Intestinal bacterial strain and use thereof in Anti-tumor immunotherapy

Abstract

The present invention relates to the field of cancer immunotherapy. Specifically, the present invention relates to the effect of an intestinal-specific strain Anaerostipes caccae ibiome007 on anti-tumor immunity, and provides a method for improving the tumor immunotherapy response rate of patients.

Description

A strain of intestinal bacteria and its application in anti-tumor immunotherapy Technical Field

[0001] The present invention relates to the field of cancer immunotherapy. Specifically, the present invention relates to the anti-tumor immunity effect of specific intestinal bacterial strains and provides a method for improving the response rate of patients to tumor immunotherapy. Background Art

[0002] Programmed death receptor 1 (PD-1) is an immunosuppressive molecule primarily expressed on the surface of activated CD4 and CD8 T cells, B cells, monocytes, NK cells, and dendritic cells. It promotes immune tolerance by inhibiting T cell inflammatory activity. Tumor cells upregulate PD-1's ligand, PD-L1, to promote T cell exhaustion and thereby achieve immune escape. In recent years, inhibitors targeting programmed death 1 (PD-1) and its ligand (PD-L1) have garnered widespread attention due to their significant clinical efficacy in advanced malignancies, earning them the 2018 Nobel Prize in Physiology or Medicine. However, the therapeutic efficacy of immune checkpoint blockade (ICB) is currently limited to only 15-30% of cancer patients, and a significant proportion of patients remain unresponsive to ICB therapy.

[0003] Preclinical studies in mice have shown that ICB treatment in germ-free (GF) tumor-bearing mice has no significant anti-tumor efficacy compared to specific pathogen-free (SPF) mice. Similarly, antibiotic treatment of SPF mice significantly inhibits the efficacy of ICB. Furthermore, Matson et al., through pre-ICB fecal 16s sequencing analysis of 42 metastatic melanoma patients, found that Bifidobacterium longum was enriched in patients who responded to PD-1 therapy. Colonization of mice with Bifidobacterium commensalum in combination with PD-1 blockade significantly reduced tumor volume (Vyara Matson, et al., The commensal microbiome is associated with anti-PD-1 efficacy in metastatic melanoma patients. Science. 2018 Jan 5; 359(6371): 104-108. doi: 10.1126 / science.aao3290.). These results suggest that specific gut microbial taxa can modulate responses to anti-PD-1 therapy through interactions with the host immune system. Therefore, finding specific strains that can enhance the therapeutic efficacy of PD1 is crucial for ICB treatment of tumors and has broad application prospects in the field of tumor treatment. Technical issues

[0004] The present invention provides an intestinal bacterium that can enhance the secretion capacity of CD8T cell effector factors, thereby increasing the efficacy of immune checkpoint blockade therapy and achieving the purpose of improving the survival of tumor patients. Technical Solutions

[0005] Therefore, the inventors first established an intestinal bacterial library containing the main groups of human intestinal microorganisms, and through in vitro screening of the IFN-γ+CD8T cell stimulation test of the culture supernatant, they screened out the fecal anaerobic rod-shaped bacteria (Anaerostipes caccae) ibiome007 that can enhance the body's immune response. It was preserved in the China Center for Type Culture Collection, located at the China Center for Type Culture Collection of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The preservation date is August 11, 2023, and the preservation number is CCTCC NO: M 20231456.

[0006] This strain can grow large off-white colonies in anaerobically cultured GAM broth. Its 16s rRNA sequence is shown in SEQ ID No: 1.

[0007] In in vitro screening, metabolites derived from this strain significantly enhanced IFN-γ secretion by CD8 T cells. In in vitro killing experiments, metabolites derived from this strain increased the IFN-γ secretion capacity of CD8 T cells and the proportion of PD-1-positive and TNF-α-positive cells in IFN-γ-positive CD8 T cells.

[0008] The fecal anaerobic rod-shaped bacteria (Anaerostipes caccae) ibiome007 can reduce the tumor volume of tumor-bearing mice, improve the response rate of anti-tumor immunotherapy, and colonize in the body of the subjects, which is expected to enhance the effect of anti-PD-1-based tumor treatment.

