Microrna let-7b-5p for treating tendon pathologies

Abstract

Compositions and methods for treating a connective tissue or musculoskeletal condition in a subject with a compound that increases let-7b-5p activity.

Description

MICRORNA let-7b-5p FOR TREATING TENDON PATHOLOGIESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 531,440 filed August 8, 2023, the content of which is hereby incorporated by reference.

[0002] Throughout this application, various publications are referenced, including referenced in parenthesis. The disclosures of all publications mentioned in this application in their entireties are hereby incorporated by reference into this application in order to provide additional description of the art to which this invention pertains and of the features in the art which can be employed with this invention.REFERENCE TO SEQUENCE LISTING

[0003] This application incorporates-by-reference nucleotide sequences which are present in the file named “240808_00468-0008_Sequence_Listing_AWG.xml”, which is 4,397 bytes in size, and which was created on August 7, 2024 in the IBM-PC machine format, having an operating system compatibility with MS-Windows, which is contained in the xml file filed August 8, 2024 as part of this application.BACKGROUND OF THE INVENTION

[0004] Tendinopathy is a common chronic tendon disorder that affects 30-50% of individuals over 60 years old. It is characterized by pain, swelling, loss of function, and impaired performance. There is currently no cure, and both spontaneous “healing” and surgical repair often produce scars that result in a weakened tissue that is susceptible to rupture.BRIEF SUMMARY OF THE INVENTION

[0005] Disclosed herein are compositions and methods for treating a connective tissue or musculoskeletal condition in a subject with a compound that increases let-7b-5p activity.

[0006] The invention provides a pharmaceutical composition comprising in a unit dosage form: a therapeutically-effective amount of a compound that increases let-7b-5p activity; and a pharmaceutically-acceptable carrier.

[0007] The invention also provides a method of treating a connective tissue condition in a subject in need thereof, the method comprising administering to the subject a therapeutically- effective amount of a compound that increases let-7b-5p activity.

[0008] The invention also provides a method of treating a musculoskeletal condition in a subject in need thereof, the method comprising administering to the subject a therapeutically- effective amount of a compound that increases let-7b-5p activity.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figs. 1A-1I: Identification of let-7b-5p as a novel exosomal miRNA in Ex3D targeting key regulators in the pathogenesis and aging-related disease process of tendinopathy. (Fig. 1A) Heatmap of a select list of differentially elevated miRNAs in Ex3D that inhibit target genes critically involved in tendinopathy pathogenesis including IL-17RA, IL-33, HIF-la, NLRP3 and LOX-1, based on analysis by Affymetrix Transcriptome Analysis Console.56(Fig. IB) Real-time PCR analysis for relative expression level of let-7b-5p in Ex2D and Ex3D derived from human TSPCs. (Fig. 1C) Complementary alignment of hsa-let-7b-5p (UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 1)) to target regions on 3’ UTR of LOX-1 (GAACUCAGUCUUCUUUACCUCAU (SEQ ID NO: 2)), TLR4(GUCAUUUCAACUCUUACCUCAU (SEQ ID NO: 3)), and p21(AAGGGCACCCUAGUUCUACCUCA (SEQ ID NO: 4)). (Fig. ID) Immunocytochemistry staining of LOX-1, NLRP3, TLR4, and p21 in human tenocytes transfected with hsa-let-7b-5p mimic or scrambled control in the presence of 10pm H2O2. (Fig. IE) Representative images and (Fig. IF) quantification of senescence-associated 0-gal staining (Cell Signaling, Cat. # 9860S). Cells were treated as in Fig. ID. (Fig. 1G) Representative images (scale bar = 100pm) and (Fig. 1H) quantification of immunofluorescence staining ofNLRP3 (Novus Cat.# NBP2- 12446), TLR4 (Abeam Cat. #abl3556), LOX-1 (Proteintech Cat. # 17958-1-AP) and p21 (Abeam Cat. # abl88224) in 12-month-old rats (Sprague Dawley, female) subject to collagenase-induced tendinopathy for 7 days and then intra-tendinous injections of 200pmol of let-7b-5p or Scr-miR (n=3 / group) using in vzvo-jetPEI as the transfection reagent (Polyplus). Rats were sacrificed 4 days after miRNA injections. (Fig. II) Working model: by suppressing LOX-1, NLRP3, TLR4 and p21 and modulating their downstream mediators and effectors, let-7b-5p mitigatestendinopathy, including in the elderly. Abbreviation: SASP - Senescence-Associated Secretory Phenotype.

[0010] Figs. 2A-2J: Design and selection of a let-7b-5p drug candidate based on optimal cellular uptake and stability, suppressing effects on critical drug targets, and therapeutic effect on tendinopathy in adult rats. (Fig. 2A) Schematic of let-7b-5p mimic and chemically- modified let-7b-5p oligos. (Fig. 2B) Representative images, and (Fig. 2C) quantification of the immunofluorescent cells transfected with Let7-Ml to Let7-M4 at 24 and 72 hours after transfection, in human tenocytes (87-year-old male) in the presence of fL-10. FAM: green; DAPI: blue; n=4-5 images per experimental group; scale bar = 100pm. (Fig. 2D) Representative images and (Fig. 2E) quantification of LOX-1 and NLRP3 expression (red) in the transfected tenocytes in vitro compared to DAPI (blue); scale bar = 100pm. (Fig. 2F) FAM and (Fig. 2G) LOX-1 and NLRP3 immunofluorescence staining in tendinopathic tissue in vivo. let-7b-5p mimics (20nmol) were transfected in human primary tenocytes (87-year-old male) using Lipofectamine RNAiMAX or in vzvo-jetPEI (Polyplus transfection), respectively. * »<0.05, **£><0.01, ***p<0.001, ****p<0.0001 using Sidak’s multiple comparison test in a mixed-effects model (Fig. 2C), oneway ANOVA (Fig. 2E, Fig. 2F, and Fig. 2G).#£><0.05,### / ><0.001, <0.000 l vs. Scr-miR group (Fig. 2E and Fig. 2F). (Fig. 2H) Representative H&E images and (Fig. 21) modified Movin score,68which was analyzed using H&E images in a blinded manner; scale bar = 50 pm. (Fig. 2J) von Frey assay using the Electronic von Frey System (Bioseb) to assess the paw withdrawal threshold (PWT) of the rodent’s hind limbs. n=5 / group. *£><0.05; **£><0.01, one-way ANOVA with Tukey post-hoc test (Fig. 21 and Fig. 2J). All data analyzed using GraphPad.DETAILED DESCRIPTION OF THE INVENTION

[0011] The invention provides a pharmaceutical composition comprising in a unit dosage form: a therapeutically-effective amount of a compound that increases let-7b-5p activity; and a pharmaceutically-acceptable carrier.

[0012] In some embodiments, the compound is a microRNA or mimic thereof. For example, the compound that increases let-7b-5p activity (e.g., in a tendon cell of a subject) may be a let-7b- 5p miRNA or mimic thereof.

[0013] In some embodiments, the microRNA or mimic thereof is double-stranded. In some embodiments, the microRNA or mimic thereof forms a hairpin loop structure.

[0014] In some embodiments, the antisense strand of the microRNA or mimic thereof is modified. In some embodiments, the passenger strand of the microRNA or mimic thereof is modified. In some embodiments, the non-targeting strand of the microRNA or mimic thereof is modified.

[0015] In some embodiments, the guide strand of the microRNA or mimic thereof is unmodified. In some embodiments, the targeting strand of the microRNA or mimic thereof is unmodified.

[0016] In some embodiments, the compound is conjugated to a serum lipoprotein.

[0017] In some embodiments, the compound is a microRNA or mimic thereof and the serum lipoprotein is conjugated to a 3’ end of the microRNA, preferably wherein the serum lipoprotein is conjugated to the 3’ end of an antisense RNA strand of a double-stranded microRNA.

[0018] In some embodiments, the serum lipoprotein is cholesterol.

[0019] In some embodiments, the compound comprises a ribose modification.

[0020] In some embodiments, the ribose modification is a 2'-O-methyl modification.

[0021] In some embodiments, the compound is a microRNA or mimic thereof comprising an antisense strand consisting of 2’-O-methyl-modified nucleotides.

[0022] In some embodiments, the compound comprises a phosphate backbone modification.

[0023] In some embodiments, the phosphate backbone modification is a phosphorothioate modification.

[0024] In some embodiments, the compound is a microRNA or mimic thereof comprises six (6) phosphorothioate modifications, preferably wherein the first two and final four backbone linkages from 5’ to 3’ are phosphorothioate modified linkages, preferably wherein antisense strand comprises two initial 5’ phosphorothioate modified linkages and four final 3’ phosphorothioate modified linkages and the guide strand is unmodified.

[0025] In some embodiments, the compound is conjugated to a label, optionally a fluorescent label.

[0026] In some embodiments, the microRNA is let-7b-5p. In some embodiments, the microRNA is a modified let-7b-5p.

[0027] In some embodiments, the compound comprises at least about 70% sequence identity, at least about 71% sequence identity, at least about 72% sequence identity, at least about 73% sequence identity, at least about 74% sequence identity, at least about 75% sequence identity, at least about 76% sequence identity, at least about 77% sequence identity, at least about 78% sequence identity, at least about 79% sequence identity, at least about 80% sequence identity, at least about 81% sequence identity, at least about 82% sequence identity, at least about 83% sequence identity, at least about 84% sequence identity, at least about 85% sequence identity, at least about 86% sequence identity, at least about 87% sequence identity, at least about 88% sequence identity, at least about 89% sequence identity, at least about 90% sequence identity, at least about 91% sequence identity, at least about 92% sequence identity, at least about 93% sequence identity, at least about 94% sequence identity, at least about 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, at least about 99.1% sequence identity, at least about 99.2% sequence identity, at least about 99.3% sequence identity, at least about 99.4% sequence identity, at least about 99.5% sequence identity, at least about 99.6% sequence identity, at least about 99.7% sequence identity, at least about 99.8% sequence identity, at least about 99.9% sequence identity, at least about 99.91% sequence identity, at least about 99.92% sequence identity, at least about 99.93% sequence identity, at least about 99.94% sequence identity, at least about 99.95% sequence identity, at least about 99.96% sequence identity, at least about 99.97% sequence identity, at least about 99.98% sequence identity, or at least about 99.99% sequence identity to human let-7b-5p (i.e., UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 1)).

[0028] In some embodiments, the microRNA or mimic thereof comprises a sequence having 70% to 100% sequence identity to UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 1).

