Construction method for and use of animal model having restored telomere length in blastocyst-stage transfer

Abstract

Provided are a construction method for and use of an animal model having restored telomere length in blastocyst-stage transfer. The method comprises: obtaining a zygote of a non-human animal by means of in vitro fertilization, then injecting a TERT mRNA solution into the zygote, culturing the zygote in vitro to a blastocyst stage, and then implanting an obtained embryo in the blastocyst stage into a non-human surrogate female animal and producing offspring. The method can be used for researching the mechanism of telomere shortening, and exploring optimization solutions for human clinical assisted reproductive technology.

Description

Method for constructing an animal model for restoring telomere length by blastocyst stage transplantation and its application

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the Chinese patent application filed with the Patent Office of China on October 12, 2023, with application number 202311324376.3, and invention name “A method for constructing an animal model for restoring telomere length by blastocyst stage transplantation and its use”, the entire contents of which are incorporated herein by reference; this application also claims priority to the Chinese patent application filed with the Patent Office of China on July 19, 2023, with application number 202310890939.9, and invention name “A method for constructing an animal model for restoring telomere length by blastocyst stage transplantation and its use”, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present disclosure belongs to the technical field of animal model construction, and particularly relates to a method for constructing an animal model for restoring telomere length through blastocyst stage transplantation and its use. Background Art

[0004] With the annual rise in infertility rates, the use of assisted reproductive technology (ART) is rapidly increasing worldwide. Assisted reproductive technology is categorized into two strategies, cleavage-stage transfer and blastocyst-stage transfer, depending on the stage of embryo development at the time of embryo transfer. Blastocyst-stage transfer offers higher live birth rates and is increasingly used in clinical practice. However, the process of culturing cleavage-stage embryos to the blastocyst stage occurs during a critical window for telomere elongation. Studies have reported that both human and mouse offspring from blastocyst-stage embryos experience telomere shortening. Telomeres are DNA-protein complexes located at the ends of eukaryotic chromosomes that maintain genomic stability. As organisms age, telomeres shorten due to end-replication problems during cell division. When telomeres shorten below a critical length, the structure of the telomere complex is disrupted, the protective function of chromosomes is weakened, cell cycle arrest pathways are activated, and cells gradually enter a state of senescence and fail to proliferate. Numerous human studies have shown a correlation between telomere length and overall mortality and life expectancy. Studies in mouse models have shown that mice with impaired telomere function exhibit multisystem premature aging phenotypes.

[0005] Although telomere length is longer in offspring from cleavage-stage embryo transfers compared to blastocyst-stage embryo transfers, cleavage-stage embryo transfers hinder the selection of embryos with favorable developmental status, significantly reducing live birth rates and placing significant psychological and financial pressure on families undergoing assisted reproductive technology. Furthermore, transplanting cleavage-stage embryos into the uterus disrupts the physiological synchronization of the embryo and endometrium, significantly increasing the risk of miscarriage and developmental abnormalities in the offspring.

[0006] Therefore, there is an urgent need to explore a stable, simple, and low-risk telomere length restoration strategy for blastocyst-stage transfer, providing clues and a theoretical basis for optimizing assisted reproductive technology protocols in clinical practice. Furthermore, exploring relevant telomere length restoration methods for blastocyst-stage transfers could also provide new insights and insights into the mechanisms of telomere lengthening and shortening, the biological functions of telomeres, and the relationship between telomeres and aging.

[0007] Summary of the Invention

[0008] In response to the above technical problems, the present application provides a method for constructing an animal model for restoring telomere length by blastocyst stage transplantation and its use. The method is effective, reliable, simple and easy to implement, and does not rely on gene editing technology.

[0009] Telomere length usually shortens with age, but under the action of telomerase, the embryo undergoes a biological process of telomere extension during early development. The present application found that upregulating TERT, a core component of telomerase, will enhance telomerase activity. Based on this, the present application attempts to culture animal embryos in vitro to the blastocyst stage after injecting TERT mRNA during the fertilized egg period, and then transplant them into the mother's body to enhance the telomere extension process under the action of telomerase, so as to restore the telomere length of the transplanted animals in the blastocyst stage.

[0010] To this end, this application provides the following technical solutions:

[0011] Use of TERT mRNA in the preparation of a product for restoring telomere length in animals or humans.

[0012] Optionally, restoring the telomere length of an animal or human comprises restoring the telomere length of newborn offspring of the animal or human transplanted at the blastocyst stage.

[0013] Optionally, the concentration of the TERT mRNA is 10 ng / μL-50 ng / μL; preferably, 25 ng / μL;

[0014] Optionally, the product is a medicine.

[0015] Alternatively, TERT mRNA can be injected into fertilized eggs.

[0016] A method for constructing an animal model for restoring telomere length by blastocyst stage transplantation comprises the following steps:

[0017] A fertilized egg of a non-human animal is obtained through in vitro fertilization, and then a TERT mRNA solution is injected into the fertilized egg. After the fertilized egg is cultured in vitro to the blastocyst stage, the obtained blastocyst stage embryo is implanted into a non-human surrogate female animal to produce offspring.

[0018] Optionally, the concentration of the TERT mRNA solution is 10-50 ng / μL; preferably, the concentration of the TERT mRNA solution is 25 ng / μL;

[0019] And / or, the TERT mRNA injection tool uses a micro automatic injection instrument (brand: Eppendorf, model: FemtoJet 4i)

[0020] And / or, the injection volume of the TERT mRNA solution is 1-3 pL / each fertilized egg; preferably, the injection volume of the TERT mRNA solution is 2 pL / each fertilized egg;

[0021] And / or, the blastocyst stage refers to: 70 to 120 hours after fertilization; preferably, 72±2 hours.

[0022] Optional steps include:

[0023] 1) Obtain TERT mRNA and dilute to the desired concentration using nuclease-free water;

[0024] 2) obtaining sperm from a non-human male animal, and contacting the sperm with a capacitation medium to obtain capacitated sperm;

[0025] 3) obtaining cumulus-oocyte complexes from non-human female animals;

[0026] 4) contacting the capacitated sperm obtained in step 2) with a cumulus ovary-oocyte complex in vitro to obtain a fertilized egg;

[0027] 5) microinjecting the fertilized egg obtained in step 4) with the TERT mRNA produced in step 1);

[0028] 6) allowing the fertilized egg obtained in step 5) to develop in vitro to the blastocyst stage;

[0029] 7) implanting the blastocyst-stage embryo into a non-human surrogate female animal and producing offspring;

[0030] Optionally, the non-human animal is SPF grade;

[0031] The order of step 2) and step 3) can be interchanged or performed in parallel.

[0032] Optionally, the non-human animal is a rodent;

[0033] Optionally, the non-human animal is a mouse (Mus musculus);

[0034] Optionally, the mouse is selected from any of the following strains: ICR, A / He, A / J, A / SnSf, A / WySN, AKR, AKR / A, AKR / J, AKR / N, BALB / c, B6SJLF1, B6C3F1, B6D2F1, C3H, C3He, C3Hf, C57BR, C57L, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57 BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, C58, CBA / Br, CBA / Ca, CBA / J, C BA / st, CBA / H, CB6F1, CD2F1, CFW, DBA / 1, DBA / 2, FACA, FVB, KM, NIH, NIH(S), RF, SJL, SWR, TA1, TA2, or 129.

[0035] Optionally, the male mice are 8 to 20 weeks old; preferably, 8 to 12 weeks old;

[0036] And / or, the female mouse is an adolescent female mouse, which is 3 to 12 weeks old; preferably, 4 to 5 weeks old;

[0037] And / or, the surrogate mouse is 6 to 10 weeks old; preferably, 8 weeks old.

[0038] Optionally, in step 2):

[0039] contacting the sperm with the capacitation medium at 35° C. to 38° C. and a carbon dioxide content of 4% to 7% for 0.5 to 1.5 hours;

[0040] Optionally, the sperm and the capacitation medium are allowed to contact for 1 hour at 37° C.±1° C. and 5% carbon dioxide;

[0041] Optionally, the energy acquisition medium comprises any one or a combination thereof selected from the following: sodium salt, potassium salt, calcium salt, magnesium salt, glucose, β-cyclodextrin or polyvinyl alcohol.