[0009] The present invention is achieved through the following technical solutions:

[0010] Anaerostipes caccae ibiome007 was deposited in the China Center for Type Culture Collection, China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit date is August 11, 2023, and the deposit number is CCTCC NO: M 20231456.

[0011] The present invention also protects the use of the above-mentioned Anaerostipes caccae ibiome007 in the preparation of a medicament for preventing or treating tumors, wherein the Anaerostipes caccae ibiome007 is preferably a live bacterium or a metabolite thereof, more preferably a metabolite with a molecular weight of less than 3 kDa; when the medicament is used to treat tumors, it can be used alone or in combination with other anti-cancer treatments to enhance the anti-cancer effect.

[0012] Preferably, the prevention of tumor generation or treatment of tumors includes but is not limited to at least one of the following phenotypes:

[0013] (a) Promote the secretion of CD8 T cell effector factors (such as TNF-α and / or IFN-γ) in vitro;

[0014] (b) promoting the secretion of TNF-α and / or IFN-γ, the effector factors of CD8 T cells, in intestinal lamina propria lymphocytes in vivo;

[0015] (c) promoting the secretion of TNF-α and / or IFN-γ, the effector cytokines of CD8 T cells, in tumor-infiltrating lymphocytes in vivo;

[0016] (d) slowing tumor growth;

[0017] (e) reduction of tumor volume;

[0018] (f) Reduction of tumor weight.

[0019] Preferably, the other anti-cancer treatments include anti-PD-1 therapeutic agents (preferably anti-PD-1 antibodies, CTLA-4 antibodies, PD-L1 antibodies and / or PD-L1 inhibitors), or other antibody drugs other than anti-PD-1 antibodies (preferably at least one of chemotherapy drugs, photosensitizers, photothermal agents, and immunotherapy drugs).

[0020] Furthermore, the tumor is a solid tumor (preferably one or more selected from the group consisting of gastric cancer, esophageal cancer, colon cancer, rectal cancer, liver cancer, pancreatic cancer, breast cancer, kidney cancer, fibrosarcoma, lung cancer, bile duct cancer, and melanoma, more preferably colon cancer or melanoma).

[0021] The present invention also protects the use of the above-mentioned Anaerostipes caccae ibiome007 or its culture supernatant in the preparation of a drug for promoting CD8 T cells to secrete IFN-γ.

[0022] The present invention also protects a pharmaceutical composition comprising the above-mentioned Anaerostipes caccae ibiome007, or a culture of the Anaerostipes caccae ibiome007 or a processed product thereof (preferably a live bacterium, a live bacterium metabolite, and more preferably a metabolite with a molecular weight of less than 3 kDa), and a pharmaceutically acceptable carrier.

[0023] Preferably, the pharmaceutical composition further comprises an anti-PD-1 therapeutic agent (preferably an anti-PD-1 antibody, a CTLA-4 antibody, a PD-L1 antibody or a PD-L1 inhibitor), or other antibody drugs other than anti-PD-1 antibodies (preferably at least one of a chemotherapeutic drug, a photosensitizer, a photothermal agent, and an immunotherapy drug).

[0024] Preferably, the dosage form of the pharmaceutical composition is selected from the group consisting of tablets, granules, capsules, suspensions, and lyophilized preparations.

[0025] The present invention also protects a method for improving an immune response in an organism, comprising administering the above-mentioned Anaerostipes caccae ibiome007, or a culture or processed product thereof, or the above-mentioned pharmaceutical composition to the organism.

[0026] The present invention also protects a method for detecting whether the above-mentioned Anaerostipes caccae ibiome007 is colonized in an organism, comprising extracting bacterial 16s rRNA from feces or intestinal extracts of the organism, and using it as a template to perform PCR using an upstream primer having a sequence as shown in SEQ ID No: 2 and a downstream primer having a sequence as shown in SEQ ID No: 3.

[0027] The anti-PD-1 therapeutic agent described in the present invention refers to a substance that acts by blocking or inhibiting the function of PD-1, thereby blocking or inhibiting the signal downstream of PD-1, and can be an anti-PD-1 antibody or a PD-L1 inhibitor, etc.

