Composition for improving skin condition comprising peptide complex as active ingredient

Abstract

The present invention relates to a use of a peptide complex in improving skin condition. The peptide complex of the present invention has an activity of alleviating skin cell damage by inhibiting activation of inflammatory responses, promotion of apoptosis, increased expression of MMP-1 and MMP-2, increased expression of RAGE, and decreased expression of glyoxalase, which are various skin-damaging actions induced by advanced glycation end products or precursors thereof in skin cells.

Description

Composition for improving skin condition containing a peptide complex as an active ingredient

[0001] [Cross-citation with related applications]

[0002] This application claims the benefit of priority from Korean Patent Application No. 10-2023-0098514, filed July 27, 2023, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to the use of a peptide complex for improving skin condition.

[0005] The skin, an organ that covers all of the body's organs and systems, protects the body from external invasion and plays a crucial role in maintaining homeostasis by conserving moisture and temperature within the body. Skin aging occurs naturally with age, but it can also be triggered by external factors such as UV rays and environmental pollution.

[0006] Meanwhile, advanced glycation end products (AGEs) are formed by the non-enzymatic reaction between reducing sugars, such as glucose, and proteins under conditions of high blood sugar. Specifically, the carbonyl group of the reducing sugar reacts with the free amino group of the protein, lysine or arginine, to form the initial glycation product, the Schiff base. The reaction progresses further to form Amadori products, and these formed compounds continuously undergo condensation, rearrangement, oxidation, cracking, and crosslinking processes to form stable and irreversible compounds, called advanced glycation end products (AGEs).

[0007] Advanced glycation end products (AGEs) are difficult to break down in the body and are known to damage organs and cells if left unbroken. In skin tissue, AGEs bind to collagen and elastin, inhibiting their turnover. This leads to tissue hardening and loss of elasticity, contributing to wrinkle formation. In addition, it is known that when advanced glycation end products bind to RAGE (Receptor for Advanced Glycation Endproducts), which is an advanced glycation end product receptor on the surface of skin cells such as keratinocytes and fibroblasts, it induces skin cell damage by promoting the production of reactive oxygen species (ROS), inflammatory response, and activation of cell death signaling pathways (Chen Cy, et al., 2022, Advanced Glycation End Products in the Skin: Molecular Mechanisms, Methods of Measurement, and Inhibitory Pathways. Front. Med. 9:837222. doi: 10.3389 / fmed.2022.837222).

[0008] Synthetic pharmaceuticals developed to inhibit AGE formation include aminoguanidine and pyridoxamine (Diabetes 2002 Sep;51(9):2826-32). However, these substances are toxic with long-term administration, posing safety and efficacy challenges when applied to the skin. Furthermore, various technologies are being developed for natural extracts that exhibit AGE-inhibiting activity and can improve skin damage (WO 2020 / 071630). However, these various natural extracts lack satisfactory activity and efficacy, making them difficult to develop into final products.

[0009] Accordingly, there is a need for the development of safe and highly active active substances to improve skin damage that may be caused by various factors as well as advanced glycation end products and their precursors.

[0010] [Prior Art Literature]

[0011] [Patent Document]

[0012] WO 2020 / 071630

[0013] [Non-patent literature]

[0014] 1. Diabetes 2002 Sep;51(9):2826-32

[0015] 2. Front. Med. May 2022, Vol.9:837222.

[0016] The present inventors have conducted research efforts to develop an active substance that can improve skin condition by preventing skin damage induced by advanced glycation end products, and as a result, experimentally proved that the peptide complex of the present invention has the activity of improving skin condition by inhibiting various cell damage actions induced by advanced glycation end products in skin cells and increasing the expression of glyoxalase that removes advanced glycation end products, thereby completing the present invention.

[0017] Accordingly, the purpose of the present invention is to provide a composition for improving skin condition.

[0018] Another object of the present invention is to provide a pharmaceutical composition for treating or preventing skin damage or skin disease.

[0019] Another object of the present invention is to provide a functional food composition for preventing or improving skin damage.

[0020] To achieve the above purpose,

[0021] One aspect of the present invention provides a composition for improving skin condition, comprising a peptide complex as an active ingredient, comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0022] Another aspect of the present invention provides a cosmetic composition for improving skin condition comprising the peptide complex as an active ingredient.

[0023] Another aspect of the present invention provides a pharmaceutical composition for treating or preventing skin inflammation or a skin disease, comprising a therapeutically effective amount of the peptide complex.

[0024] Another aspect of the present invention provides a functional food composition for improving skin condition, comprising the peptide complex as an active ingredient.

[0025] Hereinafter, the present invention will be described in detail.

[0026] Peptide complexes and their activities

[0027] The present invention relates to the use of a peptide complex comprising (i) a peptide comprising an amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising an amino acid sequence of SEQ ID NO: 2; for improving skin condition.

[0028] The term "peptide" as used herein means a linear molecule formed by amino acid residues being linked to each other by peptide bonds.

[0029] The peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention and the peptide comprising the amino acid sequence of SEQ ID NO: 2 may be used without modification, but a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination thereof of amino acid residues may be used within a range that does not affect the original activity of the peptide, for example, the activity of improving skin damage.

[0030] The peptide of the present invention can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc., within a range that does not change its activity.

[0031] The peptide of the present invention includes a peptide comprising an amino acid sequence substantially identical to a peptide comprising an amino acid sequence of SEQ ID NO: 1 or a peptide comprising an amino acid sequence of SEQ ID NO: 2, and a variant or active fragment thereof. The substantially identical amino acid sequence refers to an amino acid sequence having a sequence identity of 75% or more, for example, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, or 99% or more, with the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, respectively. In addition, the peptide may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence manufactured for a specific purpose to increase half-life or peptide stability.

[0032] The peptide of the present invention may be selected from a portion of the amino acid sequence and have N-terminal and / or C-terminal modifications induced to increase its activity. Through such N-terminal and / or C-terminal modifications, the stability of the peptide of the present invention can be significantly improved, and for example, the half-life of the peptide can be increased when administered in vivo. The term "stability" includes not only in vivo stability, which protects the peptide of the present invention from attack by in vivo protein-cleaving enzymes, but also storage stability (e.g., room temperature storage stability).

[0033] The above N-terminal modification may be a modification in which a protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) is bonded to the N-terminus of the peptide. The above C-terminal modification may be a modification in which a hydroxyl group (-OH), an amino group (-NH2), an azide, or the like is bonded to the C-terminus of the peptide, but is not limited thereto.

