Cervical cell gene methylation detection kit and detection method therefor

Abstract

The present invention relates to the technical field of biomedical examination, and in particular to a cervical cell gene methylation detection kit and a detection method. In the present invention, the methylation level of the promoter regions of three genes MTHFR, PAX1 and SGSH in a sample is detected, so as to determine whether the sample has precancerous lesions. The kit and method are convenient and simple in terms of operation, have high levels of detection sensitivity, good specificity, and have very positive effects on cervical cancer detection.

Description

Cervical cell gene methylation detection kit and detection method thereof Technical Field

[0001] The present invention relates to the field of biomedical testing technology, and in particular to a cervical cell gene methylation detection kit and a detection method based on fluorescent quantitative PCR technology. Background Art

[0002] In my country, cervical cancer is one of the most common malignant tumors threatening women's health, ranking second in both morbidity and mortality. In 2018, there were over 569,000 new cases of cervical cancer and over 311,000 deaths worldwide. 85% of these cases occurred in developing countries. In 2015, there were approximately 111,000 new cases and 34,000 deaths in my country. The overall distribution of cervical cancer deaths in my country is slightly higher in rural areas than in urban areas, with rates in the central and western regions being approximately twice as high as those in the eastern region. The median age of onset for cervical cancer in my country is 51 years, but it primarily occurs in two age groups: those in their 40s and 50s, with another peak in their 60s and 70s. It is rare in those under 20 years of age. However, it is noteworthy that the average age of cervical cancer onset has been gradually decreasing in recent years, showing a trend toward younger patients. Therefore, it is crucial to standardize the diagnosis and treatment of cervical cancer nationwide. Furthermore, the incidence of cervical cancer can be effectively controlled through the detection and treatment of precancerous lesions.

[0003] Current clinically used cytological TCT and virological HPV testing have limitations and cannot fully meet clinical needs. Cervical cancer gene methylation testing, with its high sensitivity, specificity, and accuracy, can effectively fill this clinical gap and provide clinicians with more valuable references, thereby better serving both clinicians and the public.

[0004] Summary of the Invention

[0005] In order to solve the problems of the prior art, the purpose of the present invention is to provide a cervical cell gene methylation detection kit and a cervical cell gene methylation detection method based on fluorescent quantitative PCR technology, so as to realize the combined detection of multi-gene methylation and thus realize the early screening of cervical cancer.

[0006] This method uses fluorescent quantitative PCR technology to jointly detect methylation of the MTHFR, PAX1, and SGSH genes in patients' cervical exfoliated cells. After bisulfite treatment of the sample, specific primers and fluorescent probes are used to amplify the nucleic acid to achieve rapid detection of methylation of the methylation-related genes MTHFR, PAX1, and SGSH, providing a simpler and more accurate screening for clinical use. The NCBI database number of the MTHFR gene sequence involved in this invention is NC_000001.11, and the NCBI database numbers of the PAX1 gene and SGSH gene are NC_000020.11 and NC_000017.11, respectively.

[0007] To achieve the purpose of the invention, the first technical solution provided by the present invention is as follows: The present invention provides a cervical cell gene methylation detection kit, characterized in that the kit includes: an MTHFR PCR reaction solution for detecting the methylation level in at least one target region in the MTHFR gene promoter region; a PAX1 PCR reaction solution for detecting the methylation level in at least one target region in the PAX1 gene promoter region; an SGSH PCR reaction solution for detecting the methylation level in at least one target region in the SGSH gene promoter region; and also includes a positive control and a negative control; the promoter region is not strictly limited to a region located within the promoter fragment, but a gene fragment in the vicinity of the promoter.

[0008] The MTHFR, PAX1 and SGSH genes are all closely related to the progression of cervical cancer. The methylation detection region of each target gene contains multiple CpGs, which reduces the randomness of base changes compared to the detection of a single base. At the same time, the combined methylation detection of the three target genes MTHFR, PAX1 and SGSH effectively supplements the differences that may be caused by site selection and reaction system, and improves the accuracy of cervical cell gene methylation detection.