[0028] The pharmaceutical composition of the present invention may contain pharmaceutically acceptable solvents, emulsifiers, suspending agents, preservatives, lubricants, etc. commonly used in the art, but is not limited thereto.

[0029] The pharmaceutical composition of the present invention can be prepared into commonly used dosage forms, such as tablets, granules, capsules, suspensions, freeze-dried preparations, etc.

[0030] The term “comprising the above-mentioned Anaerostipes caccae ibiome007” includes not only the living bacteria of the above-mentioned Anaerostipes caccae ibiome007 but also includes bacterial cell decomposition products, culture supernatants, and isolated metabolites of the above-mentioned bacteria.

[0031] The subject is a mammal, which may be a rodent such as a rat or a mouse, or a primate, preferably a primate such as a human.

[0032] The dosage of the strain of the present invention or the pharmaceutical composition containing the same is not particularly limited, as long as the Anaerostipes caccae ibiome007 can colonize the intestine of the subject. When the subject is a human, the dosage can be, for example, 5×10 6 ~5×10 12 CFU / mL, preferably 5×10 8 ~5×10 10 The strain may be administered at a concentration of 100 CFU / mL. The inoculation or administration frequency may be once every 1-3 days, preferably once every 2-3 days. To successfully colonize the subject's intestines, the continuous administration period may be, for example, two weeks or one month, which may be extended if necessary. Administration may be through the gastrointestinal tract, such as oral administration. Colonization of the strain may be confirmed by examining the subject's feces after administration. Beneficial effects

[0033] The beneficial effects of the present invention are:

[0034] 1. This strain, Anaerobic Corynebacterium faecalis ibiome007, was isolated from healthy volunteers, is easily cultured in vitro, and can colonize the mouse intestine.

[0035] 2. In in vitro experiments, this strain can enhance the secretion of the effector factor IFN-γ of CD8 T cells and improve the effector function of CD8 T cells.

[0036] 3. The strain enhances the effector function of CD8 T cells mainly by producing small molecule metabolites.

[0037] 4. In the in vivo experiments on mice, by detecting the secretion of effector factors of CD8T cells in the mouse intestine after colonization, it was found that the strain can promote the secretion of IFN-γ by mouse LPL (innate lymphocyte) cells CD8T cells, and the results are consistent with the in vitro experiments.

[0038] 5. In SPF mice bearing MC38 tumors subcutaneously and gavage-administered with the fecal anaerobic bacterium ibiome007, the strain was able to exert tumor suppression regardless of antibiotic pretreatment. Furthermore, it was able to combine with PD-1 antibodies to exert even better tumor suppression, expanding the scope of clinical drug use and preventing individual differences in antibiotic use before treatment from affecting drug efficacy.

[0039] 6. In germ-free mice bearing MC38 tumors subcutaneously and gavage-administered with the anaerobic bacterium ibiome007, this strain was able to combine with PD-1 antibodies to exert tumor suppressive function, indicating that a single strain of anaerobic bacterium ibiome007 can achieve the function of combining with PD-1.

[0040] 7. SPF mice bearing B16 melanoma were subcutaneously gavaged with the fecal anaerobic bacterium ibiome007. This strain exerted tumor suppressive function and significantly inhibited the expression of programmed death receptor 1 (PD-1) on the surface of CD8 T cells infiltrating B16 melanoma, and significantly increased the secretion of tumor necrosis factor-α (TNF-α) by CD8 T cells in LPL.

[0041] 8. This strain has the potential to synergize tumor immunotherapy, enhance the efficacy of immune checkpoint blockade therapy, increase the response rate of anti-PD-1 therapy in tumor patients, and improve patient survival. Biological Deposits

[0042] Anaerostipes caccae ibiome007, deposited on August 11, 2023, at China Center for Type Culture Collection, China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the accession number being CCTCC NO: M 20231456. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] FIG1 shows the secretion of the CD8 T cell effector factor IFN-γ detected by flow cytometry after CD8 T cells were stimulated with the culture medium control and its small molecules or the culture supernatant of anaerobic bacterium ibiome007 and its small molecules in Example 3; *** represents p < 0.001.