[0034] The peptide of the present invention can be prepared by various methods widely known in the art to which the present invention pertains. For example, the peptide of the present invention can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0035] The peptide complex of the present invention has anti-inflammatory activity in skin cells.

[0036] The peptide complex of the present invention can inhibit the activation of an inflammatory response induced by advanced glycation end products or their precursors (MGO, methylglyoxal) in skin cells.

[0037] The peptide complex of the present invention can inhibit the expression of inflammatory cytokines TNF-α, IL-1β, IL-6, and inflammatory regulator COX-2 in skin cells.

[0038] The peptide complex of the present invention can inhibit an increase in the expression levels of TNF-α, IL-1β, IL-6 and COX-2 induced by advanced glycation end products or precursors thereof in skin cells.

[0039] The peptide complex of the present invention has an activity of inhibiting apoptosis of skin cells.

[0040] The peptide complex of the present invention can inhibit apoptosis induced by advanced glycation end products or precursors thereof in skin cells.

[0041] The peptide complex of the present invention can inhibit the expression of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9, or apoptosis mediating protein Bax in skin cells, and increase the expression of anti-apoptotic protein Bcl-2.

[0042] The peptide complex of the present invention can inhibit the increase in expression of cleaved PARP-1, the increase in expression of cleaved caspase-3, the increase in expression of cleaved caspase-9, and the increase in expression of Bax induced by advanced glycation end products or precursors thereof in skin cells.

[0043] The peptide complex of the present invention can inhibit the decrease in expression of the anti-apoptotic protein Bcl-2 induced by advanced glycation endothelial cells or their precursors in skin cells.

[0044] The peptide complex of the present invention has an activity of inhibiting the expression of MMPs (Matrix Metalloproteinase) in skin cells.

[0045] The peptide complex of the present invention can inhibit the increase in expression of matrix metalloproteinases (MMPs) induced by advanced glycation end products or precursors thereof in skin cells.

[0046] The peptide complex of the present invention can inhibit an increase in the protein expression levels of MMP-1 and MMP-2 induced by advanced glycation end products or precursors thereof in skin cells.

[0047] MMPs are protein-decomposing enzymes that specifically act on collagen. Representative MMPs include MMP-1 and MMP-2. MMP-1 and MMP-2 decompose collagen, thereby reducing the elasticity of skin tissue and creating wrinkles.

[0048] The peptide complex of the present invention has an activity of inhibiting the expression of receptor advanced glycation end products (RAGE) in skin cells.

[0049] The peptide complex of the present invention can inhibit an increase in the expression level of advanced glycation end product receptor (RAGE) induced by advanced glycation end products or precursors thereof in skin cells.

[0050] When advanced glycation end products (AGEs) bind to AGE receptors on the cell surface of skin cells, they activate ROS production, inflammatory responses, and apoptotic signaling pathways through these receptors, ultimately leading to skin cell damage.

[0051] The peptide complex of the present invention inhibits ROS production of advanced glycation end products, induction of inflammatory response, and activation of apoptosis through RAGE in skin cells.

[0052] The peptide complex of the present invention has the activity of increasing the expression of glyoxalase-1 in skin cells.

[0053] The peptide complex of the present invention has an activity of inhibiting a decrease in the expression level of glyoxalase-1 induced by precursors of advanced glycation end products in skin cells, thereby resulting in an increase in the expression of glyoxalase-1.

[0054] Glyoxalase-1 is a protein that has the activity of decomposing methylglyoxal, a precursor of advanced glycation end products, and by increasing the expression of glyoxalase-1, the production of advanced glycation end products can be inhibited.

[0055] Composition for improving skin condition

[0056] One aspect of the present invention provides a composition for improving skin condition, comprising a peptide complex as an active ingredient, comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0057] The peptide complex of the present invention having the above-described activity can exhibit excellent efficacy in improving skin condition.

[0058] In one embodiment, the improvement of skin condition in the composition for improving skin condition may be alleviation of skin inflammation, improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, improvement of skin barrier, or improvement of skin damage.

[0059] In one embodiment, the improvement in skin condition in the present invention may be improvement in a skin condition worsened by advanced glycation end products or precursors thereof.

[0060] In the composition of the present invention, the weight ratio of the peptide including the amino acid sequence of SEQ ID NO: 1 and the peptide including the amino acid sequence of SEQ ID NO: 2 is not particularly limited, and for example, it may be included in a weight ratio of 0.5:2 to 2:0.5, may be included in a weight ratio of 0.5:1.5 to 1.5:0.5, and specifically may be included in a weight ratio of 1:1.

[0061] In one embodiment, the composition for improving skin condition of the present invention has one or more of the following activities (a) to (e):

[0062] (a) inhibition of expression of TNF-α, IL-1β, or IL-6, or inhibition of expression of COX-2;

[0063] (b) inhibition of expression of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9 or Bax or increase of expression of Bcl-2;

[0064] (c) inhibition of expression of MMP-1 or MMP-2;

[0065] (d) Inhibition of expression of Receptor Advanced Glycation End Products (RAGE);

[0066] (e) Increased expression of glyoxalase-1.

[0067] The composition of the present invention has anti-inflammatory activity in skin cells.

[0068] The composition of the present invention can inhibit the activation of an inflammatory response induced by advanced glycation end products or their precursors (MGO, methylglyoxal) in skin cells.

[0069] The composition of the present invention can inhibit the expression of inflammatory cytokines TNF-α, IL-1β, IL-6, and inflammatory regulator COX-2 in skin cells.

[0070] The composition of the present invention can inhibit an increase in the expression levels of TNF-α, IL-1β, IL-6 and COX-2 induced by advanced glycation end products or precursors thereof in skin cells.

[0071] The composition of the present invention has an activity of inhibiting apoptosis of skin cells.

[0072] The composition of the present invention can inhibit apoptosis induced by advanced glycation end products or precursors thereof in skin cells.

[0073] The composition of the present invention can inhibit the expression of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9, or apoptosis mediating protein Bax in skin cells, and increase the expression of anti-apoptotic protein Bcl-2.

[0074] The composition of the present invention can suppress the increase in expression of cleaved PARP-1, the increase in expression of cleaved caspase-3, the increase in expression of cleaved caspase-9, and the increase in expression of Bax induced by advanced glycation end products or precursors thereof in skin cells.

[0075] The composition of the present invention can inhibit the decrease in expression of the anti-apoptotic protein Bcl-2 induced by advanced glycation endothelial cells or their precursors in skin cells.

[0076] The composition of the present invention has an activity of inhibiting the expression of MMPs (Matrix Metalloproteinase) in skin cells.