[0042] Optionally, in step 4):

[0043] contacting the capacitated sperm and the cumulus-oocyte complex in an in vitro fertilization medium at 35° C. to 38° C. and a carbon dioxide content of 4% to 7% for 4 to 10 hours; optionally, for 5.5 to 6.5 hours;

[0044] Optionally, contacting the capacitated sperm and the cumulus oocyte complex in an in vitro fertilization medium at 37° C.±1° C. and 5% carbon dioxide for 5.5-6.5 hours;

[0045] Optionally, the in vitro fertilization medium comprises any one or a combination thereof selected from the following: reduced glutathione, electrolytes, a carbon source or a nitrogen source.

[0046] Optionally, in step 1):

[0047] Obtaining the TERT gene coding sequence CDS, inserting the TERT coding sequence CDS into a plasmid vector, and performing in vitro transcription on the plasmid to obtain TERT gene mRNA;

[0048] Alternatively, the TERT coding sequence CDS was inserted into the pcDNA3.1 plasmid vector using HindIII and EcoRI restriction sites;

[0049] Alternatively, use the mMESSAGE mMACHINE manufactured by Thermo Fisher Scientific. TM In vitro transcription was performed using the T7 ULTRA kit.

[0050] Optionally, in step 6):

[0051] contacting the fertilized egg with the cleavage culture medium at 35° C. to 38° C. and a carbon dioxide content of 4% to 7% for 40 to 54 hours to obtain an 8-cell stage embryo;

[0052] The 8-cell stage embryos are brought into contact with a blastocyst culture medium at 35° C. to 38° C. and a carbon dioxide content of 4% to 7% for 20 to 28 hours to obtain blastocyst stage embryos.

[0053] Optionally, the fertilized egg is allowed to contact the cleavage culture medium at 37° C.±1° C. and 5% carbon dioxide for 48±2 hours to obtain an 8-cell stage embryo;

[0054] The 8-cell stage embryos were brought into contact with a blastocyst culture medium at 37°C ± 1°C and a carbon dioxide content of 5% for 24 ± 2 hours to obtain blastocyst stage embryos.

[0055] Optionally, compared to a negative control non-human animal, the telomere length in the tissue of the animal model is statistically significantly longer; compared to a positive control non-human animal, the telomere length in the tissue of the animal model is statistically not significantly different or is significantly longer;

[0056] Optionally, the tissue is selected from any one or a combination of the following: peripheral blood, heart, liver or brain;

[0057] Optionally, the negative control non-human animal, the positive control non-human animal and the animal model are of the same strain;

[0058] Optionally, the negative control non-human animal refers to the offspring produced by injecting sterile water into the fertilized egg and then implanting the embryo into a non-human surrogate female animal at the blastocyst stage; the positive control non-human animal refers to the offspring produced by injecting sterile water into the fertilized egg and then implanting the embryo into a non-human surrogate female animal before the blastocyst stage;

[0059] More optionally, the positive control non-human animal refers to the offspring produced by injecting sterile water into the fertilized egg and then implanting the embryo into a non-human surrogate female animal during the cleavage stage.

[0060] An animal model constructed by the construction method for restoring telomere length by blastocyst transplantation.

[0061] A use of the animal model for restoring telomere length by blastocyst stage transplantation in telomere research or aging research.

[0062] A use of the animal model for restoring telomere length by blastocyst stage transplantation in research related to the optimization of human clinical assisted reproductive technology operation methods.

[0063] Preferably, the mice are SPF-grade mice of various strains (eg, ICR mice).

[0064] As a preferred method, before fertilization, the sperm is added to a conventional commercial sperm capacitation solution (such as TYH sperm capacitation solution, manufacturer: Aibei Bio, product number: M2050) and cultured for 1 hour to capacite the sperm. The culture conditions are a temperature of 37±1°C and a carbon dioxide content of 4%-7%, preferably a temperature of 37°C and a carbon dioxide content of 5%.

[0065] As a preferred method, before fertilization, the cumulus ovary-oocyte complex COCs is introduced into conventional commercial fertilization fluid droplets (such as HTF fertilization fluid, manufacturer: Aibei Bio, product number: M1150) and placed in an incubator. The culture conditions are a temperature of 37±1°C and a carbon dioxide content of 4%-7%, preferably a temperature of 37°C and a carbon dioxide content of 5%.

[0066] As a preference, the in vitro fertilization method includes intracytoplasmic sperm injection (ICSI) / in vitro fertilization (IVF).

[0067] Preferably, 1-3 μl of sperm suspension is drawn from the outer edge of the sperm capacitation solution droplet and injected into the fertilization solution droplet containing COCs, and the in vitro fertilization dish is placed in an incubator for culture.

[0068] Preferably, after obtaining the fertilized egg, TERT mRNA at a dose of 25 ng / μL is injected into the fertilized egg.

[0069] As a preferred method, the TERT CDS was inserted into the pcDNA3.1 plasmid vector through the HindIII and EcoRI restriction sites, and the mMESSAGE mMACHINE produced by Thermo Fisher was used. TM T7 ULTRA Kit (Cat. No.: AM1345) was used for in vitro transcription to obtain the TERT mRNA.

[0070] As a preferred method, the fertilized egg injected with mRNA is cultured in vitro to the blastocyst stage, and the in vitro culture conditions include conventional commercial cleavage embryo culture medium (e.g., cleavage culture medium, manufacturer: Cook, product number: K-SICM-20, used for fertilized eggs to eight-cell stage embryos), conventional commercial blastocyst culture medium (e.g., blastocyst culture medium, manufacturer: Cook, product number: K-SIBM-20, used for eight-cell stage embryos to blastocysts), and the culture conditions are a temperature of 37±1°C and a carbon dioxide content of 4%-7%, preferably a temperature of 37°C and a carbon dioxide content of 5%.

[0071] Preferably, the in vitro culture to the blastocyst stage is about 3-4 days.

[0072] As an embodiment, a method for restoring telomere length in assisted reproductive mice transplanted at the blastocyst stage comprises the following steps:

[0073] (1) Preparation of TERT mRNA: Download the TERT gene coding sequence (CDS) from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), insert the TERT CDS into the pcDNA3.1 plasmid vector through the HindIII and EcoRI restriction sites, and use a conventional commercial in vitro transcription kit (e.g., mMESSAGE mMACHINE TM The plasmid was in vitro transcribed using a T7 ULTRA kit (manufacturer: Thermo Fisher, catalog number: AM1345) to obtain TERT gene mRNA, which was diluted to 25 ng / μL using nuclease-free water for later use.

[0074] (2) Sperm preparation: Pick up the sperm paste and put it into another droplet of sperm capacitation solution. Place the sperm capacitation dish in an incubator and culture it for 1 hour to allow the sperm to capamate.

[0075] (3) Oocyte preparation: cumulus ovary-oocyte complexes (COCs) were collected and released into mineral oil. COCs were introduced into a 100 μl droplet of fertilization solution using ophthalmic forceps and placed in an incubator to await sperm capacitation. The incubation conditions were 37°C and 5% carbon dioxide.

[0076] (4) In vitro fertilization: 1-3 μl of sperm suspension is drawn from the outer edge of the sperm capacitation solution droplet and injected into the fertilization solution droplet containing COCs. The IVF dish is placed in an incubator for approximately 6 hours at 37°C and 5% carbon dioxide.

[0077] (5) TERT mRNA injection: 6 hours after in vitro fertilization, the fertilized eggs were washed three times with in vitro fertilization solution. After washing, the male and female pronuclei were observed and the unfertilized eggs were removed. The reserved TERT mRNA of 25 ng / μL was injected into the fertilized eggs using a microsyringe (brand: Eppendorf, model: FemtoJet 4i) at an injection dose of 2 pL.

[0078] (6) Embryo culture and transplantation: Prepare pseudo-pregnant surrogate female mice for in vitro fertilization. Prepare cleavage embryo culture dishes, 100 μl of conventional commercial cleavage embryo culture medium (e.g., cleavage culture medium, manufacturer: Cook, item number: K-SICM-20), cover with mineral oil, and place in an incubator for 6 hours in advance. Transfer the fertilized eggs injected with mRNA into the cleavage embryo culture medium, and place the cleavage embryo culture dish in an incubator for culture at a temperature of 37°C and a carbon dioxide content of 5%. After culturing for about 24 hours, observe the embryo status, remove developmentally arrested embryos, and retain embryos that develop normally to the 2-cell stage. Continue culturing for about 24 hours, and then prepare blastocyst culture dishes, 100 μl of conventional commercial blastocyst culture medium (e.g., blastocyst culture medium, manufacturer: Cook, item number: K-SIBM-20), cover with mineral oil, and place in an incubator for 6 hours in advance. Observe the embryo development, remove developmentally arrested embryos, select embryos that develop normally to the 8-cell stage, transfer them into the blastocyst culture medium, and place them in an incubator. After about 24 hours of culture, the embryonic development was observed, developmentally arrested embryos were removed, and embryos that developed normally to the blastocyst stage were selected and transplanted into the uterus of surrogate female mice. 15 blastocysts were transplanted into each female mouse, and each mouse was raised in a single cage until delivery. The offspring obtained were the animal model.

