Enzyme combination, genetically engineered bacterium and use thereof in production of d-psicose

Abstract

The present invention relates to the technical field of bioengineering, and in particular to an enzyme combination, a genetically engineered bacterium and the use thereof in the production of D-psicose. A glucose isomerase and a D-psicose 3-epimerase from a specific source are co-expressed in Bacillus subtilis. A fructose syrup and a D-psicose syrup are obtained by means of fermenting the obtained engineered bacteria to obtain a crude enzyme solution, using glucose at a high concentration as a substrate and performing an isomerization reaction, and separating, purifying and concentrating same. The provided enzyme combination has a relatively high catalytic rate for a substrate, and can significantly increase the conversion rate of D-psicose. Meanwhile, the production cost of D-psicose is greatly reduced by means of using cheap glucose as a raw material. In addition, when D-psicose is produced, the fructose syrup is synchronously produced, so that the input of one set of production lines of the fructose syrup is saved, and the economic benefits are greatly improved.

Description

An enzyme combination, genetically engineered bacteria, and their use in producing D-psicose Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to an enzyme combination, genetically engineered bacteria and applications thereof in producing D-psicose. Background Art

[0002] D-allulose is a rare sugar with 70% of the sweetness of sucrose but very low in calories, making it a good substitute for sucrose. Furthermore, its absorption rate is lower than that of other sweeteners, which can reduce the body's absorption of fructose and glucose, lowering fat accumulation and thus lowering the risk of conditions such as type 2 diabetes and obesity. Studies have also shown that D-allulose can lower blood lipids and blood sugar. The U.S. Food and Drug Administration (FDA) has certified D-allulose as GRAS (Generally Recognized as Safe), allowing it to be used as a food additive. D-allulose has broad application prospects in food and health supplements.

[0003] Currently, allulose is primarily produced from fructose via the enzyme D-psicose-3 epimerase, catalyzed by fructose. However, the high market price of fructose inevitably leads to high production costs. Fructose, on the other hand, can be produced through the epimerization of glucose catalyzed by glucose isomerase. By utilizing engineered bacteria co-expressing both glucose isomerase and D-psicose-3 epimerase in fermentation, D-psicose can be produced from glucose in a single step. This method uses glucose as a raw material, reducing raw material costs and eliminating a production line for fructose production from glucose, thus reducing equipment investment. It has significant industrial application value. Technical issues

[0004] In light of this, the present invention provides an enzyme combination, a genetically engineered bacterium, and their use in the production of D-psicose. This invention utilizes glucose isomerase and D-psicose 3-epimerase from a specific source to catalyze the conversion of the substrate glucose into D-psicose, significantly improving the D-psicose conversion efficiency and shortening the production time, making it suitable for industrial production. Technical Solutions

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an enzyme combination, comprising glucose isomerase derived from Thermus thermophilus and D-psicose 3-epimerase derived from Ruminococcus sp.

[0007] The amino acid sequence of the glucose isomerase is selected from any one of the following;

[0008] 1) as shown in SEQ ID NO: 1;

[0009] 2) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 1 without changing its function; or

[0010] 3) An amino acid sequence that is at least 90% homologous to the sequence shown in SEQ ID NO: 1 and has the same or similar protein activity as SEQ ID NO: 1.

[0011] The amino acid sequence of the D-psicose 3-epimerase is selected from any one of the following:

[0012] a) as shown in SEQ ID NO: 2;

[0013] b) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 2 without changing the protein activity; or

[0014] c) an amino acid sequence that is at least 90% homologous to the sequence shown in SEQ ID NO: 2 and has the same or similar amino acid activity as the protein shown in SEQ ID NO: 2.

[0015] In a specific embodiment, the glucose isomerase GI described in the present invention is derived from Thermus thermophilus, with accession number WP_244348257.1 and an amino acid sequence of SEQ ID NO: 1. The D-psicose 3-epimerase DPE is derived from Ruminococcus sp., with accession number MBS6425357.1 and an amino acid sequence of SEQ ID NO: 2.

