Method for producing l-arginine using recombinant escherichia coli, and recombinant bacterium used therein

Abstract

A method for producing L-arginine using a recombinant Escherichia coli, and a recombinant bacterium used therein. Specifically, the present invention relates to a method for producing L-arginine using a recombinant Escherichia coli, and a recombinant bacterium used therein. The recombinant Escherichia coli is a recombinant bacterium obtained by means of over-expressing a gene encoding a cyanate transporter in a receptor Escherichia coli, or a recombinant bacterium obtained by means of over-expressing a gene encoding a carbonic anhydrase in a receptor Escherichia coli. The cyanate transporter is a protein having an amino acid sequence of SEQ ID NO: 4, and the carbonic anhydrase is a protein having an amino acid sequence of SEQ ID NO: 5. By means of regulating the expression of the cyanate transporter or carbonic anhydrase, the yield of arginine is significantly improved. The method provides a new line of thought for the synthesis of bio-based L-arginine, and has wide application space and market prospects.

Description

Method for producing L-arginine using recombinant Escherichia coli and recombinant bacteria used therein

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202310879981.0, filed with the Patent Office of China on July 18, 2023, entitled “Method for producing L-arginine using Escherichia coli with overexpressed cynX gene and recombinant bacteria used therein” and Chinese patent application No. 202310879978.9, filed with the Patent Office of China on July 18, 2023, entitled “Method for producing L-arginine using Escherichia coli with overexpressed cynT gene and recombinant bacteria used therein”, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of genetic engineering technology, and in particular relates to a method for producing L-arginine by utilizing recombinant Escherichia coli and the recombinant bacteria used therein. Background Art

[0004] L-arginine has a wide range of uses in medicine, industry, food, cosmetics, animal husbandry and other fields, and has important economic and social value.

[0005] Currently, L-arginine production methods primarily include microbial fermentation and protein hydrolysis. Compared to protein hydrolysis, microbial fermentation offers advantages such as a wider range of raw material sources, a relatively simple production process, relatively low environmental impact, and high product purity, making it more suitable for large-scale industrial production.

[0006] Breeding efficient strains capable of producing L-arginine is key to the industrial application of microbial fermentation. Currently, there are two main methods for breeding L-amino acid-producing strains: 1) Irrational mutagenesis screening: This method primarily uses physical or chemical methods to mutagenize wild-type chassis microorganisms, combined with L-arginine structural analog resistance screening methods, to breed mutagenized strains with antagonistic effects on L-arginine. After multiple rounds of mutagenesis, superior production strains capable of L-arginine synthesis are ultimately selected; 2) Rational metabolic engineering: This method primarily utilizes efficient gene editing technologies to systematically metabolically engineer the L-arginine synthesis network in chassis microorganisms to maximize the redirection of carbon metabolic flux to the L-arginine synthesis pathway. This includes blocking the L-arginine degradation pathway, removing the feedback inhibition regulatory mechanism of key enzymes in the synthesis pathway, enhancing the supply of the precursor carbamyl phosphate, optimizing the balance of coenzyme supply in chassis cells, and modifying the L-arginine transmembrane transport system. With the rapid development of genetic engineering technology, the method of rational metabolic engineering to construct efficient L-arginine production strains has gradually replaced the mutagenesis screening breeding method and become the mainstream method for breeding efficient and stable L-arginine production strains.

[0007] Improving the L-arginine production performance of chassis microorganisms is a continuous goal of rational metabolic engineering breeding. In the process of systematically reconstructing the metabolic network of chassis microorganisms, increasing or decreasing the expression intensity of target genes is a common strategy to improve L-arginine production performance. For example, reducing the expression of one or more genes for L-arginine degradation, one or more genes in the competitive pathway for L-arginine synthesis, and genes involved in carbon and nitrogen flux redistribution significantly promotes L-arginine synthesis. In addition, increasing the expression of key enzymes in the L-arginine synthesis pathway, increasing the expression of membrane proteins that efflux the target product, and increasing the expression of key enzymes in the synthesis pathway of the target product precursor also has significant beneficial effects on improving L-arginine synthesis in chassis microorganisms.

[0008] The cynX gene encodes a cyanate transporter. The effect of increased cynX gene expression on L-arginine production has not been studied. In particular, there are currently no reports on L-arginine production using Enterobacteriaceae bacteria that overexpress the cynX gene.

[0009] The cynT gene encodes carbonic anhydrase, which catalyzes the reaction of CO₂ and H₂O to produce H₂CO₃. The effect of increased cynT gene expression on L-arginine production has not been studied. Specifically, there are currently no reports on L-arginine production using Escherichia coli overexpressing the cynT gene.

[0010] Invention Disclosure

[0011] The problem to be solved by the present invention is how to improve the L-arginine production capacity of microorganisms.

[0012] In order to solve the above problems, the present invention provides a recombinant Enterobacter.

[0013] The recombinant Enterobacter provided by the present invention is a recombinant Enterobacter A or a recombinant Enterobacter B. The recombinant Enterobacter A is a recombinant bacterium obtained by overexpressing a cyanate transporter encoding gene in the recipient Enterobacter; and the recombinant Enterobacter B is a recombinant bacterium obtained by overexpressing a carbonic anhydrase encoding gene in the recipient Enterobacter.

[0014] In the above recombinant Enterobacter, the cyanate transporter gene is derived from Escherichia coli, and the carbonic anhydrase gene is derived from Escherichia coli.

[0015] In the above-mentioned recombinant Enterobacter, the cyanate transporter is any one of the following proteins:

[0016] A1) The cyanate transporter encoding gene encodes the protein whose amino acid sequence is SEQ ID No. 4;

[0017] A2) a protein having cyanate transporter activity obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of A1) and having at least 80% identity with the protein of A1);

[0018] A3) A fusion protein having cyanate transporter activity obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0019] In the above-mentioned recombinant Enterobacter, the carbonic anhydrase is any one of the following proteins:

[0020] B1) a carbonic anhydrase encoding gene encoding a protein having an amino acid sequence of SEQ ID No. 5;

[0021] B2) a protein having carbonic anhydrase activity obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of B1) and having at least 75% identity with the protein of L1);

[0022] B3) A fusion protein having carbonic anhydrase activity obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2).

[0023] The protein with the amino acid sequence SEQ ID No. 4 is cyanate transporter (abbreviated as cynX).

[0024] In a specific embodiment, the amino acid sequence of the cyanate transporter is as follows:

[0025] The protein with the amino acid sequence of SEQ ID No. 5 is carbonic anhydrase (abbreviated as cynT).

[0026] In a specific embodiment, the amino acid sequence of the carbonic anhydrase is as follows:

[0027] In the above-mentioned recombinant Enterobacter, the gene encoding the cyanate transporter may be any one of the following:

[0028] C1) a DNA molecule having a nucleotide sequence of SEQ ID No. 2;

[0029] C2) a DNA molecule having more than 80% identity with the nucleotide sequence defined in C1) and encoding the cyanate transporter;

[0030] C3) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence specified in either C1) or C2) and encodes the cyanate transporter.

[0031] In the above-mentioned recombinant Enterobacter, the carbonic anhydrase encoding gene may be any one of the following:

[0032] D1) a DNA molecule having a nucleotide sequence of SEQ ID No. 3;

[0033] D2) a DNA molecule that has more than 75% identity with the nucleotide sequence defined in D1) and encodes the carbonic anhydrase;

[0034] D3) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in either D1) or D2) and encodes the carbonic anhydrase.

[0035] Those skilled in the art can readily mutate the nucleotide sequence encoding the cyanate transporter or carbonic anhydrase of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequence of the cyanate transporter or carbonic anhydrase of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the cyanate transporter or carbonic anhydrase and have the function of the cyanate transporter or carbonic anhydrase.

[0036] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence."identity" comprises a nucleotide sequence with 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity to the nucleotide sequence of a coding cyanate transporter or carbonic anhydrase of the present invention. Identity can be evaluated with the naked eye or computer software. Using computer software, the identity between two or more sequences can be represented by percentage (%), which can be used to evaluate the identity between the related sequences.

[0037] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.

[0038] In the above-mentioned recombinant Enterobacter, the expression level of the cyanate transporter encoding gene or the carbonic anhydrase encoding gene of the recombinant Enterobacter is higher than that of the recipient Enterobacter.

[0039] In the above-mentioned recombinant Enterobacter, the overexpression of the cyanate transporter or carbonic anhydrase encoding gene in the recipient Enterobacter may be achieved by replacing the ygaY gene of the recipient Enterobacter with the cyanate transporter or carbonic anhydrase encoding gene.

