Library building method for RNA direct sequencing

Abstract

Provided is a library building method for RNA direct sequencing, comprising the following steps: S0, preparing a hybrid duplex: using an RNA sequence to be sequenced as a template, and forming an RNA / DNA hybrid duplex by means of reverse transcription; S1, preparing an adapter complex-transposase complex: co-incubating a non-RNA polynucleotide, a helicase and a transposase to obtain an adapter complex-transposase complex; and S2, preparing a sequencing library: the adapter complex-transposase complex is used to perform random cleavage on the RNA / DNA hybrid duplex to obtain a fragmented hybrid duplex; and then, the transposase is detached to obtain an adapter complex, and the adapter complex is linked to the fragmented hybrid duplex to obtain a sequencing library; and S3, performing nanopore sequencing on the sequencing library in step S2. A novel method for measuring a base sequence of a target RNA polynucleotide is realized, the linking efficiency of RNA library building is improved, and the process of RNA sequencing library building is simplified.

Description

A library construction method for direct RNA sequencing Technical Field

[0001] The present invention relates to the technical field of RNA sequencing, and in particular to a library construction method for direct RNA sequencing. Background Art

[0002] Nanopore gene sequencing is a revolutionary next-generation sequencing technology. Its real-time, portable, ultra-long read lengths, and ability to detect epigenetic modifications on nucleic acids make it a promising future for gene sequencing. Furthermore, nanopore sequencing captures nucleic acid sequence information by detecting changes in channel current caused by the passage of single-stranded nucleic acids through a pore. Therefore, nanopore sequencing can sequence not only DNA but also RNA.

[0003] Compared to DNA, RNA typically exists as a single strand and possesses a wide variety of base modifications, with over a hundred identified to date. Because RNA possesses a rich array of secondary and higher-order structures, direct sequencing of single-stranded RNA can significantly impact the uniformity of its passage through the nanopore, hindering sequencing efficiency and complicating signal decoding, leading to reduced sequencing accuracy. Therefore, it is crucial to develop optimized library construction methods that can control the pore-passing efficiency and translocation speed of the nucleic acids being tested and improve sequencing accuracy.

[0004] CN110168104A discloses a method for characterizing a polynucleotide, the method comprising: (i) combining in solution: a) a construct comprising a double-stranded polynucleotide having a template strand and a complementary strand, wherein the template strand and the complementary strand are not covalently linked, and b) a nanopore, wherein one or more tags bound to a portion of the construct are conjugated to the nanopore, wherein the construct and the nanopore are combined under conditions in which the construct is bound to the nanopore; (ii) providing conditions to allow the template strand of the construct to enter the nanopore, so as to allow separation of the template strand and translocation of at least a portion of the template strand through the nanopore; (iii) measuring a change in a property indicative of translocation of the template strand through the nanopore; and (iv) characterizing the polynucleotide based on the change in the property measured when the template strand translocates through the nanopore. However, the efficiency of this method needs to be further improved, and the complexity of the method needs to be reduced.

[0005] Therefore, there is still a need to develop better RNA library construction methods to improve library construction efficiency while reducing the complexity and cost of the library construction process.

[0006] Summary of the Invention

[0007] In response to the shortcomings of the prior art, the present invention provides a method for constructing a library for direct RNA sequencing, which solves the problems in the prior art in terms of library construction efficiency and complexity, which need to be further improved.

[0008] In one aspect, the present invention provides a method for constructing a library for direct RNA sequencing, comprising the following steps:

[0009] S0 Preparation of hybrid double strands: Using the RNA sequence to be sequenced as a template, reverse transcription is performed to form RNA / DNA hybrid double strands;

[0010] S1: preparing an adapter complex-transposase complex: incubating a non-RNA polynucleotide, a helicase, and a transposase together to obtain an adapter complex-transposase complex;

[0011] S2: Preparation of sequencing library: RNA / DNA hybrid duplexes are randomly sheared using the adapter complex-transposase complex to obtain fragmented hybrid duplexes. The transposase then falls off to obtain the adapter complex, which is then ligated to the fragmented hybrid duplexes to obtain the sequencing library.