[0029] In some embodiments, the microRNA or mimic thereof is 10-45 nucleotides in length. In some embodiments, a double-stranded or base-paired portion of the microRNA or mimic thereof is 10-45 nucleotides in length. In some embodiments, a guide strand of the microRNA or mimic thereof is 10-45 nucleotides in length. In some embodiments, a guide strand of the microRNA ormimic thereof is about 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length.

[0030] In some embodiments, the guide strand of the microRNA or mimic thereof comprises a sequence having 70% to 100% sequence identity to UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 1).

[0031] In some embodiments, the compound is a precursor of a microRNA or a mimic thereof.

[0032] In some embodiments, the compound encodes a microRNA or a mimic thereof.

[0033] In some embodiments, the compound encodes a precursor of a microRNA or a mimic thereof.

[0034] In some embodiments, the compound reduces expression of LOX1, reduces expression of TLR4, and / or reduces expression of p21. In some embodiments, the compound reduces expression ofNLRP3.

[0035] In some embodiments, the compound binds to LOX1 mRNA, TLR4 mRNA, or p21 mRNA. In some embodiments, a portion of the compound (e.g. an RNA guide strand) binds to LOX1 mRNA, TLR4 mRNA, or p21 mRNA.

[0036] In some embodiments, the compound binds to a 3'-UTR of LOX1 mRNA, TLR4 mRNA, or p21 mRNA. In some embodiments, a portion of the compound (e.g. an RNA guide strand) binds to a 3'-UTR of LOX1 mRNA, TLR4 mRNA, or p21 mRNA.

[0037] In some embodiments, the compound is encapsulated in a microvesicle, polymeric delivery vehicle, or nanoparticle.

[0038] In some embodiments, the microvesicle, polymeric delivery vehicle, or nanoparticle is conjugated to tendon-specific ligand, optionally a ligand specific to tendon stem / progenitor cells (TSPCs) and / or tenocytes, optionally a tartrate-resistant acid phosphatase (TRAP)-binding peptide.

[0039] In some embodiments, the compound is conjugated to tendon-specific ligand, optionally a ligand specific to tendon stem / progenitor cells (TSPCs) and / or tenocytes, optionally a tartrate-resistant acid phosphatase (TRAP)-binding peptide.

[0040] In some embodiments, the compound is conjugated to a targeting moiety for delivery to a target tissue, optionally a targeting moiety specific to tendon tissue and / or tendon stem / progenitor cells (TSPCs) and / or tenocytes.

[0041] In some embodiments, the pharmaceutical composition is formulated for injection.

[0042] In some embodiments, the pharmaceutical composition is formulated for intratendinous injection.

[0043] The invention also provides method of treating a connective tissue condition in a subject in need thereof, the method comprising administering to the subject any one of the pharmaceutical compositions described herein.

[0044] In some embodiments, the method reduces expression of LOX1, reduces expression of TLR4, and / or reduces expression of p21.

[0045] In some embodiments, the method reduces expression of NLRP3.

[0046] In some embodiments, a reduction in expression of LOX1, TLR4, p21, and / or NLRP3 is detectable within 3-4 days of the administration of the pharmaceutical composition.

[0047] In some embodiments, the administering is by injection.

[0048] In some embodiments, the administering is by intratendinous injection.

[0049] In some embodiments, the administering is by injection once every 1-2 weeks, 2-4 weeks, 4-8 weeks, or 8-16 weeks.

[0050] In some embodiments, the connective tissue condition is tendinopathy, preferably age- related tendinopathy, tendonitis, or a tendon injury.

[0051] In some embodiments, the method further comprises assaying the subject for modulation of gene expression of LOX1, TLR4, and / or p21. In some embodiments, the method further comprises assaying the subject for modulation of gene expression NLRP3.

[0052] In some embodiments, the method further comprises assaying the subject for modulation of gene expression of IL-ip, TNFa, type I collagen, and / or type III collagen.

[0053] In some embodiments, the method further comprises assaying the subject for modulation of a ratio of gene expression of type I collagen to gene expression of type III collagen

[0054] In some embodiments, the subject is a human subject aged 55 years or older, preferably 60 years older, more preferably 65 years or older.

[0055] In some embodiments, the treating comprises mitigating histologic features of tendinopathy, preferably by resulting in a) decreased tendon cellularity; b) less rounded tendon cell morphology; c) decreased tendon vascularity; and / or d) increased organization of collagen fibers.

[0056] In some embodiments, the treating comprises a) increasing the subj ect’ s tendon-related pain threshold; b) improvements to mechanical properties of a subject’s tendon; c) decreasing cellular senescence, apoptosis, mitochondrial dysfunction, and / or DNA damage in tendon cells, preferably tendon stem / progenitor cells (TSPCs) and / or tenocytes; d) improving the Movin score of the subject; and / or e) reducing the amount of cleaved collagen in tendon tissue of the subject; f) increasing the type I / III collagen ratio in tendon tissue of the subject; and / or g) enhancing the number of Scx / Tnmd+ cells in tendon tissue of the subject.

[0057] The invention also provides a method of treating a musculoskeletal condition in a subject in need thereof, the method comprising administering to the subject any one of the pharmaceutical compositions described herein.

[0058] In some embodiments, the method reduces expression of LOX1, reduces expression of TLR4, and / or reduces expression of p21.

[0059] In some embodiments, the method reduces expression of NLRP3.

[0060] In some embodiments, a reduction in expression of LOX1, TLR4, p21, and / or NLRP3 is detectable within 3-4 days of the administration of the pharmaceutical composition.

[0061] In some embodiments, the administering is by injection.

[0062] In some embodiments, the administering is by intraarticular injection or intramuscular injection.

[0063] In some embodiments, the administering is by injection once every 1-2 weeks, 2-4 weeks, 4-8 weeks, or 8-16 weeks.

[0064] In some embodiments, the musculoskeletal condition is arthritis, rheumatoid arthritis, or osteoarthritis.

[0065] In some embodiments, the method further comprises assaying the subject for modulation of gene expression of LOX1, TLR4, and / or p21. In some embodiments, the method further comprises assaying the subject for modulation of gene expression of NLRP3.

[0066] In some embodiments, the method further comprises assaying the subject for modulation of gene expression of IL-10, TNFa, type I collagen, and / or type III collagen.

[0067] In some embodiments, the method further comprises the subject for modulation of a ratio of gene expression of type I collagen to gene expression of type III collagen.

[0068] The invention provides any composition, method, process, kit or use, characterized by one or more elements disclosed herein.

[0069] A pharmaceutical composition can be a combination of any pharmaceutical compounds described herein with other chemical components, such as carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, solubilizing agents, excipients, buffers, preservatives, and surface-active agents. For example, a pharmaceutical composition disclosed herein is suspended in a saline solution. Pharmaceutical formulations can also include one or more additional active ingredients such as antimicrobial agents, anti-inflammatory agents, or anesthetics.

[0070] The pharmaceutical composition facilitates administration of the compound to a subject. Pharmaceutical compositions can be administered by various forms and routes including, for example, injection, peri-tissue injection, intra-tissue injection, intratendinous injection, intraarticular, intramuscular, intravascular, subcutaneous, infusion, intravenous, enteral, oral, buccal, sublingual, rectal, parenteral, ocular, and topical administration. In some embodiments, a pharmaceutical composition disclosed herein can be administered via local injection into the pathological site of a subject. For example, a pharmaceutical composition disclosed herein can be administered via local injection into a tendon of a subject. In some embodiments, a pharmaceuticalcomposition disclosed herein can be administered via a biocompatible substrate, e.g., an implant, scaffold, vesicle, or liposome.

[0071] Pharmaceutical compositions disclosed herein can be administered in a local or systemic manner, for example, via injection of the compound directly into an organ, optionally in a depot or sustained release formulation. Pharmaceutical compositions can be provided in the form of a rapid release formulation, in the form of an extended-release formulation, or in the form of an intermediate release formulation. A rapid release form can provide an immediate release. An extended-release formulation can provide a controlled release or a sustained delayed release.

[0072] Parenteral injections can be formulated for bolus injection or continuous infusion. Pharmaceutical compositions can be in a form suitable for parenteral injection as a sterile suspension, solution, or emulsion in oily or aqueous vehicles, and can contain formulatory agents, such as suspending, stabilizing, or dispersing agents. Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Suspensions of the active compounds can be prepared as oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. The suspension can also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.

[0073] Pharmaceutical compositions can be formulated using one or more physiol ogically- acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active compounds into preparations that can be used pharmaceutically. An excipient can fdl a role as simple and direct as being an inert fdler, or an excipient as used herein can be part of a pH stabilizing system or coating to ensure delivery of the ingredients safely to a target tissue. Formulations can be modified depending upon the route of administration chosen. Pharmaceutical compositions comprising a compound described herein can be manufactured, for example, by mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or compression processes.

[0074] The pharmaceutical compositions can include at least one pharmaceutically acceptable carrier, diluent, or excipient and compounds described herein as free-base or pharmaceutically- acceptable salt form. The methods and pharmaceutical compositions described herein can include the use of crystalline forms (or polymorphs), and active metabolites of these compounds having the same type of activity.

[0075] A composition disclosed herein can be produced by various methods in any quantity. For example, a compound disclosed herein can be produced in an amount of about 1 microgram, about 1 milligram, about 1 gram, about 1 kilogram, or more. Methods for the preparation of compositions comprising the compounds described herein include formulating the compounds with one or more inert, pharmaceutically acceptable excipients or carriers to form a semi-solid or liquid composition. Semi-solid compositions include, for example, gels, suspensions, and creams. Liquid compositions include, for example, emulsions comprising a compound, or a solution containing exosomes.

[0076] Non-limiting examples of dosage forms suitable for use in the present disclosure include liquid, elixir, aerosol, inhalant, spray, gel, geltab, nanosuspension, nanoparticle, microgel, suppository troches, aqueous or oily suspensions, ointment, patch, lotion, dentifrice, emulsion, creams, drops, emulsion in hard or soft gel capsules, syrups, and any combination thereof.

[0077] A composition of the present disclosure can be, for example, an immediate release form or a controlled release formulation. An immediate release formulation can be formulated to allow the compounds to act rapidly. Non-limiting examples of immediate release formulations include readily dissolvable formulations. A controlled release formulation can be a pharmaceutical formulation that has been adapted such that drug release rates and drug release profiles can be matched to physiological and chronotherapeutic requirements or, alternatively, has been formulated to effect release of a drug at a programmed rate. Non-limiting examples of controlled release formulations include hydrogels (e.g., of synthetic or natural origin), other gelling agents (e.g., gel-forming dietary fibers) and matrix-based formulations (e.g., formulations comprising a polymeric material having at least one active ingredient dispersed through).