[0077] The composition of the present invention can inhibit an increase in the expression of MMPs (Matrix Metalloproteinase) induced by advanced glycation end products or precursors thereof in skin cells.

[0078] The composition of the present invention can inhibit an increase in the protein expression levels of MMP-1 and MMP-2 induced by advanced glycation end products or precursors thereof in skin cells.

[0079] MMPs are protein-decomposing enzymes that specifically act on collagen. Representative MMPs include MMP-1 and MMP-2. MMP-1 and MMP-2 decompose collagen, thereby reducing the elasticity of skin tissue and creating wrinkles.

[0080] The composition of the present invention has an activity of inhibiting the expression of receptor advanced glycation end products (RAGE) in skin cells.

[0081] The composition of the present invention can inhibit an increase in the expression level of advanced glycation end product receptor (RAGE) induced by advanced glycation end products or precursors thereof in skin cells.

[0082] When advanced glycation end products (AGEs) bind to AGE receptors on the cell surface of skin cells, they activate ROS production, inflammatory responses, and apoptotic signaling pathways through these receptors, ultimately leading to skin cell damage.

[0083] The composition of the present invention inhibits the production of ROS from advanced glycation end products, induction of inflammatory response, and activation of apoptosis through RAGE in skin cells.

[0084] The composition of the present invention has the activity of increasing the expression of glyoxalase-1 in skin cells.

[0085] The composition of the present invention has an activity of inhibiting a decrease in the expression level of glyoxalase-1 induced by a precursor of advanced glycation end products in skin cells, thereby resulting in an increase in the expression of glyoxalase-1.

[0086] Glyoxalase-1 is a protein that has the activity of decomposing methylglyoxal, a precursor of advanced glycation end products, and by increasing the expression of glyoxalase-1, the production of advanced glycation end products can be inhibited.

[0087] The composition of the present invention can exhibit the effect of improving skin condition through the above-described activity.

[0088] The composition for improving skin condition of the present invention may include a peptide complex at a concentration of 0.01 μM to 1000 μM, specifically, the peptide complex of the present invention may include a concentration of 0.01 μM to 1000 μM; 0.05 μM to 800 μM, 0.05 μM to 700 μM, 0.05 μM to 600 μM, 0.05 μM to 500 μM, 0.05 μM to 300 μM, 0.05 μM to 200 μM; 0.1 μM to 800 μM, 0.1 μM to 700 μM, 0.1 μM to 600 μM, 0.1 μM to 500 μM, 0.1 μM to 300 μM, 0.1 μM to 200 μM; It may be included at a concentration of, but is not limited to, 1 μM to 800 μM, 1 μM to 700 μM, 1 μM to 600 μM, 1 μM to 500 μM, 1 μM to 300 μM, 1 μM to 200 μM; 5 μM to 800 μM, 5 μM to 700 μM, 5 μM to 600 μM, 5 μM to 500 μM, 5 μM to 300 μM, or 5 μM to 200 μM.

[0089] In one embodiment, the composition for improving skin condition described above may be a cosmetic composition.

[0090] The above cosmetic composition may be prepared in any formulation commonly manufactured in the technical field to which the present invention pertains, and may be a topical skin preparation. For example, it may be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleanser, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto.

[0091] The above cosmetic composition can be manufactured in various forms such as a solution, sol-gel, emulsion, oil, wax, aerosol, etc., such as a flexible toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, a powder, a hair tonic, a hair cream, a hair lotion, a hair shampoo, a hair rinse, a hair conditioner, a hair spray, a hair aerosol, a pomade, a gel, etc., but is not limited thereto.

[0092] The cosmetic composition of the present invention may include other additives such as excipients and carriers, and it is possible to apply and mix as much as necessary the usual ingredients mixed in general skin cosmetics.

[0093] When the formulation of the above cosmetic composition is in the form of a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

[0094] When the formulation of the above cosmetic composition is in the form of a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be additionally included, but is not limited thereto.

[0095] When the formulation of the above cosmetic composition is in the form of a solution or emulsion, a solvent, a solubilizer or an emulsifier may be used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0096] When the formulation of the above cosmetic composition is in the form of a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethyl sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier component.

[0097] When the formulation of the above cosmetic composition is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester may be used as a carrier component.

[0098] When the formulation of the above cosmetic composition is a hair shampoo, base ingredients for forming a shampoo, such as a thickener, a surfactant, a viscosity modifier, a moisturizer, a pH adjuster, a preservative, and essential oils, may be mixed. CDE may be used as the thickener, LES, which is an anionic surfactant, and coco betaine, which is an amphoteric surfactant, polyquat may be used as the viscosity modifier, glycerin may be used as the moisturizer, and citric acid or sodium hydroxide may be used as the pH adjuster. Grapefruit extract or the like may be used as the preservative, and in addition, essential oils such as cedarwood, peppermint, and rosemary, as well as silk amino acids, pentaol, or vitamin E may be added.

[0099] The ingredients included in the above cosmetic composition may further include, in addition to the peptide complex of the present invention and the carrier component as active ingredients, ingredients commonly used in cosmetic compositions, such as conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances, but are not limited thereto.

[0100] pharmaceutical composition

[0101] Another aspect of the present invention provides a pharmaceutical composition for treating or preventing skin inflammation or a skin disease, comprising as an active ingredient a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0102] The peptide complex of the present invention having the above-described activity can exhibit excellent efficacy in preventing or treating skin inflammation or skin diseases.

[0103] The pharmaceutical composition for treating or preventing skin inflammation or skin disease of the present invention has one or more of the following activities (a) to (e):

[0104] (a) inhibition of expression of TNF-α, IL-1β, or IL-6, or inhibition of expression of COX-2;

[0105] (b) inhibition of expression of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9 or Bax or increase of expression of Bcl-2;

[0106] (c) inhibition of expression of MMP-1 or MMP-2;

[0107] (d) Inhibition of expression of Receptor Advanced Glycation End Products (RAGE);

[0108] (e) Increased expression of glyoxalase-1.

[0109] The activity of the pharmaceutical composition of the present invention related to skin inflammation or skin disease is the same as that described in the composition for improving skin condition described above, and therefore, this is cited and will not be described again.

[0110] In the above pharmaceutical composition, the skin inflammation may be skin inflammation caused by advanced glycation end products.

[0111] In the above pharmaceutical composition, the skin disease may be an advanced glycation end product (AGEs)-related skin disease.

[0112] In the present invention, the advanced glycation end product-related skin disease refers to a skin disease caused directly or indirectly by advanced glycation end products.