[0012] S3: Perform nanopore sequencing on the sequencing library in step S2.

[0013] Furthermore, in step S1, the non-RNA polynucleotide includes a first segment for guiding the fragment to be sequenced into the nanopore, a second segment for binding to the helicase, a third segment for controlling the speed of the helicase moving along the fragment to be sequenced, and a fourth segment for binding to the transposase and connecting the fragment to be sequenced.

[0014] In one embodiment of the present invention, the sequence of the non-RNA polynucleotide is shown as SEQ ID NO.1.

[0015] Furthermore, the non-RNA polynucleotide is modified with a linker sequence 2 and / or a linker sequence 3, and the linker sequence 2 is partially or fully complementary to the fourth segment;

[0016] The linker sequence 3 is complementary to the non-RNA polynucleotide portion;

[0017] Preferably, the end of the linker sequence 2 is connected to an anchor group,

[0018] In one embodiment of the present invention, the nucleotide sequence of the linker sequence 2 is shown as SEQ ID NO.2, and the nucleotide sequence of the linker sequence 3 is shown as SEQ ID NO.3.

[0019] Furthermore, the step of modifying the non-RNA polynucleotide is: mixing the non-RNA polynucleotide, the linker sequence 2, and the linker sequence 3 and performing annealing treatment.

[0020] Furthermore, the molar ratio of the non-RNA polynucleotide, the linker sequence 2, and the linker sequence 3 is 1:1.1:1.1.

[0021] Furthermore, in step S1, the molar ratio of the non-RNA polynucleotide, the helicase, and the transposase is 1:5:1;

[0022] Preferably, the co-incubation temperature is 20°C-30°C, and the time is 10-60 minutes.

[0023] Furthermore, in step S2, during the shearing and connecting process, the temperature is 37° C.-55° C., and the time is 30-60 min.

[0024] Furthermore, in step S2, the ligation is performed under the action of T4 DNA ligase.

[0025] Furthermore, in step S3, the nanopore includes an MspA nanopore.

[0026] In a second aspect, the present invention provides an adapter complex-transposase complex for direct RNA sequencing, comprising a non-RNA polynucleotide, a helicase, and a transposase;

[0027] The non-RNA polynucleotide includes a first segment for guiding the fragment to be sequenced into the nanopore, a second segment for binding to the helicase, a third segment for controlling the speed of the helicase moving along the fragment to be sequenced, and a fourth segment for binding to the transposase and connecting the fragment to be sequenced;

[0028] Preferably, the sequence of the non-RNA polynucleotide is as shown in SEQ ID NO.1;

[0029] The non-RNA polynucleotide is modified with a linker sequence 2 and / or a linker sequence 3, wherein the linker sequence 2 is partially or fully complementary to the fourth segment;

[0030] The linker sequence 3 is complementary to the non-RNA polynucleotide portion;

[0031] Preferably, the end of the linker sequence 3 is connected to an anchor group,

[0032] Preferably, the nucleotide sequence of the linker sequence 2 is shown as SEQ ID NO.2, and the nucleotide sequence of the linker sequence 3 is shown as SEQ ID NO.3.

[0033] Terms and Definitions

[0034] "Adapter complex" refers to a complex formed by the ligation of a non-RNA polynucleotide and a helicase.

[0035] "Fragments to be sequenced" refer to single RNA strands or single DNA strands in the fragmented hybrid duplexes in the sequencing library.

[0036] It is understood that when the adaptor complex-transposase complex randomly cleaves the RNA / DNA hybrid chain, there may be two or more adaptor complex-transposase complexes.

[0037] It is understood that the RNA in the present invention can be selected from eukaryotic mature mRNA, prokaryotic mRNA, tRNA, ribosomal RNA, etc.

[0038] It is understood that the transposases of the present invention include but are not limited to Tn5 transposase and its complex, MuA transposase and its complex. Preferably, the transposase is Tn5 transposase; more preferably, the amino acid sequence of the transposase is shown in SEQ ID NO.9.

