin fibers, microtubules and lipid bilayer. A custom-built petri dish holder held the culture dish firmly during all the AFM experiments. Cells in the culture dish were identified using an optical microscope attached to the ICON head scanner. Further, nanoindentation and force ramp script experiments evaluated linear and non-linear NMPs, respectively. The ramping parameters were optimized. Nanoindentation technique involves the approach of the tip followed by indenting into the sample driven by the applied force and finally, retracting from the sample, resulting into a force-separation (F-S) curve. The entire nanoindentation process at a single point occurs over a few milliseconds’ duration. For ramp script analysis the experimental protocol involved rapidly indenting into the sample to a desired depth (10% of the cellular height) and thereon maintaining the depth while monitoring relaxation in the force levels up to a few seconds followed by retracting the tip from the sample. See, for example, Kulkarni et al., ACS Applied Bio Materials, 4(1), 984 (2021); Kulkarni et al., Biochimica et Biophysica Acta (BBA) - General Subjects 1863(5), 802 (2019); or Kulkarni et al., Journal of Nanobiotechnology, 20(1), 1 (2022). The ramp script process occurs over a 10 second time frame for each data point resulting into individual force-relaxation (F-R) curve. For both nanoindentation and ramp script procedures, at least 7 cells each with 10 data points assigned to nanoindentation and at least 5 data points assigned to ramp script procedure were incorporated for each treatment. Finally, all the experiments were conducted at 37°C maintained using a temperature-controlled AFM stage. Data analysis of AFM experiments Each individual F-S and F-R was passed through a boxcar filter to reduce noise and improve signal strength. It was then baseline corrected to complete the pre-processing of data. The corrected F-S and F-R curves were then subjected to individual mathematical models to extract linear and non-linear NMPs. See, for example, Kulkarni et al., ACS Applied Bio Materials, 4(1), 984 (2021); and Kulkarni et al., Journal of Nanobiotechnology, 20(1), Attorney Docket No.07039-2207WO1 / 2022-500 1(2022). A Derjaguin-Muller-Toporov (DMT) model was used to analyze F-S curve given as follows: …. (1) the F-S curve, is the adhesion force, is the effective Young’s modulus given by, …. (2) given by, …. (3) contact given by, …. (4) Where, and are Poisson’s ratio ad modulus of the probe whereas, and are that of the sample, respectively. and are the radius of the probe and sample, respectively. A poroelasticity model was used to evaluate non-linear NMPs. Drained Poisson’s ratio ( ) is evaluated as follows, …. (5) In the F-R experiments, as the force levels reach plateau, the interstitial fluid pressure build up from rapid indentation redistributes in the cell commonly termed as drained condition and given by, Attorney Docket No.07039-2207WO1 / 2022-500 …. (6) the F-R curve. and can be further extracted from the poroelasticity model given by, …. (7) for the force to relax. was evaluated from ‘ ’ as follows, …. (8) Where, is the . Evaluation of cytokine expression using qRT-PCR To evaluate mRNA expression analysis of the cytokine expressions, total RNA was extracted using RNeasy Kit (purchased from Qiagen). Following which, 1 µg of total RNA was reverse transcribed using an iScript™ cDNA synthesis kit (purchased from Bio-Rad) according to the manufacturer’s protocol. PCR was then performed using 0.1 µg of cDNA in a 10 µL of PCR mix containing 500 nM of each primer and power SYBR™ master mix (purchased form Life Technologies). The reaction was performed using 7500 PCR system (purchased from Applied Biosystems) and the parameters applied were 40 cycles of amplification at 95 °C for 15 seconds and 57 °C for 1 minute. The PCR primers and their sequences are shown in Table 1. Attorney Docket No.07039-2207WO1 / 2022-500 Animal experimental plan For the 4T1 breast cancer tumor model in BALB / c mice, 1 X 1064T1 cells were implanted in the mammary fat pad of the mouse using an 18-gauge needle. After two weeks of tumor initiation, mice were randomized and treated with either a breast cancer specific vaccine (vaccine) once per week for three weeks (it has five peptides which was highly expressed on 4T-1 cells and two adjuvants) or with 10 mg / kg anti-PD-1 antibody (PD-1) twice per week for three weeks. After completion of the treatment regime, these mice were euthanized. Breast cancer (4T1) tumor tissue was harvested using a 6-mm hole puncher at the endpoint after sacrificing the mice. Immediately following the harvesting, tumor tissue was stored in HypoThermosol®(purchased from BioLife Solutions Inc.) tissue storage buffer and sliced into 2-4 mm in diameter and 350 µm thick sections using a vibratome (VF-300-0Z vibrating microtome, Compresstome, Precisionary Instruments LLC). These thin sections were then glued onto a 60-mm petri dish using a 3M VetbondTM / MCtissue adhesive.3 mL of tissue storage buffer was added to the petri dish such that the entire section of tissue was submerged in the buffer. AFM was then performed on the prepare sample. For the TUBO breast cancer tumor model in BALB / c mice, 1 X 106TUBO cells were implanted in the mammary fat pad of the mouse using a needle. After two weeks of tumor initiation, mice were randomized and treated with vaccine (three peptides that are highly expressed on TUBO cells and two adjuvants) once per week for three weeks or with 10 mg / kg of PD-1 twice per week for three weeks. After completion of the treatment regime, these mice were euthanized. Breast cancer (TUBO) tumor tissue was harvested using a 6-mm hole puncher at the endpoint after sacrificing the mice. Immediately following the harvesting, tumor tissue was stored in HypoThermosol®(purchased from BioLife Solutions Inc.) tissue storage buffer and sliced into 2-4 mm in diameter and 350 µm thick sections using a vibratome (VF-300-0Z vibrating microtome, Compresstome, Precisionary Instruments LLC). These thin sections were then glued onto a 60-mm petri dish using a 3M VetbondTM / MCtissue adhesive.3 mL of tissue storage buffer was added to the petri dish such that the entire section of tissue was submerged in the buffer. AFM was then performed on the prepare sample. For 4T1 breast cancer tumor model in BALB / c mice, 1 X 1064T1 cells were implanted in the mammary fat pad of mouse using a needle. After the tumor reached around Attorney Docket No.07039-2207WO1 / 2022-500 30-40 mm3, mice were randomized into 3 treatment groups (N=5 in each group), such as control, rapamycin + vinorelbine (R+V), and liposomal formulation containing rapamycin and vinorelbine (RLV). Mice were then treated with rapamycin 1 mg / kg body weight and vinorelbine 0.5 mg / kg body weight in indicated groups twice per week for three weeks. These mice were then euthanized when tumor burden impaired their ability to move freely inside the cage. Breast cancer (4T1) tumor tissue was harvested using a 6-mm hole puncher at the endpoint after sacrificing the mice. Immediately following the harvesting, tumor tissue was stored in HypoThermosol®(purchased from BioLife Solutions Inc.) tissue storage buffer and sliced into 2-4 mm in diameter and 350 µm thick sections using a vibratome (VF-300-0Z vibrating microtome, Compresstome, Precisionary Instruments LLC). These thin sections were then glued onto a 60-mm petri dish using a 3M VetbondTM / MCtissue adhesive.3 mL of tissue storage buffer was added to the petri dish such that the entire section of tissue was submerged in the buffer. AFM was then performed on the prepare sample. For TUBO breast cancer tumor model in BALB / c mice, 1 X 106TUBO cells (purchased from ATCC) were implanted in the mammary fat pad of mouse using a needle. After the tumor reached around 30-40 mm3, mice were randomized into treatment 3 groups (N=5 in each group), such as control, R+V, and RLV. Mice were then treated with rapamycin 1 mg / kg body weight and vinorelbine 0.5 mg / kg body weight in indicated groups twice weekly for three weeks. These mice were then euthanized when tumor burden impaired their ability to move freely inside the cage. Breast cancer (TUBO) tumor tissue was harvested using a 6-mm hole puncher at the endpoint after sacrificing the mice. Immediately following the harvesting, tumor tissue was stored in HypoThermosol®(purchased from BioLife Solutions Inc.) tissue storage buffer and sliced into 2-4 mm in diameter and 350 µm thick sections using a vibratome (VF-300-0Z vibrating microtome, Compresstome, Precisionary Instruments LLC). These thin sections were then glued onto a 60-mm petri dish using a 3M VetbondTM / MCtissue adhesive.3 mL of tissue storage buffer was added to the