[0040] The method for replacing the ygaY gene of the recipient Enterobacter with the cyanate transporter or carbonic anhydrase encoding gene comprises integrating the cyanate transporter or carbonic anhydrase encoding gene into the ygaY gene site of the recipient Enterobacter, and knocking out the ygaY gene of the recipient Enterobacter.

[0041] In the above recombinant Enterobacter, the predicted transporter ygaY gene encodes any one of the following proteins:

[0042] H1) The predicted transporter encoding gene ygaY encodes a protein with the amino acid sequence of SEQ ID No. 6;

[0043] H2) a protein obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of H1) and having at least 80% identity with the protein of H1) and having predicted transporter protein activity;

[0044] H3) A fusion protein having predicted transporter protein activity obtained by connecting a tag to the N-terminus and / or C-terminus of H1) or H2).

[0045] In a specific embodiment, the encoding amino acid sequence of ygaY is:

[0046] Herein, the ygaY gene may be any of the following:

[0047] P1) a DNA molecule having a nucleotide sequence of SEQ ID No. 7;

[0048] P2) a DNA molecule having a nucleotide sequence identity of more than 75% with the nucleotide sequence defined in P1);

[0049] P3) A DNA molecule that hybridizes to any one of the nucleotide sequences defined in P1) to P2) under stringent conditions.

[0050] In a specific embodiment, the nucleotide sequence of ygaY is: 5'-atgatcctcggtacggcattaaccggtttattctcagtcgtggcacaaattctggttccgctggcagcgacgctggc -3' (SEQ ID No. 7).

[0051] The aforementioned recombinant E. coli also contains a promoter for initiating transcription of the cyanate transporter or carbonic anhydrase encoding gene.

[0052] The promoter may be a Ptrc promoter, and the Ptrc promoter is any one of the following DNA molecules:

[0053] 1) A DNA molecule having a nucleotide sequence of one chain as SEQ ID No. 1 in the sequence listing;

[0054] 2) A DNA molecule having 80% or more identity with the DNA molecule of 1) and having promoter function.

[0055] In a specific embodiment, the nucleotide sequence of the Ptrc promoter is: 5'-TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC-3' (SEQ ID No. 1).

[0056] The recombinant Enterobacter may be a recombinant Escherichia coli, and the recombinant Enterobacter may be Escherichia coli.

[0057] The recipient Escherichia coli can be wild Escherichia coli or modified Escherichia coli.

[0058] The wild Escherichia coli may be Escherichia coli W3110.

[0059] The modified Escherichia coli may be genetically engineered bacteria E. coli W3110 (E. coli W3110 ARG10).

[0060] The recombinant Escherichia coli may be ARG-cynX and W3110-cynX, ARG-pZ8-cynX and W3110-pZ8-cynX.

[0061] The expression level of the cyanate transporter encoding gene cynX of the recombinant Escherichia coli ARG-cynX is higher than that of the receptor Escherichia coli ARG10.

[0062] The expression level of the cyanate transporter encoding gene cynX of the recombinant Escherichia coli W3110-cynX is higher than that of the recipient Escherichia coli W3110.

[0063] The expression level of the cyanate transporter encoding gene of the recombinant Escherichia coli ARG-pZ8-cynX is higher than that of the receptor Escherichia coli ARG10.

[0064] The expression level of the cyanate transporter encoding gene of the recombinant Escherichia coli W3110-pZ8-cynX is higher than that of the recipient Escherichia coli W3110.

[0065] The recombinant E. coli ARG-cynX, W3110-cynX, ARG-pZ8-cynX and W3110-pZ8-cynX do not contain the complete coding region of the predicted transporter protein encoding gene ygaY. The complete coding region of ygaY is 882 bp, and positions 215-405 of the ygaY coding region (positions 215-405 of SEQ ID No. 7) are replaced by cynX promoted by Ptrc.

[0066] The recombinant Escherichia coli may also be ARG-cynT and W3110-cynT, ARG-pZ8-cynT and W3110-pZ8-cynT.

[0067] The expression level of the carbonic anhydrase encoding gene cynT of the recombinant Escherichia coli ARG-cynT is higher than that of the recipient Escherichia coli ARG10.

[0068] The expression level of the carbonic anhydrase encoding gene cynT of the recombinant Escherichia coli W3110-cynT is higher than that of the recipient Escherichia coli W3110.

[0069] The expression level of the carbonic anhydrase encoding gene of the recombinant Escherichia coli ARG-pZ8-cynT is higher than that of the recipient Escherichia coli ARG10.

[0070] The expression level of the carbonic anhydrase encoding gene of the recombinant Escherichia coli W3110-pZ8-cynT is higher than that of the recipient Escherichia coli W3110.

[0071] The recombinant E. coli ARG-cynT and W3110-cynT, ARG-pZ8-cynT and W3110-pZ8-cynT do not contain the complete coding region of the predicted transporter protein encoding gene ygaY. The complete coding region of ygaY is 882 bp, and positions 215-405 of the ygaY coding region (positions 215-405 of SEQ ID No. 7) are replaced by cynT promoted by Ptrc.

[0072] The vector described herein refers to a vector capable of carrying exogenous DNA or target genes into host cells for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: a plasmid, a phage (such as lambda phage or M13 filamentous phage), a cosmid (i.e., a cosmid), or a viral vector.

[0073] The microorganisms described herein may be yeast, bacteria, algae, or fungi. The bacteria may be from, but are not limited to, Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., Bacillus sp., Brevibacterium sp., Corynebacterium sp., Aerobacter sp., Enterobacteria sp., Micrococcus sp., Serratia sp., Salmonella sp., Streptomyces sp., Providencia sp., and the like.

[0074] Furthermore, the bacterium may be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum or Corynebacterium pekinense.

[0075] The cell described herein can be a plant cell or an animal cell. The cell can be any biological cell that can synthesize the target amino acid.

[0076] The present invention also provides a method for constructing the above-mentioned recombinant Escherichia coli.

[0077] The present invention provides a method for constructing the aforementioned recombinant Escherichia coli, which is method A or method B:

[0078] The method A is to regulate the arginine production of the microorganism by regulating the expression of the gene encoding the cyanate transporter described above, or regulating the activity or content of the cyanate transporter, to obtain a microorganism with a changed arginine production;

[0079] The method B is to regulate the arginine production of the microorganism by regulating the expression of the gene encoding the carbonic anhydrase described above, or regulating the activity or content of the carbonic anhydrase, to obtain a microorganism with a changed arginine production.

[0080] By regulating the expression of the gene encoding the protein of the L-arginine metabolic pathway described above, or regulating the activity or content of the protein of the L-arginine metabolic pathway, the arginine production of the microorganism is regulated to obtain a microorganism with changed arginine production.

[0081] In the above method, the method for regulating the expression of the gene encoding the cyanate transporter or regulating the activity or content of the cyanate transporter may be any of the following:

[0082] M1) introducing the gene encoding the cyanate transporter into the target microorganism;

[0083] M2) introducing the gene encoding the amino acid sequence of SEQ ID No. 4 into the target microorganism;

[0084] In the above method, the method for regulating the expression of the gene encoding the carbonic anhydrase or regulating the activity or content of the carbonic anhydrase is any one of the following:

[0085] N1) introducing the gene encoding the carbonic anhydrase into the target microorganism;

[0086] N2) Introducing the gene encoding the amino acid sequence of SEQ ID No. 5 into the target microorganism.

[0087] In one embodiment, the aforementioned recombinant E. coli is constructed according to a method comprising the following steps: replacing nucleotide positions 215-405 of the ygaY gene of the recipient E. coli of SEQ ID No. 7 with the cyanate transporter or carbonic anhydrase encoding gene.

[0088] The ygaY gene encodes the predicted transporter protein YgaY.

[0089] In the above method, the gene encoding the cyanate transporter may be any one of the following:

[0090] C1) a DNA molecule having a nucleotide sequence of SEQ ID No. 2;

[0091] C2) a DNA molecule that has 75% or more identity with the nucleotide sequence defined in C1) and encodes the cyanate transporter;

[0092] C3) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence specified in any one of C1) to C2) and encodes the cyanate transporter.

[0093] In the above method, the gene encoding the carbonic anhydrase may be any one of the following:

[0094] D1) a DNA molecule having a nucleotide sequence of SEQ ID No. 3;

[0095] D2) a DNA molecule that has more than 75% identity with the nucleotide sequence defined in D1) and encodes the carbonic anhydrase;

[0096] D3) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in any one of D1) to D2) and encodes the carbonic anhydrase.