[0078] A controlled release formulation can be a sustained release form. A sustained release form can be formulated to sustain, for example, the compound’s action over an extended period of time. A sustained release form can be formulated to provide an effective dose of any compounddescribed herein (e.g., provide a physiologically-effective blood profile) over about 4, about 8, about 12, about 16 or about 24 hours.

[0079] Non-limiting examples of pharmaceutically-acceptable excipients can be found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington ’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999), each of which is incorporated by reference in its entirety.

[0080] Methods disclosed herein include administration of a compound that increases let-7b- 5p activity (e.g. the compound may be let-7b-5p miRNA or a mimic thereof), in combination with a pharmaceutically-acceptable carrier. The carrier can be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject.

[0081] A composition described herein can be conveniently formulated into pharmaceutical compositions composed of one or more pharmaceutically acceptable carriers. See e.g., Remington 's Pharmaceutical Sciences, latest edition, by E.W. Martin Mack Pub. Co., Easton, PA, which discloses typical carriers, including fluid carriers, and conventional methods of preparing pharmaceutical compositions that can be used in conjunction with the preparation of formulations of the compound described herein and which is incorporated by reference herein. Such pharmaceuticals can be standard carriers for administration of compositions to humans and nonhumans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. Other compositions can be administered according to standard procedures. For example, pharmaceutical compositions can also include one or more additional active ingredients such as antimicrobial agents, anti-inflammatory agents, and anesthetics.

[0082] Non-limiting examples of pharmaceutically acceptable liquid carriers include water, saline solution, Ringer’s solution, glycerol, ethanol, and dextrose solution. The pH of the solution can be from about 5 to about 8, and can be from about 7 to about 7.5. Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the compound or a pharmaceutically acceptable salt thereof, where the matrices are in the form of shaped articles, such as films, liposomes, microparticles, and microcapsules.

[0083] Pharmaceutical compositions containing the compounds described herein can be administered for prophylactic or therapeutic treatments. Compositions can contain any number of active agents. In therapeutic applications, the compositions can be administered to a subject already suffering from a disease or condition, in an amount sufficient to cure or at least partially arrest the symptoms of the disease or condition, or to cure, heal, improve, reduce, lessen, ameliorate, or reduce a likelihood of occurrence of the disease or condition. Compounds can also be administered to lessen or reduce a likelihood of developing, contracting, or worsening a condition. Amounts effective for this use can vary based on the severity and course of the disease or condition, previous therapy, the subject’s health status, weight, response to the drugs, and the judgment of the treating physician.

[0084] Multiple therapeutic agents can be administered in any order or simultaneously. If simultaneously, the multiple therapeutic agents can be provided in a single, unified form, or in multiple forms, for example, as multiple injections. The compounds can be packed together or separately, in a single package or in a plurality of packages. One or all of the therapeutic agents can be given in multiple doses. If not simultaneous, then the timing between the multiple doses can vary.

[0085] The compositions described herein can be administered before, during, or after the occurrence of a disease or condition, and the timing of administering the composition containing a compound can vary. For example, the compounds can be used as a prophylactic and can be administered continuously to subjects with a propensity to conditions or diseases to lessen or reduce a likelihood of the occurrence of the disease or condition. The compounds and compositions can be administered to a subject during or as soon as possible after the onset of the symptoms. The administration of the compounds can be initiated within the first 48 hours of the onset of the symptoms, within the first 24 hours of the onset of the symptoms, within the first 6 hours of the onset of the symptoms, or within 3 hours of the onset of the symptoms. The initial administration can be via any route practical, such as by any route described herein using any formulation described herein.

[0086] A composition described herein can be administered as soon as is practical after the onset of a disease or condition is detected or suspected, and for a length of time necessary for the treatment of the disease, such as, for example, from about 1 month to about 3 months. In someembodiments, the length of time a compound can be administered can be about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 2 months, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 3 months, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 4 months, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 5 months, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months about 23 months, about 2 years, about 2.5 years, about 3 years, about 3.5 years, about 4 years, about 4.5 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, or about 10 years. The length of treatment can vary for each subject.

[0087] Also provided herein are methods for treating a subject afflicted with a musculoskeletal or connective tissue condition, for example, tendinopathy, preferably age-related tendinopathy, with a therapeutically effective amount of a compound increases let-7b-5p activity (e.g. the compound may be let-7b-5p miRNA or a mimic thereof) in a subject. For example, the let-7b-5p activity may inhibit expression of NLRP3, LOX1, TLR4, and / or p21. The subject can be a human. Treatment can include treating a human in a clinical trial. A treatment can comprise administrating to a subject a let-7b-5p miRNA or mimic thereof, for example, Let7-M4.

[0088] Methods described herein include methods for the treatment of tendon damage, including damage resulting from tendon injury and tendinopathy, including age-related tendinopathy. Treatment can include modulating or promoting healing of tendon, increasing development or proliferation of tenocytes, modulating or increase relative collagen composition or synthesis in tendon (e.g., collagen I or collagen III), modulating or improving biomechanical properties of tendon (e.g. improving or increasing the tensile strength of the tendon), and relieving or reducing pain or discomfort resulting from tendon injury and tendinopathy.

[0089] Non-limiting examples of possible subjects for administration include the following. Subjects are mammalian and can be humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, and swine; domesticanimals such as rabbits, dogs, and cats; and laboratory animals including rats, mice, and guinea pigs. A subject can be of any age. Subjects can be, for example, elderly adults, adults, adolescents, pre-adolescents, children, toddlers, and infants.

[0090] Subjects described herein in need of treatment can include subjects having reduced expression of let-7b-5p and / or subjects having elevated expression of NLRP3, LOX1, TLR4, and / or p21, as compared to subjects not in need of treatment for a musculoskeletal or connective tissue condition, including tendinopathy.

[0091] Tendon injuries and pathologies include conditions such as tendinopathy and tendonitis. Tendinopathy is a highly-prevalent tendon disorder. Tendinopathy is chronic tendon degeneration which is caused by tendon overuse and / or overload, leading to microscopic collagen fiber failure and a failed healing response, often resulting in tendon rupture. While tendinopathy can affect any tendon, the most common incidents include the rotator cuff tendons, the Achilles tendon, tennis elbow, and golfer’s elbow.

[0092] Tendonitis is the inflammation of a tendon. Like tendinopathy, tendonitis can occur when a tendon is overused or injured, for example, during sport or physical activities. Tendonitis is often linked to an acute injury with inflammation. Tendonitis can affect tendons in the elbow, wrist, finger, thigh, and other parts of the body. Non-limiting examples of sites of tendon injury or tendon degeneration include the rotator cuff, the Achilles, tennis elbow (tissue connecting forearm muscle to elbow), golfer’s elbow (inner side of elbow), jumper’s knee (also known as patellar tendon; tissue connecting kneecap to shinbone), swimmer’s shoulder (tissue rubbing against shoulder blade), the neck, the forearm, the shoulder, the pelvis, the hip, the hamstring, the knee, the ankle, and the foot.

[0093] Current treatment strategies for tendon injuries and degenerative conditions include administration of non-steroidal anti-inflammatory drugs (NSAIDs), corticosteroid injections, and physical therapy. However, these strategies tend to be limited to targeting only the symptomatology instead of intervening the disease. Moreover, prolonged use of NSAIDs can elevate the risk of upset stomach and gastrointestinal bleeding, while corticosteroids can deleteriously affect tendon tissue.

[0094] Non-limiting examples of musculoskeletal or connective tissue conditions include tendinopathy, age-related tendinopathy, tendinitis, tenosynovitis, tendon injury, acute tendoninjury, chronic tendon injury, a tendon condition, a cartilage injury, a ligament condition, a soft tissue condition, a joint condition, a muscle condition, a bone condition, osteoporosis, osteoarthritis, arthritis, rheumatoid arthritis, gout, fibromyalgia syndrome, systemic lupus erythematosus, Sjogren’s syndrome, an autoimmune condition, and a non-autoimmune condition.

[0095] Provided herein are methods for treating a subject afflicted with a pain associated with a musculoskeletal or connective tissue condition with a therapeutically-effective amount of let-7b- 5p miRNA or mimic thereof, for example, Let7-M4.

[0096] In some embodiments, the miRNA molecule comprises a chemical modification. Nonlimiting examples of suitable chemical modifications include 2'-0-methyl (M), 2'-0-methyl, 3'phosphorothioate (MS) or 2'-0-methyl, 3'thioPACE (MSP), pseudouridine, and 1-methyl pseudouridine. Each possibility represents a separate embodiment of the present invention.

[0097] Any suitable delivery system may be used to deliver a composition comprising an miRNA. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in cells and target tissues. Non-viral vector delivery systems include naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer.

[0098] Methods of non-viral delivery of nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (L\Ps), polycation or lipidmucleic acid conjugates, artificial virions, and agent-enhanced uptake of nucleic acids. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids. Cationic-lipid mediated delivery of proteins and / or nucleic acids is also contemplated as an in vivo, ex vivo, or in vitro delivery method.

[0099] Non-viral vectors, such as transposon-based systems e.g. recombinant Sleeping Beauty transposon systems or recombinant PiggyBac transposon systems, may also be delivered to a target cell and utilized for transposition of a polynucleotide molecule or a polynucleotide molecule encoding the molecule of the composition in the target cell.

[0100] Lipofection is delivery is also contemplated. Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides. Delivery can be to cells or targettissues. The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art.

[0101] Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGenelC delivery vehicles (EDVs).

[0102] Delivery vehicles include, but are not limited to, nanoparticles, exosomes, microvesicles, gene gun delivery, for example, by attachment of a composition to a gold particle which is fired into a cell using via a “gene-gun”, viral vehicles, including but not limited to lentiviruses, AAV, and retroviruses), virus-like particles (VLPs). large VLPs (LVLPs), lentivirus- like particles, transposons, viral vectors, naked vectors, DNA, or RNA, among other delivery vehicles known in the art.

[0103] The compositions described herein may be delivered to a target cell using a nonintegrating lentiviral particle method, e.g. a LentiFlash® system. Such a method may be used to deliver an RNA into a target cell.

[0104] Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, AAV, and psi.2 cells or PA317 cells, which package retrovirus.

[0105] In some embodiments, it is desirable that the vector be delivered with a high degree of specificity to a particular tissue type. Accordingly, a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cellsurface receptor, can be leveraged for specificity. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences which favor uptake by specific target cells.