[0009] The MTHFR PCR reaction solution includes MTHFR forward and reverse primers, an MTHFR probe, internal reference ACTB forward and reverse primers, and an internal reference ACTB probe; the PAX1 PCR reaction solution includes PAX1 forward and reverse primers, a PAX1 probe, internal reference ACTB forward and reverse primers, and an internal reference ACTB probe; the SGSH PCR reaction solution includes SGSH forward and reverse primers, an SGSH probe, internal reference ACTB forward and reverse primers, and an internal reference ACTB probe.

[0010] The MTHFR, PAX1, and SGSH PCR reaction solution contains 10× buffer, 10 mM dNTP mixture, and an enzyme mixture. The enzyme mixture includes Taq enzyme and UNG enzyme, wherein the Taq enzyme is a hot-start Taq enzyme and the UNG enzyme is uracil-N-glycosylase.

[0011] The base sequence of the MTHFR forward primer is tcggtttttattggtcgcgg (SEQ ID No. 1), the base sequence of the THFR reverse primer is tacctcgaaacaaaacgc (SEQ ID No. 2), and the base sequence of the MTHFR probe is accgcgaaaccaac (SEQ ID No. 3); the base sequence of the PAX1 forward primer is tcgacgttgtagtttttcggttagacgaat (SEQ ID No. 4), the base sequence of the PAX1 reverse primer is tacccctccaaaacctcccac (SEQ ID No. 5), and the base sequence of the PAX1 probe is cccgaccccaacccaaataacttcat (SEQ ID No. 6); the base sequence of the SGSH forward primer is gtttcgcgtcgcgttt (SEQ ID No. 7), and the base sequence of the SGSH reverse primer is acgacgacgaaccacc (SEQ ID No. 8). No.8), the base sequence of the SGSH probe is cgcgccctaaact (SEQ ID No.9); the base sequence of the internal reference ACTB forward primer is taggatttttatttag (SEQ ID No.10), the base sequence of the internal reference ACTB reverse primer is tgtgaatttttgttat (SEQ ID No.11), and the base sequence of the internal reference ACTB probe is ttttaagggaggagt (SEQ ID No.12).

[0012] The two ends of the MTHFR probe, PAX1 probe, SGSH probe and ACTB probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group.

[0013] The fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5; the fluorescent quencher group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0014] Each probe is labeled with a fluorescent reporter group / fluorescence quencher group at both ends, the fluorescent reporter group at the 5' end is the same or different and is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5; the fluorescent quencher group at the 3' end is the same or different and is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0015] In a specific embodiment of the present invention, the MTHFR fluorescent probe has a 5'-end reporter group of FAM and a 3'-end quencher group of BHQ1; the internal reference gene fluorescent probe has a 5'-end fluorescent reporter group of VIC and a 3'-end quencher group of BHQ1; the PAX1 fluorescent probe has a 5'-end reporter group of FAM and a 3'-end quencher group of BHQ1; the internal reference gene fluorescent probe has a 5'-end fluorescent reporter group of VIC and a 3'-end quencher group of BHQ1; the SGSH fluorescent probe has a 5'-end luminescent group of FAM and a 3'-end quencher group of BHQ1; the internal reference gene fluorescent probe has a 5'-end fluorescent reporter group of VIC and a 3'-end quencher group of BHQ1.

[0016] The positive control substance is selected from the DNA of cervical squamous cell carcinoma cell Hisa:

[0017] The negative control substance is sterile water.

[0018] To achieve the purpose of the invention, the second technical solution provided by the present invention is as follows: The present invention provides a method for detecting gene methylation in cervical cells, characterized in that the method comprises the following steps:

[0019] (1) Extracting DNA from the sample to be tested;

[0020] (2) treating the sample DNA to be tested with bisulfite to obtain purified Bis-DNA;

[0021] (3) Using the purified Bis-DNA as a template, a PCR amplification reaction was performed using the primer and probe combinations in the MTHFR PCR reaction solution, PAX1 PCR reaction solution, and SGSH PCR reaction solution in the kit of the present invention: ACTB was selected as the internal reference gene for the three target genes MTHFR, PAX1, and SGSH, and multi-channel fluorescent probe labeling was used to achieve simultaneous detection of the target genes and the internal reference genes;