petri dish such that the entire section of tissue was submerged in the buffer. AFM was then performed on the prepare sample. Attorney Docket No.07039-2207WO1 / 2022-500 AFM parameter for tissue experiments Bruker’s Dimension Fast Scan with ICON head was employed to characterize tissue stiffness in these sections in fluid environment. The probe incorporated had a tip radius in the form of 5 µm bead bearing a nominal cantilever spring constant, k=0.185 N / m along with a resonant frequency of 21.87 kHz and a long cantilever length of 115 µm making it ideal for tissue characterization. Foremost, the laser was aligned on the back of the tip to optimize the signal to noise ratio using thermal tuning method in air. Afterwards, the tip was engaged in fluid medium in an empty 60-mm petri dish and performed ramping to determine the deflection sensitivity. The calibrated deflection sensitivity and cantilever stiffness were observed to be 133.5nm / V and 0.1 N / m, respectively. The calibrated deflection sensitivity incorporates the effect of hydrodynamic drag during the actual experiments. The calibration method further yielded a peak force amplitude of 304.7 nm / V at 1 kHz operating frequency. Post identification of the tissue sample and engagement of the tip, nanoindentation mode of experiment was performed in which, the probe rapidly indented into the sample according to the applied force followed by immediate retraction, which resulted in a force-separation (F- S) curve. The ramping parameters such as ramp size of 5 µm, ramp rate of 1 Hz, samples / ramp of 256 and trigger force of 5 nN were maintained consistent throughout the nanoindentation experiments. For each treatment group, 9 regions each with 25 data points were incorporated, yielding 225 data points. All the experiments were performed at 37°C maintained using a temperature-controlled AFM stage. Statistical significance Origin Pro Lab software was used to evaluate statistical significance and plotting the AFM data. Foremost, each dataset was analyzed for normality distribution criteria and upon successful implementation it was subjected to One-Way ANOVA test. Statistical differences were determined to be significant at P > 0.05. Results Tumor tissues from 4T1 cell line were prepared at 350 ?m thick sections and subjected to AFM and RT-PCR experiments. Alterations in nanomechanical attributes and relative mRNA expressions were observed for vaccine, PD-1, and PD-1 + vaccine treated Attorney Docket No.07039-2207WO1 / 2022-500 tissues and compared with the untreated tumor tissue (Figures 29A-29C). Untreated tissue exhibited average stiffness of 13.29 +- 0.44 kPa. Introduction of vaccine treatment significantly elevated tissue stiffness to 52.82 +- 2.51 kPa in the case of only vaccine and 65.10 +- 1.71 kPa in the case of PD-1 + vaccine. Only PD-1 treatment decreased the tissue stiffness to 4.84 +-0.08 kPa compared to untreated (Figure 29A). Deformation attribute for untreated tissue was observed to be 0.21 +- 0.009 ?m. PD-1 treatment bearing softer tissue showed an elevation in deformation to 0.49 +- 0.01 ?m. However, both vaccine and PD-1 + vaccine decreased the deformation significantly to 0.07 +- 0.006 ?m and 0.07 +-0.0006 ?m, respectively (Figure 29B). Adhesion of untreated tissue was observed to be 187.38 +- 21.74 pN. All the treatments significantly reduced the adhesion profile of the tissue compared to the untreated. Vaccine, PD-1 and PD-1 + vaccine treatment exhibited 13.06 +- 2.72, 1.16 +- 0.2 and 2.46 +-0.56 pN, respectively (Figure 29C). In the observed cytokine panel, the three treatments consistently decreased the cytokine expressions except for TGF?1 (Figure 30). Among the treatment groups, vaccine treatment caused most reduction followed by PD-1, and then PD-1 + vaccine. For instance, for PD-1 treatment, CXCL3 showed almost 95% reduction in relative mRNA value followed by IL-18 and CXCL2, both exhibiting a 91% reduction. Vaccine treatment induced over 95% reduction in relative mRNA expression in CXCL3, CXCL2, CXCL1, IL18, and IL11. Tumor tissues from TUBO cell line were prepared at 350 µm thick sections and subjected to AFM and RT-PCR experiments. Alterations in nanomechanical attributes and relative mRNA expressions were observed for vaccine, PD-1, and PD-1 + vaccine treated tissues and compared with the untreated tumor tissue (Figures 31A-31C). Untreated tumor