[0106] Additionally, in some embodiments conjugation to a targeting ligand may be utilized to enable tissue-specific delivery. For example, a tartrate-resistant acid phosphatase (TRAP)-binding peptide may be utilized for a tendon-specific delivery system. See e.g., Adjei-Sowah et al. “Development of a Nanoparticle-Based Tendon-Targeting Drug Delivery System to Pharmacologically Modulate Tendon Healing” bioRxiv, November 30, 2023. In some embodiments, a delivery vehicle (e.g., a nanoparticle) containing a let-7b-5p miRNA or mimic thereof and / or a let-7b-5p miRNA or mimic thereof itself is conjugated to a tendon-specific ligand (e.g., a TRAP -binding peptide).

[0107] Vectors (e.g., retroviruses, liposomes, etc.) containing therapeutic RNA compositions can also be administered directly to an organism for transduction of cells in vivo. Alternatively, naked RNA may be administered. Administration is by any of the routes normally used for introducing amolecule into cells or tissues including, but not limited to, injection, infusion, topical application and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.

[0108] Histological assays, e.g., tendon histology assays, can be used to assess therapeutic effectiveness of a compound herein. For example, the Movin scoring system can be used to classify the histopathology of tendinopathy. Variables included in the Movin scale are: (1) fiber structure; (2) fiber arrangement; (3) rounding of the nuclei; (4) regional variations in cellularity; (5) increased vascularity; (6) decreased collagen stainability; (7) hyalinization; and (8) glycosaminoglycan (GAG) content. Each variable is scored between 0 and 3, with 0 being normal, 1 slightly abnormal, 2 abnormal, and 3 markedly abnormal. Hematoxylin and eosin (H&E) staining can be used to assess the first seven variables. Alcian blue staining can be used to assess GAG content. The total semiquantitative histologic score can vary between 0 (normal tendon) and 24 (the most severe abnormality detectable).

[0109] Biological activity of a compound described herein can also be assessed by measuring expression levels of the target mRNA and downstream effectors. For example, let-7b-5p miRNA activity can be evaluated by measuring expression of NLRP3, LOX1, TLR4, and / or p21.

[0110] Nociception (pain) and mechanical sensibility assays can be used to assess therapeutic effectiveness of a compound herein. For example, the Von Frey assay that uses small pieces of nylon rod (known as Von Frey hairs or filaments) or a plastic tip connected to a load cell to test arodent’s sensitivity to a mechanical stimulus. In this test, the animal stands on an elevated mesh platform, and the Von Frey hairs are inserted through the mesh to poke the animal’s hindpaw. The animal normally reacts by withdrawing or shaking of the paw. The force at which this response occurs is known as the paw withdrawal threshold (PWT). An increased PWT can indicate increased sensibility to the stimulus due to alleviation tendinopathy pain symptoms.

[0111] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0112] As used herein, the term “guide strand” as it relates to a microRNA or mimic thereof is the strand of the microRNA, or portion thereof, which is the targeting strand that hybridizes to a target mRNA. For example, a double-stranded let-7b-5p miRNA mimic may comprise a guide strand having the sequence UGAGGUAGUAGGLUGUGUGGUU (SEQ ID NO: 1). An example of a guide strand is shown in Fig. 1C, which depicts complementarity between the guide strand of hsa-let-7b-5p and its LOX-1, TLR4, and p21 target mRNAs.

[0113] As used herein, the term “antisense strand” as it relates to a microRNA or mimic thereof is the strand of the microRNA, or portion thereof, which is complementary to the guide strand and is a non-targeting strand.

[0114] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. In embodiments, about means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to + / - 10% of the specified value. In embodiments, about includes the specified value. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of and any combination of items it conjoins.

[0115] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a,” “an” and “at least one” are used interchangeably in this application.

[0116] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0117] In the description and claims of the present application, each of the verbs, “comprise,” “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb. Other terms as used herein are meant to be defined by their well-known meanings in the art.

[0118] For the foregoing embodiments, each embodiment disclosed herein is contemplated as being applicable to each of the other disclosed embodiments.

[0119] As used herein, all headings are simply for organization and are not intended to limit the disclosure in any manner. The content of any individual section may be equally applicable to all sections. All combinations of the various elements disclosed herein are within the scope of the invention.

[0120] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

[0121] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0122] An example is provided below to facilitate a more complete understanding of the invention. The following example illustrates the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in this example, which is for purposes of illustration only.EXAMPLE

[0123] Tendinopathy is a common chronic tendon disorder, characterized by pain, swelling, loss of tendon function, and diminished performance of musculoskeletal movement. Aging is a predisposing factor for tendinopathy, which enhances pathogenesis and impairs tissue healing. It has been recognized that limitations in treatment options is due to, at least in part, the lack of an efficient strategy to address the aging-related disease process.Preliminary Studies1. Identification oflet-7b-5p as a potential therapeutic microRNA targeting key regulators in the pathogenesis and aging-related disease process of tendinopathy

[0124] Tendinopathy worsens with age and compromises the structure, composition, and biomechanical properties of aged tendons elevating the risk for rupture as well as treatment failure.14In an effort to develop a drug that mitigates tendinopathy, including in the elderly, the initial studies focused on identifying active ingredients from Ex3D, exosomes derived from mesenchymal stem cells (MSCs) grown on a novel 3D scaffold which were found to exert a therapeutic effect on tendinopathy. As therapeutic effects of exosomes can be mediated by their carried non-coding RNAs, particularly miRNAs,47'48a miRNA microarray analysis was performed to compare Ex3D vs. Ex2D, exosomes derived from MSCs grown in regular 2D culture, to identify miRNAs that are differentially elevated in Ex3D and exert therapeutic effect for tendinopathy.The analysis showed the presence of let-7b-5p at a much higher level in Ex3D relative to that in Ex2D (Fig. 1A), which was further confirmed by real-time PCR (Fig. IB). Among the miRNAs that differentially elevated in Ex3D, let-7b-5p drew attention not only because it represents a member of the let-7 family, which is associated with aging and various age-related disease processes,16 17,49’53but also because, as indicated by bioinformatics and database analysis, it bears potential in modulating multiple targets, including LOX-1 and TLR4 and p21 (Fig. 1C). These are pathway mediators for chronic inflammation, ECM remodeling, and collagen degradation, and oxidative stress response and cell senescence in aging related diseases, all of which are critically involved in tendinopathy.28'30,43’34Interestingly, NLRP3, a target for tendinopathy35and a drug target of Ex3D, is a downstream mediator of LOX-1. Therefore, let-7b-5p may mitigate tendinopathy by suppressing not only LOX-1, TLR4 and p21, but also NLRP3.

[0125] To validate these potential pathway targets of let-7b-5p, the effect of let-7b-5p on these pathway mediators was evaluated in vitro, and in vivo. For the in vitro study, human tenocytes (87-year-old, male) were cultured and transfected with hsa-let-7b-5p mimic or scrambled control at 20 nmol (Millipore Sigma, n=3 per group) using Lipofectamine RNAiMAX (Invitrogen) for 72 hours in the presence of H2O2, an oxidative stress whose levels are increased during aging. Immunocytochemistry analyses demonstrated that let-7b-5p mimic suppressed LOX-1 as well as NLRP3, TLR4, and p21 in aged human tenocytes cultured in vitro (Fig. ID). Corresponding with these molecular and signaling events, let-7b-5p mimic treatment mitigated cellular senescence (Fig. IE and Fig. IF). Furthermore, suppression of LOX-1, as well as NLRP3, TLR4, and p21 was also evident in vivo in the Achilles tendons of rats with collagenase-induced tendinopathy and treatment with let-7b-5p mimic compared to tendinopathic tendons treated with scrambled miRNA mimic as a control (Fig. 1G and Fig. 1H). These critical in vitro and in vivo findings allowed for establishment of a working model that, via suppression ofLOX-1, NLRP3, TLR4 and p21, let-7b- 5p exerts its therapeutic effect on tendinopathy by mitigating pathogenesis and aging-related process of the disease (Fig. II).2. Design and selection of the let-7b-5p mimic drug candidate, and its efficacy on mitigating tendinopathy

[0126] The positive results in Preliminary Study 1 were encouraging and led to the design and selection of let-7b-5p mimic drug candidates to explore the drug potential of let-7b-5p. As let-7b-5p is conserved between rats and human,57,58the selection criteria of the drug candidate included: 1) cellular uptake, suppressing effects on critical drug targets in vitro in human tenocytes, 2) these parameters in vivo in rats, and 3) therapeutic efficacy in a rat disease model.

[0127] i) Drug design. Chemical modification is an industry-proven strategy in oligonucleotide drug development to enhance the oligo nucleotide stability and delivery to the target.59'62Accordingly, various double-stranded let-7b-5p mimics were designed (Fig. 2A). Let7- M1 is designated as the unmodified mimic. To preserve the silencing activity of let-7b-5p, the antisense strand and not the guide strand was modified. In Let7-M2, cholesterol is conjugated to the 3’ end and the bases are not modified. Cholesterol facilitates cellular uptake and is intended to increase pharmacokinetics of the miRNA. In Let7-M3, the antisense strand consists of 2'-O- methyl-modified nucleotides, six of the backbone linkages are substituted with phosphorothioate (PS) bonds, and the remaining linkages are phosphodiester. These modifications are intended to increase stability of the miRNA mimic. In I.el7-M4. the double-stranded let-7b-5p is conjugated with cholesterol as in Let7-M2 and chemically modified as in Let7-M3. A double-stranded miRNA nonsense sequence (Scr-miR) served as a control. To facilitate tracking of the miRNA, each of the above-described oligonucleotides was conjugated with a fluorescent label (i.e., FAM) on the 3 ’ end.

[0128] ii) Selection of the optimal let-7b-5p mimic design that enables the highest uptake and stability. Fluorescent imaging shows successful transfection of these miRNA into human primary tenocytes (Fig. 2B). While let-7b-5p uptake was not significantly different between Let7-Ml (no modification) and Let7-M2 (cholesterol modification), both Let7-M3 (base modification) and Let7-M4 (both modifications) led to enhanced and sustained uptake of let-7b-5p at 24 and 72 hours after transfection compared to Let7-Ml (Fig. 2B and Fig. 2C). Let7-M4 appears to have a synergistic effect of increasing let-7b-5p uptake compared to Let7-M2 and Let7-M3 combined. To test whether the chemical modifications altered the silencing activity of let-7b-5p, expression of LOX-1 and NLRP3 were evaluated and it was found that the protein levels of both were significantly decreased at 24 hours after treatment compared to that of scrambled miRNA treatment in human tenocytes. Let7-M4 treatment further reduced LOX-1 and NLRP3 levels compared to treatment with Let7-Ml, Let7-M2 and Let7-M3 (Fig. 2D and Fig. 2E). The data suggests that chemical modification of let-7b-5p does not alter the effect of let-7b-5p in suppressing expression of LOX-1 and NLRP3. Further, Let7-M4 achieved the stronger biologiceffect in suppressing both targets compared with other modifications and was therefore identified as the optimal mimic design for let-7b-5p.