[0044] FIG2 shows the results of the colonization experiment of anaerobic fecal bacteria ibiome007 in SPF mice in Example 4.

[0045] FIG3 shows the effect of colonization of anaerobic Corynebacterium faecalis ibiome007 on intestinal immunity in Example 5; 3A is the gating strategy for flow cytometry, and 3B is the statistical result diagram of flow cytometry.

[0046] Figure 4 shows the effect of anaerobic bacterium ibiome007 on MC38 tumor growth in SPF mice in Example 6; Figure 4A shows the tumor growth curves of each group after tumor injection, Figure 4B shows a photograph of mouse tumor tissue removed 14 days after tumor injection, and Figure 4C shows the tumor weight statistics in Figure 4B.

[0047] FIG5 shows the effect of anaerobic bacterium ibiome007 on the growth of MC38 tumor in SPF mice in Example 7; 5A is the tumor growth curve of each group after tumor injection, and 5B is a photograph of the mouse tumor tissue peeled off 28 days after tumor injection.

[0048] Figure 6 shows the effect of Anaerobic Bacillus faecalis ibiome007 in Example 8 on the growth of subcutaneous B16 melanoma in SPF mice; Figure 6A shows the tumor growth curves of each group after tumor injection, Figure 6B shows a photograph of the mouse tumor tissue peeled off 34 days after tumor injection, Figure 6C shows that Anaerobic Bacillus faecalis ibiome007 can significantly inhibit the expression of programmed death receptor 1 (PD-1) on the surface of CD8 T cells infiltrating B16 melanoma, and Figure 6D shows that Anaerobic Bacillus faecalis ibiome007 can significantly increase the secretion of tumor necrosis factor-α (TNF-α) by CD8 T cells in LPL.

[0049] Figure 7 shows the results of the colonization experiment of anaerobic coryneform bacteria ibiome007 in germ-free mice in Example 9; among them, 7A shows the growth of the smear plate of sterile mouse feces, 7B shows the growth of the smear plate of sterile mouse feces that were gavage-administered with anaerobic coryneform bacteria ibiome007, and 7C shows the colony identification result of 7B.

[0050] FIG8 shows the effect of the anaerobic bacterium ibiome007 in Example 10 in combination with PD-1 on tumor growth in germ-free (GF) mice.

[0051] FIG9 is a graph showing body weight monitoring of mice after oral administration of anaerobic coryneform bacteria ibiome007 in Example 11.

[0052] Figure 10 shows the effect of anaerobic bacterium ibiome007 on the growth of E0771 breast cancer tumors in SPF mice in Example 12; 10A is the tumor growth curve of each group after tumor injection, 10B is the statistical results of tumor weighing, and 10C is a photograph of the mouse tumor tissue peeled off 35 days after tumor injection. Best Mode for Carrying Out the Invention

[0053] For a better understanding of the present invention, the present invention is further described below in conjunction with embodiments and drawings. The following embodiments are merely illustrative of the present invention and are not intended to limit the present invention. Example 1: Establishment of a bacterial library

[0054] Single bacterial colonies were isolated and cultured from the feces of 10 healthy adults, adolescents, infants and 1 patient who responded to PD-1 blockade therapy: the fecal samples of volunteers were preserved in 20% glycerol phosphate buffer and serially diluted to 10 -5 , 10 -6 , 10 -7 The concentrations were plated on GAM broth (Solarbio LA4450), BBE (pseudo-bile aesculin solid medium, Solarbio LA7310), RCM (Clostridium enrichment medium, Qingdao Haibo HB0316), MRS broth (Qingdao Haibo HB0384-1), TSB (tryptic soy broth, Qingdao Haibo HB4114-19), BHI (brain heart infusion medium, OXOID, CM1136), and Columbia blood agar plates (Beekman Biotechnology). Single clones were picked and transferred to the corresponding liquid culture medium. The species was confirmed by sequencing using 16S rRNA universal primers (upstream primer 27F: AGAGTTTGATCCTGGCTCAG, downstream primer 1492R: TACGGCTACCTTGTTACGACTT) (amplification conditions: initial denaturation at 95°C for 3 min; 35 cycles of [denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 30 s]; and complete extension at 72°C for 5 min). The bacteria were stored at -80°C with glycerol. The bacteria were cultured in a 37°C shaker until the OD 600 = 0.8, centrifuged at 3000 rpm for 10 min, and the bacterial culture supernatant was collected and frozen at -40°C for later use. A bacterial library containing 1000 strains from 5 phyla, 12 classes, 15 orders, 30 families, and 300 strains was established, covering the main groups of human intestinal microorganisms. Example 2: In vitro screening of IFN-γ+CD8 T cells