[0113] The above advanced glycation end product-related skin disease may specifically be a bacterial skin infection, a skin wound, a diabetic skin wound, diabetic dermatosis, diabetic foot disease, hyperpigmentation disease, solar hyperpigmentation disease, psoriasis, or systemic lupus erythematosus, and the bacterial skin infection may be a skin infection of Staphylococcus aureus, and the hyperpigmentation disease may be solar hyperpigmentation disease, but is not limited thereto.

[0114] For information on the above-mentioned advanced glycation end products-related skin diseases, see Manli Na et al., The Journal of Infectious Diseases, 218(5): 791-800 (2018); Hwan June Kang et al., Journal of Controlled Release 333: 176-187 (2021); Jiaqi Fang et al., Journal of Investigative Dermatology, 142(10): 2591-2602 (2022); Anastasia Papagrigoraki et al., Int. J. Mol. Sci. 18, 2471 (2017); Nowak, A et al., Cells, 10, 3523 (2021); Lee et al., Kor. J. Herbol. 32(5): 7-12 (2017); Kim et al., Kor. J. Herbol. 32(4): 17-24(2017), which are incorporated herein by reference.

[0115] The term "prevention" as used herein means reducing the risk of developing skin inflammation or a skin disease, and any action that inhibits or delays the onset of a disease by preventing the skin inflammation or skin disease or one or more clinical symptoms thereof from progressing.

[0116] The term "treatment" as used herein means alleviating skin inflammation or a skin disease, and includes any action that improves or beneficially alters the symptoms of the disease by arresting or reducing the progression of one or more clinical symptoms of the skin inflammation or skin disease.

[0117] The pharmaceutical composition of the present invention may contain a therapeutically effective amount of the peptide complex.

[0118] The term "therapeutically effective amount" above means an amount sufficient to achieve the activity or efficacy of the peptide complex, which is an active ingredient of the pharmaceutical composition of the present invention, for example, an amount sufficient to achieve the efficacy of treating or preventing skin inflammation or skin disease.

[0119] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.

[0120] The pharmaceutically acceptable carriers mentioned above are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0121] The above pharmaceutical composition can be manufactured in a unit dosage form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablets, capsules or gel (e.g., hydrogel), and may additionally include a dispersant or stabilizer.

[0122] The pharmaceutical composition of the present invention may additionally include, in addition to the above ingredients, a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc., but is not limited thereto.

[0123] Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0124] The pharmaceutical composition of the present invention can be administered by any suitable route for treating skin inflammation or skin disease, for example, it can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, topical administration, transdermal administration, etc.

[0125] The dosage of the pharmaceutical composition may be, but is not limited to, 0.0001 μg to 100 mg, 0.001 μg to 100 mg, 0.01 μg to 100 mg, 0.1 μg to 100 mg, or 1.0 μg to 1000 mg per day, and may be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity.

[0126] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains, and the method can be performed. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet or capsule, and may additionally include a dispersing agent or stabilizer.

[0127] The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the treatment or prevention of skin inflammation or skin diseases.

[0128] The pharmaceutical composition of the present invention may be a topical skin preparation. The topical skin preparation is a preparation that can be applied to the outside of the skin and used. When the pharmaceutical composition of the present invention is used as a topical skin preparation, it may be applied to the skin, specifically, to a skin area where skin inflammation or a skin disease has occurred. The topical skin preparation may be a cream, a gel, an ointment, a skin emulsifier, a skin suspension, a transdermal patch, a drug-containing bandage, a lotion, or a combination thereof. The topical skin preparation may be appropriately mixed with ingredients commonly used in topical skin preparations such as cosmetics or pharmaceuticals, such as aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, or a combination thereof, as needed. The above skin external preparation may also appropriately contain metal sequestrants such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid; caffeine, tannin, bellapamil, licorice extract, glabridin, hot water extract of the fruit of Kalin; various herbal medicines; tocopheryl acetate, glycyrrhizic acid, tranexamic acid and derivatives or salts thereof; and sugars such as vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, and trehalose.

[0129] Food composition

[0130] Another aspect of the present invention provides a functional food composition for improving skin condition, comprising as an active ingredient a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0131] The above skin condition improvement may be alleviation of skin inflammation, improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, improvement of skin barrier, or improvement of skin damage.

[0132] The activity related to improving skin condition in the functional food composition of the present invention is the same as that described in the composition for improving skin condition described above, and therefore, this is cited and will not be described again.

[0133] In the functional food composition of the present invention, the peptide complex may be included in an appropriate amount selected within a range of 10 wt% or less, specifically 0.000001 wt% to 10 wt%, based on the total composition weight.

[0134] The functional food composition of the present invention may include a food-effective amount of a peptide complex and a food-acceptable carrier.

[0135] The functional food composition of the present invention comprises not only the peptide complex as the effective ingredient, but also components commonly added during food manufacturing, such as proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates mentioned above include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, and erythritol. Natural flavoring agents, thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

[0136] In addition to the above-described ingredients, the functional food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may contain fruit pulp for the production of natural fruit juices and fruit juice drinks and vegetable drinks. For example, when the functional food composition of the present invention is produced as a drink, in addition to the peptide, which is an effective ingredient of the present invention, citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia ulmoides extract, jujube extract, licorice extract, etc. may be additionally contained.

[0137] There are no specific restrictions on the types of the above functional foods. Examples of the above functional foods or foods include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea drinks, alcoholic beverages, vitamin complexes, dairy products, fermented milk, etc., and all functional foods or foods in the conventional sense are included.

[0138] Uses of the peptide complex of the present invention

[0139] In another aspect of the present invention, there is provided a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2; for use in improving skin conditions, or for use in treating, preventing, or improving skin inflammation or skin diseases.

[0140] In another aspect of the present invention, there is provided a use of a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2; for the manufacture of a medicament, cosmetic, or health functional food for improving skin condition, treating, preventing, or improving skin inflammation or skin disease.

[0141] In another aspect of the present invention, a method for improving a skin condition, or a method for treating, preventing, or improving skin inflammation or a skin disease, is provided, comprising administering to a subject in need of improving a skin condition, or a subject in need of treating, preventing, or improving skin inflammation or a skin disease, a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO: 2.

[0142] The subject may be a human or a non-human animal. Additionally, the subject may be a human or a non-human animal having skin inflammation or a skin disease.

[0143] All of the contents described above regarding the peptide complex, composition, cosmetic composition, pharmaceutical composition, and functional food composition of the present invention can be equally applied to the above-described method for improving skin condition, treating, preventing, or improving skin damage or skin disease, and are not described repeatedly to avoid excessive complexity of the specification.