[0039] It is understood that the helicases in the present invention include but are not limited to DEAD-box, DEAH-box, DExH, RecQ and SW1 / SNF, pif1, BLM, and WRN.

[0040] It is understood that the anchoring groups of the present invention include cholesterol, tocopherol, palmitate, thiol, lipid, and biotin groups.

[0041] It is understood that the purification of the transcription product in the present invention includes but is not limited to purification using an RNA recovery kit, TRIzol extraction, or RNA Clean XP beads purification.

[0042] It is understood that the reverse transcriptase in the present invention includes but is not limited to NEB's II Reverse Transcriptase, Novezan II 1st Strand cDNA Synthesis Kit, TaKaRa's PrimeScript TM IV 1st strand cDNA Synthesis Mix.

[0043] The technical principle of the present invention is:

[0044] The inventors reverse-transcribed mature eukaryotic mRNA to obtain DNA / RNA hybrid double-stranded nucleic acids. A transposase-containing adapter complex was then specifically ligated to the DNA / RNA hybrid double-stranded nucleic acid and truncated to form a target RNA polynucleotide and helicase combination for nanopore sequencing experiments. A control example (Example 2) was also established, and the inventors found that the technical solution of the present invention not only shortened the sample library preparation time compared to the comparative example, but also improved the sample throughput rate.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] (1) The present invention cleverly designs the linker sequence and simultaneously completes the connection and shearing of DNA / RNA hybrid double strands through the linker complex-transposase complex, thereby reducing the difficulty of RNA complex structure in the library construction process, realizing a new method for measuring the base sequence of the target RNA polynucleotide, and improving efficiency.

[0047] (2) The present invention uses a linker complex similar to the DNA structure to connect the DNA / RNA hybrid double strand to obtain a construct for nanopore sequencing, thereby improving the connection efficiency of RNA library construction and simplifying the process of RNA sequencing library construction.

[0048] (3) The present invention controls the movement speed of the target RNA polynucleotide in the RNA / DNA double strand relative to the transmembrane nanopore by directional movement of the helicase along the 5'- to 3'-end direction on the target RNA chain, thereby improving efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] FIG1 is a flow chart of library construction for direct RNA sequencing in Example 1 of the present invention.

[0050] FIG2 is a diagram of nanopore sequencing via-hole signals in Example 1 of the present invention.

[0051] FIG3 is a flow chart of library construction for direct RNA sequencing in Example 2 of the present invention.

[0052] FIG4 shows the fragmentation effects of different molar concentration ratios of the Tn5 transposome complex to the Lambda 2Kb RNA / DNA hybrid chain in Example 2 of the present invention, wherein A represents the control sample Lambda 2Kb RNA / DNA hybrid chain; BF represent the molar concentration ratios of the Tn5 transposome complex to the Lambda 2Kb RNA / DNA hybrid chain of 1:100, 1:200, 1:300, 1:400, and 1:500, respectively;

[0053] FIG5 is a diagram of nanopore sequencing via-hole signals in Example 2 of the present invention. DETAILED DESCRIPTION

[0054] The technical solutions of the present invention will be described in further detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection that the present invention is intended to protect.

[0055] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0056] Example 1 RNA sequencing

[0057] 1. Design and synthesize connectors

[0058] The linker sequence 1 (SEQ ID NO. 1) was synthesized according to the following sequence:

[0059] Linker sequence 2 (SEQ ID NO. 2):

[0060] Linker sequence 3 (SEQ ID NO.3):

[0061] 2. Annealing treatment of joint

[0062] Dissolve adapter sequence 1, adapter sequence 2, and adapter sequence 3 in annealing buffer (50 mM HEPES, pH 8.0 and 100 mM KCl) to prepare 100 μM stock solutions 1, 2, and 3. Mix stock solutions 1, 2, and 3 in a ratio of 1:1.1:1.1 and anneal to obtain the annealed adapter. Annealing procedure: Adjust the temperature from 95°C to 22°C at 2°C / min.