tissues exhibited 13.48 +-0.56 kPa. PD-1 + vaccine treatment significantly increased the tissue stiffness by approximately 5-fold to 64.08 +-2.44 kPa. Vaccine treatment reduced the tissue stiffness 5.30 +-0.43 kPa whereas vaccine only treatment increased the stiffness to 36.38 +- 3.18 kPa (Figure 31A). Untreated tissue exhibited deformation of 0.13+-0.1 µm. Vaccine treatment showed deformation of 0.37 +-0.01 µm. PD-1 and PD-1 + vaccine treatment reduced the deformation progressively to 0.08 +-0.009 and 0.02 +-0.004 ?m, respectively (Figure 31B). Adhesion of the untreated tissue was observed to be 60.38 +-8.89 Attorney Docket No.07039-2207WO1 / 2022-500 pN. Vaccine, PD-1, and PD-1 + vaccine exhibited adhesion of 161.87 +- 34.4 pN, 48.92 +-4 pN and 21.97 +-3.48 pN, respectively (Figure 31C). In the observed cytokine panel, PD-1 + vaccine treatment consistently reduced the relative mRNA expression in all the cytokines compared to the untreated (Figure 32). The most significant reduction was observed for IL-8, followed by CXCL2, in which the observed reduction was 84% and 80%, respectively. For TGF?1, treatment with PD-1 alone and treatment with and vaccine alone increased the relative mRNA expressions by 3 and approximately 4-fold, respectively (Figure 32). Tumor tissues from 4T1 cell line were prepared at 350 µm thick sections and subjected to AFM and RT-PCR experiments. Alterations in nanomechanical attributes and relative mRNA expressions were observed for R+V and RLV treated tissue compared with the untreated tumor tissue (Figures 33A-33C). Untreated tissues possessed a stiffness of 25.98 +- 1.05 kPa. Both RLV and R+V significantly made the tissue softer with stiffness value corresponding to 7.48+-0.21 and 2.93 +-0.2, respectively (Figure 33A). Deformation was contrary to the stiffness with untreated tissue bearing a deformation of 0.14 +-0.007 ?m. In the case of RLV and R+V, the observed deformation was 0.33 +-0.01 ?m and 0.59 +-0.02 ?m, respectively (Figure 33B). Both RLV and R+V significantly increased the adhesion value 164.37 +-81.53 pN and 399.24 +- 173.94 pN, respectively, compared to the untreated 18.94 +- 8.45 pN (Figure 33C). In the observed cytokine panel, all the cytokines except for IL-8 showed non- significant alteration in their relative mRNA expression levels for R+V and RLV (Figure 34). However, IL-8 was most responsive for both RLV and R+V inducing alteration in its expression corresponding to 5.62-fold and 4.98-fold, respectively (Figure 34). Tumor tissues from TUBO cell line were prepared at 350 µm thick sections and subjected to AFM and RT-PCR experiments. Alterations in nanomechanical attributes and relative mRNA expressions were observed R+V and RLV treated tissues and compared with the untreated tumor tissue (Figures 35A-35C). Untreated tumor tissue exhibited an average tissue stiffness of 2.54 +-0.12 kPa. Both RLV and R+V treatments increased tissue stiffness to 7.4 +- 0.42 kPa and 9.92 +-0.21 kPa, respectively (Figure 35A). Deformation for untreated tissue was observed at 0.7 +- 0.09 ?m. Both RLV and R+V treatment reduced the Attorney Docket No.07039-2207WO1 / 2022-500 deformation systematically to 0.35 +-0.03 ?m and 0.24 +-0.01 µm, respectively (Figure 35B). Adhesion for the tissue treatments such as RLV and R+V was observed as 102.84 +- 50.48 pN and 152.81 +-19.06 pN and significantly lesser than untreated tissue at 167.96 +- 72.04 pN (Figure 35C). In the observed cytokine panel, RLV and R+V treatments consistently reduced the relative mRNA expression in all the cytokines compared to the untreated, except for TGF?1 (Figure 36). Both treatments decreased the cytokine expression for CXCL2 by 92%. The most reduction was observed in IL-8, 96% and 94% for RLV and R+V treatments, respectively (Figure 36). Example 3: Assessing PDAC Treatment A tissue sample containing one or more PDAC cells is obtained from a human having PDAC. The obtained sample is portioned into a first portion and a second portion. The first portion of the sample is contacted with a candidate anti-cancer treatment. Nanomechanical properties of the first portion contacted to the candidate anti-cancer treatment and nanomechanical properties of the second portion not contacted by the candidate anti-cancer treatment are measured. Nanomechanical properties including membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D), are measured. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer treatment is classified as being likely to be effective in treating the human. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are not altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer treatment is classified as not being likely to be effective in treating the human. Attorney Docket No.07039-2207WO1 / 2022-500 Example 4: Treating PDAC A tissue sample containing one or more PDAC cells is obtained from a human having PDAC. The obtained sample is portioned into a first portion and a second portion. The first portion of the sample is contacted with a candidate anti-cancer treatment. Nanomechanical properties of the first portion contacted to the candidate anti-cancer treatment and nanomechanical properties of the second portion not contacted by the candidate anti-cancer treatment are measured. Nanomechanical properties including membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D), are measured. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer treatment is classified as being likely to be effective in treating the human. In this case, the candidate anti-cancer treatment is administered to the human. The treatment can delay relapse, decrease the number of cancerous cells in the human having the PDAC, decrease the size of the tumor, or reduce the rate of increase in the size of the tumor. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are not altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer treatment is classified as not being likely to be effective in treating the human. In this case, an anti-cancer treatment different from the candidate anti-cancer treatment is administered to the human. Example 5: Assessing Breast Cancer Treatment A tissue sample containing one or more breast cancer cells is obtained from a human having breast cancer. The obtained sample is portioned into a first portion and a second portion. The first portion of the sample is contacted with a candidate anti-cancer treatment. Nanomechanical properties of the first portion contacted to the candidate anti-cancer treatment and nanomechanical properties of the second portion not contacted by the candidate anti-cancer treatment are measured. Nanomechanical properties including Attorney Docket No.07039-2207WO1 / 2022-500 membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D), are measured. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer treatment is classified as being likely to be effective in treating the human. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are not altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer treatment is classified as not being likely to be effective in treating the human. Example 6: Treating Breast Cancer A tissue sample containing one or more breast cancer cells is obtained from a human having breast cancer. The obtained sample is portioned into a first portion and a second portion. The first portion of the sample is contacted with a candidate anti-cancer treatment. Nanomechanical properties of the first portion contacted to the candidate anti-cancer treatment and nanomechanical properties of the second portion not contacted by the candidate anti-cancer treatment are measured. Nanomechanical properties including membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D), are measured. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer treatment is classified as being likely to be effective in treating the human. In this case, the candidate anti-cancer treatment is administered to the human. The treatment can delay relapse, decrease the number of cancerous cells in the human having the breast cancer, decrease the size of the tumor, or reduce the rate of increase in the size of the tumor. If the first portion of the sample contacted with a candidate anti-cancer treatment has nanomechanical properties that are not altered as compared to the second portion of the sample that is not contacted with a candidate anti-cancer treatment, the candidate anti-cancer Attorney Docket No.07039-2207WO1 / 2022-500 treatment is classified as not being likely to be effective in treating the human. In this case, an anti-cancer treatment different from the candidate anti-cancer treatment is administered to the human. OTHEREMBODIMENTSIt is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.07039-2207WO1 / 2022-500 WHATISCLAIMEDIS:

1. A method for determining if a candidate anti-cancer treatment is likely to be effective in treating a mammal having a cancer, wherein the method comprises: (a) contacting a first portion of a sample obtained from the mammal with the candidate anti-cancer treatment; (b) comparing one or more nanomechanical properties of the first portion following the contacting step (a) to one or more nanomechanical properties of a second portion of the sample, wherein the second portion was not contacted with the candidate anti-cancer treatment; and (c) classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal if the one or more nanomechanical properties of the first portion are altered as compared to the one or more nanomechanical properties of the second portion; or (d) classifying the candidate anti-cancer treatment as not being likely to be effective in treating the mammal if the one or more nanomechanical properties of the first portion are not altered as compared to the one or more nanomechanical properties of the second portion.

2. The method of claim 1, wherein the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D).

3. The method of claim 1 or claim 2, wherein the method further comprises comparing an expression level of one or more polypeptides of the first portion following the contacting step (a) to an expression level of the one or more polypeptides of a second portion of the sample, wherein the one or more polypeptides are selected from the group consisting of a TGF?1 polypeptide, an IL-8 polypeptide, a CCL2 polypeptide, and a CXCL2 polypeptide.Attorney Docket No.07039-2207WO1 / 2022-500 4. The method of claim 3, wherein said method comprises classifying the candidate anti- cancer treatment as being likely to be effective in treating the mammal if the expression level of the TGF?1 polypeptide and / or the IL-8 polypeptide of the first portion is higher than the expression level of the TGF?1 polypeptide and / or the IL-8 polypeptide of the second portion.

5. The method of claim 3, wherein said method comprises classifying the candidate anti- cancer treatment as not being likely to be effective in treating the mammal if the expression level of the TGF?1 polypeptide and / or the IL-8 polypeptide of the first portion is not higher than the expression level of the TGF?1 polypeptide and / or the IL-8 polypeptide of the second portion.

6. The method of claim 3, wherein said method comprises classifying the candidate anti- cancer treatment as being likely to be effective in treating the mammal if the expression level of the CCL2 polypeptide and / or the CXCL2 polypeptide of the first portion is lower than the expression level of the CCL2 polypeptide and / or the CXCL2 polypeptide of the second portion.

7. The method of claim 3, wherein said method comprises classifying the candidate anti- cancer treatment as not being likely to be effective in treating the mammal if the expression level of the CCL2 polypeptide and / or the CXCL2 polypeptide of the first portion is not lower than the expression level of the CCL2 polypeptide and / or the CXCL2 polypeptide of the second portion.

8. The method of any one of claims 1-7, wherein the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy.

9. The method of claim 8, wherein the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG- doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine withAttorney Docket No.07039-2207WO1 / 2022-500 paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin- bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab.

10. The method of any of one of claims 1-9, wherein the sample is a tissue sample.

11. The method of any one of claims 1-10, wherein the cancer is selected from the group consisting of a pancreatic cancer, a breast cancer, a lung cancer, a glioblastoma, and a lymph node cancer.