[0129] To confirm the activity of let-7b-5p in vivo, Let7-M4 and Scr-miR with both modifications were injected into the Achilles tendon of rats one week after collagenase-induced tendinopathy. Levels of both Let7-M4 and Scr-miR, as indicated by immunofluorescence staining for FAM, were detected at significantly high levels at 4 days after injection, in contrast to those injected with Let7-Ml (with no modification) (Fig. 2F). Further, the injection of Let7-M4, but not Scr-miR, corresponded to a decrease in LOX-1 and NLRP3 expression in vivo at 4 days after injection (Fig. 2G). Together, the data support that Let7-M4 represents the optimal chemical modification that enables the highest uptake and stability.

[0130] Hi) Evidence of let-7b-5p ’s efficacy in mitigating tendinopathy in adult rats. As the ultimate goal is to develop a drug for tendinopathy patients across various age groups, the focus was to establish critical initial evidence for let-7b-5p’s therapeutic effect. To this end, it was decided to determine the efficacy in mitigating the pathology in adult rats. Using collagenase- induced tendinopathy as a model, rats (male, Sprague Dawley, Charles River) at 8-10 month, whose age corresponded to a human adult,63were injected with 10 pl collagenase (0.015mg / ml, Sigma-Aldrich, Cat. No. C9891) or 10 pl PBS as a sham control.64'67. One week after the collagenase injection66the tendinopathic tendons were further injected with: 1) Let7-M4 (Synbio Technologies, 200 pmol), or 2) Scr-miR (Synbio Technologies, 200 pmol) in 10 pl PBS. The sham control animals were further injected with 10 pl PBS (vehicle control). Three weeks after this 2ndinjection, the rats were subjected to pain behavior testing using the von Frey assay and then sacrificed.

[0131] H&E analysis revealed that tendinopathic rats (rats injected with collagenase) treated with Let7-M4 mitigated histologic features of tendinopathy, including increased cellularity, a more rounded cell morphology, increased vascularity, and disorganized arrangement of collagen fibers, which were seen in tendinopathic rats treated with Scr-miR (Fig. 2H). The improvement in tendon histopathology from Let7-M4 treatment led to a decrease in the Movin Score, compared to treatment using Scr-miR (Fig. 21). The von Frey assay revealed that Scr-miR-treated rats exhibited a lower paw withdrawal threshold (PWT), while Let7-M4 treatment effectively alleviated this pain-related symptom with a significant increase of the PWT (Fig. 2J).