[0097] In the above method, the predicted transporter ygaY gene encodes any one of the following proteins:

[0098] H1) The predicted transporter encoding gene ygaY encodes a protein with the amino acid sequence of SEQ ID No. 6;

[0099] H2) a protein having at least 80% identity with the protein of H1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of H1);

[0100] H3) A fusion protein having predicted transporter protein activity obtained by connecting a tag to the N-terminus and / or C-terminus of H1) or H2).

[0101] The present invention also provides any of the following uses of the strain described above:

[0102] E1) Use in regulating the production of arginine in microorganisms;

[0103] E2) Use in the preparation of arginine;

[0104] E3) Use of the invention in constructing genetically engineered microorganisms producing arginine.

[0105] The present invention also provides use of the aforementioned strain in producing arginine or food, medicine and / or feed containing arginine.

[0106] The present invention also provides any of the following uses of the protein:

[0107] F1) Use in regulating the production of arginine in microorganisms;

[0108] F2) Use in the preparation of arginine;

[0109] F3) Use of genetically engineered microorganisms in the construction of arginine.

[0110] The protein may be protein A or protein B, wherein protein A is a cyanate transporter with an amino acid sequence of SEQ ID No. 4, and protein B is a carbonic anhydrase with an amino acid sequence of SEQ ID No. 5.

[0111] The present invention also provides any of the following uses of the aforementioned construction method:

[0112] E1) Use in regulating the production of arginine in microorganisms;

[0113] E2) Use in the preparation of arginine;

[0114] E3) Use of the invention in constructing genetically engineered microorganisms producing arginine.

[0115] The present invention also provides the use of the aforementioned construction method in producing arginine or food, medicine and / or feed containing arginine.

[0116] The present invention also provides a nucleic acid molecule, which is nucleic acid molecule A or nucleic acid molecule B; nucleic acid molecule A encodes the cyanate transporter in the aforementioned Enterobacter; and nucleic acid molecule B encodes the carbonic anhydrase in the aforementioned Enterobacter.

[0117] The present invention also provides an expression cassette, wherein the expression cassette is expression cassette A or expression cassette B, wherein the expression cassette A contains the nucleic acid molecule A described above, and the expression cassette B contains the nucleic acid molecule B described above.

[0118] The present invention also provides a recombinant vector, wherein the expression cassette is a recombinant vector A or a recombinant vector B, wherein the recombinant vector A contains the nucleic acid molecule A described above or contains the expression cassette described above, and the recombinant vector B contains the nucleic acid molecule B described above or contains the expression cassette described above.

[0119] The present invention also provides a whole-cell catalyst, wherein the whole-cell catalyst is a whole-cell catalyst A or a whole-cell catalyst B. The whole-cell catalyst A contains the nucleic acid molecule A described above, and the whole-cell catalyst B contains the nucleic acid molecule B described above.

[0120] The present invention also provides a method for preparing L-arginine, which comprises culturing the recombinant Escherichia coli described above to obtain a fermentation product, and obtaining L-arginine from the fermentation product.

[0121] Recombinant microorganisms or recombinant cells constructed by overexpressing cynX or cynT according to the present invention can also be used to produce a variety of products, including but not limited to lysine, glutamic acid, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine and / or citrulline.

[0122] Best Mode for Carrying Out the Invention

[0123] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0124] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0125] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0126] The pREDCas9 plasmids in the following examples are described in: Jiang W, Bikard D, Cox D, Zhang F, Marrafni LA (2013) RNA guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 31: 233–239. https: / / doi.org / 10.1038 / nbt.2508. The public can obtain this biological material from the applicant. This biological material is only used to repeat the experiments of the present invention and cannot be used for other purposes.

[0127] The shuttle expression vector pZ8 in the following examples has been recorded in: Huang Qinqin, Wang Huimei, Liang Ling, Huang Qingeng, Wu Songgang, et al. Effects of lysC site-directed mutagenesis and lysC and asdA tandem expression on L-threonine accumulation in Corynebacterium glutamicum. Biotechnology Bulletin [J]. 2019(035)002. The public can obtain the biological material from the applicant. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0128] The modified Escherichia coli W3110 ARG10 in the following examples, also known as genetically engineered E. coli W3110 ARG10, was constructed according to the method of Example 1 of CN 110964683 B.

[0129] The wild-type strain Escherichia coli W3110 in the following examples was purchased from Biolabs, catalog number BTN12-170201y.

[0130] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated an extremely significant difference.

[0131] In the following examples, primers were designed according to the principle of homologous recombination, and primer synthesis and sequencing were completed by Suzhou Jinweizhi Biotechnology Co., Ltd. The specific sequences are shown in Table 1 below.

[0132] Table 1. Primers used in the present invention

[0133] Note: The underlined nucleotide sequences are homologous sequences.

[0134] The specific information of the strains used in the present invention is shown in Table 2.

[0135] Table 2. Strains and plasmids used in the present invention

[0136] In the following examples, the slant culture medium is composed of: glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast powder 1-5 g / L, NaCl 1-2.5 g / L, agar 15-20 g / L, and the rest is water, with a pH of 7.0-7.2.

[0137] In the following examples, the seed culture medium composition is: glucose 20-40 g / L, yeast extract 2-5 g / L, peptone 2-4 g / L, K2HPO4 1-3 g / L, MgSO4·7H2O 1-2 g / L, FeSO4·7H2O 15-20 mg / L, MnSO4·7H2O 15-20 mg / L, V B1 、V B3 、V B5 、V B12 、V H 1-3 mg / L of each, the rest is water, pH 7.0-7.2.

[0138] In the following examples, the fermentation medium composition is: glucose 20-40 g / L, yeast extract 1-3 g / L, peptone 2-3 g / L, K2HPO4 3-6 g / L, MgSO4·7H2O 1-2 g / L, FeSO4·7H2O 15-20 mg / L, MnSO4·7H2O 15-20 mg / L, V B1 、V B3 、V B5 、VB12 、V H 1-3 mg / L of each, the rest is water, pH 7.0-7.2.

[0139] Unless otherwise specified, the experimental methods in the following examples are conventional methods and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions.

[0140] The detailed steps of some experimental methods in the following examples are as follows:

[0141] I. Gene Editing Methods: The method was carried out according to the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR–Cas9 meditated genome editing. Metabolic engineering, 2015, 31:13-21). The pREDCas9 plasmid carries the gRNA expression system, the Red recombination system of λ phage, and the Cas9 protein expression system, and contains spectinomycin resistance (working concentration: 100 mg / L). Cultures were incubated at 32°C. The pGRB plasmid contains the J23100 promoter, the gRNA-Cas9 binding region sequence, and the terminator sequence, and contains ampicillin resistance (working concentration: 100 mg / L). Cultures were incubated at 37°C.

[0142] The specific steps of the pGRB plasmid construction method of the present invention are as follows:

[0143] 1. Construction of pGRB Plasmid

[0144] The purpose of constructing the pGRB plasmid is to transcribe the corresponding gRNA, which then forms a complex with the Cas9 protein and recognizes the target gene site through base pairing and PAM, achieving the target DNA double-strand break. The pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment.

[0145] 1.1 Target sequence design

[0146] Design target sequence (PAM: 5'-NGG-3') using CRISPR RGEN Tools

[0147] 1.2 Preparation of DNA fragments containing target sequences

[0148] Primers were designed: 5'-linearized vector end sequence (15 bp)-restriction site-target sequence (excluding the PAM sequence)-linearized vector end sequence (15 bp)-3' and its reverse complementary primer. DNA fragments containing the target sequence were prepared by annealing single-stranded DNA. The target sequences of the present invention are as follows: 5'-CTCAACTACCCACAGTTGTT-3' (for knocking out the ygaY gene, SEQ ID No. 46), 5'-ATTTGTGGTCATTCCAACTG-3' (for knocking out the cynT gene, SEQ ID No. 47), and 5'-ACTGCTACCGCAATTGCGCC-3' (for knocking out the cynX gene, SEQ ID No. 48).

[0149] Reaction conditions: pre-denaturation at 95°C for 5 minutes; annealing at 30-50°C for 1 minute. The 20 μL annealing system is as follows:

[0150] Table 3, 20 μL annealing system

[0151] 1.3 Preparation of linear vectors

[0152] The vector was linearized by inverse PCR amplification. Plasmid pGRB was amplified with primers YPpGRBF and YPpGRBR.

[0153] 1.4 Recombination reaction

[0154] The recombinant system is shown in Table 4. All recombinant enzymes used are ClonExpress IIOne Step Cloning Kit enzymes, recombination conditions: 37°C, 30 min.