[0079] This application does not protect the method of obtaining sperm and eggs from mice. It only protects the modeling method of producing telomere-restored mice by injecting TERT mRNA into fertilized eggs obtained by in vitro fertilization, culturing them into blastocysts, and transplanting them into surrogate mothers for development.

[0080] After the surrogate mothers gave birth, the relative telomere lengths of the mice's peripheral blood, heart, liver, and brain tissues were measured on the first day after birth. The results showed that the telomere lengths of the mice in each tissue were significantly restored. According to the construction method of this application, the telomere length of the mice transplanted at the blastocyst stage can be successfully restored.

[0081] The technical solution of this application has the following advantages:

[0082] (1) This application provides a simple method for constructing an animal model for restoring telomere length by blastocyst-stage embryo transfer, requiring no gene editing. By injecting TERT mRNA into the fertilized egg, the telomere lengthening process under the action of telomerase is enhanced, resulting in restoration of telomere length without significantly affecting maternal reproductive rate. Therefore, this application provides an important method for constructing an animal model for exploring the mechanisms of telomere restoration and telomere-related phenotypes such as aging.

[0083] Furthermore, the telomere restoration effect of the animal model constructed in the present application is stable and reliable, and the telomere lengths of the peripheral blood, liver, brain, and heart tissues of the constructed animal model are significantly restored.

[0084] Furthermore, the animal model constructed in this application can be used for related research on optimization schemes for human assisted reproductive operations. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] FIG1 is a schematic diagram of the operational flow of the method for constructing an animal model for restoring telomere length by blastocyst-stage transplantation provided in this application;

[0086] FIG2 is a schematic diagram showing a comparison of telomere length in peripheral blood of short-telomere mice and control mice on day 1 after birth, provided in Examples 2 and 3 of the present application;

[0087] FIG3 is a schematic diagram showing a comparison of telomere lengths in liver tissues of short-telomere mice and control mice on day 1 after birth, as provided in Examples 2 and 3 of the present application;

[0088] FIG4 is a schematic diagram showing a comparison of telomere lengths in brain tissue of short-telomere mice and control mice on day 1 after birth, as provided in Examples 2 and 3 of the present application;

[0089] FIG5 is a schematic diagram showing a comparison of telomere lengths in heart tissue of short-telomere mice and control mice on day 1 after birth, as provided in Examples 2 and 3 of the present application;

[0090] FIG6 is a schematic diagram showing a comparison of telomere length in peripheral blood of short-telomere mice and control mice on day 1 after birth, as provided in Examples 5 and 6 of the present application;

[0091] FIG7 is a schematic diagram showing a comparison of telomere lengths in liver tissues of short-telomere mice and control mice on day 1 after birth, as provided in Examples 5 and 6 of the present application;

[0092] FIG8 is a schematic diagram showing a comparison of telomere lengths in brain tissues of short-telomere mice and control mice on day 1 after birth, as provided in Examples 5 and 6 of the present application;

[0093] FIG9 is a schematic diagram showing a comparison of telomere lengths in heart tissue of short-telomere mice and control mice on day 1 after birth, as provided in Examples 5 and 6 of the present application;

[0094] FIG10 is a schematic diagram showing a comparison of telomere length in peripheral blood of short-telomere mice and control mice on day 1 after birth, as provided in Examples 8 and 9 of the present application;

[0095] FIG11 is a schematic diagram showing a comparison of telomere lengths in liver tissues of short-telomere mice and control mice on day 1 after birth, as provided in Examples 8 and 9 of the present application;

[0096] FIG12 is a schematic diagram showing a comparison of telomere lengths in brain tissues of short-telomere mice and control mice on day 1 after birth, as provided in Examples 8 and 9 of the present application;

[0097] Figure 13 is a schematic diagram showing the comparison of telomere lengths in heart tissue of short-telomere mice and control mice on day 1 after birth, as provided in Examples 8 and 9 of the present application. DETAILED DESCRIPTION

[0098] The following examples are provided to further better understand the present application, but are not limited to the best implementation mode described herein, and do not limit the content and protection scope of the present application. Any product identical or similar to the present application obtained by anyone under the inspiration of the present application or by combining the features of the present application with other prior arts shall fall within the scope of protection of the present application.

[0099] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in this field can be used. If the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional reagents.

[0100] Animal models refer to non-human animals established in various medical, scientific, and research fields that exhibit symptoms that mimic human diseases.

[0101] According to some embodiments disclosed in the present application, an animal model for restoring telomere length by blastocyst stage transplantation is provided.

[0102] Telomeres are stretches of DNA and protein complexes at the ends of eukaryotic chromosomes. One of the functions of telomeres is to protect the ends of chromosomes from fusion and maintain genomic stability. Due to terminal replication problems, telomeres lose some length after each cell division cycle. When they shorten to a certain limit, they lose their ability to protect the genome, causing cells to enter a state of cell cycle arrest. Therefore, severely shortened telomeres are a sign of cellular aging. Telomere length is an important factor associated with human health and is correlated with overall mortality and life expectancy. Telomeres can be synthesized and extended using RNA as a template by the enzyme telomerase, whose activity is regulated by its core component, TERT.

[0103] Telomere restoration means that the telomere lengths of multiple tissues (including peripheral blood, liver, brain, heart, etc.) of offspring animals (such as mice) born through the method disclosed in this application are the same as or longer than those of offspring animals (such as mice) transplanted at the cleavage stage, and are longer than those of offspring animals (such as mice) transplanted at the blastocyst stage but not injected with TERT mRNA, and the above differences are statistically significant (P-value < 0.05).

[0104] The present study found that the ability of telomerase to synthesize telomeres can be enhanced by injecting TERT mRNA into fertilized eggs. Fertilized eggs injected with TERT mRNA are cultured in vitro to the blastocyst stage and then transplanted into the mother until birth. At this time, the telomere length of newborn offspring animals (such as mice) is restored.

[0105] According to some embodiments disclosed in the present application, a method for constructing an animal model for restoring telomere length by blastocyst stage transplantation is provided, which comprises the steps of injecting TERT mRNA into a fertilized egg, culturing the fertilized egg into a blastocyst in vitro, implanting the blastocyst stage embryo into a non-human surrogate female animal and producing offspring.

[0106] In the present application, TERT mRNA refers to telomerase reverse transcriptase messenger ribonucleic acid, and the injection dose is 10 ng / μL-50 ng / μL, preferably 25 ng / μL.

[0107] In this application, the blastocyst stage refers to: 70 to 120 hours after fertilization (for example, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 hours), preferably 72±2 hours; the embryos in the blastocyst stage are required to be well developed, with a complete inner cell mass and extraembryonic trophoblast visible in morphology.

[0108] In this application, "after fertilization" refers to the time from when the fertilized egg is obtained (not the time when the sperm and COCs come into contact).

[0109] In all embodiments, the methods disclosed herein do not involve any steps of modifying the genetic material of mouse chromosomes or mitochondria, such as but not limited to: gene mutation, gene editing, gene knockout, and mutagenesis.

[0110] In some embodiments, the mouse is Mus. musculus. The present invention has no particular limitation on the strain of mice, as long as the mice are SPF grade.

[0111] SPF (Specific Pathogen Free) animals are free of specific pathogens. SPF animals ensure that no specific diseases can interfere with experimental results; for example, when studying the effects of drugs on anti-aging, the animals are free of pathogens that could affect their survival.

[0112] As an example, mice that can be used to construct mouse models are selected from any of the following strains: A / He, A / J, A / SnSf, A / WySN, AKR, AKR / A, AKR / J, AKR / N, BALB / c, B6SJLF1, B6C3F1, B6D2F1, C3H, C3He, C3Hf, C57BR, C57L, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C 57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, C58, CBA / Br, CBA / Ca, CBA / J, CB A / st, CBA / H, CB6F1, CD2F1, CFW, DBA / 1, DBA / 2, FACA, FVB, ICR, KM, NIH, NIH(S), RF, SJL, SWR, TA1, TA2, 129.