[0132] In summary, results from the Preliminary Studies strongly support the novel drug potential of let-7b-5p or its mimics such as Let7-MR4 for tendinopathy. These studies found that: i) let-7b-5p directly targets LOX-1, TLR4, and p21, which exert an inhibiting effect on a spectrum of downstream mediators and effectors, including NLRP3, all critical to the pathogenesis and aging-related disease process of tendinopathy; ii) chemical modifications enhanced uptake and stability of let-7b-5p mimics, with Let7-M4 exhibiting the most promising effect in suppressing these targets; iii) Let7-M4 mitigated histologic features of tendinopathy and relieved tendinopathy - related pain compared to scrambled miRNA control in adult rats. These findings support that let- 7b-5p exerts therapeutic effect on tendinopathy, including in the elderly.References1. Sharma P, Maffulli N. Understanding and managing achilles tendinopathy. Br J Hosp Med (Lond). Feb 2006;67(2):64-7. doi: 10.12968 / hmed.2006.67.2.204632. Jarvinen TA, Kannus P, Maffulli N, Khan KM. Achilles tendon disorders: etiology and epidemiology. Foot Ankle Clin. Jun 2005;10(2):255-66. doi: 10.1016 / j .fcl.2005.01.0133. Raikin SM, Garras DN, Krapchev PV. Achilles tendon injuries in a United States population. Foot Ankle Int. Apr 2013;34(4):475-80. doi: 10.1177 / 10711007134776214. Andarawis-Puri N, Flatow EL, Soslowsky LJ. Tendon basic science: Development, repair, regeneration, and healing. J Orthop Res. Jun 2015;33(6):780-4. doi:10.1002 / jor.228695. Millar NL, Silbernagel KG, Thorborg K, et al. Tendinopathy. Nat Rev Dis Primers. Jan 7 2021 ;7( 1 ): 1. doi : 10.1038 / s41572-020-00234- 16. Albers IS, Zwerver J, Diercks RL, Dekker JH, Van den Akker-Scheek I. Incidence and prevalence of lower extremity tendinopathy in a Dutch general practice population: a cross sectional study. BMC Musculoskelet Disord. Jan 13 2016; 17: 16. doi: 10.1 186 / s 12891 -016- 0885-27. Werner RA, Franzblau A, Gell N, Ulin SS, Armstrong TJ. A longitudinal study of industrial and clerical workers: predictors of upper extremity tendonitis. J Occup Rehabd. Mar 2005;15(l):37-46.8. Maffulli N, Wong J, Almekinders LC. Types and epidemiology of tendinopathy. Clin Sports Med. Oct 2003;22(4):675-92. doi: 10.1016 / s0278-5919(03)00004-89. Korcari A, Przybelski SJ, Gingery A, Loiselle AE. Impact of aging on tendon homeostasis, tendinopathy development, and impaired healing. Connect Tissue Res. Jan 2023;64(l): l-13. doi: 10.1080 / 03008207.2022.210200410. Nourissat G, Houard X, Sellam J, Duprez D, Berenbaum F. Use of autologous growth factors in aging tendon and chronic tendinopathy. Front Biosci (Elite Ed). Jun 1 2013;5:911-21. doi: 10.274 l / e67011. Zhang J, Wang JH. Moderate Exercise Mitigates the Detrimental Effects of Aging on Tendon Stem Cells. PLoS One. 2015;10(6):e0130454. doi: 10.1371 / journal.pone.013045412. Zhou B, Zhou Y, Tang K. An overview of structure, mechanical properties, and treatment for age-related tendinopathy. J Nutr Health Aging. Apr 2014;18(4):441-8. doi : 10. 1007 / s 12603 -014-0026-2Zhou Z, Akinbiyi T, Xu L, et al. Tendon-derived stem / progenitor cell aging: defective selfrenewal and altered fate. Aging Cell. Oct 2010;9(5):911-5. doi: 10.1111 / j .1474- 9726.2010.00598.x Lui PPY, Wong CM. Biology of Tendon Stem Cells and Tendon in Aging. Front Genet. 2019;10: 1338. doi: 10.3389 / fgene.2019.01338 Ahmad Z, Parkar A, Shepherd J, Rushton N. Revolving doors of tendinopathy: definition, pathogenesis and treatment. PostgradMedJ. Feb 2020;96(l 132):94-101. doi : 10.1136 / postgradmedj -2019-136786 Liu Q, Zhu Y, Zhu W, Zhang G, Yang YP, Zhao C. The role of MicroRNAs in tendon injury, repair, and related tissue engineering. Biomaterials. Oct 2021;277: 121083. doi: 10.1016 / j. biomaterials.2021.121083 Thankam FG, Boosani CS, Dilisio MF, Gross RM, Agrawal DK. Genes interconnecting AMPK and TREM-1 and associated microRNAs in rotator cuff tendon injury. Mol Cell Biochem. Apr 2019;454(l-2):97-109. doi: 10.1007 / sl 1010-018-3456-z Gumucio JP, Korn MA, Saripalli AL, et al. Aging-associated exacerbation in fatty degeneration and infiltration after rotator cuff tear. J Shoulder Elbow Surg. Jan 2014;23(l):99-108. doi: 10.1016 / j .jse.2013.04.011 Hanna J, Hossain GS, Kocerha J. The Potential for microRNA Therapeutics and Clinical Research. Front Genet. 2019;10:478. doi: 10.3389 / fgene.2019.00478 Kumar A, Tiwari A, Sharma A. Changing Paradigm from one Target one Ligand Towards Multi-target Directed Ligand Design for Key Drug Targets of Alzheimer Disease: An Important Role of In Silico Methods in Multi -target Directed Ligands Design. Curr Neuropharmacol. 2018; 16(6):726-739. doi: 10.2174 / 1570159X16666180315141643 Bolognesi ML, Cavalli A. Multitarget Drug Discovery and Polypharmacology. ChemMedChem. Jun 20 2016;l 1(12): 1190-2. doi: 10.1002 / cmdc.201600161 Ramsay RR, Popovic-Nikolic MR, Nikolic K, Uliassi E, Bolognesi ML. A perspective on multi -target drug discovery and design for complex diseases. Clin Transl Med. Jan 17 2018;7(l):3. doi:10.1186 / s40169-017-0181-2 Sun L, Zhu M, Feng W, et al. Exosomal miRNA Let-7 from Menstrual Blood-Derived Endometrial Stem Cells Alleviates Pulmonary Fibrosis through Regulating Mitochondrial DNA Damage. Oxid Med Cell Longev . 2019;2019:4506303. doi: 10.1155 / 2019 / 4506303 Barreto J, Karathanasis SK, Remaley A, Sposito AC. Role of LOX-1 (Lectin-Like Oxidized Low-Density Lipoprotein Receptor 1) as a Cardiovascular Risk Predictor: Mechanistic Insight and Potential Clinical Use. Arterioscler Thromb Vase Biol. Jan 2021 ;41(1): 153-166. doi: 10.1161 / ATVBAHA.120.315421 Ding Z, Liu S, Wang X, et al. LOX-1, mtDNA damage, and NLRP3 inflammasome activation in macrophages: implications in atherogenesis. Cardiovasc Res. Sep 12014; 103 (4) : 619-28. doi : 10.1093 / cvr / cvu 114 Li X, Tang X, Liu B, et al. LOX-1 Deletion Attenuates Myocardial Fibrosis in the Aged Mice, Particularly Those With Hypertension. Front Cardiovasc Med. 2021;8:736215. doi:10.3389 / fcvm.202L 736215 Teng GG, Wang WH, Dai Y, Wang SJ, Chu YX, Li J. Let- 7b is involved in the inflammation and immune responses associated with Helicobacter pylori infection by targeting Toll-like receptor 4. PLoS One. 2013;8(2):e56709. doi: 10.1371 / journal. pone.0056709Akbar M, Gilchrist DS, Kitson SM, et al. Targeting danger molecules in tendinopathy: the HMGB1 / TLR4 axis. RMD Open. 2017;3(2):e000456. doi: 10.1136 / rmdopen-2017-000456 Zhao G, Zhang J, Nie D, et al. HMGB 1 mediates the development of tendinopathy due to mechanical overloading. PLoS One. 2019;14(9):e0222369. doi : 10.1371 / j ournal . pone.0222369 Thankam FG, Roesch ZK, Dilisio MF, et al. Association of Inflammatory Responses and ECM Disorganization with HMGB1 Upregulation and NLRP3 Inflammasome Activation in the Injured Rotator Cuff Tendon. Sci Rep. 06 2018;8(1):8918. doi: 10.1038 / s41598-018- 27250-2 Papismadov N, Gal H, Krizhanovsky V. The anti-aging promise of p21. Cell Cycle. 2017;16(21): 1997-1998. doi: 10.1080 / 15384101.2017.1377500 Chandra A, Lagnado AB, Farr JN, et al. Targeted clearance of p21- but not pl6-positive senescent cells prevents radiation-induced osteoporosis and increased marrow adiposity. Aging Cell. May 2022;21(5):el3602. doi: 10.1111 / acel.13602 Herranz N, Gil J. Mechanisms and functions of cellular senescence. J Clin Invest. Apr 2 2018;128(4): 1238-1246. doi: 10.1172 / JCI95148 Hu C, Zhang X, Teng T, Ma ZG, Tang QZ. Cellular Senescence in Cardiovascular Diseases: A Systematic Review. Aging Dis. Feb 2022; 13(1 ): 103-128. doi: 10.14336 / AD.2021.0927 Huang W, Hickson LJ, Eirin A, Kirkland JL, Lerman LO. Cellular senescence: the good, the bad and the unknown. Nat Rev Nephrol. Oct 2022;18(10):611-627. doi : 10.1038 / s41581 -022-00601 -z Kumari R, Jat P. Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Front Cell Dev Biol. 2021;9:645593. doi: 10.3389 / fcell.2021.645593 Englund DA, Jolliffe A, Aversa Z, et al. p21 induces a senescence program and skeletal muscle dysfunction. Mol Metab. Jan 2023;67:101652. doi:10.1016 / j.molmet.2022.101652 Hampel B, Fortschegger K, Ressler S, et al. Increased expression of extracellular proteins as a hallmark of human endothelial cell in vitro senescence. Exp Gerontol. May 2006;41(5):474-81. doi: 10.1016 / j.exger.2006.03.001 Poulsen RC, Watts AC, Murphy RJ, Snelling SJ, Carr AJ, Hulley PA. Glucocorticoids induce senescence in primary human tenocytes by inhibition of sirtuin 1 and activation of the p53 / p21 pathway: in vivo and in vitro evidence. Ann Rheum Dis. Jul 2014;73(7): 1405- 13. doi : 10.1136 / annrheumdi s-2012-203146 Abate M, Silbemagel KG, Siljeholm C, et al. Pathogenesis of tendinopathies: inflammation or degeneration? Arthritis Res Ther. 2009; 11 (3):235. doi: 10.1186 / ar2723 Millis AJ, Hoyle M, McCue HM, Martini H. Differential expression of metalloproteinase and tissue inhibitor of metalloproteinase genes in aged human fibroblasts. Exp Cell Res. Aug 1992;201 (2):373-9. doi: 10.1016 / 0014-4827(92)90286-h Millar NL, Wei AQ, Molloy TJ, Bonar F, Murrell GA. Cytokines and apoptosis in supraspinatus tendinopathy. J Bone Joint SurgBr. Mar 2009;91(3):417-24. doi: 10.1302 / 0301-620X.91B3.21652 Hawthorne BC, Wellington IJ, Sabitsky JT, et al. Human Rotator Cuff Tears Reveal an Age-Dependent Increase in Markers of Cellular Senescence and Selective Removal of Senescent Cells With Dasatinib + Quercetin Increases Genetic Expression of COL1A1 In Vitro. Arthroscopy. Jun 23 2023;doi:10.1016 / j.arthro.2023.05.036Damase TR, Sukhovershin R, Boada C, Taraballi F, Pettigrew RI, Cooke JP. The Limitless Future of RNA Therapeutics. Front Bioeng Biotechnol. 2021;9:628137. doi:10.3389 / fbioe.2021.628137 Thakur S, Sinhari A, Jain P, Jadhav HR. A perspective on oligonucleotide therapy: Approaches to patient customization. Front Pharmacol. 2022; 13: 1006304. doi: 10.3389 / fphar.2022.1006304 Moumne L, Marie AC, Crouvezier N. Oligonucleotide Therapeutics: From Discovery and Development to Patentability. Pharmaceutics. Jan 222022; 14(2)doi : 10.3390 / pharmaceutics 14020260 Xin H, Li Y, Chopp M. Exosomes / miRNAs as mediating cell-based therapy of stroke. Front Cell Neurosci. 2014;8:377. doi: 10.3389 / fncel.2014.00377 Cobelli NJ, Leong DJ, Sun HB. Exosomes: biology, therapeutic potential, and emerging role in musculoskeletal repair and regeneration. Ann N Y Acad Sci. Dec 2017; 1410(1): 57- 67. doi:10.1111 / nyas. l3469 Roush S, Slack FJ. The let-7 family of microRNAs. Trends Cell Biol. Oct 2008; 18(10):505- 16. doi: 10.1016 / j.tcb.2008.07.007 Wang Y, Zhao J, Chen S, et al. Let-7 as a Promising Target in Aging and Aging-Related Diseases: A Promise or a Pledge. Biomolecules. Aug 2 2022;12(8)doi:10.3390 / bioml2081070 Schmid T, Wegener F, Hotfiel T, Hoppe MW. Moderate evidence exists for four microRNAs as potential biomarkers for tendinopathies and degenerative tendon ruptures at the upper extremity in elderly patients: conclusion of a systematic review with bestevidence synthesis. J Exp Orthop. Aug 102023; 10(l):81. doi: 10.1186 / s40634-023-00645- 5 Thankam FG, Boosani CS, Dilisio MF, Dietz NE, Agrawal DK. MicroRNAs Associated with Shoulder Tendon Matrisome Disorganization in Glenohumeral Arthritis. PLoS One. 2016;l l(12):e0168077. doi: 10.1371 / journal.pone.0168077 Thankam FG, Boosani CS, Dilisio MF, Agrawal DK. MicroRNAs associated with inflammation in shoulder tendinopathy and glenohumeral arthritis. Mol Cell Biochem. Jan 2018;437(l-2):81-97. doi: 10.1007 / sl 1010-017-3097-7 Wen J, Chang Y, Huo S, et al. Tanshinone IIA attenuates atherosclerosis via inhibiting NLRP3 inflammasome activation. Aging (Albany NY) . Nov 16 2020;13(l):910-932. doi: 10.18632 / aging.202202 Jiang L, Liu T, Lyu K, et al. Inflammation-related signaling pathways in tendinopathy. Open Life Sci. 2023; 18(l):20220729. doi: 10.1515 / biol -2022-0729 Chamorro-Petronacci C, Perez-Sayans M, Padin-Iruegas ME, Marichalar-Mendia X, Gallas-Torreira M, Garcia Garcia A. Differential expression of snoRNAs in oral squamous cell carcinomas: new potential diagnostic markers. J Enzyme Inhib Med Chem. Dec2018;33(l):424-427. doi: 10.1080 / 14756366.2018.1426574 Nixon B, Stanger SJ, Mihalas BP, et al. Next Generation Sequencing Analysis Reveals Segmental Patterns of microRNA Expression in Mouse Epididymal Epithelial Cells. PLoS One. 2015;10(8):e0135605. doi: 10.1371 / journal.pone.0135605 Ponnusamy V, Ip RTH, Mohamed M, et al. Neuronal let-7b-5p acts through the Hippo- YAP pathway in neonatal encephalopathy. Commun Biol. Sep 30 2021 ;4(1 ): 1143. doi : 10.1038 / s42003 -021-02672-3 CMC Regulatory Considerations for Oligonucleotide Drug Products: FDA Perspective.Khvorova A, Watts JK. The chemical evolution of oligonucleotide therapies of clinical utility. Nature biotechnology. Mar 2017;35(3):238-248. doi: 10.1038 / nbt.3765 Glazier DA, Liao J, Roberts BL, et al. Chemical Synthesis and Biological Application of Modified Oligonucleotides. Bioconjug Chem. May 20 2020;31(5): 1213-1233. doi : 10.1021 / acs.bioconj chem .0c00060 Roberts TC, Langer R, Wood MJ A. Advances in oligonucleotide drug delivery. Nat Rev DrugDiscov. Oct 2020;19(10):673-694. doi: 10.1038 / s41573-020-0075-7 Sengupta P. The Laboratory Rat: Relating Its Age With Human's. Int J Prev Med. Jun 2013;4(6):624-30. Lake SP, Ansorge HL, Soslowsky LJ. Animal models of tendinopathy. Disabil Rehabil. 