[0144] The peptide complex of the present invention has an activity of inhibiting skin cell damage. The peptide complex of the present invention has an activity of improving skin cell damage by inhibiting various skin damage actions induced by advanced glycation end products or their precursors in skin cells, such as activation of inflammatory response, promotion of apoptosis, increased expression of MMP-1 and MMP-2, increased expression of RAGE, and decreased expression of glyoxalase. However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0145] Figure 1a shows the results of decreasing the increased expression levels of inflammatory response factors TNF-α, IL-1β, and IL-6 by AGE-BSA treatment in HaCaT keratinocytes by treatment with the peptide complex, and Figure 1b is a graph quantifying this by measuring the intensity of the bands in Figure 1a.

[0146] Figure 2a shows the results of the increased expression levels of inflammatory response factors TNF-α, IL-1β, and IL-6 by MGO treatment in HaCaT keratinocytes, which are reduced by treatment with the peptide complex, and Figure 2b is a graph quantifying this by measuring the intensity of the bands in Figure 2a.

[0147] Figure 3a shows the results of the increased expression levels of inflammatory response factors COX-2, IL-1β, and IL-6 in NIH3T3 fibroblasts by AGE-BSA treatment, which are reduced by treatment with the peptide complex, and Figure 3b is a graph quantifying this by measuring the intensity of the bands in Figure 3a.

[0148] Figure 4a shows the results of the increased expression levels of apoptosis regulators, cleaved PARP-1, cleaved caspase-3, and cleaved caspase-9, and apoptosis mediator protein, Bax, by AGE-BSA treatment in HaCaT keratinocytes, which were reduced by treatment with the peptide complex, and Figure 4b is a graph quantifying this by measuring the intensity of the bands in Figure 4a.

[0149] Figure 5a shows that the increased expression levels of cleaved caspase-3 and cleaved caspase-9, which are apoptosis regulators, by MGO treatment in HaCaT keratinocytes are reduced by treatment with the peptide complex, and the decreased expression levels of Bcl-2, which is an anti-apoptotic protein, by MGO treatment are increased by treatment with the peptide complex. Figure 5b is a graph quantifying this by measuring the intensity of the bands in Figure 5a.

[0150] Figure 6a shows that the increased expression levels of apoptosis regulators, cleaved PARP-1, cleaved caspase-3, and cleaved caspase-9, and apoptosis mediator protein, Bax, were decreased by treatment with the peptide complex in NIH3T3 fibroblasts treated with AGE-BSA, and that the decreased expression levels of anti-apoptotic protein, Bcl-2, were increased by treatment with the peptide complex in AGE-BSA, and Figure 6b is a graph quantifying this by measuring the intensity of the bands in Figure 6a.

[0151] Figure 7a shows that the expression levels of MMP-1 and MMP-2, which were increased by AGE-BSA treatment in HaCaT keratinocytes, were reduced by treatment with a peptide complex, and Figure 7b is a graph quantifying this by measuring the intensity of the bands in Figure 7a.

[0152] Figure 8a shows the results showing that the expression levels of MMP-1 and MMP-2 increased by MGO treatment in HaCaT keratinocytes are reduced by treatment with a peptide complex, and Figure 8b is a graph quantifying this by measuring the intensity of the bands in Figure 8a.

[0153] Figure 9a shows the results showing that the expression level of MMP-1 increased by AGE-BSA treatment in NIH3T3 fibroblasts is reduced by treatment with a peptide complex, and Figure 9b is a graph quantifying this by measuring the intensity of the bands in Figure 9a.

[0154] Figure 10a shows the results of reducing the expression level of RAGE, which was increased by AGE-BSA treatment in HaCaT keratinocytes, by treatment with a peptide complex, and Figure 10b is a graph quantifying this by measuring the intensity of the bands in Figure 10a.

[0155] Figure 11a shows the results showing that the expression level of RAGE increased by MGO treatment in HaCaT keratinocytes is reduced by treatment with a peptide complex, and Figure 11b is a graph quantifying this by measuring the intensity of the bands in Figure 11a.

[0156] Figure 12a shows the results showing that the expression level of RAGE increased by AGE-BSA treatment in NIH3T3 fibroblasts is reduced by treatment with a peptide complex, and Figure 12b is a graph quantifying this by measuring the intensity of the bands in Figure 12a.

[0157] Figure 13a shows the results showing that the expression level of glyoxalase-1, which was reduced by MGO treatment in HaCaT keratinocytes, was increased by treatment with a peptide complex, and Figure 13b is a graph quantifying this by measuring the intensity of the bands in Figure 13a.

[0158] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0159] Manufacturing Example 1: Manufacturing of a peptide complex

[0160] Using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), peptides having amino acid sequences of SEQ ID NO: 1 and peptides having amino acid sequences of SEQ ID NO: 2 as shown in Table 1 below were synthesized, respectively, and these synthesized peptides were purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was ACQUITY UPLC BEH300 C18 (2.1 mm Y 100 mm, 1.7 μm, Waters Co, USA).

[0161] Amino acid sequence sequence number KGSATGWMA1LKTRN2

[0162] Afterwards, a peptide complex was prepared by mixing equal amounts of a peptide having an amino acid sequence of sequence number 1 and a peptide having an amino acid sequence of sequence number 2, and the efficacy of the peptide complex prepared in the following experimental example was evaluated.

[0163] Experimental Example 1: Measurement of the expression level of inflammatory cytokines in skin cells.

[0164] The effect of the peptide complex prepared in Manufacturing Example 1 on the expression level of inflammatory cytokines induced by AGE or its precursor MGO in skin cells was evaluated. Human skin keratinocyte cell line HaCaT keratinocytes and NIH3T3 fibroblasts were cultured at 2x10 5The cells were seeded in a 6-well plate at a density of 10 cells / well and cultured for 24 hours. After that, the cells were pretreated with the peptide complex prepared in Manufacturing Example 1 at concentrations of 50 μM, 100 μM, and 200 μM for 1 hour. The pretreated cells were treated with 200 μg / mL AGE-BSA or 200 μM MGO and cultured in a CO2 incubator at 37°C for 48 hours. At this time, the control wells of the AGE-BSA treatment experiment were treated with 200 μg / mL BSA. After washing twice with PBS, easy-BLUE TM Total RNA was isolated using iNtRON (Cat. No.: 17061, Korea). After quantifying the isolated total RNA, cDNA was synthesized using an RT kit (enzynomics, Cat. No.: RT200, Korea), and PCR was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used are shown in Table 2.