[0113] In some embodiments, a method for constructing an animal model for restoring telomere length by blastocyst stage transplantation comprises the steps of:

[0114] 1) Obtain TERT mRNA and dilute it with nuclease-free water to a concentration of 25 ng / μL;

[0115] 2) obtaining sperm from a male mouse, and contacting the sperm with a capacitation medium to obtain capacitated sperm;

[0116] 3) obtaining a cumulus oocyte complex from a female mouse, and contacting the cumulus oocyte complex with an in vitro fertilization medium;

[0117] 4) contacting the capacitated sperm obtained in step 2) with the cumulus ovary-oocyte complex obtained in step 3) in vitro to obtain a fertilized egg;

[0118] 5) injecting the TERT mRNA obtained in step 1) into the fertilized egg obtained in step 4);

[0119] 6) culturing the fertilized eggs injected with TERT mRNA in vitro to the blastocyst stage;

[0120] 7) implanting the blastocyst-stage embryo into a surrogate female mouse;

[0121] 8) The surrogate female mice produce the telomere length restoration mouse model;

[0122] The mice were SPF grade;

[0123] The order of step 2) and step 3) can be interchanged or performed in parallel.

[0124] In some embodiments, TERT mRNA can be freshly obtained, or preserved.

[0125] In some embodiments, sperm obtained from male mice can be freshly obtained or preserved.

[0126] In some embodiments, sperm obtained from male mice is freshly obtained and the sperm is contacted with a capacitation medium.

[0127] In some embodiments, when sperm obtained from male mice is cryopreserved, extracellular matrix proteins can be added to the sperm sample after thawing or rapid freezing storage. The IVF technician can conveniently wash the thawed sperm, concentrate the sperm by centrifugation, and then resuspend the sperm in capacitation medium.

[0128] In some embodiments, the male mice are 8 to 20 weeks old (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20). In some specific embodiments, the male mice (e.g., ICR) are 8 to 12 weeks old. Technicians are aware that, as strains change, technicians can determine equivalent ages. In the methods disclosed herein, the inventors found that the conservatism between strains of mice is high, and mice of other strains can be applied at the same age as ICR mice.

[0129] In vitro transcription

[0130] The ability of telomerase to extend telomeres is limited by its core component TERT, and the expression of the TERT gene is strictly regulated by the cell. If exogenous TERT mRNA is introduced into the cell, more TERT protein will be translated into the cell, thereby exerting its biological function and enhancing the ability of telomerase to extend telomere fragments. Exogenous TERT mRNA can be obtained in the existing technology, such as but not limited to in vitro transcription. Transcription usually occurs in organisms, but if we use RNA transcriptase, NTP and other conditions, in an in vitro cell-free system, using DNA as a template, we can also generate RNA by mimicking the in vivo transcription process. This technology can control the transcribed gene, the transcription process and the use of the post-transcription mRNA, which is called in vitro transcription. The specific operation is to download the TERT gene coding sequence (CDS) from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), insert the TERT CDS into the pcDNA3.1 plasmid vector through the HindIII and EcoRI restriction sites, and use a conventional commercial in vitro transcription kit (such as mMESSAGE mMACHINE TM The plasmid was transcribed in vitro using T7 ULTRA kit (manufacturer: Thermo Fisher, catalog number: AM1345) to obtain TERT gene mRNA.

[0131] Empowerment

[0132] Although freshly obtained sperm are morphologically mature and motile, they are not capable of fertilization; the sperm must first undergo a maturation process called "capacitation" (Austin et al. The capacitation of the mammalian sperm. Nature, 170:326 (1952); Chang et al. Fertilizing capacity of spermatozoa deposited into the fallopian tubes. Nature, 168:697-8 (1951)).

[0133] The principles of sperm capacitation are known in the art, for example, but not limited to, causing sperm to undergo sterol efflux (Travis et al., "The role of cholesterol efflux in regulating the fertilization potential of mammalians permatozoa." The Journal of Clinical Investigation, 110: 731-36 (2002)). For another example, cholesterol (and other lipids, such as gangliosides) form microdomains within the plasma membrane of mouse sperm (Asano et al., "Biochemical characterization of membrane fractions in murine sperm: Identification of three distinct sub-types of membrane rafts." J Cell Physiol., 218: 537-48 (2009)). For another example, in mouse in vitro fertilization, the cleavage rate after fertilization was significantly increased when the concentration of GSH was 300 mM (Effect of GSH on mouse oocyte maturation in vitro fertilization," Master's thesis, Northeast Agricultural University, 2008).

[0134] Methods, reagents, and media for capacitation of sperm are available in the prior art.

[0135] In a specific embodiment, the capacitation method, reagent, or medium is the reagent or medium described in CN1893968A. As an example, the capacitation medium comprises angiotensin II amide. Alternatively, peptides containing the tripeptide motif RGD (Arg-Gly-Asp) or the tetrapeptide RGDS (Arg-Gly-Asp-Ser) can be used as capacitation mediators. RGD can be combined with angiotensin II because it inhibits extracellular matrix protein binding, increasing the efficiency of added angiotensin II in stimulating motility and thereby enhancing capacitation.

[0136] In a specific embodiment, the capacitation medium comprises: sodium salt, potassium salt, calcium salt, magnesium salt, glucose, β-cyclodextrin and polyvinyl alcohol. As a preferred example, the capacitation medium comprises: sodium chloride, potassium chloride, calcium chloride dihydrate, glucose, sodium pyruvate, magnesium sulfate heptahydrate, potassium dihydrogen phosphate, sodium bicarbonate, β-cyclodextrin and polyvinyl alcohol.

[0137] In a specific embodiment, commercially available capacitation medium can also be used, such as but not limited to TYH sperm capacitation solution (Aibei Bio, product number: M2050), which contains: 119.37mMol / L NaCl, 4.78mMol / L KCl, 1.19mMol / L KH2PO4, 1.19mMol / L MgSO4·7H2O, 5.56mMol / L glucose, 1.71mMol / L CaCl2·2H2O, 25.07mMol / L NaHCO3, 0.5mMol / L sodium pyruvate, 0.025g / L gentamicin sulfate, 0.75mMol / L methyl-β-cyclodextrin, and 1g / L polyvinyl alcohol.

[0138] In one embodiment, the sperm are contacted with a capacitation medium to obtain capacitated sperm.

[0139] In a specific embodiment, the sperm and the capacitation medium are contacted under appropriate culture conditions for a period of time (e.g., 0.5 to 2 hours, preferably 0.5 to 1.5 hours, for example but not limited to 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0 ± 10%, or a range between any two of the above values).

[0140] During capacitation, appropriate culture conditions may be those recommended by the manufacturer of the capacitation medium, or the method disclosed in CN1893968A may be used.

[0141] As a non-limiting example, suitable culture conditions for capacitation are temperature (30 to 40, 35 to 38, preferably 37±1°C); carbon dioxide content (3-10%, 4%-7%, preferably 5%).

[0142] Collection of cumulus-oocyte complexes

[0143] The term "follicle" as used herein refers to an ovarian follicle, which is the basic unit of female reproductive biology and consists of a roughly spherical aggregate of cells found in the ovary. A follicle contains a single oocyte. The follicle begins to grow and develop regularly, ultimately ovulating a single, usually competent, oocyte.

[0144] As used herein, the term "oocyte" includes an oocyte alone or in association with one or more other cells, such as an oocyte as part of a cumulus-oocyte complex.

[0145] The term "cumulus cell" as used herein refers to a cell in the developing ovarian follicle that is directly adjacent to or very close to the oocyte. The cumulus cell participates in providing some of the nutrients, energy, and / or other requirements necessary for the oocyte to produce a viable embryo upon fertilization.

[0146] The term "cumulus-oocyte complex (COCs)" as used herein refers to at least one oocyte and at least one cumulus cell physically associated with each other. Typically, an oocyte is surrounded by a tightly packed layer of cumulus cells to form a cumulus-oocyte complex.

[0147] In the present disclosure, the eggs are provided in the form of "cumulus-oocyte complexes".

[0148] In some embodiments, to collect preovulatory COCs, dense COCs are collected from large antral follicles 30-50 hours, such as 48 hours, after administration of chorionic gonadotropin to prepubertal female mice.

[0149] In some embodiments, the female mice are 3 to 12 weeks old (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). In some specific embodiments, the female mice (e.g., ICR) are 4 to 5 weeks old. The skilled person will appreciate that, as strains vary, the skilled person will be able to determine equivalent ages.

[0150] In some embodiments, the collection and pretreatment of COCs may also adopt methods in the prior art, such as the method disclosed in CN107208057A.

[0151] IVF

[0152] IVF is the process of retrieving oocytes from a woman's ovaries and fertilizing them with sperm in a laboratory procedure.