[0055] IFN-γ is a cytokine commonly expressed by NK cells, NKT cells, CD4 and CD8 T cells, with a broad ability to stimulate and regulate the immune system. IFN-γ+ CD8 T cells also play a crucial role in anti-tumor immunity and have been reported to affect the efficacy of immune checkpoint inhibitor (ICI) therapy. Honda's laboratory found that a mixture of 11 intestinal bacteria isolated from healthy humans was able to significantly inhibit tumor growth in mouse experiments by upregulating the ability of CD8 T cells to secrete IFN-γ. Therefore, intestinal bacteria that can stimulate the secretion of IFN-γ by CD8 T cells can be used as an indicator for screening potential anti-tumor functional bacteria.

[0056] However, previous studies used antibiotic enrichment methods, resulting in a mixture of 11 intestinal bacteria that was ampicillin-resistant and potentially proliferating under antibiotic administration, posing safety risks. Furthermore, because previous studies have not identified the specific strains, and the effects of Fusobacteria in the mixture on tumors remain controversial, identifying a specific, single, active strain is crucial.

[0057] CD8 T cells were isolated from the spleens of 6-8 week-old IFN-γ fluorescent reporter mice (an IRES sequence and a Katushka fluorescent protein sequence were inserted after the IFN-γ protein transcript sequence, resulting in simultaneous expression of Katushka fluorescence in the cells. For construction methods, see Villegas-Mendez, A. et al. Parasite-Specific CD4+ IFN-γ+ IL-10+ T Cells Distribute within Both Lymphoid and Nonlymphoid Compartments and Are Controlled Systemically by Interleukin-27 and ICOS during Blood-Stage Malaria Infection. Infection and Immunity 84, 34-46, doi:10.1128 / iai.01100-15 (2016).) The spleen tissue was trimmed of surface fat, added to phosphate-buffered saline, and ground into a cell suspension. The remaining tissue was filtered through a steel mesh. The cells were collected by centrifugation at 500g at 4°C for 5 minutes, and 2 mL of red blood cell lysis buffer was added to remove red blood cells. The remaining cells were separated into CD8 T cells using a CD8 T cell magnetic bead separation kit (Biolegend 480035).

[0058] Calculate the cells and take 3×10 5 Anti-CD3 antibody (final concentration 5 μg / mL) and anti-CD28 antibody (final concentration 2 μg / mL) (Biolegend 100223 and Biolegend 102112, respectively) were added to activate CD8 T cells in vitro. 5 20 μL of the frozen bacterial supernatant of Example 1 was added to each well for stimulation and cultured (i.e., stimulated) for 48 h.

[0059] Collect the stimulated cells (about 1×10 61. Add 60 µL of a mixture containing specific surface marker fluorescent antibodies (FITC-CD3 Biolegend 100204 0.2 µL / well, APC-Cy7 CD8 Biolegend 100714 0.2 µg / well) to each well. Incubate at 4°C in the dark for 15-20 minutes. Top up with 1× PBS and wash once (6000 rpm for 2 minutes).

[0060] Resuspend the cells in 200-300 µL 1× PBS and load the sample at a concentration of 3-5×10 6 / mL. The cell suspension was filtered through a 200-mesh nylon mesh to remove impurities, transferred to an Eppendorf tube, and transiently stained with DAPI (200-fold dilution, Boster AR1177) for analysis using FlowJo software. For IFN-γ, single cells were first gated using FSC-H and FSC-A as the horizontal and vertical axes. DAPI-negative live cells were then gated within the single-cell gate. CD3- and CD8-positive CD8 T cells were then gated to assess IFN-γ secretion by these cells.