[0165] 세포주프라이머서열(5' -> 3')서열번호HaCaTTNF-α ForwardAACATCCAACCTTCCCAAACG3TNF-α ReverseGACCCTAAGCCCCCAATTCTC4IL-1β ForwardTTCGACACATGGGATAACGA5IL-1β ReverseTCTTTCAACACGCAGGACAG6IL-6 ForwardAAAGAGGCACTGCCAGAAAA7IL-6 ReverseATCTGAGGTGCCCATGCTAC8NIH3T3COX-2 ForwardTGAGTGGTAGCCAGCAAAGC9COX-2 ReverseCTGCAGTCCAGGTTCAATGG10IL-1β ForwardCCACAGACCTTCCAGGAGAATG11IL-1β ReverseGTGCAGTTCAGTGATCGTACAGG12IL-6 ForwardCACGGCCTTCCCTACTTCAC13IL-6 ReverseAGCCACTCCTTCTGTGACTC14HaCaT / NIH3T3GAPDH ForwardGGAGCCAAAAGGGTCATCAT15GAPDH ReverseGTGATGGCATGGACTGTGGT16

[0166] As factors of the inflammatory response induced by AGE-BSA in HaCaT keratinocytes, the mRNA expression levels of inflammatory cytokines TNF-α, IL-1β, and IL-6 were measured, and the measurement results are shown in Figs. 1a and 1b. As shown in Figs. 1a and 1b, in the negative control group, the mRNA expression levels of TNF-α, IL-1β, and IL-6 increased by AGE-BSA treatment compared to the control group, and by treatment with the peptide complex of the present invention, the mRNA expression levels of TNF-α, IL-1β, and IL-6 decreased compared to the negative control group. In addition, as factors of the inflammatory response induced by MGO in HaCaT keratinocytes, the mRNA expression levels of inflammatory cytokines TNF-α, IL-1β, and IL-6 were measured, and the measurement results are shown in Figs. 2a and 2b. As shown in Figures 2a and 2b, in the negative control group, the mRNA expression levels of TNF-α, IL-1β, and IL-6 increased by MGO treatment compared to the control group, and by treatment with the peptide complex of the present invention, the mRNA expression levels of TNF-α, IL-1β, and IL-6 decreased compared to the negative control group.

[0167] As factors of the inflammatory response induced by AGE-BSA in NIH3T3 fibroblasts, the mRNA expression levels of COX-2, an inflammatory mediator, and IL-1β and IL-6, inflammatory cytokines, were measured, and the measurement results are shown in Figs. 3a and 3b. As shown in Figs. 3a and 3b, in the negative control group, the mRNA expression levels of COX-2 and IL-1β increased compared to the control group by AGE-BSA treatment, and by treatment with the peptide complex of the present invention, the mRNA expression levels of COX-2 and IL-6 decreased compared to the negative control group. In the case of IL-1β, when the peptide complex was treated at a concentration of 50 μM, the mRNA expression level was slightly higher than that of the negative control group, but when treated at concentrations of 100 μM and 200 μM, the mRNA expression level decreased.

[0168] Experimental Example 2: Measurement of the expression levels of apoptosis regulators, MMPs, and RAGE in skin cells.

[0169] 1. Experimental method

[0170] To evaluate the skin damage improvement effect of the peptide complex manufactured in Manufacturing Example 1, the expression levels of apoptosis regulators, MMPs, and RAGE in skin cells were confirmed through Western blot.

[0171] Specifically, 2x10 human skin keratinocyte cell line HaCaT keratinocytes and NIH3T3 fibroblasts 5The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. After that, the peptide complex prepared in Manufacturing Example 1 was pretreated to the cells at concentrations of 50 μM, 100 μM, and 200 μM for 1 hour. The pretreated cells were treated with 200 μg / mL AGE-BSA or 200 μM MGO and cultured in a CO2 incubator at 37°C for 48 hours. At this time, 200 μg / mL BSA was treated to the control well of the AGE-BSA treatment experiment. After washing twice with PBS, the cells were lysed by adding cell lysis buffer. After treatment with 5X sample buffer, SDS-PAGE was performed using a 10% SDS-PAGE gel, and the proteins separated by SDS-PAGE were transferred to a PVDF membrane. Blocking was performed at room temperature for 1 hour using 5% skim milk. The primary antibodies listed in Table 3 below were diluted 1:1000 in 5% skim milk and reacted with the membrane for 2 hours, and washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 10 minutes each. Afterwards, the secondary antibodies corresponding to each primary antibody listed in Table 3 below were diluted 1:3000 in 5% skim milk and reacted with the membrane for 2 hours. After treatment with ECL solution (GE Healthcare, Cat. No.: RPN2232, USA), images were captured using ImageQuant 800 (Cytiva, Cat. No: 29-3994-81, USA).

[0172] 1차 항체2차 항체Cell lineAntibodies제조사Cat. No.Antibodies제조사Cat. No.HaCaTCleaved PARP-1cell signaling technology (USA)9541sPeroxidase-AffiniPure Goat Anti-Rabbit IgG (H+L)Jackson ImmunoResearch (USA)111-035-003NIH3T3Santa Cruz Biotechnology (USA)sc56196Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (USA)115-035-003HaCaT / NIH3T3Cleaved caspase-3abcam (UK)ab184787Peroxidase-AffiniPure Goat Anti-Rabbit IgG (H+L)Jackson ImmunoResearch (USA)111-035-003HaCaT / NIH3T3Cleaved caspase-9abcam (UK)ab25758Peroxidase-AffiniPure Goat Anti-Rabbit IgG (H+L)Jackson ImmunoResearch (USA)111-035-003HaCaTBaxSanta Cruz Biotechnology (USA)sc20067Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (USA)115-035-003NIH3T3Santa Cruz Biotechnology (USA)sc7480Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (USA)115-035-003HaCaT / NIH3T3Bcl-2Santa Cruz Biotechnology (USA)sc7382Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch(USA)115-035-003HaCaT / NIH3T3MMP-1abcam (UK)ab137332Peroxidase-AffiniPure Goat Anti-Rabbit IgG (H+L)Jackson ImmunoResearch (USA)111-035-003HaCaT / NIH3T3MMP-2abcam (UK)ab86607Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (USA)115-035-003HaCaT / NIH3T3RAGESanta Cruz Biotechnology (USA)sc33662Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (USA)115-035-003HaCaT / NIH3T3α-tubulinSanta Cruz Biotechnology (USA)sc69969Peroxidase-AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (USA)115-035-003

[0173] 2. Observation of the effect of inhibiting skin cell death

[0174] To confirm the effect of the peptide complex on inhibiting skin cell death, the expression levels of apoptosis regulatory factors were measured, and the measurement results are shown in Figs. 4a, 4b, 5a, 5b, 6a, and 6b. Cleaved PARP-1, cleaved caspase-3, and cleaved caspase-9 are characteristic marker proteins that can confirm apoptosis, Bax is an apoptosis mediating protein, and Bcl-2 is an anti-apoptotic protein.