[0153] In some embodiments, the capacitated sperm is contacted with a cumulus-oocyte complex in vitro to obtain a fertilized egg.

[0154] In some embodiments, the capacitated sperm and the cumulus-oocyte complex are contacted in an in vitro fertilization medium under appropriate culture conditions for 4-10 hours (e.g., 4, 5, 6, 7, 8, 9, 10, or a range between any two of the foregoing values, such as 5.5-6.5 hours) to obtain a fertilized egg. As a non-limiting example, appropriate culture conditions include a temperature (30 to 40°C, 35 to 38°C, preferably 37±1°C) and a carbon dioxide content (3-10%, 4%-7%, preferably 5%).

[0155] As an example, in vitro fertilization media suitable for the methods disclosed herein are well known in the prior art, such as, but not limited to, the methods taught in CN113817668A. The in vitro fertilization medium comprises any one or a combination thereof selected from the following: reduced glutathione, an electrolyte, a carbon source, a nitrogen source. In an exemplary embodiment, the in vitro fertilization medium comprises any one or a combination thereof selected from the following: a sodium salt, a potassium salt, a magnesium salt, a calcium salt, glucose, bovine serum albumin, reduced glutathione (when frozen sperm is used, reduced glutathione is preferably included in the in vitro fertilization medium).

[0156] In a specific embodiment, commercially available in vitro fertilization media can also be used, such as but not limited to HTF fertilization solution (Aibei Bio, product number: M1150), which contains: 119.37mMol / L NaCl, 4.78mMol / L KCl, 1.19mMol / L KH2PO4, 1.19mMol / L MgSO4·7H2O, 5.56mMol / L glucose, 1.71mMol / L CaCl2·2H2O, 25.07mMol / L NaHCO3, 0.5mMol / L sodium pyruvate, 0.025g / L gentamicin sulfate, 3.98g / sodium lactate (60% syryp), and 0.0002mMol / L phenol red.

[0157] Obtaining blastocyst-stage embryos

[0158] In some embodiments, the fertilized eggs obtained above are developed in vitro to the blastocyst stage.

[0159] Various mouse embryonic development classification criteria are known in the art, for example, the widely used one is the Theiler criteria.

[0160] The formation of a blastocyst is the result of cleavage, with the blastomeres forming a hollow, spherical embryo called a blastocyst. This stage of the embryo is called the blastocyst stage. The blastocyst stage typically occurs 70 to 120 hours after fertilization (with no significant differences between strains). Blastocyst stage criteria include the presence of an intact inner cell mass and extraembryonic trophoblast.

[0161] In some embodiments, under appropriate conditions, the fertilized egg and the cleavage culture medium are contacted for 40 to 54 hours (e.g., 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or a range between any two of the aforementioned values; preferably 48 ± 2 hours) to obtain an 8-cell stage embryo. As a non-limiting example, appropriate culture conditions are temperature (30 to 40, 35 to 38, preferably 37 ± 1°C); carbon dioxide content (3-10%, 4%-7%, preferably 5%). As another non-limiting example, appropriate culture conditions are the conditions recommended by the cleavage culture medium manufacturer.

[0162] In some embodiments, the cleavage culture medium comprises any one or a combination selected from the group consisting of: hyaluronic acid, human serum albumin, gentamicin, and a bicarbonate buffer system.

[0163] In some specific embodiments, commercially available cleavage culture media may also be used, such as, but not limited to, cleavage embryo culture medium (Cook, Cat. No.: K-SICM-20).

[0164] In other specific embodiments, commercially available cleavage culture media can also be used, for example, containing: alanine, alanyl-glutamine, asparagine, aspartic acid, calcium chloride, ethylenediaminetetraacetic acid, glucose, glutamic acid, glycine, hyaluronic acid, magnesium sulfate, penicillin, potassium chloride, proline, serine, sodium bicarbonate, sodium chloride, sodium dihydrogen phosphate, sodium lactate, sodium pyruvate, taurine, and water for injection; pH: 7.30±0.10, osmotic pressure: 261±5mOsm / kg.

[0165] In some embodiments, under appropriate conditions, the 8-cell stage embryo is contacted with the blastocyst culture medium for 20 to 28 hours (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, or a range between any two of the foregoing values; preferably 24 ± 2 hours) to obtain a blastocyst stage embryo. As a non-limiting example, the appropriate culture conditions are temperature (30 to 40, 35 to 38, preferably 37 ± 1°C); carbon dioxide content (3-10%, 4%-7%, preferably 5%). As another non-limiting example, the appropriate culture conditions are the conditions recommended by the blastocyst culture medium manufacturer.

[0166] In some embodiments, the blastocyst culture medium comprises any one or a combination selected from the group consisting of: hyaluronic acid, human serum albumin, gentamicin, and a bicarbonate buffer system.

[0167] In some specific embodiments, commercially available blastocyst culture media may also be used, such as but not limited to blastocyst culture medium (Cook, Cat. No.: K-SIBM-20).

[0168] In some specific embodiments, commercially available blastocyst culture medium can also be used, for example, it contains: sodium chloride, potassium chloride, magnesium sulfate, potassium dihydrogen phosphate, magnesium chloride, sodium bicarbonate, sodium pyruvate, L-arginine·HCl, L-lysine·HCl, L-threonine, L-valine, L-leucine, L-phenylalanine, L-tryptophan, L-cystine·2HCl, L-histidine·HCl·H20, L-isoleucine, L-methionine, L-tyrosine, L-calcium lactate, D-glucose, alanylglutamine, L-taurine, glycine, D-calcium pantothenate, gentamicin sulfate, human serum albumin, L-alanine, L-proline, L-serine, L-asparagine·H2O, L-aspartic acid, L-glutamic acid, and purified water.

[0169] In some embodiments, embryos are optionally examined during the period from fertilization to the blastocyst stage (eg, but not limited to, the 2-cell stage, the 4-cell stage, the 8-cell stage) to eliminate abnormalities.

[0170] Embryo implantation

[0171] In some embodiments, blastocyst-stage embryos are transferred into the uterus of surrogate mice and cultured until short-telomere mice are produced.

[0172] In some embodiments, blastocyst-stage embryos are transferred into the uterus of surrogate mice at a ratio of 15 blastocysts per embryo.

[0173] In some embodiments, the surrogate mouse is 6 to 10 weeks old, preferably 8 weeks old. In some specific embodiments, the surrogate mouse (such as ICR) is 8 weeks old. The skilled person knows that as the strain changes, the skilled person can determine the equivalent age.

[0174] Telomere restoration mouse model

[0175] In some embodiments, a telomere restoration mouse model is provided, which is produced by the aforementioned method.

[0176] In some embodiments, the telomere length in tissues of the telomere-restored mouse model is statistically significantly longer or no different compared to positive control mice, and the telomere length in tissues of the telomere-restored mouse model is statistically significantly longer compared to negative control mice.

[0177] In some embodiments, longer means that the telomere length is extended by at least 10% relative to a control to which the disclosed methods are not administered, and may include but is not limited to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a range between any two of the foregoing values.

[0178] In other embodiments, longer means that there is a statistically significant difference in the degree of extension of telomere length relative to a control to which the disclosed method is not applied, with p being set to, for example, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, or even lower. For example, based on the measured values ​​of two individuals (or groups), when the resulting p value is less than a specific p value level, it is considered that there is a statistically significant difference between the two individuals (or groups). Specifically, there is a statistically significant difference in the telomere length of the telomere restoration mouse model and the telomere length of the control mice at a specific p value level.

[0179] In some embodiments, telomere length is determined by methods known in the art, such as, but not limited to, telomere terminal restriction fragment analysis (TRF), quantitative PCR (qPCR), quantitative fluorescence in situ hybridization (Q-FISH), flow cytometry and flow fluorescence in situ hybridization (Flow FISH), single telomere length analysis (STELA), and telomere length analysis based on whole genome sequencing; preferably, quantitative PCR.

[0180] In some embodiments, the telomeres are from any one or a combination of tissues selected from the group consisting of peripheral blood, heart, liver, and brain.

[0181] In some embodiments, the control mouse and the telomere-restored mouse are of the same strain.

[0182] In some embodiments, the method for producing positive control mice differs only in that enzyme-free water is injected into fertilized eggs instead of TERT mRNA, and the embryos are implanted into surrogate females before the blastocyst stage (e.g., at the cleavage stage). The method for producing negative control mice differs only in that enzyme-free water is injected into fertilized eggs instead of TERT mRNA.

[0183] use

[0184] According to some embodiments, use of the disclosed telomere restoration mouse protocol in telomere research or aging research is provided.