[0061] Analysis of the test results revealed a strain derived from healthy volunteers, isolated from GAM broth culture medium, and able to grow large gray-white colonies through anaerobically cultured in GAM broth. The metabolites derived from this strain can significantly enhance the secretion of IFN-γ by CD8 T cells, as well as increase the proportion of TNF-α-positive cells in IFN-γ-positive CD8 T cells.

[0062] The 16s rRNA gene sequence (SEQ ID NO. 1) of this strain was sequenced using the method in Example 1 and submitted to the NCBI Basic Local Alignment Search Tool for 16s rRNA gene analysis. The alignment results showed that the strain with the highest similarity was Anaerostipes caccaestrain L1-92 (99.93% similarity). Therefore, this strain belongs to the species Anaerostipes caccae and was named Anaerostipes caccae ibiome007. It was deposited with the China Center for Type Culture Collection at Luojiashan, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit date was August 11, 2023, and the deposit number is CCTCC NO: M 20231456. Example 3: Small molecule metabolites of anaerobic Corynebacterium faecalis increase the IFN-γ secretion capacity of CD8 T cells cultured in vitro

[0063] The supernatant of Anaerostipes caccae ibiome007 and GAM broth were collected and sterilized by filtration through a 0.2 µm filter membrane. The supernatant was then ultrafiltered through a molecular sieve with a pore size of <3 kDa to remove the protein components. Four groups of samples were prepared: (1) GAM broth, (2) GAM broth after molecular sieve ultrafiltration, (3) Anaerostipes caccae ibiome007 supernatant, and (4) Anaerostipes caccae ibiome007 supernatant after molecular sieve ultrafiltration. One day in advance, 60 µL of 4 µg / mL CD3 antibody was plated in a 96-well plate.

[0064] According to the method of Example 2, the above four groups of samples were added only during stimulation culture, and the IFN-γ secretion of CD8 T cells in the presence of the four groups of samples was detected.

[0065] The results are shown in Figure 1. The culture supernatant of anaerobic fecal bacteria has the ability to promote the secretion of CD8 T cell effector factors, and the active ingredients that exert this function are small molecule metabolites (<3 kDa) of bacterial origin.

[0066] Example 4: Detection of the colonization effect of Anaerostipes caccae ibiome007 in an SPF mouse model

[0067] C57 / B6J mice purchased from Jicui Yaokang were fed ABX (1 g / L ampicillin, neomycin, metronidazole, and 0.5 g / L vancomycin hydrochloride) for 2 weeks (drinking water was replaced by ABX), and then divided into two groups: the control group was gavaged with PBS, and the colonization group was gavaged with 5×10 6 200 μL of bacterial suspension (CFU / mL) was added every two days. After one week, mouse feces were collected and the fecal anaerobic Corynebacterium content was determined. Bacteria were disrupted with 20% (w / v) SDS, and bacterial DNA was extracted with phenol-chloroform. PCR was performed using strain-specific primers SEQ ID Nos. 2 and 3 (F: TAGAGGCTTCGGTGCC, R: CCTGTCTCCAATGTCTCG). 16s rRNA universal primers (qPCR-27F: AGAGTTTGATCMTGGCTCAG, qPCR-342R: CTGCTGCSYCCCGTAG) were used as internal controls to assess strain colonization.

[0068] The results are shown in Figure 2. Compared with the control group, the content of anaerobic Corynebacterium faecalis ibiome007 in the feces of mice in the colonization group was significantly increased. This indicates that after oral administration, the level of anaerobic Corynebacterium faecalis ibiome007 increased in the mouse intestines and that anaerobic Corynebacterium faecalis ibiome007 was able to colonize the mice.