[0016] After long-term research, the present invention found that enzyme combinations from different sources catalyze the conversion of the substrate glucose into psicose at different rates. Ultimately, an optimal combination was obtained, namely a combination of glucose isomerase from Thermus thermophilus and D-psicose 3-epimerase from Ruminococcus sp., with a conversion rate significantly higher than other combinations. Specifically, the amino acid sequence of the glucose isomerase is SEQ ID NO: 1, and the amino acid sequence of the D-psicose 3-epimerase is SEQ ID NO: 2.

[0017] The present invention also provides a nucleic acid combination encoding the enzyme combination, including a GI gene and a DPE gene. The present invention optimizes the GI gene and the DPE gene according to the codon preference of Bacillus subtilis. The sequence of the optimized GI gene is SEQ ID NO: 3, and the sequence of the optimized DPE gene is SEQ ID NO: 4.

[0018] The present invention also provides a gene expression cassette comprising a promoter, a gene in the nucleic acid combination, and a terminator. The GI gene and the DPE gene in the nucleic acid combination are respectively driven by constitutive promoters. In some embodiments, the constitutive promoter is a p43 promoter.

[0019] The present invention also provides an expression vector comprising a backbone vector and the nucleic acid combination. The genes encoding glucose isomerase and D-psicose 3-epimerase are located in the same backbone vector, and each gene is driven by a separate promoter. The promoters can be the same (e.g., the p43 promoter) or different.

[0020] In the expression vector described in the present invention, the backbone vector is pWB980, pP43NMK, pYH-P43, etc., and other common vector types in the art can be used, including but not limited to these.

[0021] The present invention also provides an engineering bacterium for transfecting or transforming the expression vector.

[0022] The starting bacteria of the engineering bacteria of the present invention is Bacillus subtilis, and in the specific embodiment, it is Bacillus subtilis WB600.

[0023] The present invention also provides a method for constructing the engineered bacteria, comprising ligating a glucose isomerase gene and a D-psicose 3-epimerase gene to a backbone vector to obtain a recombinant vector; and introducing the recombinant vector into Bacillus subtilis to obtain the engineered bacteria. The sequence of the glucose isomerase gene is shown in SEQ ID NO: 3, and the sequence of the D-psicose 3-epimerase gene is shown in SEQ ID NO: 4.

[0024] In some specific embodiments, the construction method of the engineered bacteria is as follows:

[0025] 1) The glucose isomerase protein sequence from Thermus thermophilus (GI, SEQ ID NO:1) and the D-psicose 3-epimerase protein sequence from Ruminococcus sp. (DPE, SEQ ID NO:2) were selected and their encoding genes were codon-optimized. The optimized GI gene sequence is SEQ ID NO:3, and the DPE gene sequence is SEQ ID NO:4. Both genes were fully synthesized by GenScript Biotech. The two genes were ligated into the pWB980 vector via homologous recombination to generate the recombinant plasmids pWB980-GI and pWB980-DPE.

[0026] 2) Using the pWB980-DPE plasmid as a template, the p43-RBS-DPE fragment was amplified by PCR. This fragment was then ligated into the pWB980-GI vector via homologous recombination to generate the recombinant plasmid pWB980-GI-DPE. The GI and DPE genes are each controlled by the P43 promoter for constitutive intracellular expression.

[0027] 3) The recombinant plasmid pWB980‑GI-DPE was transformed into Bacillus subtilis WB600 to obtain recombinant Bacillus subtilis WB600 / GI-DPE.

[0028] Experiments have shown that the strain can be used to directly ferment glucose to produce fructose syrup and D-psicose. It has a high catalytic rate for glucose and significantly shortens the reaction time, which is conducive to the industrial production of psicose and has high economic benefits.

[0029] The present invention also provides the use of the enzyme combination, the nucleic acid combination, the expression vector or the engineered bacteria in producing D-psicose or in preparing a blood sugar and lipid-lowering product.

[0030] The present invention also provides a method for preparing psicose, using a fermentation culture, extract, or isolated enzyme solution of an engineered bacterium co-expressing glucose isomerase and D-psicose 3-epimerase as a catalyst to catalyze the reaction of the substrate glucose to produce psicose. The method specifically comprises the following steps:

[0031] Fermenting and culturing the engineered bacteria, and then disrupting the bacteria to obtain a crude enzyme solution containing glucose isomerase and D-psicose 3-epimerase;

[0032] adding substrate glucose to the crude enzyme solution to obtain invert sugar syrup;

[0033] The invert sugar syrup is filtered, purified, chromatographed, and concentrated in sequence to obtain D-psicose and fructose, respectively.