[0185] According to other embodiments, there is provided use of the disclosed telomere restoration mouse operation protocol in research related to optimization strategies for clinical assisted reproductive technology.

[0186] It should be understood that the numbering of the aforementioned steps is not intended to limit a specific order of arrangement, but is only used to distinguish different steps.

[0187] "Optionally" means that the features or steps following this term may or may not be present.

[0188] It should be understood that when a numerical range is mentioned herein, for example, "A to B" is a concise way of writing, although not every point value in the range is given, it is deemed that the integers and decimals in the range have been clearly disclosed in the text.

[0189] Example 1. Construction of a telomere restoration mouse model

[0190] This embodiment provides a method for constructing an animal model for restoring telomere length by blastocyst transplantation. The operation process is shown in FIG1 :

[0191] 1. Material Preparation

[0192] The TERT gene coding sequence (CDS) (ENSMUSG00000021611:ENSMUST00000022104.9, the specific sequence is shown in SEQ ID NO. 5) was downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The TERT CDS was inserted into the pcDNA3.1 plasmid vector through the HindIII and EcoRI restriction sites. The enzyme digestion reaction system was 5 μL buffer (rCutSmart TM Buffer, manufacturer: NEB, catalog number: B6004), 1 μL HindIII enzyme (HindIII-HF, manufacturer: NEB, catalog number: R3104), 1 μL EcoRI enzyme (EcoRI-HF, manufacturer: NEB, catalog number: R3101), 3 ug plasmid template (pcDNA3.1), ddH2O to 50 μL, react at 37°C for 3 hours. The product was subjected to the next ligation reaction. The reaction system: 50 ng enzyme digestion system reaction product, 137 ng TERT CDS DNA, 2 μL buffer (T4 DNA Ligase Reaction Buffer, manufacturer: NEB, catalog number: B0202S), 1 μL T4 ligase (T4 DNA Ligase, manufacturer: NEB, catalog number: M0202), ddH2O to 20 μL. Use a conventional commercial in vitro transcription kit (e.g., mMESSAGE mMACHINE TMThe plasmid obtained from the ligation reaction was in vitro transcribed using the T7 ULTRA kit (Thermo Fisher, Catalog No. AM1345) to produce TERT gene mRNA. Dilute to 25 ng / μL in nuclease-free water for later use.

[0193] Donor male mice (ICR strain, 8-12 weeks old) were housed individually in a single cage for one week before sperm collection. 30 minutes before sperm collection:

[0194] - In a sperm capacitation dish: prepare two 100 μl droplets of conventional commercial sperm capacitation solution (e.g., TYH sperm capacitation solution, manufacturer: Aibei Biotechnology, product number: M2050) and cover with mineral oil;

[0195] - On the IVF dish: prepare 100 μl droplets of conventional commercial IVF solution (e.g. HTF fertilization solution, manufacturer: Aibei Biotechnology, product number: M1150), cover with mineral oil, and place in a 37°C, 5% CO2 incubator for equilibrium.

[0196] 2. Sperm Collection and Sperm Processing

[0197] Male mice aged 8-12 weeks were killed by cervical dislocation, the abdominal cavity was opened, the tail of the epididymis was taken out and placed on sterile filter paper to remove blood, fat and other impurities, and the surface of the tail of the epididymis was blotted dry.

[0198] Place the cauda epididymis into a droplet of capacitation solution in a sperm capacitation dish and squeeze out the sperm paste. Transfer the sperm paste to another droplet of capacitation solution. Place the sperm capacitation dish in an incubator at 37°C and 5% CO2 for 1 hour to capamate the sperm.

[0199] 3. Egg Preparation

[0200] 4-5 week old female mice (same strain) were superovulated and intraperitoneally injected with 5 IU of pregnant mare serum gonadotropin (PMSG). Forty-eight hours after PMSG injection, 5 IU of human chorionic gonadotropin (HCG) were injected. 15 hours after HCG injection, the female mice were sacrificed by cervical dislocation, the abdominal cavity was opened, and the oviducts were removed and placed in mineral oil in an IVF dish. The oviduct magnum was slit and squeezed on both sides to completely release the cumulus ovarian-oocyte complexes (COCs) into the mineral oil. Using ophthalmic forceps, the COCs were introduced into a 100 μl droplet of fertilization solution and placed in an incubator for sperm capacitation at 37°C and 5% CO2.

[0201] 4. In vitro fertilization

[0202] Aspirate 1-3 μl of sperm suspension from the outer edge of the sperm capacitation solution droplet and inject it into the fertilization solution droplet containing COCs. Place the IVF dish in an incubator for approximately 6 hours at 37°C and 5% carbon dioxide.

[0203] 5. Injection of TERT mRNA

[0204] TERT mRNA at a dose of 25 ng / μL was injected into the fertilized egg under a microscope using a pronuclear injection instrument using a micro-automatic injection device (brand: Eppendorf, model: FemtoJet 4i). The injection volume of TERT mRNA solution was 2 pL per fertilized egg.

[0205] 6. Embryo culture and transplantation

[0206] Prepare pseudopregnant surrogate female mice for in vitro fertilization.

[0207] Prepare a cleavage embryo culture dish, cover it with mineral oil, add 100 μl of conventional commercial cleavage embryo culture medium (such as cleavage culture medium, manufacturer: Cook, product number: K-SICM-20), and place it in an incubator for 6 hours in advance.

[0208] Six hours after in vitro fertilization, the fertilized eggs were washed three times with IVF solution. After washing, the male and female pronuclei were observed, and unfertilized eggs were removed. The fertilized eggs were then transferred to cleavage embryo culture medium. The cleavage embryo culture dish was placed in an incubator at 37°C and 5% carbon dioxide. After approximately 24 hours of incubation, the embryos were observed and developmentally arrested embryos were removed.

[0209] After retaining embryos that have developed normally to the 2-cell stage and continuing to culture for about 24 hours, prepare blastocyst culture dishes, cover with 100 μl of conventional commercial blastocyst culture medium (e.g., blastocyst culture medium, manufacturer: Cook, product number: K-SIBM-20), and mineral oil, place in an incubator for 6 hours in advance to equilibrate, observe the development of the embryos, remove developmentally arrested embryos, select embryos that have developed normally to the 8-cell stage, transfer them to the blastocyst culture medium, and place them in the incubator.

[0210] After about 24 hours of culture, the embryonic development was observed, developmentally arrested embryos were removed, and embryos that developed normally to the blastocyst stage were selected and transplanted into the uterus of surrogate female mice (ICR strain, 8 weeks old). 15 blastocysts were transplanted into each female mouse, and each mouse was raised in a single cage until delivery to obtain offspring mice.

[0211] Example 2. Setting up the positive control group

[0212] The experiment is divided into:

[0213] Group A: The modeling method of Example 1 was used.

[0214] Group B: The difference from Group A is that nuclease-free water instead of TERT mRNA was injected into the fertilized eggs. When the fertilized eggs developed to the 2-cell stage (the method is the same as above), they were transplanted into the unilateral oviduct of surrogate female mice. Each female mouse was transplanted with 15 2-cell stage embryos, and each mouse was raised in a single cage until delivery.

[0215] Example 3. Setting up of negative control group

[0216] Group A: The modeling method of Example 1 was used.

[0217] Group C: The difference from Group A is that nuclease-free water instead of TERT mRNA was injected into the fertilized eggs. When the fertilized eggs developed to the blastocyst stage (the method is the same as above), they were transplanted into the unilateral oviduct of surrogate female mice. Each female mouse was transplanted with 15 2-cell embryos, and the mice were raised individually in single cages until delivery.

[0218] Example 4. Method for constructing a telomere restoration mouse model

[0219] The difference between this embodiment and embodiment 1 is that:

[0220] 1. Material preparation: TERT gene mRNA, diluted to 10 ng / μL with nuclease-free water;

[0221] 2. Sperm collection and processing: Place the sperm capacitation dish in an incubator for 0.5 hours to capamate the sperm. The incubation conditions are 35°C and 4% carbon dioxide.

[0222] 4. During IVF: 1-3 μl of sperm suspension is drawn from the outer edge of the sperm capacitation solution droplet and injected into the fertilization solution droplet containing COCs. The IVF dish is placed in an incubator for approximately 4 hours at 35°C and 4% CO2.

[0223] 5. Injection of TERT mRNA:

[0224] A pronuclear injection instrument was used to inject 10 ng / μL of TERT mRNA into the fertilized eggs under a microscope. The injection volume of the TERT mRNA solution was 1 pL per fertilized egg.