2008;30(20-22): 1530-41. doi: 10.1080 / 09638280701785460 Lui PP, Maffulli N, Rolf C, Smith RK. What are the validated animal models for tendinopathy? Scand J Med Sci Sports. Feb 2011;21(1):3-17. doi: 10.1111 / j .1600- 0838.2010.01164.x Jelinsky SA, Lake SP, Archambault JM, Soslowsky LJ. Gene expression in rat supraspinatus tendon recovers from overuse with rest. Clin Orthop Relat Res. Jul 2008;466(7): 1612-7. doi : 10.1007 / s 11999-008-0270-z Perucca Orfei C, Lovati AB, Vigano M, et al. Dose-Related and Time-Dependent Development of Collagenase-Induced Tendinopathy in Rats. PLoS One.2016;l l(8):e0161590. doi: 10.1371 / joumal.pone.0161590 Maffulli N, Longo UG, Franceschi F, Rabitti C, Denaro V. Movin and Bonar scores assess the same characteristics of tendon histology. Clin Orthop Relat Res. Jul 2008;466(7): 1605- 11. doi : 10.1007 / s 11999-008-0261 -0 Shah V, Bendele A, Dines JS, et al. Dose-response effect of an intra-tendon application of recombinant human platelet-derived growth factor-BB (rhPDGF-BB) in a rat Achilles tendinopathy model. J Orthop Res. Mar 2013;31(3):413-20. doi: 10.1002 / jor.22222 Oshita T, Tobita M, Tajima S, Mizuno H. Adipose-Derived Stem Cells Improve Collagenase-Induced Tendinopathy in a Rat Model. Am J Sports Med. Aug 2016;44(8): 1983-9. doi: 10.1177 / 0363546516640750 Sanchez-Sanchez JL, Calderon-Diez L, Herrero-Turrion J, Mendez-Sanchez R, Arias-Buria JL, Femandez-de-Las-Penas C. Changes in Gene Expression Associated with Collagen Regeneration and Remodeling of Extracellular Matrix after Percutaneous Electrolysis on Collagenase-Induced Achilles Tendinopathy in an Experimental Animal Model: A Pilot Study. JClinMed. Oct 15 2020;9(10)doi: 10.3390 / jcm9103316 Li S, Wu Y, Jiang G, et al. Intratendon delivery of leukocyte-rich platelet-rich plasma at early stage promotes tendon repair in a rabbit Achilles tendinopathy model. J Tissue Eng RegenMed. Mar 2020; 14(3):452-463. doi: 10.1002 / term.3006 Gonzalez JC, Lopez C, Alvarez ME, Perez JE, Carmona JU. Autologous leukocyte-reduced platelet-rich plasma therapy for Achilles tendinopathy induced by collagenase in a rabbit model. Scientific reports . Jan 19 2016;6:19623. doi: 10.1038 / srep 19623 de Cesar Netto C, Godoy-Santos AL, Augusto Pontin P, et al. Novel animal model for Achilles tendinopathy: Controlled experimental study of serial injections of collagenase in rabbits. PLoS One. 2018;13(2):e0192769. doi: 10.1371 / joumal.pone.Ol 92769 Lee SY, Chieh HF, Lin CJ, et al. Characteristics of Sonography in a Rat Achilles Tendinopathy Model: Possible Non-invasive Predictors of Biomechanics. Sci Rep. Jul 11 2017;7( 1 ): 5100. doi : 10.1038 / s41598-017-05466-yThomopoulos S, Williams GR, Gimbel JA, Favata M, Soslowsky LJ. Variation of biomechanical, structural, and compositional properties along the tendon to bone insertion site. J Orthop Res. May 2003;21(3):413-9. doi: 10.1016 / S0736-0266(03)00057-3 Gimbel JA, Van Kleunen JP, Mehta S, Perry SM, Williams GR, Soslowsky LJ.Supraspinatus tendon organizational and mechanical properties in a chronic rotator cuff tear animal model. J Biomech. May 2004;37(5):739-49. doi: 10.1016 / j.jbiomech.2003.09.019 Gimbel JA, Van Kleunen JP, Williams GR, Thomopoulos S, Soslowsky LJ. Long durations of immobilization in the rat result in enhanced mechanical properties of the healing supraspinatus tendon insertion site. J Biomech Eng. Jun 2007;129(3):400-4. doi: 10.1115 / 1.2721075 Leong DJ, Choudhury M, Hanstein R, et al. Green tea polyphenol treatment is chondroprotective, anti-inflammatory and palliative in a mouse post-traumatic osteoarthritis model. Arthritis Res Ther. Dec 17 2014; 16(6):508. doi: 10.1186 / sl3075-014- 0508-y Rio E, Moseley L, Purdam C, et al. The pain of tendinopathy: physiological or pathophysiological? Sports Med. Jan 2014;44(l):9-23. doi: 10.1007 / s40279-013-0096-z Vaschenko MA, Zhadan PM, Aminin DL, Almyashova TN. Lipofuscin-like pigment in gonads of Sea Urchin Strongylocentrotus intermedius as a potential biomarker of marine pollution: a field study. Arch Environ Contam Toxicol. May 2012;62(4):599-613. doi : 10.1007 / s00244-011-9733-4 Georgakopoulou EA, Tsimaratou K, Evangelou K, et al. Specific lipofuscin staining as a novel biomarker to detect replicative and stress-induced senescence. A method applicable in cryo-preserved and archival tissues. Aging (Albany NY) . Jan 2013;5(l):37-50. doi: 10.18632 / aging.100527 Han SH, Kim HK, Ahn JH, et al. A Protocol to Acquire the Degenerative Tenocyte from Humans. J Vis Exp. Jun 9 2018;(136)doi: 10.3791 / 57634 Bi Y, Ehirchiou D, Kilts TM, et al. Identification of tendon stem / progenitor cells and the role of the extracellular matrix in their niche. Nat Med. Oct 2007; 13(10): 1219-27. doi: 10.1038 / nml630 Wang Y, Zhao X, Lotz M, Terkeltaub R, Liu-Bryan R. Mitochondrial biogenesis is impaired in osteoarthritis chondrocytes but reversible via peroxisome proliferator-activated receptor gamma coactivator 1 alpha. Arthritis Rheumatol. May 2015;67(8):2141-53. doi: 10.1002 / art.39182 Dietrich-Zagonel F, Hammerman M, Bemhardsson M, Eliasson P. Effect of storage and preconditioning of healing rat Achilles tendon on structural and mechanical properties. Sci Rep. Jan 13 2021 ; 11(1 ):958. doi: 10.1038 / s41598-020-80299-w Lake SP, Snedeker JG, Wang VM, Awad H, Screen HRC, Thomopoulos S. Guidelines for ex vivo mechanical testing of tendon. J Orthop Res. Oct 2023 ;41 ( 10):2105-21 13. doi: 10.1002 / jor.25647 Leahy TP, Nuss CA, Evans MK, Fung AK, Shetye SS, Soslowsky LJ. Achilles Tendon Ruptures in Middle-Aged Rats Heal Poorly Compared With Those in Young and Old Rats [Formula: see text]. Am J Sports Med. Jan 2022;50(l): 170-181. doi: 10.1177 / 03635465211055476Wu PT, Hsu CH, Su FC, et al. Dynamic weight bearing analysis is effective for evaluation of tendinopathy using a customized corridor with multi-directional force sensors in a rat model. Sci Rep. Aug 18 2017;7(l):8708. doi : 10.1038 / s41598-017-07812-6 Deuis JR, Dvorakova LS, Vetter I. Methods Used to Evaluate Pain Behaviors in Rodents. Front Mol Neurosci. 2017;10:284. doi: 10.3389 / fnmol.2017.00284 Bonin RP, Bories C, De Koninck Y. A simplified up-down method (SUDO) for measuring mechanical nociception in rodents using von Frey filaments. Mol Pain. Apr 162014;10:26. doi : 10.1186 / 1744-8069- 10-26 Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. Jul 1994;53(l):55-63. Ren Y, Mu Y, Jiang L, et al. Multifunctional TK-VEPs nanocarrier for tumor-targeted delivery . Int J Pharm. Apr 11 2016;502(l-2):249-57. doi: 10.1016 / j.ijpharm.2016.02.037 Ramachandran S, Thiyagarajan S, Dhinakar Raj G, Uma A. Non-invasive in vivo imaging of fluorescence-labeled bacterial distributions in aquatic species. Int J Vet Sci Med. Dec 2017;5(2): 187-195. doi:10.1016 / j.ijvsm.2017.09.003 OECD Guidelines for the Testing of Chemicals. www.oecd.org / env / ehs / testing / oecdguidelinesforthetestingofchemicals.htm Lan Z, Wang L, Chong Z, et al. Evaluation of the acute and chronic toxicity of the jiangu capsules. Exp Ther Med. Dec 2017;14(6):6229-6237. doi: 10.3892 / etm.2017.5341 Yi C, Wu MX, Jie L, et al. Acute and sub-acute oral toxicity studies of the aqueous extract from radix, radix with cortex and cortex of Psammosilene tunicoides in mice and rats. J Ethnopharmacol. Mar 1 2018;213:199-209. doi: 10.1016 / j jep.2017.11.011 Oshima G, Guo N, He C, et al. In Vivo Delivery and Therapeutic Effects of a MicroRNA on Colorectal Liver Metastases. Mol Ther. Jul 5 2017;25(7):1588-1595. doi: 10.1016 / j .ymthe.2017.04.005 Reumann MK, Weiser MC, Mayer-Kuckuk P. Musculoskeletal molecular imaging: a comprehensive overview. Trends Biotechnol. Feb 2010;28(2):93-101. doi : 10.1016 / j .tibtech.2009.11.004 Vasquez KO, Casavant C, Peterson JD. Quantitative whole body biodistribution of fluorescent -labeled agents by non-invasive tomographic imaging. PLoS One.201 l;6(6):e20594. doi: 10.1371 / joumal.pone.0020594 Chan KK, Liu Z, Xie Z, et al. A novel ultrasensitive hybridization-based ELISA method for 2-methoxyphosphorothiolate microRNAs and its in vitro and in vivo application. The AAPS journal. Dec 2010; 12(4) : 556-68. doi : 10.1208 / s 12248-010-9214-0 Wang H, Chiu M, Xie Z, et al. Synthetic microRNA cassette dosing: pharmacokinetics, tissue distribution and bioactivity. Mol Pharm. Jun 4 2012;9(6): 1638-44. doi: 10.1021 / mp2006483 Paxson JA, Gruntman A, Parkin CD, et al. Age-dependent decline in mouse lung regeneration with loss of lung fibroblast clonogenicity and increased myofibroblastic differentiation. PLoS One. 201 l;6(8):e23232. doi: 10.1371 / journal.pone.0023232 Tuite DJ, Renstrom PA, O'Brien M. The aging tendon. Scand J Med Sci Sports. Apr 1997;7(2):72-7. doi: 10.1111 / j.1600-0838.1997.tb00122.x Narici MV, Maffulli N, Maganaris CN. Ageing of human muscles and tendons. Disabil Rehabil. 2008;30(20-22): 1548-54. doi: 10.1080 / 09638280701831058 Spang C, Renstrom L, Alfredson H, Forsgren S. Marked expression of TNF receptors in human peritendinous tissues including in nerve fascicles with axonal damage - Studies ontendinopathy and tennis elbow. J Musculoskelet Neuronal Interact. Sep 1 2017; 17(3):226- 236. Hess A, Axmann R, Rech J, et al. Blockade of TNF-alpha rapidly inhibits pain responses in the central nervous system. Proc Natl Acad Set USA. Mar 1 2011 ; 108(9): 3731 -6. doi : 10.1073 / pnas.1011774108 Miller RJ, Jung H, Bhangoo SK, White FA. Cytokine and chemokine regulation of sensory neuron function. Handb Exp Pharmacol . 2009;(194):417-49. doi: 10.1007 / 978-3-540- 79090-7 2 Sun JH, Yang B, Donnelly DF, Ma C, LaMotte RH. MCP-1 enhances excitability of nociceptive neurons in chronically compressed dorsal root ganglia. J Neurophysiol. Nov 2006;96(5):2189-99. doi: 10.1152 / jn.00222.2006 Michel S, Schirduan K, Shen Y, Klar R, Tost J, Jaschinski F. Using RNA-seq to Assess Off-Target Effects of Antisense Oligonucleotides in Human Cell Lines. Mol Diagn Ther. Jan 2021 ;25(1 ): 77-85. doi : 10.1007 / s40291 -020-00504-4 Hobel S, Aigner A. Polyethylenimines for siRNA and miRNA delivery in vivo. Wiley Interdiscip Rev Nanomed Nanobiotechnol. Sep-Oct 2013 ; 5(5) : 484-501. doi : 10.1002 / wnan.1228 Jager M, Schubert S, Ochrimenko S, Fischer D, Schubert US. Branched and linear poly(ethylene imine)-based conjugates: synthetic modification, characterization, and application. Chem Soc Rev. Jul 7 2012;41 (13):4755-67. doi: 10.1039 / c2cs35146c Amin B, Bowser BL, Robinson RAS. Quantitative proteomics to study aging in rabbit spleen tissues. Exp Gerontol. Oct 1 2022;167:l 11908. doi:10.1016 / j.exger.2022.111908 do Nascimento NC, Bailey TW, Santos AP, et al. Proteomic analysis reveals that aging rabbit vocal folds are more vulnerable to changes caused by systemic dehydration. BMC Genomics. Nov 21 2022;23(l ):762. doi: 10.1186 / sl2864-022-08975-x Sengupta P, Dutta S. Mapping the Age of Laboratory Rabbit Strains to Human. IntJ Prev Med. 2020;l 1:194. doi: 10.4103 / ijpvm.IJPVM_530_18 Wyrwich KW. Minimal important difference thresholds and the standard error of measurement: is there a connection? J Bi opharm Stat. Feb 2004; 14(1):97-110. doi: 10.1081 / BIP-120028508 Ikeda Y, Ishihara A, Nakajima M, Yamada K. Risk factors for superficial digital flexor tendinopathy in Thoroughbred racing horses in Japan. J Equine Sci. 2019;30(4):93-98. doi: 10.1294 / jes.30.93