[0063] 3. Preparation of the adapter complex-transposase complex

[0064] (1) GG-Dda helicase (SEQ ID NO. 8) was treated with DTT (final concentration 2 mM) and incubated at room temperature for 30 minutes to open the disulfide bonds to facilitate the binding of protein and nucleic acid in subsequent experiments;

[0065] (2) Incubate the annealed linker obtained in step 2 with the disulfide bond-opening GG-Dda helicase at a molar ratio of 1:15 at room temperature for 30 minutes to allow the helicase to bind to the linker;

[0066] (3) Use a desalting column to replace the buffer in the sample in step (2);

[0067] (4) Add N,N,N',N'-tetramethylazodicarbonamide (TMAD, final concentration 500 μM) to the sample and incubate at 35°C for 1 h to facilitate the locking of the helicase on the nucleic acid chain;

[0068] (5) Add ATP (final concentration 1 mM) and incubate at room temperature for 30 min to allow the GG-Dda helicase bound to other parts of the nucleic acid chain to move and fall off under the action of ATP;

[0069] (6) Purify the sample using molecular sieves and collect the linker complex that only binds to one GG-Dda helicase based on the molecular weight;

[0070] (7) The adapter complex was incubated with Tn5 transposase (SEQ ID NO: 9) at a molar ratio of 1:5 at room temperature for 30 min to obtain an adapter complex-transposase complex, which was stored at -20°C for subsequent experiments. The structure of the adapter complex-transposase complex is shown in Figure 1 .

[0071] 4. Preparation of RNA / DNA hybrid chains

[0072] Using lambda DNA (NEB) as a template and SEQ ID NO.6 and SEQ ID NO.10 as primers, PCR amplification was performed to obtain a 2Kb DNA sequence containing a T7 RNA Polymerase binding site. The obtained DNA sequence was purified and used as a template in the subsequent transcription reaction. TM Transcription reaction was performed using T7 High Yield RNA Synthesis Kit (NEB) to obtain lambda 2Knt RNA, which was then purified using TRIzol. Purified lambda2K RNA was used as template and SEQ ID NO.10 as reverse transcription primer. Reverse transcription was performed using the II First Strand cDNA Synthesis Kit (NEB), and the reverse transcription product was purified using the GeneJET PCR Purification Kit (thermo scientific) to obtain Lambda 2Kb RNA / DNA hybrid strand, which was stored at -80°C. The reaction process is shown in Figure 1 for reverse transcription.

[0073] 5. Ligation and cleavage of the adaptor complex-transposase complex and RNA / DNA hybrid chains

[0074] The adapter complex-transposase complex from step 3 and the RNA / DNA hybrid from step 4 are reacted at a suitable operating temperature (37°C-55°C, preferably 37°C) for 30-60 minutes. The adapter complex and RNA / DNA hybrid are sheared and ligated using T4 DNA ligase. The product is then purified using AMPure XP beads and can be directly used for sequencing.

[0075] 6. Nanopore sequencing of RNA

[0076] Electrical signal measurements were obtained from MspA nanopores embedded in DPhPC phospholipid bilayers in buffer (600 mM KCl, 75 mM K3[Fe(CN)6, 25 mM K4[Fe(CN)6]·3H2O, 100 mM HEPES, pH 8.0).

[0077] After achieving single-pore insertion into the phospholipid bilayer, 2 ml of buffer (600 mM KCl, 75 mM K3[Fe(CN)6, 25 mM K4[Fe(CN)6]·3H2O, 100 mM HEPES, pH 8.0) was flowed through the system to remove excess nanopores. The test sample from step 5, ATP (final concentration 2 mM), and MgCl2 (final concentration 10 mM) were then flowed into the single nanopore experimental system (total volume 100 μL). The signal was measured at a constant voltage of +180 mV for 1 hour (including a potential 2-second voltage reversal at -180 mV). The results are shown in Figure 2.

[0078] As shown in FIG2 , from the analysis of the current signal, it can be observed that the RNA sample can pass through the nanopore smoothly, and the sample prepared by this method has a high passing efficiency.