[0225] 6. Embryo culture and transplantation: Transfer the fertilized egg into the cleavage embryo culture medium, and place the cleavage embryo culture dish in an incubator for culture at 35°C and 4% carbon dioxide. After about 40 hours of culture, select embryos that have developed normally to the 8-cell stage and transfer them into the blastocyst culture medium. Place the embryos in the incubator and continue to culture for 20 hours to obtain blastocyst-stage embryos.

[0226] Example 5. Setting up the positive control group

[0227] The experiment is divided into:

[0228] Group A: The modeling method of Example 4 was adopted.

[0229] Group B: The difference from Group A is that nuclease-free water instead of TERT mRNA was injected into the fertilized eggs. When the fertilized eggs developed to the 2-cell stage (the method is the same as above), they were transplanted into the unilateral oviduct of surrogate female mice. Each female mouse was transplanted with 15 2-cell stage embryos, and each mouse was raised in a single cage until delivery.

[0230] Example 6. Setting up of negative control group

[0231] Group A: The modeling method of Example 4 was adopted.

[0232] Group C: The difference from Group A is that nuclease-free water instead of TERT mRNA was injected into the fertilized eggs. When the fertilized eggs developed to the blastocyst stage (the method is the same as above), they were transplanted into the unilateral oviduct of surrogate female mice. Each female mouse was transplanted with 15 2-cell embryos, and the mice were raised individually in single cages until delivery.

[0233] Example 7. Method for constructing a telomere restoration mouse model

[0234] The difference between this embodiment and embodiment 1 is that:

[0235] 1. Material preparation: TERT gene mRNA, diluted to 50 ng / μL with nuclease-free water;

[0236] 2. Sperm collection and processing: Place the sperm capacitation dish in an incubator for 1.5 hours to capamate the sperm. The incubation conditions are 38°C and 7% carbon dioxide.

[0237] 4. During IVF: 1-3 μl of sperm suspension is drawn from the outer edge of the sperm capacitation solution droplet and injected into the fertilization solution droplet containing COCs. The IVF dish is placed in an incubator for approximately 10 hours at 38°C and 7% CO2.

[0238] 5. Injection of TERT mRNA:

[0239] A pronuclear injection instrument was used to inject 50 ng / μL of TERT mRNA into the fertilized eggs under a microscope. The injection volume of the TERT mRNA solution was 3 pL per fertilized egg.

[0240] 6. Embryo culture and transplantation: The fertilized egg is transferred into the cleavage embryo culture medium, and the cleavage embryo culture dish is placed in the incubator for culture at 38°C and 7% carbon dioxide. After about 54 hours of culture, the embryos that have developed normally to the 8-cell stage are selected and transferred into the blastocyst culture medium. The embryos are placed in the incubator and cultured for another 28 hours to obtain blastocyst-stage embryos.

[0241] Example 8. Setting up a positive control group

[0242] The experiment is divided into:

[0243] Group A: The modeling method of Example 5 was adopted.

[0244] Group B: The difference from Group A is that nuclease-free water instead of TERT mRNA was injected into the fertilized eggs. When the fertilized eggs developed to the 2-cell stage (the method is the same as above), they were transplanted into the unilateral oviduct of surrogate female mice. Each female mouse was transplanted with 15 2-cell stage embryos, and each mouse was raised in a single cage until delivery.

[0245] Example 9. Setting up of negative control group

[0246] Group A: The modeling method of Example 5 was adopted.

[0247] Group C: The difference from Group A is that nuclease-free water instead of TERT mRNA was injected into the fertilized eggs. When the fertilized eggs developed to the blastocyst stage (the method is the same as above), they were transplanted into the unilateral oviduct of surrogate female mice. Each female mouse was transplanted with 15 2-cell embryos, and the mice were raised individually in single cages until delivery.

[0248] Experimental Example 1. Telomere Length Test

[0249] 1. On the day after delivery, some mice in Groups A (telomere restoration mice) and B (positive control mice) of Example 2 were decapitated and dissected to obtain peripheral blood, liver, brain, and heart tissues. DNA was extracted and the relative telomere length (RTL) of each tissue was detected using qPCR.

[0250] The detection method is to amplify the DNA template using two pairs of primers:

[0251] Tel-F primer sequence:

[0252] 5'cggtttgtttgggtttgggtttgggtttgggtttgggtt3' (300nM) (SEQ ID No. 1);

[0253] Tel-R primer sequence:

[0254] 5'ggcttgccttacccttacccttacccttacccttaccct3' (300nM) (SEQ ID No. 2);

[0255] Reaction conditions: 95°C for 10 min; 30 cycles of 95°C for 15 s, then 56°C for 1 min. A single reaction consisted of 5 μl of ChamQSYBR qPCR MasterMix (Vazyme, Cat. No. Q331-02), F and R primers (concentrations as described above), 20 ng of DNA template, and ddH2O to a final volume of 10 μl.

[0256] 36B4-F primer sequence:

[0257] 5'gttggggagttggactatggac3' (300nM) (SEQ ID No. 3);

[0258] 36B4-R primer sequence:

[0259] 5'tgaactgattggacacacaca3' (500nM) (SEQ ID No. 4);

[0260] Reaction conditions: 95°C for 10 min; 35 cycles of 95°C for 15 s, 52°C for 20 s, and 72°C for 30 s. A single reaction consisted of 5 μl of ChamQSYBR qPCR MasterMix, primers F and R (concentrations as described above), 20 ng of DNA template, and ddH2O to a final volume of 10 μl.

[0261] 3. Calculate the sample RTL based on the CT values ​​of the two reactions of the sample. The calculation method is:

[0262] in:

[0263] RTL indicates relative telomere length;

[0264] CT Tel Indicates: the number of cycles experienced when the telomere amplification reaction reaches the set threshold;

[0265] CT 36B4 Indicates: the number of cycles experienced when the 36B4 gene amplification reaction reaches the set threshold.

[0266] 4. Statistical analysis was performed using specialized statistical analysis software (Rv4.0.2):

[0267] (1) Data standardization: The relative telomere lengths of different groups were standardized using the mean of one group to ensure comparability between data.

[0268] (2) Telomere lengths among the groups were compared using the Student's t-test. The statistical significance level was set at 0.05, and all statistical tests were two-sided.

[0269] 5. The results showed that on the first day after birth, the telomere lengths of four different tissues, including peripheral blood, liver, brain, and heart, in Group A mice were either not significantly different from those in Group B or were significantly longer than those in Group B. These results demonstrate that the method of Example 1 successfully restored the telomere shortening caused by blastocyst transfer (Figures 2 to 5).

[0270] 6. Summary:

[0271] The advantages of the telomere restoration mouse model constructed in this application are:

[0272] (1) The telomere restoration mouse model constructed in this disclosure is simple to create, has a short modeling cycle, and does not require gene editing. By injecting TERT mRNA into the fertilized egg, the telomere extension process under the action of telomerase is enhanced, resulting in the restoration of telomere length. Therefore, this application discloses an important mouse model construction method for exploring the mechanism of telomere restoration and telomere-related phenotypes such as aging.

[0273] (2) The telomere restoration effect disclosed herein is stable and reliable, and the telomere lengths of the peripheral blood, liver, brain, and heart tissues of the constructed model mice are significantly restored (Figures 2 to 5).

[0274] (3) The disclosed method for restoring telomeres in blastocyst-stage transplanted mice can be used in research related to optimizing protocols for human assisted reproductive procedures.

[0275] Experimental Example 2. Telomere Length Test

[0276] 1. On the day after delivery, peripheral blood, liver, brain, and heart were collected from mice in Groups A (telomere restoration mice) and C (negative control mice) of Example 3, and DNA was extracted. RTL was detected using qPCR. The detection method was the same as in Experimental Example 1.

[0277] 2. The RTL calculation method is the same as that in Test Example 1.

[0278] 3. The statistical analysis method is the same as that of Test Example 1.

[0279] 4. The results showed that on the first day after birth, the telomere lengths in the peripheral blood, liver, brain, and heart of mice in Group A were significantly longer than those in Group C. These results indicate that the telomere restoration effect achieved in Example 1 was indeed derived from the injected TERT RNA, which successfully restored the telomere length of blastocyst-stage transplanted mice (Figures 2 to 5).

[0280] Experimental Example 3. Telomere Length Test

[0281] 1. On the day after delivery, peripheral blood, liver, brain, and heart were collected from mice in Groups A (telomere restoration mice), B (positive control mice), and C (negative control mice) of Examples 5 and 6, and DNA was extracted. RTL was detected using qPCR. The detection method was the same as in Experimental Example 1.