Claims

CLAIMSWhat is claimed is:

1. A pharmaceutical composition comprising in a unit dosage form: a therapeutically- effective amount of a compound that increases let-7b-5p activity; and a pharmaceutically- acceptable carrier.

2. The pharmaceutical composition of claim 1, wherein the compound is a microRNA or mimic thereof.

3. The pharmaceutical composition of claim 2, wherein the microRNA or mimic thereof is double-stranded.

4. The pharmaceutical composition of claim 3, wherein the antisense strand of the microRNA or mimic thereof is modified.

5. The pharmaceutical composition of claim 2 or 3, wherein the guide strand of the microRNA or mimic thereof is unmodified.

6. The pharmaceutical composition of any one of claims 1-5, wherein the compound is conjugated to a serum lipoprotein.

7. The pharmaceutical composition of any one of claims 1-6, wherein the compound is a microRNA or mimic thereof and the serum lipoprotein is conjugated to a 3’ end of the microRNA, preferably wherein the serum lipoprotein is conjugated to the 3’ end of an antisense RNA strand of a double-stranded microRNA.

8. The pharmaceutical composition of claim 6 or 7, wherein the serum lipoprotein is cholesterol.

9. The pharmaceutical composition of any one of claims 1-8, wherein the compound comprises a ribose modification.

10. The pharmaceutical composition of claim 9, wherein the ribose modification is a 2'-O- methyl modification.

11. The pharmaceutical composition of claim 10, wherein the compound is a microRNA or mimic thereof comprising an antisense strand consisting of 2'-O-methyl-modified nucleotides.

12. The pharmaceutical composition of any one of claims 1-11, wherein the compound comprises a phosphate backbone modification.

13. The pharmaceutical composition of claim 12, wherein the phosphate backbone modification is a phosphorothioate modification.

14. The pharmaceutical composition of any one of claims 1-13, wherein the compound is a microRNA or mimic thereof comprises six (6) phosphorothioate modifications, preferably wherein the first two and final four backbone linkages from 5’ to 3’ are phosphorothioate modified linkages.

15. The pharmaceutical of any one of claims 1-14, wherein the compound is conjugated to a label, optionally a fluorescent label.

16. The pharmaceutical composition of any one of claims 2-15, wherein the microRNA is let- 7b-5p.

17. The pharmaceutical composition of any one of claims 2-16, wherein the microRNA or mimic thereof comprises a sequence of UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 1).

18. The pharmaceutical composition of claim 1, wherein the compound is a precursor of a microRNA or a mimic thereof.

19. The pharmaceutical composition of claim 1, wherein the compound encodes a microRNA or a mimic thereof.

20. The pharmaceutical composition of claim 1, wherein the compound encodes a precursor of a microRNA or a mimic thereof.21 . The pharmaceutical composition of any one of claims 1 -20, wherein the compound reduces expression of LOX1, reduces expression of TLR4, and / or reduces expression of p21.

22. The pharmaceutical composition of any one of claims 1-21, wherein the compound binds to LOX1 mRNA, TLR4 mRNA, or p21 mRNA.

23. The pharmaceutical composition of any one of claims 1-22, wherein the compound binds to a 3'-UTR of LOX 1 mRNA, TLR4 mRNA, or p21 mRNA.

24. The pharmaceutical composition of any one of claims 1-23, wherein the compound is encapsulated in a microvesicle, polymeric delivery vehicle, or nanoparticle.

25. The pharmaceutical composition of claim 24, wherein the microvesicle, polymeric delivery vehicle, or nanoparticle is conjugated to tendon-specific ligand, optionally a ligand specific to tendon stem / progenitor cells (TSPCs) and / or tenocytes, optionally a tartrate-resistant acid phosphatase (TRAP)-binding peptide.

26. The pharmaceutical composition of any one of claims 1-25, wherein the compound is conjugated to tendon-specific ligand, optionally a ligand specific to tendon stem / progenitor cells (TSPCs) and / or tenocytes, optionally a tartrate-resistant acid phosphatase (TRAP)- binding peptide.

27. The pharmaceutical composition of any one of claims 1-25, wherein the compound is conjugated to a targeting moiety for delivery to a target tissue, optionally a targeting moiety specific to tendon tissue and / or tendon stem / progenitor cells (TSPCs) and / or tenocytes.

28. The pharmaceutical composition of any one of claims 1-27, wherein the pharmaceutical composition is formulated for injection.

29. The pharmaceutical composition of any one of claims 1-28, wherein the pharmaceutical composition is formulated for intratendinous injection.

30. A method of treating a connective tissue condition in a subject in need thereof, the method comprising administering to the subject the pharmaceutical composition of any one of claims 1-29.

31. The method of claim 30, wherein the method reduces expression of LOX1, reduces expression of TLR4, and / or reduces expression of p21, preferably wherein the reduction in expression is detectable within 3-4 days of the administration of the pharmaceutical composition.

32. The method of claim 30 or 31, wherein the administering is by injection.

33. The method of any one of claims 30-32, wherein the administering is by intratendinous injection.

34. The method of any one of claims 30-33, wherein the administering is by injection once every 1-2 weeks, 2-4 weeks, 4-8 weeks, or 8-16 weeks.

35. The method of any one of claims 30-34, wherein the connective tissue condition is tendinopathy, preferably age-related tendinopathy, tendonitis, or a tendon injury.

36. The method of any one of claims 30-35, further comprising assaying the subject for modulation of gene expression of LOX1, TLR4, and / or p21.

37. The method of any one of claims 30-36, further comprising assaying the subject for modulation of gene expression of IL-ip, TNFa, type I collagen, and / or type III collagen.

38. The method of any one of claims 30-37, further comprising assaying the subject for modulation of a ratio of gene expression of type I collagen to gene expression of type III collagen.

39. The method of any one of claims 30-38, wherein the subject is a human subject aged 60 years or older, more preferably 65 years or older.

40. The method of any one of claims 30-39, wherein the treating comprises mitigating histologic features of tendinopathy, preferably by resulting in a) decreased tendon cellularity; b) less rounded tendon cell morphology; c) decreased tendon vascularity; and / or d) increased organization of collagen fibers.41 . The method of any one of claims 30-40, wherein the treating comprises a) increasing the subj ect’ s tendon-related pain threshold; b) improvements to mechanical properties of a subject’s tendon; c) decreasing cellular senescence, apoptosis, mitochondrial dysfunction, and / or DNA damage in tendon cells, preferably tendon stem / progenitor cells (TSPCs) and / or tenocytes; d) improving the Movin score of the subject; and / or e) reducing the amount of cleaved collagen in tendon tissue of the subject; f) increasing the type I / III collagen ratio in tendon tissue of the subject; and / or g) enhancing the number of Scx / Tnmd+ cells in tendon tissue of the subject.

42. A method of treating a musculoskeletal condition in a subject in need thereof, the method comprising administering to the subject the pharmaceutical composition of any one of claims 1-29.

43. The method of claim 42, wherein the method reduces expression of LOX1, reduces expression of TLR4, and / or reduces expression of p21, preferably wherein the reduction in expression is detectable within 3-4 days of the administration of the pharmaceutical composition.

44. The method of claim 42 or 43, wherein the administering is by injection.

45. The method of any one of claims 42-44, wherein the administering is by intraarticular injection or intramuscular injection.

46. The method of any one of claims 42-45, wherein the administering is by injection once every 1-2 weeks, 2-4 weeks, 4-8 weeks, or 8-16 weeks.

47. The method of any one of claims 42-46, wherein the musculoskeletal condition is arthritis, rheumatoid arthritis, or osteoarthritis.

48. The method of any one of claims 42-47, further comprising assaying the subject for modulation of gene expression of LOX1, TLR4, and / or p21.

49. The method of any one of claims 42-48, further comprising assaying the subject for modulation of gene expression of IL-ip, TNFa, type I collagen, and / or type III collagen.

50. The method of any one of claims 42-49, further comprising assaying the subject for modulation of a ratio of gene expression of type I collagen to gene expression of type III collagen.