[0079] Example 2 RNA sequencing

[0080] 1. Preparation of the linker complex

[0081] Similar to Example 1, except that:

[0082] (1) Linker sequence 1 (SEQ ID NO.11):

[0083] (2) Linker sequence 2 (SEQ ID NO. 12): GTGAGCAATACGTAACTGAACGAAGTACATT

[0084] (3) Omit (7) in step 3 of Example 1.

[0085] 2. Preparation of Tn5 transposome complex

[0086] Design and synthesize the upstream primer SEQ ID NO. 4 and the downstream primer SEQ ID NO. 5 for Tn5. Dissolve each primer in annealing buffer (50 mM HEPES, pH 8.0 and 100 mM KCl) to prepare a 100 μM stock solution. Mix the upstream and downstream primers in an equimolar ratio and anneal to obtain Tn5-Me. Annealing procedure: You can initially raise the temperature to 95°C / 98°C, then decrease the temperature by 1-2°C / minute to 23-26°C. Gently mix Tn5 Transposase (SEQ ID NO. 9) and Tn5-Me in an equimolar ratio and incubate at room temperature for 1 hour to obtain the Tn5 transposome complex.

[0087] 3. Preparation of RNA / DNA hybrid chains

[0088] The process is similar to step 4 of Example 1, except that SEQ ID NO. 10 is replaced by SEQ ID NO. 7, and the Lambda 3.4 Kb RNA / DNA hybrid chain is used.

[0089] Referring to the Reverse Transcription step in FIG3 , the target RNA is reverse transcribed using a reverse transcriptase to obtain a DNA / RNA hybrid double strand.

[0090] 4. Fragmentation of RNA / DNA hybrid chains

[0091] The RNA / DNA hybrid purified in step 3, the Tn5 transposome complex in step 2, and reaction buffer (10 mM Tris-HCl, 5 mM MgCl2, 8% PEG8000, pH 7.5) were gently mixed and reacted in a 55°C PCR instrument for 30 minutes. The reaction was then immediately terminated with Stop Buffer (0.2% SDS) in a 55°C PCR instrument for 5 minutes. Finally, the fragmented RNA / DNA hybrid was purified using a GeneJET PCR Purification Kit (Thermo Scientific) for subsequent ligation reactions.

[0092] Referring to the Transposon clevage step in FIG3 , the target DNA / RNA double-strand hybrid is randomly sheared by the Tn5 transposome complex.

[0093] The fragmentation effects of different molar concentration ratios of Tn5 transposome complex to Lambda 2Kb RNA / DNA hybrid chain are shown in Figure 4. The preferred molar concentration ratio of Tn5 transposome complex to RNA / DNA hybrid chain is 300:1.

[0094] 5. Ligation of adapter complexes to fragmented RNA / DNA hybrid chains and nanosequencing

[0095] The adapter complex from step 1 and the fragmented RNA / DNA hybrid from step 4 were incubated in ligation buffer (330 mM Tris-HCl, 50 mM MgCl2, 5 mM ATP, 30% Polyethylene glycol (PEG 6000) pH 8.0) with T4 DNA ligase for 30 minutes at room temperature and then 20 minutes at 4°C to complete the ligation reaction. The ligated sample was then purified using AMPure XP beads and used directly for sequencing. The sequencing method was the same as that in Example 1.

[0096] Referring to the Ligation step in FIG3 , T4 DNA ligase is used to ligate the sheared DNA / RNA hybrid double strands to the adapter complex to obtain a construct for nanopore sequencing.

[0097] The sequencing results are shown in Figure 5. As shown in Figure 5, analysis of the current signal indicates that the RNA sample can pass through the nanopore smoothly. However, the sample prepared by this method has a low pore passage efficiency, lower than that of the sample prepared by the method of Example 1. In addition, due to the connection step involved in the preparation process, most of the pore passage signals are sequencing adapters.