[0282] 2. The RTL calculation method is the same as that in Test Example 1.

[0283] 3. The statistical analysis method is the same as that of Test Example 1.

[0284] 4. The results showed that on the first day after birth, there were no significant differences in telomere length in the peripheral blood, liver, brain, and heart of mice in Group A compared with those in Groups B and C. These results suggest that the procedure of Example 4 partially restored the telomere shortening caused by blastocyst transfer, but the effect was not as good as that of Example 1 (Figures 6 to 9).

[0285] Experimental Example 4. Telomere Length Test

[0286] 1. On the day after delivery, peripheral blood, liver, brain, and heart were collected from mice in Groups A (telomere restoration mice), B (positive control mice), and C (negative control mice) of Examples 8 and 9, and DNA was extracted. RTL was detected using qPCR. The detection method was the same as in Experimental Example 1.

[0287] 2. The RTL calculation method is the same as that in Test Example 1.

[0288] 3. The statistical analysis method is the same as that of Test Example 1.

[0289] 4. The results showed that on the first day after birth, there were no significant differences in telomere length in the peripheral blood, liver, brain, and heart of mice in Group A compared with those in Group B. Telomere length in the peripheral blood, brain, and heart of mice in Group A was significantly longer than that in mice in Group C. These results indicate that the procedure in Example 7 successfully restored telomere shortening caused by blastocyst transfer, but the effect was slightly inferior to that in Example 1 ( Figures 10 to 13 ).

[0290] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. Use of TERT mRNA in the preparation of a product for restoring telomere length in animals or humans.

2. The use according to claim 1, characterized in that The restoration of the telomere length of the animal or human comprises the restoration of the telomere length of the newborn offspring of the animal or human transplanted at the blastocyst stage; And / or, the concentration of the TERT mRNA is 10 ng / μL-50 ng / μL; preferably, 25 ng / μL; and / or, injection of TERT mRNA during the fertilized egg stage; And / or, the product is a medicine.

3. A method for constructing an animal model for restoring telomere length by blastocyst stage transplantation, characterized in that: The steps include: A fertilized egg of a non-human animal is obtained by in vitro fertilization, and then a TERT mRNA solution is injected into the fertilized egg. After the fertilized egg is cultured in vitro to the blastocyst stage, the obtained blastocyst stage embryo is implanted into a non-human surrogate female animal to produce offspring.

4. The construction method according to claim 3, characterized in that: The concentration of the TERT mRNA solution is 10-50 ng / μL; preferably, the concentration of the TERT mRNA solution is 25 ng / μL; And / or, the TERT mRNA injection tool uses a micro automatic injection instrument; And / or, the injection volume of the TERT mRNA solution is 1-3 pL / each fertilized egg; preferably, the injection volume of the TERT mRNA solution is 2 pL / each fertilized egg; And / or, the blastocyst stage refers to: 70 to 120 hours after fertilization; preferably, 72±2 hours.

5. The construction method according to claim 3 or 4, characterized in that: The steps include: 1) Obtain TERT mRNA and dilute to the desired concentration using nuclease-free water; 2) obtaining sperm from a non-human male animal, and contacting the sperm with a capacitation medium to obtain capacitation sperm; 3) obtaining cumulus-oocyte complexes from non-human female animals; 4) contacting the capacitated sperm obtained in step 2) with the cumulus-oocyte complex in vitro to obtain a fertilized egg; 5) microinjecting the fertilized eggs obtained in step 4) with TERT mRNA obtained in step 1); 6) allowing the fertilized egg obtained in step 5) to develop in vitro to the blastocyst stage; 7) implanting the blastocyst-stage embryo into a non-human surrogate female animal and producing offspring; Optionally, the non-human animal is SPF grade; The order of step 2) and step 3) can be interchanged or performed in parallel.

6. The construction method according to any one of claims 3 to 5, characterized in that: The non-human animal is a rodent; Optionally, the non-human animal is a mouse (Mus musculus); Optionally, the mouse is selected from any of the following strains: ICR, A / He, A / J, A / SnSf, A / WySN, AKR, AKR / A, AKR / J, AKR / N, BALB / c, B6SJLF1, B6C3F1, B6D2F1, C3H, C3He, C3Hf, C57BR, C57L, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57 BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, C58, CBA / Br, CBA / Ca, CBA / J, C BA / st, CBA / H, CB6F1, CD2F1, CFW, DBA / 1, DBA / 2, FACA, FVB, KM, NIH, NIH(S), RF, SJL, SWR, TA1, TA2, or 129; Optionally, the male mice are 8 to 20 weeks old; preferably, 8 to 12 weeks old; Optionally, the female mouse is an adolescent female mouse, which is 3 to 12 weeks old; preferably, 4 to 5 weeks old; Optionally, the female surrogate mouse is 6 to 10 weeks old; preferably, 8 weeks old.

7. The construction method according to any one of claims 3 to 6, characterized in that: In step 2): The sperm and the capacitation medium are contacted at 35° C. to 38° C. and a carbon dioxide content of 4% to 7% for 0.5 to 1.5 hours; optionally, the sperm and the capacitation medium are contacted at 37° C.±1° C. and a carbon dioxide content of 5% for 1 hour; optionally, the capacitation medium comprises any one or a combination thereof selected from the following: sodium salt, potassium salt, calcium salt, magnesium salt, glucose, β-cyclodextrin or polyvinyl alcohol; and / or, in step 4): The capacitated sperm and the cumulus-oocyte complex are contacted in an in vitro fertilization medium at 35°C to 38°C and a carbon dioxide content of 4%-7% for 4-10 hours; optionally, they are contacted in an in vitro fertilization medium for 5.5-6.5 hours; optionally, the capacitated sperm and the cumulus-oocyte complex are contacted in an in vitro fertilization medium for 5.5-6.5 hours at 37°C±1°C and a carbon dioxide content of 5%; optionally, the in vitro fertilization medium contains any one or a combination thereof selected from the following: reduced glutathione, electrolytes, a carbon source or a nitrogen source; and / or, in step 1): Obtain the TERT gene coding sequence CDS, insert the TERT coding sequence CDS into a plasmid vector, and perform in vitro transcription on the plasmid to obtain TERT gene mRNA; optionally, use HindIII and EcoRI restriction sites to insert the TERT coding sequence CDS into a pcDNA3.1 plasmid vector; optionally, use mMESSAGE mMACHINE TM T7 ULTRA kit for in vitro transcription; and / or, in step 6): The fertilized egg and the cleavage culture medium are contacted for 40 to 54 hours at 35° C. to 38° C. and a carbon dioxide content of 4% to 7% to obtain an embryo at the 8-cell stage; alternatively, the fertilized egg and the cleavage culture medium are contacted for 48±2 hours at 37° C.±1° C. and a carbon dioxide content of 5% to obtain an embryo at the 8-cell stage; The 8-cell stage embryo is contacted with blastocyst culture medium at 35°C to 38°C and a carbon dioxide content of 4%-7% for 20 to 28 hours to obtain a blastocyst stage embryo; optionally, the 8-cell stage embryo is contacted with blastocyst culture medium at 37°C±1°C and a carbon dioxide content of 5% for 24±2 hours to obtain a blastocyst stage embryo.

8. The construction method according to any one of claims 3 to 7, characterized in that: The telomere length in the tissue of the animal model is statistically significantly longer than that in the negative control non-human animal; the telomere length in the tissue of the animal model is statistically insignificant or significantly longer than that in the positive control non-human animal; Optionally, the tissue is selected from any one or a combination of the following: peripheral blood, heart, liver or brain; Optionally, the negative control non-human animal, the positive control non-human animal and the animal model are of the same strain; Optionally, the negative control non-human animal refers to the offspring produced by implanting an embryo into a non-human surrogate female animal at the blastocyst stage after injecting sterile water into the fertilized egg; the positive control non-human animal refers to the offspring produced by implanting an embryo into a non-human surrogate female animal before the blastocyst stage after injecting sterile water into the fertilized egg; More optionally, the positive control non-human animal refers to the offspring produced by injecting sterile water into the fertilized egg and then implanting the embryo into a non-human surrogate female animal during the cleavage stage.

9. An animal model for restoring telomere length by blastocyst stage transplantation constructed by the construction method according to any one of claims 3 to 8.

10. Use of the animal model for restoring telomere length by blastocyst stage transplantation as claimed in claim 9 in telomere research or aging research or research related to optimization of human clinical assisted reproductive technology operation methods.

Images