[0175] First, the expression levels of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9, and Bax, which are apoptosis regulatory factors induced by AGE-BSA treatment in HaCaT keratinocytes, were measured, and the measurement results are shown in Figs. 4a and 4b. As shown in the negative control group in Figs. 4a and 4b, the expression levels of cleaved caspase-3, cleaved caspase-9, and Bax increased by AGE-BSA treatment, and it was confirmed that the increased expression levels of the apoptosis regulatory proteins were decreased by peptide complex treatment.

[0176] In addition, the expression levels of cleaved caspase-3, cleaved caspase-9, and Bcl-2, which are apoptosis regulatory factors whose expression levels were changed by MGO treatment in HaCaT keratinocytes, were measured, and the measurement results are shown in Figures 5a and 5b. As shown in the negative control group of Figures 5a and 5b, the expression level of cleaved caspase-3 increased by MGO treatment, the expression level of cleaved caspase-9 was not changed, and the expression level of Bcl-2, an anti-apoptotic factor, decreased. However, as shown in the experimental group, the expression levels of cleaved caspase-3 and caspase-9 decreased by treatment with the peptide complex. In addition, the expression level of Bcl-2, which was decreased by MGO treatment, was increased by treatment with the peptide complex.

[0177] The expression levels of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9, Bax, and Bcl-2, which are apoptosis regulatory factors whose expression levels are changed by AGE-BSA treatment in NIH3T3 fibroblasts, were measured, and the measurement results are shown in Fig. 6a and Fig. 6b. As shown in the negative control group in Fig. 6a and Fig. 6b, the expression levels of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9, and Bax increased by AGE-BSA treatment, while the expression level of Bcl-2, an anti-apoptotic factor, decreased. However, as shown in the experimental group, the expression levels of cleaved PARP-1, cleaved caspase-3, and Bax, which were increased by AGE-BSA treatment, were decreased by peptide complex treatment. In the case of Bcl-2, the expression level of Bcl-2, which was reduced in the negative control group, increased in a concentration-dependent manner by treatment with the peptide complex.

[0178] In summary, it was confirmed that the peptide complex of the present invention inhibits the expression of apoptosis-promoting factors induced by AGE-BSA or MGO in HaCaT keratinocytes and NIH3T3 fibroblast cells and promotes the expression of anti-apoptotic factors, thereby inhibiting cell death and thereby improving skin cell damage.

[0179] 3. Observation of the effect of inhibiting MMP expression

[0180] Matrix Metalloproteinases (MMPs) are proteolytic enzymes that specifically target collagen. MMP-1 and MMP-2 can degrade collagen, thereby reducing skin tissue elasticity and contributing to wrinkle formation. Therefore, we examined whether treating skin cells with the peptide complex of the present invention reduced the expression level of MMPs, and the results are shown in Figures 7a, 7b, 8a, 8b, 9a, and 9b.

[0181] First, we confirmed the expression levels of MMP-1 and MMP-2 induced by AGE-BSA treatment in HaCaT keratinocytes and the changes in the expression levels of MMP-1 and MMP-2 upon peptide complex treatment, and the measurement results are shown in Figures 7a and 7b. As shown in Figures 7a and 7b, the expression levels of MMP-1 and MMP-2 increased in the negative control group upon AGE-BSA treatment. However, as shown in the experimental group, the protein expression levels of MMP-1 and MMP-2 decreased upon treatment with the peptide complex.

[0182] In addition, we confirmed the increased expression levels of MMP-1 and MMP-2 by MGO treatment in HaCaT keratinocytes and the change in the expression levels of MMP-1 and MMP-2 when treated with a peptide complex, and the measurement results are shown in Figures 8a and 8b. As shown in Figures 8a and 8b, the expression levels of MMP-1 and MMP-2 increased by MGO treatment in the negative control group. However, as shown in the experimental group, when treated with a peptide complex, the protein expression levels of MMP-1 and MMP-2 decreased compared to the negative control group.

[0183] The expression level of MMP-1 increased by AGE-BSA treatment in NIH3T3 fibroblasts and the change in the expression level of MMP-1 when treated with a peptide complex were confirmed, and the measurement results are shown in Figures 9a and 9b. As shown in Figures 9a and 9b, the expression level of MMP-1 increased by treatment with AGE-BSA in the negative control group. However, as shown in the experimental group, when treated with the peptide complex, the protein expression level of MMP-1 decreased compared to the negative control group.

[0184] In summary, it was confirmed that the peptide complex of the present invention inhibits the expression of MMP-1 and MMP-2 increased by AGE-BSA or MGO treatment in HaCaT keratinocytes and NIH3T3 fibroblasts, thereby improving skin damage such as enhancing the elasticity of skin tissue and preventing wrinkle formation by reducing the degradation of collagen.

[0185] 4. Observation of the effect of suppressing RAGE expression

[0186] RAGE (Receptor for Advanced Glycation Endproducts) is a transmembrane receptor protein present on the cell surface to which advanced glycation end products can bind. It is known that when advanced glycation end products bind to RAGE in skin cells such as keratinocytes and fibroblasts, it can induce skin cell damage by inducing ROS production, inflammatory response, and activation of apoptotic signaling pathways within the skin cells. When the peptide complex of the present invention was treated to skin cells, it was confirmed whether the expression level of RAGE was reduced, and the results are shown in Figs. 10a, 10b, 11a, 11b, 12a, and 12b.

[0187] First, we examined the expression levels of RAGE induced by AGE-BSA treatment in HaCaT keratinocytes and the changes in RAGE expression levels induced by the peptide complex. As shown in Figures 10a and 10b, RAGE expression levels increased in the negative control group following AGE-BSA treatment. However, as shown in the experimental group, treatment with the peptide complex resulted in a concentration-dependent decrease in RAGE protein expression levels.