[0069] Example 5: Anaerostipes caccae ibiome007 increases IFN-γ secretion capacity of CD8 T cells in the intestinal lamina propria

[0070] 6-8 week old Jicui Yaokang C57 / B6J mice were pre-treated with a quadruple antibiotic (ABX) to eliminate intestinal bacteria: 0.25g of ampicillin, neomycin, metronidazole, and 0.125g of vancomycin hydrochloride were added to each 250mL of water and fed for 2 weeks. Afterwards, the mice were switched to drinking normal water and randomly divided into two groups: the experimental group was gavaged with 5×10 8 The mice were gavaged with 200 μL of PBS containing the anaerobic bacterium ibiome007 (Anaerostipes caccae) at a concentration of 1.5 CFU / mL. Two weeks after ibiome007 colonization, the mice were sacrificed, the intestinal contents were flushed with PBS, and the intestines were dissected. The intestines were cut into 1-2 cm segments and placed in 25 mL of pre-digestion solution (65 mL RPMI, 1.2 mL FBS, 120 μL EDTA) at 37°C and shaken at 220 rpm for 20 min. The resulting medium was filtered through a 200-mesh steel mesh, and the intestinal segments were added to the pre-digestion solution for subsequent processing. The filtered medium was centrifuged to obtain intestinal epithelial cells and intraepithelial lymphocytes. This step was repeated twice, and the remaining tissue was digested with a digestion solution containing collagenase and DNase (10 mL RPMI, 20 μL DNASE I STOCK, 5 mg Type II Collagenase (Sigma), 0.2 mL FBS). After filtration, the intestinal lamina propria lymphocytes were obtained. The lamina propria lymphocytes were labeled with specific fluorescent antibodies and the secretion of IFN-γ was detected by flow cytometry.

[0071] As shown in Figure 3, the upper figure (3A) illustrates the gating strategy for flow cytometry: after isolating mouse intestinal epithelial cells, live cells were first circled, followed by CD45+ lymphocytes, followed by CD3+ T cells, further distinguishing between CD4 and CD8, and finally, detecting CD8 IFN-γ secretion. The lower figure (3B) is a statistical graph of the flow cytometry results, demonstrating that compared with the blank control group, the group receiving gavage with Anaerobic Corynebacterium faecalis showed increased secretion of the CD8 T cell effector IFN-γ and TNF-α by lymphocytes in the lamina propria of the small intestine.

[0072] Example 6: Anti-MC38 Tumor Effect of Anaerostipes caccae ibiome007 on SPF Mice

[0073] MC38, also known as MCA38, is a mouse colon carcinoma cell line. It is derived from colon tumor tissue of C57BL6 mice that develop colon adenocarcinoma after long-term exposure to the carcinogen DMH (1,2-dimethylhydrazine dihydrochloride) and expresses high levels of human carcinoembryonic antigen (CEA). Colorectal cancer (CRC) is the second leading cause of cancer death worldwide. Rodent colon cancer model studies are an effective method for preclinical evaluation of new drugs. MC38 cells have a favorable response to immunomodulatory antibodies, demonstrating that the tumor microenvironment can modify immune activation. Therefore, MC38 is positioned as a powerful immuno-oncology model with important applications in drug development, and is often used to study the in vivo immune function of anti-tumor drugs, particularly those against colon cancer.

[0074] Six- to eight-week-old Jicui Yaokang C57 / B6J mice were pre-treated with a quadruple antibiotic (ABX) to eliminate intestinal bacteria. 0.25g of ampicillin, neomycin, and metronidazole, as well as 0.125g of vancomycin hydrochloride, were added to each 250mL of water and fed for two weeks. The mice were randomly divided into four groups: a blank control group, a PD-1 antibody-treated group, and a PD-1 antibody-treated group. The PD-1 antibody-treated group and the PD-1 antibody-treated group were gavaged daily with 200μL of 2.5×10 7 The control group and the PD-1 antibody treatment group were gavaged with PBS every day. After 2 weeks of colonization, all mice in the group were shaved and subcutaneously loaded with MC38 tumors, 3*10 5 Tumor volume was measured every other day after tumor implantation and approximately calculated using the ratio 0.5*length*width*width. Seven, nine, and eleven days after tumor implantation, mice in the PD-1 antibody-treated group and the Anaerobic Corynebacterium faecalis combined with PD-1 antibody-treated group were intraperitoneally injected with 100 μg of anti-PD-1 (BioXcell BE0146) per mouse. On day 14 after tumor implantation, mice were sacrificed, and tumors were photographed and weighed. As shown in Figure 4, Anaerobic Corynebacterium faecalis ibiome007 can inhibit tumor growth in combination with PD-1 antibodies. Specifically, oral administration of anaerobic fecal bacteria ibiome007 alone can significantly slow down the tumor growth curve (Figure 4A), significantly reduce the volume (Figure 4B), and significantly reduce the tumor weight (Figure 4C), and the effect is better than PD-1; when anaerobic fecal bacteria ibiome007 is administered at the same time as PD-1 antibody, the effect is even better, and the growth curve (Figure 4A), volume (Figure 4B), and weight (Figure 4C) are significantly better than those of the PD-1 antibody treatment group.