[0034] In a specific embodiment, the preparation method of D-psicose includes:

[0035] (1) The recombinant strain was inoculated into LB seed medium and cultured overnight at 37°C and 200 rpm for enrichment to obtain a seed solution with an OD600 value of 3-6;

[0036] (2) The seed liquid of the recombinant strain obtained in step (1) was inoculated into a fermentation medium (10 g of peptone, 5 g of yeast powder, 2.5 g of potassium dihydrogen phosphate, 15 g of dipotassium hydrogen phosphate, 0.1 g of manganese chloride tetrahydrate, 0.1 g of magnesium sulfate heptahydrate, 6 g of glucose, and fixed to 1 L with water) at a ratio of 0.1% (v / v) for fermentation at a temperature of 37°C and a temperature of 200 rpm for 48 h to obtain a fermentation broth.

[0037] (3) Add lysozyme at 0.1‰ (w / v) to the fermentation broth obtained in step (2) and react at 37°C and 200 rpm for 1 h to break the bacteria and release the intracellular enzyme to obtain a crude enzyme solution.

[0038] (4) Glucose was added to the crude enzyme solution obtained in step (3) at a final concentration of 600 g / L, and the mixture was reacted at 60°C for 24 h to obtain invert syrup.

[0039] (5) The invert sugar syrup obtained in step (4) was filtered through a ceramic membrane with a pore size of 8-10 nm to remove impurities at a flux of 50 L / ㎡ / h to obtain a permeate.

[0040] (6) The permeate obtained in step (5) was filtered through a nanofiltration membrane with a molecular weight cutoff of 100-300 Daltons to remove impurities and decolorize at a flux of 10 L / ㎡ / h to obtain a permeate.

[0041] (7) The permeate obtained in step (6) is passed through a cation resin and then an anion resin to remove cations and anions, thereby obtaining a desalted sugar solution. The cation resin model is D001-FD, and the anion resin model is D354-FD.

[0042] (8) The desalted sugar solution from step (7) is then subjected to chromatographic separation to obtain solution AD, which is a psicose solution, and solution BD, which is a mixed sugar solution of glucose and fructose. During the chromatographic separation process, the sugar solution concentration is controlled at 15-25%, the temperature is 50-60°C, the pressure is 0.2-0.3 MPa, the water-to-material mass ratio is 1:2, and the processing capacity is 2.2 kg / kg / d.

[0043] (9) The AD solution and BD solution obtained in step (8) are concentrated to a solid content of 75% to obtain D-psicose syrup and fructose syrup. Beneficial effects

[0044] (1) The present invention utilizes a combination of enzymes from specific sources to convert glucose into D-psicose in a relatively short period of time, which significantly shortens the production time, greatly improves the economic benefits, and is conducive to industrial production.

[0045] (2) The present invention uses cheap raw material glucose as a substrate, which greatly reduces the production cost of D-psicose.

[0046] (3) The present invention can produce both D-psicose and fructose syrup simultaneously, thereby saving the investment in a set of fructose syrup production lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 is a map of the recombinant plasmid pWB980 GI DPE;

[0048] Figure 2 is an SDS-PAGE electrophoresis image, where lanes 1 and 2 represent: 1: WB600 / pWB980, 2: WB600 / pWB980-GI-DPE;

[0049] Figure 3 is a liquid phase detection spectrum. Modes for Carrying Out the Invention

[0050] The present invention provides an enzyme combination, a genetically engineered bacterium, and their use in the production of D-psicose. Those skilled in the art can refer to the contents herein and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0051] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0052] The present invention will be further described below in conjunction with the embodiments:

[0053] Example 1 Construction and Functional Verification of Glucose Isomerase (GI) and D-Psicose 3-Epimerase (DPE) Co-expressing Engineering Bacteria of the Present Invention

[0054] The glucose isomerase protein sequence from Thermus thermophilus (GI, SEQ ID NO: 1) and the D-psicose 3-epimerase protein sequence from Ruminococcus sp. (DPE, SEQ ID NO: 2) were selected. After codon optimization, the encoding genes were SEQ ID NO: 3 for the GI gene and SEQ ID NO: 4 for the DPE gene. GenScript Biotech synthesized the genes and ligated them into the pUC57 vector, naming them pUC57-GI and pUC57-DPE, respectively.