[0155] Table 4, 20 μL reconstitution system

[0156] 1.5 Plasmid transformation

[0157] Add 10 μL of the recombination reaction from step 1.4 to 100 mL of DH5α competent cells. Mix gently, then incubate on ice for 20 minutes. Heat shock at 42°C for 45-90 seconds, then immediately incubate on ice for 2-3 minutes. Add 900 μL of SOC medium and resuspend at 37°C for 1 hour. Centrifuge at 8000 rpm for 2 minutes, discard the supernatant, and resuspend the cells in approximately 200 μL of the supernatant. Spread the cells onto a plate containing 100 mg / L ampicillin, invert the plate, and incubate at 37°C overnight. Once a single colony grows on the plate, identify the positive recombinants by colony PCR.

[0158] 1.6 Clone identification

[0159] The PCR-positive colonies were inoculated into LB medium containing 100 mg / L ampicillin and cultured overnight. The plasmids were extracted and identified by enzyme digestion to obtain the recombinant plasmid pGRB-sgRNA.

[0160] The structure of the recombinant plasmid pGRB-sgRNA is described as follows: the small fragment between the homology arms 5'-GCTCAGTCCTAGGTATAATACTAGT-3' (SEQ ID No. 49) and 5'-GTTTTAGAGCTAGAAATAGCAAGT-3' (SEQ ID No. 31) of the pGRB vector is replaced with a DNA fragment containing the target sequence of 5'-CTCAACTACCCACAGTTGTT-3' (for knocking out the ygaY gene, SEQ ID No. 46) or 5'-ATTTGTGGTCATTCCAACTG-3' (for knocking out the cynT gene, SEQ ID No. 47) or 5'-ACTGCTACCGCAATTGCGCC-3' (for knocking out the cynX gene, SEQ ID No. 48), while keeping the other sequences of the pGRB vector unchanged to obtain a recombinant expression vector.

[0161] II. Transformation of pREDCas9 vector and preparation of competent strain containing pREDCas9

[0162] 1. Electroporation of pREDCas9

[0163] The pREDCas9 plasmid was electroporated into the electrocompetent cell of the starting strain. After resuscitation, the cells were plated on LB plates containing 100 mg / L spectinomycin and incubated overnight at 32°C. Single colonies growing on the resistant plates were screened for positive recombinants by colony PCR using the identification primer set pCasF / pCasR (see Table 1 for specific sequences).

[0164] 2. Preparation of competent target strain containing pREDCas9

[0165] The target strain containing pREDCas9 was cultured at 32°C until OD 600 =0.1-0.2, add 0.1M IPTG (to make the final concentration 0.1mM) and continue to culture until OD 600 Competent cells were prepared when the pH was between 0.6 and 0.7. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process required for competent cell preparation followed standard procedures.

[0166] Example 1: Application of cynX protein and its encoding gene in regulating arginine production

[0167] A. Construction of genetically engineered bacteria ARG-cynX

[0168] 1. Preparation of Recombinant DNA Fragments

[0169] The recombinant fragment used for overexpression of cynX gene consists of upstream and downstream homology arms of cynX gene (ygaY::P trc -cynX). Using primer design software primer5, the upstream and downstream sequences of the cynX gene were used as templates to design upstream and downstream homology arm primers (amplification length of about 400-800bp). The upstream primer and downstream primer of the upstream homology arm were UP-ygaY-S / UP-ygaY-A (specific sequences are shown in Table 1); the upstream primer and downstream primer sequences of cynX were cynX-S / cynX-A (specific sequences are shown in Table 1); the upstream primer and downstream primer of the downstream homology arm were DN-ygaY-S / DN-ygaY-A (specific sequences are shown in Table 1). After amplifying the upstream and downstream homology arms and the target gene fragments respectively by PCR, the recombinant fragment ygaY::P was prepared by overlapping PCR. trc -cynX. Recombinant fragment ygaY::P trc The nucleotide sequence of -cynX is Sequence 8 in the sequence listing.

[0170] The system and method of 50 μL PCR are shown in Table 5.

[0171] Table 5. PCR amplification system

[0172] The system for 50 μL overlapping PCR is shown in Table 6 below.

[0173] Table 6. Overlapping PCR amplification system

[0174] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homology arms and the target gene, and the total amount does not exceed 10 ng.

[0175] PCR reaction conditions (Bao Bio PrimeSTAR HS enzyme): pre-denaturation (95°C) for 5 min; then 30 cycles of denaturation (98°C) for 10 s, annealing ((Tm-3 / 5)°C) for 15 s, extension at 72°C (this enzyme activity extends approximately 1 kb per minute); further extension at 72°C for 10 min; hold (4°C).

[0176] 2. Preparation of Electrocompetent Cells Containing pREDCas9

[0177] For details on the preparation of electroporated competent cells containing pREDCas9, please refer to the experimental method II above.

[0178] 3. Transformation of pGRB and Recombinant DNA Fragments

[0179] The pGRB prepared in the experimental method I above and the recombinant DNA fragment obtained in step A 1 of this example were simultaneously electrotransformed into the electrocompetent cells containing pREDCas9 in step 2. The revived bacteria after electrotransformation were spread on LB plates containing ampicillin (concentration: 100 mg / L) and spectinomycin (concentration: 100 mg / L) and cultured overnight at 32°C. Colony PCR verification was performed using the specially designed identification primer set UP-ygaY-S and DN-ygaY-A (specific sequences are shown in Table 1). The strain with 2462 bp was obtained as a positive strain, and the screened positive recombinants were preserved as strains.

[0180] 4. Elimination of Plasmids

[0181] 1) Elimination of pGRB

[0182] Culture the positive recombinants obtained in step 3 overnight in LB medium containing 0.2% arabinose. Dilute appropriately and plate onto LB plates containing spectinomycin resistance. Incubate overnight at 32°C. Select individual colonies that do not grow on the ampicillin plate but grow on the spectinomycin resistance plate and save the strain.

[0183] 2) Elimination of pREDCas9 plasmid

[0184] Transfer the positive recombinants to non-resistant LB liquid medium and culture overnight at 42°C. After appropriate dilution, spread the plate onto non-resistant LB plates and culture overnight at 37°C. For each LB plate containing both spectinomycin-resistant and non-resistant strains, select the single colony that does not grow on the spectinomycin-resistant plate but grows on the non-resistant plate and save the strain.

[0185] 5.ygaY::P trc -cynX gene editing

[0186] 1) Using the Escherichia coli W3110 genome as a template, upstream homology arm primers (UP-ygaY-S, UP-ygaY-A) and downstream homology arm primers (DN-ygaY-S, DN-ygaY-A) were designed based on the upstream and downstream sequences of its ygaY gene (NCBI GeneID: 2847696). The upper homology arm fragment UP-ygaY and the lower homology arm fragment DN-ygaY were obtained.

[0187] 2) Using the Escherichia coli W3110 genome as a template, primers cynX-S and cynX-A were designed based on the upstream and downstream sequences of the cynX gene (NCBI GeneID: 948767) and the Ptrc promoter sequence to amplify the cynX gene and obtain the recombinant fragment Ptrc-cynX.

[0188] 3) The upper homology arm fragment UP-ygaY, the lower homology arm fragment DN-ygaY and the recombinant fragment Ptrc-cynX were fused by overlapping PCR to obtain ygaY::P trc -cynX (upstream homology arm-Ptrc-cynX-downstream homology arm). The upstream homology arm should be 616 bp long, the Ptrc promoter should be 74 bp long, the cynX fragment should be 1155 bp long, the downstream homology arm should be 617 bp long, and the total length of the overlapping fragments should be 2462 bp. The nucleotide sequence of the overlapping fragments is SEQ ID No. 8 in the sequence listing.

[0189]

[0190] 4) Construction of pGRB-ygaY: The DNA fragment containing the target sequence prepared by annealing primers gRNA-ygaY-S and gRNA-ygaY-A was ligated with the plasmid pGRB to construct the recombinant plasmid pGRB-ygaY.

[0191] The structure of the recombinant plasmid pGRB-ygaY is described as follows: the fragment between 5'-GCTCAGTCCTAGGTATAATACTAGT-3' (SEQ ID No. 49) and 5'-GTTTTAGAGCTAGAAATAGCAAGT-3' (SEQ ID No. 31) of pGRB is replaced with a DNA molecule with the nucleotide sequence 5'-CTCAACTACCCACAGTTGTT-3' (SEQ ID No. 46), while the other nucleotides of pGRB remain unchanged.

[0192] 5) Prepare competent cells of engineered strain ARG10 (derived from patent CN 110964683 B) and wild-type strain W3110, introduce pREDCas9 plasmid, and then culture the target strain containing pREDCas9 at 32°C until OD 600 =0.1-0.2, add 0.1M IPTG (to make the final concentration 0.1mM) and continue to culture until OD 600 Competent cells were prepared when the pH was between 0.6 and 0.7. The addition of IPTG was intended to induce expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process for competent cells followed standard procedures. For details, see Experimental Method II above.