12. The method of claim 11, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma (PDAC).

13. The method of any one of claims 1-12, wherein the mammal is a human.

14. The method of any one of claims 1-13, wherein the first portion of the sample and the second portion of the sample comprise cancer cells.

15. The method of any one of claims 1-14, wherein said method comprises classifying the candidate anti-cancer treatment as being likely to be effective in treating the mammal.

16. The method of claim 15, said method further comprises administering the candidate anti-cancer treatment to said mammal.

17. A method for treating a mammal having a cancer, wherein the method comprises: (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) determining that one or more nanomechanical properties of the first portion following the contacting step (a) are altered as compared to the one or more nanomechanical properties of a second portion of the sample, wherein theAttorney Docket No.07039-2207WO1 / 2022-500 second portion was not contacted with the candidate anti-cancer treatment; and (c) administering the candidate anti-cancer treatment to the mammal.

18. The method of claim 17, wherein the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D).

19. The method of claim 17 or claim 18, wherein the method further comprises: determining that an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the first portion following the contacting step (a) are increased as compared to an expression level of the TGF?1 polypeptide and / or the IL-8 polypeptide of a second portion of the sample.

20. The method of claim 17 or claim 18, wherein the method further comprises: determining that an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the first portion following the contacting step (a) are decreased as compared to an expression level of the CCL2 polypeptide and / or the CXCL2 polypeptide of a second portion of the sample.

21. The method of any one of claims 17-20, wherein the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy.

22. The method of claim 21, wherein the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG- doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin-Attorney Docket No.07039-2207WO1 / 2022-500 bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab.

23. The method of any of one of claims 17-22, wherein the sample is a tissue sample.

24. The method of any one of claims 17-23, wherein the cancer is selected from the group consisting of a pancreatic cancer, a breast cancer, a lung cancer, a glioblastoma, and a lymph node cancer.

25. The method of claim 24, wherein the pancreatic cancer is a pancreatic ductal adenocarcinoma.

26. The method of any one of claims 17-25, wherein the mammal is a human.

27. The method of any one of claims 17-26, wherein the first portion of the sample and the second portion of the sample comprise cancer cells.

28. A method for treating a mammal having a cancer, wherein the method comprises: (a) contacting a first portion of a sample obtained from the mammal with a candidate anti-cancer treatment; (b) determining that one or more nanomechanical properties of the first portion following the contacting step (a) are not altered as compared to the one or more nanomechanical properties of a second portion of the sample, wherein the second portion was not contacted with the candidate anti-cancer treatment, and (c) administering an anti-cancer treatment different from the candidate anti- cancer treatment to the mammal.

29. The method of claim 28, wherein the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membraneAttorney Docket No.07039-2207WO1 / 2022-500 adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D).

30. The method of claim 28 or claim 29, wherein the method further comprises: determining that an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the first portion following the contacting step (a) are not increased as compared to an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of a second portion of the sample.

31. The method of claim 28 or claim 29, wherein the method further comprises: determining that an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the first portion following the contacting step (a) are not decreased as compared to an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of a second portion of the sample.

32. The method of any one of claims 28-30, wherein the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy.

33. The method of claim 32, wherein the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG- doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin- bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab.

34. The method of any of one of claims 28-33, wherein the sample is a tissue sample.Attorney Docket No.07039-2207WO1 / 2022-500 35. The method of any one of claims 28-34, wherein the cancer is selected from the group consisting of a pancreatic cancer, a breast cancer, a lung cancer, a glioblastoma, and a lymph node cancer.

36. The method of claim 35, wherein the pancreatic cancer is a pancreatic ductal adenocarcinoma.

37. The method of any one of claims 28-36, wherein the mammal is a human.

38. The method of any one of claims 28-37, wherein the first portion of the sample and the second portion of the sample comprise cancer cells.