[0098] The inventors further established a control group based on Example 2. The difference between the control group and Example 2 was that the adapter sequence 2 was different. The adapter sequence 2 was: AGCAATACGTAACTGAACGAAGTACATT (SEQ ID NO. 13), which had three fewer bases at the 5′ end than the adapter sequence 2 in Example 2. Testing found that the adapter sequence in Example 2 had a higher ligation efficiency with the fragmented products than the control group.

[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for building a library for direct RNA sequencing, characterized in that: The following steps are involved: S0 Preparation of hybrid double strands: Using the RNA sequence to be sequenced as a template, reverse transcription is performed to form RNA / DNA hybrid double strands; S1: preparing an adapter complex-transposase complex: incubating a non-RNA polynucleotide, a helicase and a transposase together to obtain an adapter complex-transposase complex; S2: preparing a sequencing library: using the adapter complex-transposase complex to randomly shear the RNA / DNA hybrid double strands to obtain fragmented hybrid double strands; then the transposase falls off to obtain an adapter complex, and the adapter complex and the fragmented hybrid double strands are connected to obtain a sequencing library; S3: Perform nanopore sequencing on the sequencing library in step S2.

2. The method for building a library for direct RNA sequencing according to claim 1, wherein: In step S1, the non-RNA polynucleotide includes a first segment for guiding the fragment to be sequenced into the nanopore, a second segment for binding to a helicase, a third segment for controlling the moving speed of the helicase along the fragment to be sequenced, and a fourth segment for binding to a transposase and connecting the fragment to be sequenced.

3. A method for building a library for direct RNA sequencing as claimed in claim 2, characterized in that: The non-RNA polynucleotide is modified with a linker sequence 2 and / or a linker sequence 3, wherein the linker sequence 2 is partially or completely complementary to the fourth segment; The linker sequence 3 is complementary to the non-RNA polynucleotide portion; Preferably, the end of the linker sequence 3 is connected to an anchor group.

4. A method for building a library for direct RNA sequencing as claimed in claim 3, characterized in that: The step of modifying the non-RNA polynucleotide is: mixing the non-RNA polynucleotide, the adapter sequence 2, and the adapter sequence 3 and performing annealing treatment.

5. A method for building a library for direct RNA sequencing as claimed in claim 4, characterized in that: The molar ratio of the non-RNA polynucleotide, the linker sequence 2, and the linker sequence 3 is 1:1.1:1.

1.

6. The method for building a library for direct RNA sequencing according to claim 1, characterized in that: In step S1, the molar ratio of the non-RNA polynucleotide, the helicase and the transposase is 1:5:1; Preferably, the co-incubation temperature is 20°C-30°C, and the time is 10-60 min.

7. The method for building a library for direct RNA sequencing according to claim 1, characterized in that: In step S2, during the shearing and connecting process, the temperature is 37°C-55°C and the time is 30-60 minutes.

8. The method for building a library for direct RNA sequencing according to claim 1, wherein: In step S2, the ligation is performed under the action of T4 DNA ligase.

9. The method for building a library for direct RNA sequencing according to claim 1, characterized in that: In step S3, the nanopore comprises an MspA nanopore.

10. An adapter complex-transposase complex for direct RNA sequencing, comprising a non-RNA polynucleotide, a helicase and a transposase; The non-RNA polynucleotide includes a first segment for guiding the fragment to be sequenced into the nanopore, a second segment for binding to a helicase, a third segment for controlling the speed of the helicase moving along the fragment to be sequenced, and a fourth segment for binding to a transposase and connecting the fragment to be sequenced; Preferably, the sequence of the non-RNA polynucleotide is as shown in SEQ ID NO.1; The non-RNA polynucleotide is modified with a linker sequence 2 and / or a linker sequence 3, wherein the linker sequence 2 is partially or completely complementary to the fourth segment; The linker sequence 3 is complementary to the non-RNA polynucleotide portion; Preferably, the end of the linker sequence 3 is connected to an anchor group. Preferably, the nucleotide sequence of the linker sequence 2 is shown as SEQ ID NO.2, and the nucleotide sequence of the linker sequence 3 is shown as SEQ ID NO.3.

Images