[0188] Furthermore, we examined the expression levels of RAGE induced by MGO treatment in HaCaT keratinocytes and the changes in RAGE expression levels induced by the peptide complex. As shown in Figures 11a and 11b, RAGE expression levels increased in the negative control group due to MGO treatment. However, as shown in the experimental group, when treated with the peptide complex, RAGE protein expression levels decreased compared to the negative control group at peptide complex concentrations of 100 μM or higher.

[0189] We examined the expression levels of RAGE induced by AGE-BSA treatment in NIH3T3 fibroblasts and the changes in RAGE expression levels induced by the peptide complex. As shown in Figures 12a and 12b, RAGE expression levels increased in the negative control group following AGE-BSA treatment. However, as shown in the experimental group, RAGE expression levels decreased compared to the negative control group when treated with the peptide complex.

[0190] In summary, we confirmed that the increased expression level of RAGE induced by AGE-BSA or MGO in HaCaT keratinocytes and NIH3T3 fibroblast cells, which are skin cells, was reduced by treatment with the peptide complex of the present invention. Through this, we confirmed that the peptide complex can improve skin damage by reducing the expression level of RAGE increased by AGE-BSA and MGO, thereby reducing the binding of advanced glycation end-products and suppressing ROS production and the activation of inflammatory response and apoptosis signaling pathways.

[0191] Experimental Example 3: Confirming the expression level of glyoxalase-1, which inhibits the production of advanced glycation end products.

[0192] Active dicarbonyl compounds, such as glyoxal, methylglyoxal, and 3-deoxyglucosone, can crosslink with proteins to form advanced glycation end products (AGEs). Glyoxalase-1 is a detoxifying enzyme that converts methylglyoxal to lactic acid, thereby eliminating it.

[0193] The effect of the peptide complex prepared in Example 1 on the expression level of glyoxalase-1 in HaCaT keratinocytes was evaluated using RT-PCR. First, human HaCaT keratinocytes were cultured at 2x10 5 The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. Afterwards, the cells were pretreated with the peptide complex prepared in Manufacturing Example 1 at concentrations of 50 μM, 100 μM, and 200 μM for 1 hour. The pretreated cells were treated with 200 μM MGO and cultured in a CO2 incubator at 37°C for 24 hours. After washing twice with PBS, easy-BLUE TM Total RNA was isolated using (iNtRON, Cat. No.: 17061, Korea). After quantifying the isolated total RNA, cDNA was synthesized using an RT kit (enzynomics, Cat. No.: RT200, Korea), and PCR was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used are shown in Table 4 below.

[0194] Cell line primer sequence (5' -> 3') Sequence number HaCaTGlyoxalase-1 ForwardGGTCCCGTCGTCTGTGATAC17Glyoxalase-1 ReverseTAGCTTTTCTGGAGAGCGCC18

[0195] As a result, as shown in Figures 13a and 13b, the expression level of glyoxalase-1 decreased in the negative control group due to MGO treatment. However, as shown in the experimental group, it was confirmed that the expression level of glyoxalase-1 increased when the peptide complex was treated. Therefore, it was confirmed that the peptide complex can improve skin damage by inhibiting the production of advanced glycation end products by increasing the expression of glyoxalase-1, which was decreased by MGO treatment, and thereby enabling the decomposition of methylglyoxal, a precursor of advanced glycation end products.

[0196] In summary, these results indicate that treatment of skin cells with the peptide complex of the present invention reduces the expression of inflammatory response factors induced by advanced glycation end products (AGEs), exhibiting an anti-inflammatory effect, and inhibiting cell death by reducing the expression of apoptotic factors. In addition, it can be seen that the expression of collagenase is reduced, thereby enhancing skin tissue elasticity and preventing wrinkle formation. In addition, it was confirmed that treatment with the peptide complex of the present invention reduces the expression of RAGE, which is an AGE receptor, thereby reducing the binding of AGEs, thereby inhibiting ROS production and the activation of inflammatory response and apoptotic signaling pathways, thereby improving skin damage. It was confirmed that the peptide complex of the present invention can improve skin damage by inhibiting the production of AGEs by increasing the expression level of glyoxalase-1, which was reduced by MGO, and decomposing methylglyoxal, a precursor of AGEs.

[0197] Although representative embodiments of the present invention have been described above as examples, the scope of the present invention is not limited to the specific embodiments described above, and those skilled in the art will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

A composition for improving skin condition, comprising a peptide complex as an active ingredient, comprising:

1. (i) a peptide comprising an amino acid sequence of sequence number 1; and (ii) a peptide comprising an amino acid sequence of sequence number 2.

2. In claim 1, A composition for improving skin condition, wherein the improvement of the skin condition is at least one selected from the group consisting of alleviating skin inflammation, improving skin aging, promoting skin regeneration, improving skin elasticity, improving skin wrinkles, improving skin barrier, or improving skin damage.

3. In claim 1, The composition is a composition for improving skin condition, having one or more of the following activities (a) to (e): (a) inhibition of expression of TNF-α, IL-1β, or IL-6, or inhibition of expression of COX-2; (b) inhibition of expression of cleaved PARP-1, cleaved caspase-3, cleaved caspase-9 or Bax or increase of expression of Bcl-2; (c) inhibition of expression of MMP-1 or MMP-2; (d) inhibition of expression of receptor for advanced glycation end products (RAGE); and (e) Increased expression of glyoxalase-1.

4. In claim 1, The above composition is a cosmetic composition, a composition for improving skin condition.

5. In claim 4, A composition for improving skin condition, wherein the commercial cosmetic composition is in any one formulation selected from the group consisting of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray.

6. A pharmaceutical composition for treating or preventing skin inflammation or a skin disease, comprising a therapeutically effective amount of a peptide complex comprising (i) a peptide comprising the amino acid sequence of SEQ ID NO: 1; and (ii) a peptide comprising the amino acid sequence of SEQ ID NO:

2.

7. In claim 6, A pharmaceutical composition, wherein the skin disease is a disease selected from the group consisting of bacterial skin infection, skin wound, diabetic skin wound, diabetic dermatosis, diabetic foot disease, hyperpigmentation disease, solar hyperpigmentation disease, psoriasis, and systemic lupus erythematosus.

8. A functional food composition for improving skin condition, comprising a peptide complex as an active ingredient, comprising (i) a peptide comprising an amino acid sequence of sequence number 1; and (ii) a peptide comprising an amino acid sequence of sequence number 2.

9. In claim 8, A functional food composition for preventing or improving skin conditions, wherein the improvement in skin conditions is at least one selected from the group consisting of alleviating skin inflammation, improving skin aging, promoting skin regeneration, improving skin elasticity, improving skin wrinkles, improving skin barrier, or improving skin damage.

Images