[0055] Using the synthesized recombinant plasmid pUC57-GI as a template, GI-F and GI-R as primers, PCR amplification was performed, and the GI fragment was obtained by gel recovery and purification; using the synthesized recombinant plasmid pUC57-DPE as a template, DPE-F and DPE-R as primers, PCR amplification was performed, and the DPE fragment was obtained by gel recovery and purification.

[0056] Using plasmid vector pWB980 as template, pWB980-F1 and pWB980-R1 as primers for PCR amplification, and gel recovery and purification to obtain linearized plasmid gene fragment P1; using plasmid vector pWB980 as template, pWB980-F2 and pWB980-R2 as primers for PCR amplification, and gel recovery and purification to obtain linearized plasmid gene fragment P2.

[0057] Ligate the GI fragment and the linearized pWB980 gene fragment P1 according to the homologous recombination kit instructions. Electroporate the ligation product into Bacillus subtilis WB600 competent cells. The resulting recombinant Bacillus subtilis is named WB600 / GI and the recombinant plasmid is named pWB980-GI. Verify the correctness of the transformant by colony PCR and sequencing.

[0058] Table 1 Primer sequences of the present invention

[0059] Primer name Primer sequence 5'-3'GI-FATAAAAAAGGAGACATGAACGATGTATGAACCAAAACCCGAGI-RTCTTGGAATTGTGCTGAAGCTTTAACCACGCACCCCTAACAGATApWB980-F1AGCTTCAGCACAATTCCAAGApWB980-R1CGTTCATGTCTCCTTTTTTATGTACTGDPE-FATAAAAAAGGAGAC ATGAACGATGAAATATGGTATTTATTACGCTTATTGGGDPE-RTCTTGGAATTGTGCTGAAGCTTAGACTTTCAAATACATGTTTTACAAAGTGpWB980-F2AGCTTCAGCACAATTCCAAGApWB980-R2CGTTCATGTCTCCTTTTTTATGTACTGp43-RBS-DPE-FCTAACTCATAACCGAGAGGT AGCATTATTGAGTGGATGATTATATTCCp43-RBS-DPE-RACCTTCAGCAACTAAAATA TTAGACTTCAAATACATGTTTTACAAAGTGpWB980-GI-FTATTTTAGTTGCTGAAAGGTGCGpWB980-GI-RACTCTCCGGGTTATGAGTTAGTTCGI-JD-FACAGCCATTGAACATACGGTGI-JD-RCCTTG GTAACCGCTAGACTDPE-JD-FACAGCCATTGAACATACGGTDPE-JD-RTTCCATGCCCATCATAATATCATATTGI-DPE-JD-FATCTGATCCTGAAAGAGCGTGI-DPE-JD-RGCCTGTTTCTGGGTGTTCG

[0060] Ligate the DPE fragment and the linearized pWB980 gene fragment P2 according to the homologous recombination kit instructions. Electroporate the ligation product into Bacillus subtilis WB600 competent cells. The resulting recombinant Bacillus subtilis was named WB600 / DPE, and the recombinant plasmid was named pWB980-DPE. Verify the correctness of the transformant by colony PCR and sequencing.

[0061] PCR amplification was performed using the recombinant plasmid pWB980-DPE as a template, p43-RBS-DPE-F and p43-RBS-DPE-R as primers, and gel purification was performed to obtain the p43-RBS-DPE fragment. PCR amplification was then performed using the recombinant plasmid pWB980-GI as a template, pWB980-GI-F and pWB980-GI-R as primers, and gel purification was performed to obtain the linearized plasmid gene fragment P3.

[0062] The p43-RBS-DPE fragment and the pWB980-GI linearized gene fragment P3 were ligated according to the homologous recombination kit instructions. The ligation product was electroporated into Bacillus subtilis WB600 competent cells. The resulting recombinant Bacillus subtilis was named WB600 / GI-DPE, and the recombinant plasmid was named pWB980-GI-DPE (plasmid map shown in Figure 1). Transformant colony PCR and sequencing were used to verify the correctness of the transformant.