[0193] Colony PCR verification was performed using the primer set UP-ygaY-S and DN-ygaY-A (see Table 1 for specific sequences). Strains yielding 2462 bp were positive, while those yielding 1424 bp were the original strain ARG10 and the wild-type strain W3110, which had not successfully integrated. The PCR product from colony PCR using UP-ygaY-S and DN-ygaY-A was sequenced to obtain the nucleotide sequence shown in the sequence listing as SEQ ID No. 8.

[0194] The engineered strains ARG-cynX and W3110-cynX with enhanced cynX gene expression were constructed in sequence. The first step was to construct the pGRB-cynX vector; the second step was to PCR amplify ygaY::P trc-cynX integration fragment; the third step is to prepare ARG10 and W3110 competent cells and transform pREDCas9; the fourth step is to prepare the target strain ARG10 and W3110 competent cells containing pREDCas9, transform the pGRB-cynX vector and ygaY::P trc -cynX integration fragment; Step 5: Due to the integration of ygaY::P trc The pGRB-cynX vector is removed from the target strains ARG-cynX and W3110-cynX, as they contain the pGRB-cynX vector. Step 6: The pREDCas9 vector is removed from the target strains ARG-cynX and W3110-cynX, from which the pGRB-cynX vector has been removed, to obtain engineered strains ARG-cynX and W3110-cynX that are free of pGRB-cynX and pREDCas9 vectors and have enhanced cynX gene expression. For specific steps, see steps 1 to 5 of this example.

[0195] The expression level of the cyanate transporter encoding gene cynX in the engineered strain ARG-cynX was higher than that in the recipient E. coli ARG10. The expression level of the cyanate transporter encoding gene cynX in the engineered strain W3110-cynX was higher than that in the recipient E. coli W3110.

[0196] B. Construction of genetically engineered bacteria ARG-pZ8-cynX and W3110-pZ8-cynX

[0197] The low-copy cynX recombinant expression vector pZ8-cynX was constructed using the shuttle expression vector pZ8 and introduced into the engineered strain ARG10 and the wild-type strain W3110. The tac promoter on the pZ8 vector was used to drive the expression of cynX to increase the yield of L-arginine.

[0198] 1. Construction of the recombinant expression vector pZ8-cynX

[0199] Primers cynX-pS and cynX-pA were designed based on the upstream and downstream sequences of the cynX gene (NCBI GeneID: 948767) (see Table 1 for specific sequences). Using the Escherichia coli W3110 genome as a template, the cynX gene was amplified by PCR using the cynX-pS and cynX-pA primers and purified. The nucleotide sequence of the cynX fragment obtained is shown in the sequence listing as SEQ ID No. 2. For details on the PCR system and procedure, see Step 1 in the Experimental Methods above.

[0200] After the pZ8 vector was digested and purified with EcoR I and Sal I, the above-mentioned cynX PCR purified product was recombined with the linearized pZ8 vector to obtain the recombinant vector pZ8-cynX of cynX and pZ8.

[0201] The structure of the recombinant vector pZ8-cynX is described as follows: a recombinant plasmid obtained by replacing the fragment between 5'-TGAGCGGATAACAATTTCACACAGGAAACAGAATTC-3' (SEQ ID No. 50) and 5'-TCTCATCCGCCAAAACAGAAGCTTGGCTGCAGGTCGAC-3' (SEQ ID No. 51) of pZ8 with a DNA molecule having the nucleotide sequence SEQ ID No. 2, while keeping the other nucleotides of pZ8 unchanged.

[0202] The nucleotide sequence of the cynX fragment is: 5’-atgctgctggtactggtgctgattggtcttaatatgcgaccactgctcacctccgtcgggccactgctaccgcaattgcgccaggcgagcggaatgagctttagcgtggctgccctgttgaccgctctgccggtggttaccatgggcgggctggcgctggccggaagctggcttcatcagcatgtcagcgaacgtcgcagtgtcgccatcagtctgttgctgattgccgtcggtgcattgatgcgtgagctttacccgcaaagtgcgctgctgcttagcagcgcactgcttggtggggtggggatcggcatcattcaggcggtgatgccttcggtgattaaacggcggtttcagcagcgcacgccactggtgatggggctgtggtccgcggctctgatgggcggcggtgggcttggtgccgccataacgccctggttagttcaacatagcgaaacctggtatcaaacactcgcctggtgggcgctgcctgccgttgttgcgctctttgcctggtggtggcaaagcgcccgcgaggtcgcctcttcccacaagacaacaaccactccggttcgcgtggtattcactccccgcgcgtggacgctgggtgtttacttcggtctgattaacggcggttacgccagcctgattgcctggttacccgctttctatattgagattggtgccagcgcgcagtacagcggttccttactggcattgatgacgcttgggcaagccgcaggagctttgctgatgcctgctatggctcgccatcaggatcggcgcaaactgttaatgctggcgctggtgttacaactggtggggttctgcggctttatctggctgccgatgcaattgccggtattgtgggcgatggtgtgtgggttaggtctgggcggcgcgtttccgctctgtttgctgctggcgctcgatcactctgtgcaaccggctattgctggcaagctggtggcgtttatgcagggaatcggttttatcatcgccgggcttgccccgtggttttctggcgtgctgcgtagtatcagcg gcaattacctgatggactgggcatttcatgcgctgtgcgtcgttgggctgatgatcataaccctgcgttttgcaccagtacgttttccgcagctgtgggtcaaagaggcatga-3'(SEQ ID No.2).

[0203] The recombinant vector pZ8-cynX was transformed into DH5α competent cells, and PCR amplification was performed on kanamycin-resistant plates using primers pZ8F / pZ8R (for specific sequences, see Table 1), and positive transformants were screened. For specific plasmid transformation methods, see step 1, 1.5, in the experimental method above.

[0204] The PCR product was sequenced and identified, and the positive transformant of pZ8-cynX plasmid was 1243bp, while no band was amplified by PCR in DH5α strain.

[0205] 2. Construction of engineered strains ARG-pZ8-cynX and W3110-pZ8-cynX

[0206] For details on preparing competent cells of the engineered strain ARG10 and the wild-type strain W3110, refer to Step II of the Experimental Methods above. The recombinant vector pZ8-cynX was transformed into competent cells of the starting strain ARG10 and the wild-type strain W3110, respectively. PCR amplification was performed on kanamycin-resistant plates using primers pZ8F / pZ8R (specific sequences are shown in Table 1). Positive transformants were screened to construct the engineered strains ARG-pZ8-cynX and W3110-pZ8-cynX with enhanced cynX gene expression.

[0207] Positive strains containing the pZ8-cynX plasmid should show a 1243-bp band when PCR amplification is performed on the starting strain. Recombinant E. coli ARG-pZ8-cynX containing the pZ8-cynX plasmid expressed a higher level of the cyanate transporter gene than the recipient E. coli ARG10. Recombinant E. coli W3110-pZ8-cynX containing the pZ8-cynX plasmid expressed a higher level of the cyanate transporter gene than the recipient E. coli W3110.

[0208] C. Construction of genetically engineered bacteria ARG:ΔcynX

[0209] 1. Obtaining the recombinant plasmid pGRB-cynX

[0210] 1) ΔcynX gene editing

[0211] Using the Escherichia coli W3110 genome as a template, upstream homology primers (UP-cynX-S / UP-cynX-A (for specific sequences, see Table 1)) and downstream homology primers (DN-cynX-S / DN-cynX-A (for specific sequences, see Table 1)) were designed based on the upstream and downstream sequences outside the coding region of the cynX gene (NCBI GeneID: 948767). The above fragments were fused by overlapping PCR to obtain ΔcynX (cynX upstream homology arm - downstream homology arm).

[0212] 2) Construction of pGRB-cynX

[0213] The target sequence-containing DNA fragment (nucleotide sequence: 5'-ACTGCTACCGCAATTGCGCC-3', SEQ ID No. 48) was prepared by annealing primers gRNA-cynX-S and gRNA-cynX-A (specific sequences are shown in Table 1) and ligated with plasmid pGRB to construct the recombinant plasmid pGRB-cynX.

[0214] The structure of the recombinant plasmid pGRB-cynX is described as follows: the fragment between 5'-GCTCAGTCCTAGGTATAATACTAGT-3' (SEQ ID No. 49) and 5'-GTTTTAGAGCTAGAAATAGCAAGT-3' (SEQ ID No. 31) of pGRB was replaced with a DNA molecule having the nucleotide sequence 5'-ACTGCTACCGCAATTGCGCC-3' (SEQ ID No. 48), while the other nucleotide sequences of pGRB remained unchanged.