39. A method for treating a mammal having a cancer, wherein the method comprises administering an anti-cancer treatment to the mammal, wherein a first portion of a sample obtained from the mammal was determined to have one or more nanomechanical properties that were altered as compared to the one or more nanomechanical properties of a second portion of the sample, wherein the first portion was contacted with the anti-cancer treatment, and wherein the second portion was not contacted with the anti-cancer treatment.

40. The method of claim 39, wherein the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D).

41. The method of claim 39 or claim 40, wherein the first portion of the sample obtained from the mammal was determined to have a higher expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide as compared to an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the second portion of the sample.Attorney Docket No.07039-2207WO1 / 2022-500 42. The method of claims 32 or claim 40, wherein the first portion of the sample obtained from the mammal was determined to have a lower expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide as compared to an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the second portion of the sample.

43. The method of any one of claims 39-41, wherein the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy.

44. The method of claim 43, wherein the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG- doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine with paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin- bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab.

45. The method of any of one of claims 39-44, wherein the sample is a tissue sample.

46. The method of any one of claims 39-45, wherein the cancer is pancreatic cancer.

47. The method of claim 46, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.

48. The method of any one of claims 39-45, wherein the cancer is breast cancer.

49. The method of any one of claims 39-48, wherein the mammal is a human.

50. The method of any one of claims 39-49, wherein the first portion of the sample and the second portion of the sample comprise cancer cells.Attorney Docket No.07039-2207WO1 / 2022-500 51. A method for treating a mammal having a cancer, wherein the method comprises administering an anti-cancer treatment different from a candidate anti-cancer treatment to the mammal, wherein a first portion of a sample obtained from the mammal was determined to lack one or more nanomechanical properties that were altered as compared to the one or more nanomechanical properties of a second portion of the sample, wherein the first portion was contacted with the candidate anti-cancer treatment, and wherein the second portion was not contacted with the candidate anti-cancer treatment.

52. The method of claim 51, wherein the one or more nanomechanical properties are selected from the group consisting of membrane stiffness, membrane deformation, membrane adhesion, drained Poisson’s ratio (D_P), diffusion coefficient (D_C), and a pore dimension (P_D).

53. The method of claim 51 or claim 52, wherein the first portion of the sample obtained from the mammal was determined to lack a higher expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide as compared to an expression level of a TGF?1 polypeptide and / or an IL-8 polypeptide of the second portion of the sample.

54. The method of claim 51 or claim 52, wherein the first portion of the sample obtained from the mammal was determined to lack a lower expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide as compared to an expression level of a CCL2 polypeptide and / or a CXCL2 polypeptide of the second portion of the sample.

55. The method of any one of claims 51-54, wherein the candidate anti-cancer treatment comprises an anti-cancer compound, radiation therapy, or tumor treating fields (TTF) therapy.

56. The method of claim 55, wherein the anti-cancer compound is selected from the group consisting of irinotecan, pegylated nanodiamond (ND-PEG)-irinotecan, ND-PEG- doxorubicin, bortezomib, rapamycin, olaparib, ATMi, gemcitabine, gemcitabine withAttorney Docket No.07039-2207WO1 / 2022-500 paclitaxel protein-bound particles, 5-fluorouracil, oxaliplatin, paclitaxel, docetaxel, albumin- bound paclitaxel, capecitabine, cisplatin, irinotecan, liposomal irinotecan, or a combination of leucovorin, 5-fluorouracil, irinotecan, oxaliplatin, carboplatin, and pembrolizumab.

57. The method of any of one of claims 51-56, wherein the sample is a tissue sample.

58. The method of any one of claims 51-57, wherein the cancer is pancreatic cancer.

59. The method of claim 58, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.

60. The method of any one of claims 51-57, wherein the cancer is breast cancer.

61. The method of any one of claims 51-60, wherein the mammal is a human.

62. The method of any one of claims 51-61, wherein the first portion of the sample and the second portion of the sample comprise cancer cells.

Images