[0063] Positive transformants identified by PCR and sequencing were selected and inoculated into 5 ml of LB liquid medium containing 50 mg / L kanamycin. Culture was continued at 37°C, 200 rpm, and overnight. A 0.1% inoculum was then inoculated into at least 1 L of fermentation medium containing 50 mg / L kanamycin and cultured at 37°C, 200 rpm, for 48 hours. Lysozyme powder was added at a rate of 0.1‰, and the reaction was continued at 37°C, 200 rpm, for 1 hour to obtain a crude GI-DPE enzyme solution (SDS-PAGE results are shown in Figure 2).

[0064] Glucose was added to the crude enzyme solution obtained above to a final concentration of 700 g / L. The reaction was carried out at 60°C for 24 h. A 0.02 ml portion of the reaction solution was diluted 50-fold with pure water and incubated in a 100°C water bath for 10 min to inactivate the enzyme. The solution was then centrifuged at 10,000 rpm for 10 min, filtered through a 0.22 μm microporous membrane, and the filtrate was analyzed by HPLC.

[0065] Bacillus subtilis WB600 carrying the empty plasmid pWB980 was used as a blank control, and other operating conditions were the same.

[0066] High-performance liquid chromatography (HPLC) was performed using the following conditions: Agilent 1200 HPLC instrument; Waters Sugar Pak I analytical column; mobile phase: pure water; flow rate: 0.3 ml / min; column temperature: 80°C; detector: differential refractive index detector. The samples were analyzed using pure glucose, fructose, and D-psicose produced by Sigma as standards, with an injection volume of 10 μl.

[0067] The liquid chromatography analysis results (Figure 3) showed that the peak times of glucose, fructose, and D-psicose were 14.1 min, 17.9 min, and 26.9 min, respectively.

[0068] The liquid phase spectrum of the blank control (Bacillus subtilis WB600 / pWB980) contained only glucose, while the liquid phase spectrum of the experimental group (Bacillus subtilis WB600 / pWB980-GI-DPE) contained glucose, fructose, and D-psicose. These results demonstrate that the crude GI-DPE enzyme solution prepared by the above method can convert glucose into fructose, and then fructose into D-psicose.

[0069] According to peak area calculation, after 24 hours of reaction, the converted sugar solution contained 284 g / L of glucose, 209 g / L of fructose and 107 g / L of D-psicose, with a ratio of 47.33:34.83:17.83.

[0070] Example 2: Method for producing fructose syrup and D-psicose by co-expression of engineered bacteria

[0071] The specific steps are as follows:

[0072] (1) The co-expression engineered bacteria of Example 1 were inoculated into LB liquid seed culture medium containing 50 mg / L kanamycin, and cultured overnight at 37°C and 200 rpm to obtain a co-expression engineered bacteria seed solution;

[0073] (2) The engineered bacteria seed liquid obtained above was inoculated into more than 1 L of fermentation medium containing 50 mg / L kanamycin (10 g of peptone, 5 g of yeast powder, 2.5 g of potassium dihydrogen phosphate, 15 g of dipotassium hydrogen phosphate, 0.1 g of manganese chloride tetrahydrate, 0.1 g of magnesium sulfate heptahydrate, 6 g of glucose, and water was added to make the volume 1 L) at a ratio of 0.1% (v / v) for fermentation at 37°C and 200 rpm for 48 h to obtain fermentation liquid.

[0074] (3) Add lysozyme at 0.1‰ (w / v) to the fermentation broth obtained in step (2) and react at 37°C and 200 rpm for 1 h to break the bacteria and release the intracellular enzyme to obtain GI-DPE crude enzyme solution.

[0075] (4) Glucose was added to the crude enzyme solution obtained in step (3) at a final concentration of 600 g / L, and the mixture was reacted at 60°C for 2-24 h to obtain invert syrup.

[0076] (5) The invert sugar syrup obtained in step (4) was filtered through a ceramic membrane with a pore size of 8-10 nm to remove impurities at a flux of 50 L / ㎡ / h to obtain a permeate.