[0022] (4) According to the above steps, the △Ct values ​​(target Ct value - internal reference Ct value) of the three target genes MTHFR, PAX1 and SGSH are obtained: X1 = Ct value of MTHFR - Ct value of ACTB, X2 = Ct value of PAX1 - Ct value of ACTB, X3 = Ct value of SGSH - Ct value of ACTB, and the methylation degree is determined by substituting them into the regression equation Y = 10.326-0.309*X1-0.623*X2-0.552*X3. When Y ≥ 0, the sample to be tested is determined to be methylation-positive for cervical cancer; when Y < 0, the sample to be tested is determined to be methylation-negative for cervical cancer.

[0023] Advantages of the present invention:

[0024] 1. The present invention provides a methylation gene panel for cervical cancer methylation detection, comprising the following methylation genes: MTHFR, PAX1, and SGSH. In the present invention, the MTHFR, PAX1, and SGSH genes are all closely related to the progression of cervical cancer. The methylation detection region of each target gene contains multiple CpGs, which reduces the randomness of base changes compared to the detection of a single base. The methylation determination of the target gene is not limited to one or two bases.

[0025] 2. ACTB was selected as the internal reference gene for the three target genes. Multi-channel fluorescent probe labeling was used to achieve simultaneous detection of the target genes and the internal reference genes. Finally, the △Ct values ​​of the three genes (target Ct value - internal reference Ct value) were substituted into the regression equation Y = 10.326-0.309*X1-0.623*X2-0.552*X3 to determine the degree of methylation.

[0026] 3. The present invention provides a reaction solution and detection method for cervical cancer methylation PCR, and provides matching sample nucleic acid extraction and sulfite conversion methods. The DNA after sulfite conversion is used as a template for the PCR reaction, and the three target genes MTHFR, PAX1 and SGSH are detected simultaneously. The present invention effectively supplements the differences that may be caused by site selection and reaction system by combining MTHFR, PAX1 and SGSH methylation detection, thereby improving the accuracy of cervical cancer methylation detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 shows a typical PCR amplification curve for methylation of genes (MTHFR, PAX1, and SGSH) in cervical cancer exfoliated cell samples. (The primer and probe combinations used in the kit are MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P).) The Ct values ​​for the MTHFR, PAX1, and SGSH genes in cervical cancer exfoliated cell samples were all ≤32.

[0028] Figure 2 shows a typical PCR amplification curve for unmethylated genes (MTHFR, PAX1, and SGSH) in a normal cervical exfoliated cell sample. (The primer and probe combinations are MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P)). This curve shows that the Ct values ​​for the MTHFR, PAX1, and SGSH genes in normal cervical exfoliated cell samples are all >32.

[0029] Figure 3 shows the area under the ROC curve (AUC) for cervical precancerous lesions (CIN2 and above) and normal controls, with a value of 0.965 (95% CI 0.914-1; P < 0.0001);

[0030] FIG4 is a table showing the fluorescence detection channel selection and amplification cycle parameter settings according to Example 2 of the present invention;

[0031] FIG5 is a comparison table of the detection results of the kit of the present invention and the pathological detection results in Example 3 of the present invention. DETAILED DESCRIPTION

[0032] (I) Example 1 A kit for detecting gene methylation in cervical cells according to the present invention

[0033] The present invention provides a cervical cell gene methylation detection kit, characterized in that the kit comprises: an MTHFR PCR reaction solution for detecting the methylation level in at least one target region of the MTHFR gene promoter region; a PAX1 PCR reaction solution for detecting the methylation level in at least one target region of the PAX1 gene promoter region; and an SGSH PCR reaction solution for detecting the methylation level in at least one target region of the SGSH gene promoter region; the kit also includes a positive control and a negative control; the promoter region is not strictly limited to a region located within a promoter fragment, but is a gene fragment in the vicinity of the promoter.

[0034] The MTHFR PCR reaction solution includes MTHFR forward primer, MTHFR reverse primer, MTHFR probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, 10× buffer, 10 mM dNTP mixture and enzyme mixture.