[0215] 2. Construction of engineered strains ARG:ΔcynX and W3110:ΔcynX

[0216] For the preparation of competent cells of the engineered strain ARG10 and the wild-type strain W3110, please refer to step II in the experimental method above.

[0217] The recombinant vector pGRB-cynX and the ΔcynX fragment were transformed into competent cells of the starting strain ARG10 and the wild-type strain W3110, respectively. PCR amplification was performed on ampicillin (concentration: 100 mg / L) and spectinomycin (concentration: 100 mg / L) resistant plates with primers UP-cynX-S and DN-cynX-A (specific sequences are shown in Table 1). Positive transformants were screened, and engineered strains ARG:ΔcynX and W3110:ΔcynX with reduced cynX gene expression intensity were constructed, respectively.

[0218] The upstream homology arm should be 572 bp long, the downstream homology arm should be 527 bp long, and the total length of the overlapping fragment should be 1099 bp. During PCR verification, the PCR amplification fragment for positive bacteria should be 1099 bp long, and the PCR amplification product for the parent bacteria should be 2254 bp long. The nucleotide sequence of the ΔcynX fragment is SEQ ID No. 9 in the sequence listing.

[0219]

[0220] D. Fermentation production of L-arginine using engineered strains that overexpress the cynX gene and engineered strains that knock out the cynX gene

[0221] The strains to be tested were: ARG-cynX, ARG-pZ8-cynX, W3110-cynX, W3110-pZ8-cynX modified by overexpressing cynX gene, cynX gene knockout strain ARG:ΔcynX and starting strain ARG10 (control strain).

[0222] The fermentation steps are as follows:

[0223] 1) Slant culture: Take the -80°C stored culture and streak it onto an activated slant, culture it at 37°C for 12 hours, and subculture it once;

[0224] 2) Shake flask seed culture: Use an inoculating loop to scrape a ring of seeds from the slant surface and inoculate it into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium. Seal the flask with nine layers of gauze and incubate at 37°C, 200 rpm for 7-10 h.

[0225] 3) Shake flask fermentation: 10-15% of the volume of the seed culture was inoculated into a 500 mL Erlenmeyer flask (final volume 30 mL) filled with fermentation medium. The flask was sealed with nine layers of gauze and incubated at 37°C with shaking at 200 rpm. During fermentation, the pH was maintained at 7.0-7.2 by adding ammonia solution. 60% (m / v) glucose solution was added to maintain fermentation. The fermentation period was 26-30 h.

[0226] The strains were cultured in shake flasks, and the L-arginine concentration in the fermentation supernatant was determined according to the industry standard GB 36897-2018.

[0227] Table 7. Shake flask fermentation results of cynX engineered strains

[0228] The results are shown in Table 7. After 26-30 hours of fermentation, increasing the expression intensity of the cynX gene did not significantly affect the growth of the engineered strain ARG10. At the same time, the L-arginine concentration in ARG-cynX increased from 26.3 g / L to 29.4 g / L, and the L-arginine yield increased by 11.8%. The L-arginine concentration in ARG-pZ8-cynX increased from 26.3 g / L to 29.5 g / L, and the L-arginine yield increased by 12.2%. After reducing the expression intensity of the cynX gene, the L-arginine concentration in ARG:ΔcynX decreased from 26.3 g / L to 24.7 g / L, and the L-arginine yield decreased by 6.1%. In contrast, W3110 with enhanced cynX expression produced 0.35-0.41 g / L of L-arginine.

[0229] The results showed that enhancing the expression intensity of the cynX gene in Escherichia coli can significantly improve the L-arginine production performance of the engineered strain. Although knocking out the cynX gene did not affect the normal growth of the strain, it significantly reduced the L-arginine production performance of the engineered strain, indicating that the cynX gene has an enhancing effect on the L-arginine acid production capacity.

[0230] Example 2: Application of carbonic anhydrase (cynT) and its encoding gene in regulating arginine production

[0231] A. Preparation of Recombinant DNA Fragments

[0232] The recombinant fragment used for cynT overexpression consists of the upstream and downstream homology arms of the cynT gene (ygaY::P trc -cynT). Using primer design software primer5, the upstream and downstream sequences of the cynT gene were used as templates to design upstream and downstream homology arm primers (amplification length of about 400-800bp). The primers for the upstream homology arm were UP-ygaY-S / UP-ygaY-A (specific sequences are shown in Table 1); the primer sequences for the downstream homology arm were cynT-S / cynT-A (specific sequences are shown in Table 1); the primers for the downstream homology arm were DN-ygaY-S / DN-ygaY-A (specific sequences are shown in Table 1). After amplifying the upstream and downstream homology arms and the target gene fragments respectively by PCR, the recombinant fragment ygaY::P was prepared by overlapping PCR. trc -cynT. Recombinant fragment ygaY::P trc The nucleotide sequence of -cynT is Sequence 10 in the sequence listing.

[0233] The 50 μL PCR system and method are shown in Table 8 below.

[0234] Table 8. PCR amplification system

[0235] The system for 50 μL overlapping PCR is shown in Table 9 below.

[0236] Table 9. Overlapping PCR amplification system

[0237] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homology arms and the target gene, and the total amount does not exceed 10 ng.

[0238] PCR reaction conditions (Bao Bio PrimeSTAR HS enzyme): pre-denaturation (95°C) for 5 min; then 30 cycles of denaturation (98°C) for 10 s, annealing ((Tm-3 / 5)°C) for 15 s, extension at 72°C (this enzyme activity extends approximately 1 kb per minute); further extension at 72°C for 10 min; hold (4°C).

[0239] 2. Preparation of Electrocompetent Cells Containing pREDCas9

[0240] For details on the preparation of electroporated competent cells containing pREDCas9, please refer to the experimental method II above.

[0241] 3. Transformation of pGRB and Recombinant DNA Fragments

[0242] The pGRB prepared in the previous experimental method I and the recombinant DNA fragment obtained in step A 1 of this example were simultaneously electroporated into the electroporation competent cells containing pREDCas9 in step 2. The revived bacteria after electroporation were spread on LB plates containing ampicillin (concentration: 100 mg / L) and spectinomycin (concentration: 100 mg / L) and cultured overnight at 32°C. Colony PCR verification was performed using the specially designed identification primers UP-ygaY-S and DN-ygaY-A (specific sequences are shown in Table 1), and positive recombinants were screened and the strains were preserved.

[0243] 4. Plasmid Elimination

[0244] 1) Elimination of pGRB

[0245] Culture the positive recombinants obtained in step 3 overnight in LB medium containing 0.2% arabinose. Dilute appropriately and plate onto LB plates containing spectinomycin resistance. Incubate overnight at 32°C. Select individual colonies that do not grow on the ampicillin plate but grow on the spectinomycin resistance plate and save the strain.

[0246] 2) Elimination of pREDCas9 plasmid

[0247] Transfer the positive recombinants to non-resistant LB liquid medium and culture overnight at 42°C. After appropriate dilution, spread the plate onto non-resistant LB plates and culture overnight at 37°C. For each LB plate containing both spectinomycin-resistant and non-resistant strains, select the single colony that does not grow on the spectinomycin-resistant plate but grows on the non-resistant plate and save the strain.

[0248] 5.ygaY::P trc -cynT gene editing

[0249] 1) Using the Escherichia coli W3110 genome as a template, upstream homology arm primers (UP-ygaY-S, UP-ygaY-A) and downstream homology arm primers (DN-ygaY-S, DN-ygaY-A) were designed based on the upstream and downstream sequences of its ygaY gene (NCBI GeneID: 2847696) to obtain the upper homology arm UP-ygaY and the lower homology arm DN-ygaY.

[0250] 2) Using the Escherichia coli W3110 genome as a template, primers cynT-S and cynT-A required for amplifying the cynT gene were designed based on the upstream and downstream sequences of the cynT gene (NCBI GeneID: 946548) and the Ptrc promoter sequence to obtain recombinant fragment 3.

[0251] 3) The upper homology arm UP-ygaY and the lower homology arm DN-ygaY were fused with the recombinant fragment 3 by overlapping PCR to obtain ygaY::P trc -cynT (upstream homology arm-Ptrc-cynT-downstream homology arm). The upstream homology arm should be 616 bp long, the Ptrc promoter should be 74 bp long, the cynT fragment should be 660 bp long, the downstream homology arm should be 617 bp long, and the total length of the overlapping fragments should be 1967 bp. The nucleotide sequence of the overlapping fragments is SEQ ID No. 10 in the sequence listing.