[0077] (6) The permeate obtained in step (5) was filtered through a nanofiltration membrane with a molecular weight cutoff of 100-300 Daltons to remove impurities and decolorize at a flux of 10 L / ㎡ / h to obtain a permeate.

[0078] (7) The permeate obtained in step (6) is first passed through a cationic resin and then through an anionic resin to remove cations and anions; the cationic resin model is D001-FD and the anionic resin model is D354-FD; and a desalted sugar solution is obtained.

[0079] (8) The desalted sugar solution from step (7) is then subjected to chromatographic separation to obtain solution AD, which is a psicose solution, and solution BD, which is a mixed sugar solution of glucose and fructose. During the chromatographic separation process, the sugar solution concentration is controlled at 15-25%, the temperature is 50-60°C, the pressure is 0.2-0.3 MPa, the water-to-material mass ratio is 1:2, and the processing capacity is 2.2 kg / kg / d.

[0080] (9) The AD solution and BD solution obtained in step (8) are concentrated to a solid content of 75% to obtain D-psicose syrup and fructose syrup.

[0081] Comparative Example 1

[0082] Glucose isomerase (GI, nucleic acid sequence see SEQ ID NO: 1 in the record of CN113980880) and D-psicose 3-epimerase (DPE, nucleic acid sequence see SEQ ID NO: 3 in the record of CN113980880) were selected from the CN113980880 patent. Bacillus subtilis co-expressing glucose isomerase and D-psicose 3-epimerase was constructed according to the method of Example 1 of the present invention, and invert syrup containing glucose, fructose and psicose was prepared according to the method of Example 2 of the present invention.

[0083] Comparative Example 2 (GI of different genus (56% homology with the GI of the present invention), same DPE)

[0084] Glucose isomerase (GI) from CN113980880 (nucleic acid sequence: SEQ ID NO: 1 in CN113980880) and D-psicose 3-epimerase (DPE) from Ruminococcus sp. of the present application (nucleic acid sequence: SEQ ID NO: 4) were selected, and Bacillus subtilis co-expressing GI and DPE was constructed according to the method of Example 1 of the present invention. Invert syrup containing glucose, fructose, and psicose was prepared according to the method of Example 2 of the present invention.

[0085] Comparative Example 3 (GI different genus (homology 97%), same DPE)

[0086] Glucose isomerase (GI, accession number WP_126200404.1, nucleic acid sequence after codon optimization: SEQ ID NO: 5) from Thermus scotoductus and D-psicose 3-epimerase (DPE, nucleic acid sequence: SEQ ID NO: 4) from Ruminococcus sp. of the present invention were selected, and Bacillus subtilis co-expressing GI and DPE was constructed according to the method of Example 1 of the present invention. Invert syrup containing glucose, fructose, and psicose was prepared according to the method of Example 2 of the present invention.

[0087] Comparative Example 4 (same GI, different DPE (40% homology with the DPE of the present invention))

[0088] Glucose isomerase (GI) from Thermus thermophilus of the present invention, nucleic acid sequence SEQ ID NO: 3, and D-psicose 3-epimerase (DPE, nucleic acid sequence SEQ ID NO: 3 in CN113980880) from the present invention were selected, and Bacillus subtilis co-expressing GI and DPE was constructed according to the method of Example 1 of the present invention. Invert syrup containing glucose, fructose, and psicose was prepared according to the method of Example 2 of the present invention.

[0089] Comparative Example 5 (same GI, different DPE (69% homology with the DPE of the present invention))

[0090] Glucose isomerase (GI, nucleic acid sequence: SEQ ID NO: 3) from Thermus thermophilus and D-psicose 3-epimerase (DPE, WP_183684385.1, nucleic acid sequence: SEQ ID NO: 6) from Oribacterium sinus were selected, and Bacillus subtilis co-expressing GI and DPE was constructed according to the method of Example 1. Invert syrup containing glucose, fructose, and psicose was prepared according to the method of Example 2 of the present invention.

[0091] Test example

[0092] Invert syrup was prepared according to the methods of Example 2 and Comparative Examples 1-5. Samples were collected after 2, 4, 6, 12, and 24 hours of reaction time. The glucose, fructose, and psicose contents were determined by HPLC, and the psicose production rate was calculated. The results are shown in Table 2.