[0035] The PAX1 PCR reaction solution includes PAX1 forward primer, PAX1 reverse primer, PAX1 probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, 10× buffer, 10 mM dNTP mix and enzyme mix.

[0036] The SGSH PCR reaction solution includes SGSH forward primer, SGSH reverse primer, SGSH probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, 10× buffer, 10 mM dNTP mixture and enzyme mixture.

[0037] The ratio of forward primer, reverse primer and probe in the above-mentioned MTHFR PCR reaction solution, PAX1 PCR reaction solution and SGSH PCR reaction solution was 4:4:2; the forward primer was 200 nM, the reverse primer was 200 nM and the probe was 100 nM.

[0038] The enzyme mixture comprises Taq enzyme and UNG enzyme, wherein the Taq enzyme is a hot-start Taq enzyme and the UNG enzyme is uracil-N-glycosylase.

[0039] The nucleotide sequences of the primers and probes for the cervical cancer methylation genes MTHFR, PAX1, and SGSH, and the internal reference gene ACTB involved in this embodiment are shown in Table 1 below. The nucleotide sequence listings involved in the present invention have been submitted to the State Intellectual Property Office in accordance with the ST.26 standard.

[0040] Table 1

[0041] Furthermore, the positive control is selected from the DNA of cervical squamous cell carcinoma cell Hisa:

[0042] Furthermore, the negative control substance is sterile water.

[0043] The specific composition of the kit is shown in the table below:

[0044] (II) Example 2

[0045] A method for detecting cervical cell gene methylation using a cervical cell gene methylation detection kit of the present invention comprises the following steps:

[0046] (1) Extract DNA from the sample to be tested:

[0047] Cellular DNA was extracted from cervical exfoliated cell samples. After the extraction was completed, the DNA concentration and OD260 / OD280 were measured using a Nano-500 micro-spectrophotometer. The OD260 / OD280 was between 1.6 and 2.0.

[0048] (2) The sample DNA to be tested is subjected to bisulfite conversion treatment to obtain purified Bis-DNA:

[0049] After cellular DNA extraction is complete, the extracted DNA undergoes bisulfite conversion, converting unmethylated cytosine (C) to uracil (U) while leaving methylated cytosine (C) unchanged, resulting in purified Bis-DNA. The obtained Bis-DNA should be tested promptly or stored at -20°C for testing. The shelf life generally does not exceed four months. For long-term storage, store at -80°C.

[0050] (3) Using the purified Bis-DNA as a template, PCR amplification was performed using the primer and probe combinations in the MTHFR PCR reaction solution, PAX1 PCR reaction solution, and SGSH PCR reaction solution in the kit of the present invention. For the three target genes, MTHFR, PAX1, and SGSH, ACTB was selected as an internal reference gene. Simultaneous detection of the target genes and internal reference genes was achieved using multi-channel fluorescent probe labeling. The specific operations were as follows:

[0051] S1. Reagent Preparation

[0052] The MTHFR gene PCR reaction system consists of the following reagent components: MTHFR PCR reaction solution volume 15uL, Bis-DNA template volume 2-5uL, purified water up to a volume of 20uL;

[0053] The PAX11 gene PCR reaction system consists of the following reagent components: PAX1 PCR reaction solution volume 15uL, Bis-DNA template volume 2-5uL, purified water up to a volume of 20uL;

[0054] The SGSH gene PCR reaction system consists of the following reagent components: SGSH PCR reaction solution volume 15uL, Bis-DNA template volume 2-5uL, purified water up to volume 20uL;

[0055] S2. Sample addition

[0056] Add 2-5 μL of the nucleic acid sample to be tested to each tube in a row of eight tubes, with a final volume of 20 μL. Close the tube cap tightly, centrifuge briefly at low speed, and test on a PCR instrument.

[0057] S3. PCR Amplification

[0058] Select the fluorescence detection channel and set the amplification cycle parameters as shown in Figure 4; Note: Do not select ROX correction and select None for the quenching group; After setting, save the file and run the reaction program.