[0252]

[0253] 4) Construction of pGRB-ygaY: The DNA fragment containing the target sequence prepared by annealing primers gRNA-ygaY-S and gRNA-ygaY-A was ligated with the plasmid pGRB to construct the recombinant plasmid pGRB-ygaY.

[0254] The structure of the recombinant plasmid pGRB-ygaY is described as follows: the fragment between 5'-GCTCAGTCCTAGGTATAATACTAGT-3' (SEQ ID No. 49) and 5'-GTTTTAGAGCTAGAAATAGCAAGT-3' (SEQ ID No. 31) of pGRB is replaced with a DNA molecule with the nucleotide sequence 5'-CTCAACTACCCACAGTTGTT-3' (SEQ ID No. 46), while the other nucleotides of pGRB remain unchanged.

[0255] 5) Prepare competent cells of the engineered strain ARG10 (derived from CN 110964683 B) and the wild-type strain W3110, as described in Experimental Method II above.

[0256] ygaY::P trc - The PCR verification of the positive strain after cynT integration should be 1967bp, and the PCR amplification of the original bacteria should be 1424bp. trc The nucleotide sequence of the -cynT fragment is SEQ ID No. 10 in the sequence listing.

[0257] The engineered strains ARG-cynT and W3110-cynT with enhanced cynT gene expression intensity were constructed in sequence.

[0258] Step 1: Construction of pGRB-cynT vector; Step 2: PCR amplification of ygaY::P trc -cynT integration fragment; Step 3: Prepare ARG10 and W3110 competent cells and transform pREDCas9; Step 4: Prepare target strains ARG10 and W3110 competent cells containing pREDCas9 and transform pGRB-cynT vector and ygaY::P trc -cynT integration fragment; Step 5: Due to the integration of ygaY::P trcThe pGRB-cynT-producing strains ARG-cynT and W3110-cynT contain the pGRB-cynT vector, so the pGRB-cynT vector is eliminated. Step 6: Eliminate the pREDCas9 vector from the target strains ARG-cynT and W3110-cynT from which the pGRB-cynT vector has been eliminated, thereby obtaining engineered strains ARG-cynT and W3110-cynT that are free of pGRB-cynT and pREDCas9 vectors and have enhanced cynT gene expression. For specific steps, see steps 1 to 5 of this example.

[0259] The expression level of carbonic anhydrase encoding gene cynT in the engineered strain ARG-cynT was higher than that in the recipient E. coli ARG10. The expression level of carbonic anhydrase encoding gene cynT in the engineered strain W3110-cynT was higher than that in the recipient E. coli W3110.

[0260] B. Construction of genetically engineered bacteria ARG-pZ8-cynT and W3110-pZ8-cynT

[0261] The shuttle expression vector pZ8 was used to construct a low-copy cynT recombinant expression vector pZ8-cynT, which was introduced into the engineered strain ARG10 and the wild-type strain W3110. The tac promoter on the pZ8 vector was used to drive the expression of cynT to increase the yield of L-arginine.

[0262] 1. Construction of the recombinant expression vector pZ8-cynT

[0263] Primers cynT-pS and cynT-pA were designed based on the upstream and downstream sequences of the cynT gene (NCBI GeneID: 946548) (see Table 1 for specific sequences). Using the E. coli W3110 genome as a template, the cynT gene was amplified by PCR using the cynT-pS and cynT-pA primers and purified. The nucleotide sequence of the cynT fragment obtained is SEQ ID No. 3 in the sequence listing. For details on the PCR system and procedure, see Step 1 in the Experimental Methods above.

[0264] After the pZ8 vector was digested and purified with EcoR I and Sal I, the above-mentioned cynT PCR purified product was recombined with the linearized pZ8 vector to obtain the recombinant vector pZ8-cynT of cynT and pZ8.

[0265] The structure of the recombinant vector pZ8-cynT is described as follows: a recombinant plasmid obtained by replacing the fragment between 5'-TGAGCGGATAACAATTTCACACAGGAAACAGAATTC-3' (SEQ ID No. 50) and 5'-TCTCATCCGCCAAAACAGAAGCTTGGCTGCAGGTCGAC-3' (SEQ ID No. 51) of pZ8 with a DNA molecule having the nucleotide sequence SEQ ID No. 3, while keeping the other nucleotides of pZ8 unchanged.

[0266] The nucleotide sequence of the cynT fragment is as follows: 5'--3' (SEQ ID No. 3).

[0267] Transform DH5α competent cells with the recombinant vector pZ8-cynT. PCR amplification was performed on kanamycin-resistant plates using primers pZ8F / pZ8R (see Table 1 for specific sequences) to screen for positive transformants. For specific plasmid transformation methods, see step 1, 1.5, in the experimental methods above.

[0268] The PCR products were sequenced and identified. The length of the PCR product of the positive transformant of the pZ8-cynT plasmid should be 748 bp. No band was amplified by PCR of the DH5α strain.

[0269] 2. Construction of engineered strains ARG-pZ8-cynT and W3110-pZ8-cynT

[0270] For details on preparing competent cells of the engineered strain ARG10 and the wild-type strain W3110, refer to step II of the experimental methods above. The recombinant vector pZ8-cynT was transformed into competent cells of the starting strain ARG10 and the wild-type strain W3110, respectively. PCR amplification was performed on kanamycin-resistant plates using primers pZ8F / pZ8R (specific sequences are shown in Table 1). Positive transformants were screened to construct the engineered strains ARG-pZ8-cynT and W3110-pZ8-cynT with enhanced cynT gene expression.

[0271] The PCR product of a positive strain containing the pZ8-cynT plasmid should be 748 bp in length. No band was detected in the starting strain. The recombinant E. coli ARG-pZ8-cynT containing the pZ8-cynT plasmid expressed a higher level of the carbonic anhydrase gene than the recipient E. coli ARG10. The recombinant E. coli W3110-pZ8-cynT containing the pZ8-cynT plasmid expressed a higher level of the carbonic anhydrase gene than the recipient E. coli W3110.

[0272] C. Construction of genetically engineered bacteria ARG:ΔcynT

[0273] 1. Obtaining the recombinant plasmid pGRB-cynT

[0274] 1) ΔcynT gene editing

[0275] Using the Escherichia coli W3110 genome as a template, upstream homology primers (UP-cynT-S and UP-cynT-A (see Table 1 for specific sequences) and downstream homology primers (DN-cynT-S and DN-cynT-A) were designed based on the upstream and downstream sequences outside the coding region of the cynT gene (NCBI GeneID: 946548). The above fragments were fused by overlapping PCR to obtain ΔcynT (cynT upstream homology arm-downstream homology arm).

[0276] 2) Construction of pGRB-cynT

[0277] The target sequence-containing DNA fragment (the target sequence is the nucleotide sequence 5'-ATTTGTGGTCATTCCAACTG-3' (SEQ ID No. 47)) was prepared by annealing primers gRNA-cynT-S and gRNA-cynT-A and ligated with the plasmid pGRB to construct the recombinant plasmid pGRB-cynT.

[0278] The structure of the recombinant plasmid pGRB-cynT is described as follows: the fragment between 5'-GCTCAGTCCTAGGTATAATACTAGT-3' (SEQ ID No. 49) and 5'-GTTTTAGAGCTAGAAATAGCAAGT-3' (SEQ ID No. 31) of pGRB is replaced with a DNA molecule having the nucleotide sequence 5'-ATTTGTGGTCATTCCAACTG-3' (SEQ ID No. 47), while the other nucleotides of pGRB remain unchanged.

[0279] 2. Construction of engineered strains ARG:ΔcynT and W3110:ΔcynT

[0280] For the preparation of competent cells of the engineered strain ARG10 and the wild-type strain W3110, please refer to step II in the experimental method above.

[0281] The recombinant vector pGRB-cynT and the ΔcynT fragment were transformed into competent cells of the starting strain ARG10 and the wild-type strain W3110, respectively. PCR amplification was performed on kanamycin-resistant plates with primers UP-cynT-S / DN-cynT-A (specific sequences are shown in Table 1). Positive transformants were screened, and engineered strains ARG:ΔcynT and W3110:ΔcynT with reduced cynT gene expression intensity were constructed in turn.

[0282] The upstream homology arm should be 543 bp long, the downstream homology arm should be 519 bp long, and the total length of the overlapping fragment should be 1062 bp. During PCR verification, the PCR amplification fragment of a positive strain with successful cynT knockout should be 1062 bp long, and the PCR amplification product of the original strain should be 1722 bp long. The nucleotide sequence of the ΔcynT fragment is SEQ ID No. 11 in the sequence listing.