[0093] Table 2

[0094]

[0095] As can be seen from the above results, although the conversion rates of glucose to psicose produced by enzymes catalyzed by comparative examples 1 to 5 and the engineered strains of the present invention are comparable, all between 14-18%, the time required to reach equilibrium conversion is significantly different, namely 6h, 6h, 12h, 4h, 12h, and 2h, respectively. From this, the maximum production rates of psicose can be calculated to be 21.5g / L / h, 25g / L / h, 16g / L / h, 25g / L / h, 11.5g / L / h, and 53.5g / L / h, respectively. Among them, the equilibrium catalytic time of the enzyme combination of the present invention is the shortest, which is significantly lower than that of other comparative examples, and the psicose production rate of the enzyme combination of the present invention is also the largest, which is significantly higher than that of other comparative examples. Therefore, it can be determined that the combination of glucose isomerase from Thermus thermophilus and D-psicose 3-epimerase from Ruminococcus sp. provided by the present invention has the highest catalytic rate for glucose, and the production rate of psicose is the highest in the conversion reaction, which is the best combination.

[0096] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An enzyme combination, characterized in that These include glucose isomerase from Thermus thermophilus and D-psicose 3-epimerase from Ruminococcus sp.

2. The enzyme combination according to claim 1, characterized in that The amino acid sequence of the glucose isomerase is selected from any one of the following; 1) as shown in SEQ ID NO:1; 2) An amino acid sequence obtained by replacing, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 1 without changing the protein activity; or 3) An amino acid sequence that has at least 90% homology to the sequence shown in SEQ ID NO: 1 and has the same or similar protein activity as SEQ ID NO:

1.

3. The enzyme combination according to claim 1, characterized in that The amino acid sequence of the D-psicose 3-epimerase is selected from any one of the following: a) as shown in SEQ ID NO:2; b) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 2 without changing the protein activity; or c) an amino acid sequence that is at least 90% homologous to the sequence shown in SEQ ID NO: 2 and has the same or similar protein activity as the sequence shown in SEQ ID NO:

2.

4. A nucleic acid combination encoding the enzyme combination according to any one of claims 1 to 3.

5. The nucleic acid combination according to claim 4, characterized in that The glucose isomerase gene is a gene optimized according to the codon preference of Bacillus subtilis, and its nucleotide sequence is shown in SEQ ID NO: 3; The D-psicose 3-epimerase gene is a gene optimized according to the codon preference of Bacillus subtilis, and its nucleotide sequence is shown in SEQ ID NO:

4.

6. An expression vector comprising a backbone vector and the nucleic acid combination of claim 4 or 5.

7. An engineered bacterium comprising the expression vector according to claim 6.

8. The engineered bacteria according to claim 7, characterized in that: The starting bacterium is Bacillus subtilis.

9. The method for constructing the engineered bacteria according to claim 7 or 8, characterized in that: The glucose isomerase gene and the D-psicose 3-epimerase gene are connected to a backbone vector to obtain a recombinant vector; and the recombinant vector is transferred into Bacillus subtilis to obtain an engineered bacterium.

10. Use of the enzyme combination according to any one of claims 1 to 3, the nucleic acid combination according to claim 4 or 5, the expression vector according to claim 6, or the engineered bacteria according to claim 7 or 8 in the production of D-psicose, or in the preparation of a blood sugar and lipid lowering product.

11. A method for preparing D-psicose, characterized in that: The fermentation culture, extract or extracted and separated enzyme solution of the engineered bacteria according to claim 7 or 8 is used as a catalyst to catalyze the reaction of the substrate glucose to produce D-psicose.

12. The preparation method according to claim 11, characterized in that: include: Fermenting and culturing the engineered bacteria according to claim 7 or 8, and obtaining a crude enzyme solution containing glucose isomerase and D-psicose 3-epimerase by breaking the bacteria; adding substrate glucose to the crude enzyme solution to obtain invert syrup; The invert sugar syrup is filtered, purified, chromatographed and concentrated in sequence to obtain D-psicose and fructose, respectively.

Images