[0059] (4) According to the above steps, the △Ct values ​​(target Ct value internal reference Ct value) of the three target genes MTHFR, PAX1 and SGSH are obtained: X1 = Ct value of MTHFR - Ct value of ACTB, X2 = Ct value of PAX1 - Ct value of ACTB, X3 = Ct value of SGSH - Ct value of ACTB, and the methylation degree is determined by substituting them into the regression equation Y = 10.326-0.309*X1-0.623*X2-0.552*X3. When Y ≥ 0, the sample to be tested is determined to be methylation-positive for cervical cancer; when Y < 0, the sample to be tested is determined to be methylation-negative for cervical cancer.

[0060] (III) Test accuracy of kit detection in Example 3

[0061] The comparison between the detection results of the kit of the present invention and the pathological detection results is shown in FIG5 .

[0062] The results of gene methylation testing for MTHFR, PAX1, and SGSH in 60 cervical exfoliated cell samples are shown in Figures 1 and 2. Figure 1 shows a typical PCR amplification curve for methylation of the genes (MTHFR, PAX1, and SGSH) in cervical cancer exfoliated cell samples (using the kit with the primer and probe combinations of MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P)). The Ct values ​​for the MTHFR, PAX1, and SGSH genes in cervical cancer exfoliated cell samples were all ≤32. Figure 2 shows a typical PCR amplification curve for unmethylation of the genes (MTHFR, PAX1, and SGSH) in normal cervical exfoliated cell samples (using the kit with the primer and probe combinations of MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P)). The Ct values ​​for the MTHFR, PAX1, and SGSH genes in normal cervical exfoliated cell samples were all >32. Experimental data showed that, with CIN2 as the clinical diagnostic cutoff, the detection sensitivity of the kit provided in Example 1 of the present invention was 83.3% and 100%, respectively.

[0063] (IV) ROC curves of pathological diagnosis results of Example 4 for normal subjects and CIN2 and above

[0064] As shown in FIG3 , the kit provided in Case 1 of the present invention can clearly distinguish cervical precancerous lesions (CIN2 and above) from normal controls, with the area under the ROC curve (AUC) being 0.965 (95% CI 0.914-1; P < 0.0001).

[0065] (V) Logistic regression analysis of Example 5

[0066] The logistic regression equation for judging normal samples and CIN2 and above was obtained through experiments: Y = A0 + A1*X1 + A2*X2 + A3*X3; among them, A0, A1, A2, and A3 are clinical coefficients, and the weight relationship of the clinical coefficients is as follows: MTHFR proportion coefficient A1 = -0.309, PAX1 proportion coefficient A2 = -0.623, SGSH proportion coefficient A3 = -0.552, and constant proportion coefficient A0 = 10.326.

[0067] The differences in amplification cycles between the MTHFR, PAX1, and SGSH genes and the internal reference gene ACTB are X1, X2, and X3, respectively. X1 = Ct value of MTHFR minus Ct value of ACTB, X2 = Ct value of PAX1 minus Ct value of ACTB, and X3 = Ct value of SGSH minus Ct value of ACTB. Substituting these into the regression equation Y = 10.326-0.309*X1-0.623*X2-0.552*X3 determines the degree of methylation. When Y ≥ 0, the sample is considered positive for cervical cancer methylation; when Y < 0, the sample is considered negative for cervical cancer methylation.

[0068] The sensitivity and specificity of the combined detection of cervical cancer and precancerous lesions by analyzing the methylation fitting regression analysis of the three genes are much higher than the detection and analysis results of the single genes MTHFR, PAX1, and SGSH.

Claims

1. A cervical cell gene methylation detection kit, characterized in that: The kit includes: an MTHFR PCR reaction solution for detecting the methylation degree in at least one target region of the MTHFR gene promoter region; a PAX1 PCR reaction solution for detecting the methylation degree in at least one target region of the PAX1 gene promoter region; an SGSH PCR reaction solution for detecting the methylation degree in at least one target region of the SGSH gene promoter region; and also includes a positive control and a negative control; the promoter region is not strictly limited to a region located within a promoter fragment, but is a gene fragment in the vicinity of the promoter.