[0283]

[0284] D. Fermentation production of L-arginine using engineered strains that overexpress the cynT gene and engineered strains that knock out the cynT gene

[0285] The strains to be tested were: ARG-cynT, ARG-pZ8-cynT, W3110-cynT, W3110-pZ8-cynT modified by overexpressing cynT gene, cynT gene knockout strain W3110:ΔcynT and the starting strains ARG10 and W3110 (control strains).

[0286] The fermentation steps are as follows:

[0287] 1) Slant culture: Take the -80°C stored culture and streak it onto an activated slant, culture it at 37°C for 12 hours, and subculture it once;

[0288] 2) Shake flask seed culture: Use an inoculating loop to scrape a ring of seeds from the slant surface and inoculate it into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium. Seal the flask with nine layers of gauze and incubate at 37°C, 200 rpm for 7-10 h.

[0289] 3) Shake flask fermentation: 10-15% of the volume of the seed culture was inoculated into a 500 mL Erlenmeyer flask containing fermentation medium (final volume 30 mL), sealed with nine layers of gauze, and cultured at 37°C, 200 rpm, with shaking. During the fermentation process, ammonia was added to maintain the pH at 7.0-7.2; 60% (m / v) glucose solution was added to maintain the fermentation process; the fermentation period was 26-30 h.

[0290] The strains were cultured in shake flasks, and the L-arginine concentration in the fermentation supernatant was determined according to the industry standard GB 36897-2018.

[0291] Table 10. Shake flask fermentation results of cynT engineered strains

[0292] The results are shown in Table 10. After 26-30 hours of fermentation, enhancing the expression of the cynT gene did not significantly affect the growth of the engineered strain ARG10. The L-arginine concentration in ARG-cynT increased from 26.3 g / L to 30.2 g / L, and the L-arginine yield increased by 14.8%. The L-arginine concentration in ARG-pZ8-cynT increased from 26.3 g / L to 30.9 g / L, and the L-arginine yield increased by 17.5%. The L-arginine concentration in ARG:ΔcynT decreased from 26.3 g / L to 24.4 g / L, and the L-arginine yield decreased by 7.2%. Even with enhanced cynT expression, W3110 produced 0.4 g / L of L-arginine.

[0293] The results showed that enhancing the expression intensity of the cynT gene in Escherichia coli can significantly improve the L-arginine production performance of the engineered strain, while knocking out the cynT gene did not affect the normal growth of the strain, but significantly reduced the L-arginine production performance of the engineered strain, once again demonstrating the role of the cynT gene in improving the L-arginine acid production capacity.

[0294] Industrial Applications

[0295] The present invention replaces the native promoter of the Escherichia coli cynX or cynT gene with Ptrc and integrates it into the ygaY pseudogene locus of the genome. The strong Ptrc promoter activates the cynX or cynT gene to enhance the expression of the cynX or cynT gene, resulting in more cost-effective L-arginine fermentation production. Using an L-arginine engineered strain, ARG10, as the starting strain (patent: ZL201911211097.X), enhancing the expression of the cynX gene increased the L-arginine accumulation concentration in the strain from 26.3 g / L to 29.4 g / L, and the L-arginine yield increased by 11.8%. Enhancing the expression of the cynT gene also increased the L-arginine accumulation concentration in the strain from 26.3 g / L to 30.2 g / L, and the L-arginine yield increased by 14.8%.

Claims

1. A recombinant Enterobacter, characterized in that The recombinant Enterobacter is a recombinant bacterium obtained by causing the recipient Enterobacter to overexpress a cyanate transporter encoding gene and / or a carbonic anhydrase encoding gene.

2. The recombinant Enterobacter according to claim 1, characterized in that The cyanate transporter gene is derived from Escherichia coli, and the carbonic anhydrase gene is derived from Escherichia coli.

3. The recombinant Enterobacter according to claim 1 or 2, characterized in that The cyanate transporter is any of the following proteins: A1) the cyanate transporter encoding gene encodes a protein whose amino acid sequence is SEQ ID No. 4; A2) a protein having cyanate transporter activity and having at least 80% identity with the protein of A1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of A1); A3) A fusion protein having cyanate transporter activity obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2); The carbonic anhydrase is any of the following proteins: B1) the carbonic anhydrase encoding gene encodes a protein whose amino acid sequence is SEQ ID No. 5; B2) a protein having carbonic anhydrase activity and having at least 80% identity with the protein of B1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of B1); B3) A fusion protein having carbonic anhydrase activity obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2).

4. The recombinant Enterobacter according to any one of claims 1 to 3, characterized in that The coding gene of the cyanate transporter is any one of the following: C1) a DNA molecule whose nucleotide sequence is SEQ ID No. 2; C2) a DNA molecule having more than 80% identity with the nucleotide sequence defined in C1) and encoding the cyanate transporter; C3) a DNA molecule that hybridizes with any of the nucleotide sequences specified in C1) to C2) under stringent conditions and encodes the cyanate transporter; The coding gene of the carbonic anhydrase is any one of the following: D1) a DNA molecule whose nucleotide sequence is SEQ ID No. 3; D2) a DNA molecule having more than 80% identity with the nucleotide sequence defined in D1) and encoding the carbonic anhydrase; D3) is a DNA molecule that hybridizes with any one of the nucleotide sequences specified in D1) to D2) under stringent conditions and encodes the carbonic anhydrase.

5. A method for constructing the recombinant Enterobacter according to any one of claims 1 to 4, the method comprising: Q1) regulating the expression of a gene encoding the cyanate transporter according to any one of claims 1 to 4, or regulating the activity or content of the cyanate transporter, to thereby regulate the arginine production of a microorganism, thereby obtaining a microorganism with a changed arginine production; Q2) regulating the expression of the gene encoding the carbonic anhydrase according to any one of claims 1 to 4, or regulating the activity or content of the carbonic anhydrase, to regulate the arginine production of the microorganism, thereby obtaining a microorganism with a changed arginine production.

6. The method according to claim 5, characterized in that The method for regulating the expression of the gene encoding the cyanate transporter or regulating the activity or content of the cyanate transporter is any one of the following: M1) introducing the gene encoding the cyanate transporter into the target microorganism; M2) introducing a gene encoding the amino acid sequence of SEQ ID No. 4 into the target microorganism; The method for regulating the expression of the gene encoding the carbonic anhydrase or regulating the activity or content of the carbonic anhydrase is any one of the following: N1) introducing the coding gene of the carbonic anhydrase into the target microorganism; N2) Introducing the coding gene of the amino acid sequence SEQ ID No. 5 into the target microorganism.

7. Use of the Enterobacterium according to any one of claims 1 to 4 in any of the following: E1) Use in regulating the production of arginine in microorganisms; E2) Use in the preparation of arginine; E3) Use of the invention in constructing genetically engineered microorganisms producing arginine.

8. Use of the Enterobacterium according to any one of claims 1 to 4 in producing arginine or food, medicine and / or feed containing arginine.

9. Use of the method according to claim 5 or 6 in any of the following: E1) Use in regulating the production of arginine in microorganisms; E2) Use in the preparation of arginine; E3) Use of the invention in constructing genetically engineered microorganisms producing arginine.

10. Use of the method according to claim 5 or 6 in producing arginine or food, medicine and / or feed containing arginine.

11. Use of protein, characterized in that The protein is protein A or protein B, The protein A is a cyanate transporter with an amino acid sequence of SEQ ID No.4, and the protein B is a carbonic anhydrase with an amino acid sequence of SEQ ID No.5; The use is any of the following: F1) Use in regulating the production of arginine in microorganisms; F2) Use in the preparation of arginine; F3) Use of genetically engineered microorganisms in constructing arginine.

12. A nucleic acid molecule, characterized in that The nucleic acid molecule is nucleic acid molecule A or nucleic acid molecule B; the nucleic acid molecule A encodes the cyanate transporter in the Enterobacter as claimed in any one of claims 1-4; the nucleic acid molecule B encodes the carbonic anhydrase in the Enterobacter as claimed in any one of claims 1-4.

13. An expression cassette, characterized in that The expression cassette is expression cassette A or expression cassette B, wherein expression cassette A contains the nucleic acid molecule A according to claim 12, and expression cassette B contains the nucleic acid molecule B according to claim 12.

14. A recombinant vector, characterized in that: The expression cassette is a recombinant vector A or a recombinant vector B, wherein the recombinant vector A contains the nucleic acid molecule A according to claim 12 or the expression cassette according to claim 13, and the recombinant vector B contains the nucleic acid molecule B according to claim 12 or the expression cassette according to claim 13.

15. A whole cell catalyst, characterized in that The whole-cell catalyst is a whole-cell catalyst A or a whole-cell catalyst B. The whole-cell catalyst A contains the nucleic acid molecule A according to claim 12, and the whole-cell catalyst B contains the nucleic acid molecule B according to claim 12.

Images