2. A cervical cell gene methylation detection kit according to claim 1, characterized in that: The MTHFR PCR reaction solution includes MTHFR forward and reverse primers, MTHFR probe, internal reference ACTB forward and reverse primers, and internal reference ACTB probe; the PAX1 PCR reaction solution includes PAX1 forward and reverse primers, PAX1 probe, internal reference ACTB forward and reverse primers, and internal reference ACTB probe; the SGSH PCR reaction solution includes SGSH forward and reverse primers, SGSH probe, internal reference ACTB forward and reverse primers, and internal reference ACTB probe.

3. A cervical cell gene methylation detection kit according to claim 2, characterized in that: The MTHFR, PAX1, SGSH PCR reaction solution also includes 10× buffer, 10mM dNTP mixture and enzyme mixture, the enzyme mixture includes Taq enzyme and UNG enzyme, the Taq enzyme is hot start Taq enzyme, and the UNG enzyme is uracil-N-glycosylase.

4. A cervical cell gene methylation detection kit according to claim 2, characterized in that: The base sequence of the MTHFR forward primer is tcggtttttattggtcgcgg (SEQ ID No. 1), the base sequence of the THFR reverse primer is tacctcgaaacaaaacgc (SEQ ID No. 2), and the base sequence of the MTHFR probe is accgcgaaaccaac (SEQ ID No. 3); the base sequence of the PAX1 forward primer is tcgacgttgtagtttttcggttagacgaat (SEQ ID No. 4), the base sequence of the PAX1 reverse primer is tacccctccaaaacctcccac (SEQ ID No. 5), and the base sequence of the PAX1 probe is cccgaccccaacccaaataacttcat (SEQ ID No. 6); the base sequence of the SGSH forward primer is gtttcgcgtcgcgttt (SEQ ID No. 7), and the base sequence of the SGSH reverse primer is acgacgacgaaccacc (SEQ ID No. 8). No.8), the base sequence of the SGSH probe is cgcgccctaaact (SEQ ID No.9); the base sequence of the internal reference ACTB forward primer is taggatttttatttag (SEQ ID No.10), the base sequence of the internal reference ACTB reverse primer is tgtgaatttttgttat (SEQ ID No.11), and the base sequence of the internal reference ACTB probe is ttttaagggaggagt (SEQ ID No.12).

5. A cervical cell gene methylation detection kit according to claim 2, characterized in that: The two ends of the MTHFR probe, PAX1 probe, SGSH probe and ACTB probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group; the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5; the fluorescent quencher group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

6. A cervical cell gene methylation detection kit according to claim 1, characterized in that: The positive control substance is selected from the DNA of Hisa of cervical squamous cell carcinoma cells; the negative control substance is sterile water.

7. A method for detecting gene methylation in cervical cells, characterized in that The following steps are involved: (1) Extracting DNA from samples to be tested; (2) treating the sample DNA to be tested with bisulfite to obtain purified Bis-DNA; (3) using the purified Bis-DNA as a template, and using the primers and probe combinations in the MTHFR PCR reaction solution, PAX1 PCR reaction solution, and SGSH PCR reaction solution in the kit of claim 1 to perform a PCR amplification reaction: for the three target genes MTHFR, PAX1, and SGSH, ACTB was selected as an internal reference gene, and the target genes and internal reference genes were simultaneously detected based on multi-channel fluorescent probe labeling; (4) According to the above steps, the △Ct values ​​(target Ct value - internal reference Ct value) of the three target genes MTHFR, PAX1 and SGSH are obtained: X1 = Ct of MTHFR - Ct value of ACTB, X2 = Ct of PAX1 - Ct value of ACTB, X3 = Ct of SGSH - Ct value of ACTB, and the results are substituted into the regression equation Y = 10.326-0.309*X1-0.623*X2-0.552*X3 to determine the degree of methylation. When Y ≥ 0, the sample to be tested is judged to be methylation-positive for cervical cancer; when Y < 0, the sample to be tested is judged to be methylation-negative for cervical cancer.

Images