[0075] Example 7: The anti-MC38 tumor effect of Anaerostipes caccae ibiome007 in SPF mice is not affected by the original intestinal flora

[0076] After one week of adaptive feeding, female Jicui Yaokang C57 / B6J mice were randomly divided into two groups: a PBS control group and a fecal anaerobic Corynebacterium treatment group. The fecal anaerobic Corynebacterium treatment group was gavaged with ibiome007 bacterial powder every other day. The bacterial powder was dissolved in sterile PBS and each mouse was gavaged with 200 μL (5×10 6 CFU). In the PBS control group, each mouse was gavaged with 200 μL PBS every other day. After four gavages, all mice in the groups were shaved and subcutaneously loaded with MC38 tumors, 5*10 5 / mouse. The tumor volume was measured starting from the 7th day after tumor bearing, and then measured every other day. The tumor volume was approximately calculated using 0.5*length*width*width. The mice were sacrificed about 28 days after tumor bearing, and the mouse tumors were photographed. As shown in Figure 5, the fecal anaerobic bacterium ibiome007 was able to inhibit the growth of MC38 tumors. Combined with Example 6, regardless of whether antibiotics were used to treat the original intestinal bacteria of the mice, ibiome007 showed a good anti-tumor effect. And not treating with antibiotics is more inclined to the actual clinical treatment scenario, which greatly improves the scope of clinical drug use, that is, the therapeutic efficacy of ibiome007 is not affected by individual differences in the patient's intestinal bacteria and the use of antibiotics and other medications.

[0077] Example 8: Antitumor Effect of Anaerostipes caccae ibiome007 on Subcutaneous B16 Melanoma in SPF Mice

[0078] B16 mouse melanoma cells are spontaneously derived from the skin of C57BL / 6 mice, primarily metastasizing to the lungs. The growth and metastatic properties of B16 cells in mice closely resemble those of human melanoma, making them an ideal animal model for melanoma and widely used in studies of melanoma development, metastasis, and drug screening.

[0079] After one week of adaptive feeding, male C57 / B6J mice from Jicui Yaokang were treated with a quadruple antibiotic (ABX) to eliminate intestinal bacteria. 0.25g of ampicillin, neomycin, and metronidazole, as well as 0.125g of vancomycin hydrochloride, were added to every 250mL of water and fed for 3 weeks. Four days after discontinuing the quadruple antibiotic (ABX), the mice were randomly divided into two groups: a PBS control group and a fecal anaerobic coryneformis treatment group. The fecal anaerobic coryneformis treatment group was gavaged with fecal anaerobic coryneformis ibiome007 bacterial powder every other day. The bacterial powder was dissolved in sterile PBS and each mouse was gavaged with 200μL (5×10 6 CFU). In the PBS control group, each mouse was gavaged with 200 μL PBS every other day. After 8 gavages, all mice in the groups were shaved and subcutaneously loaded with B16 tumors, 5*10 5 Tumor volume was measured and recorded starting on day 7 of tumor loading and every other day thereafter. Tumor volume was approximately calculated using 0.5 * length * width * width. Mice were sacrificed approximately 34 days after tumor loading, and tumors were photographed. As shown in Figures 6A and 6B, the anaerobic bacterium ibiome007 significantly inhibited the growth of B16 melanoma tumors.

[0080] After photographing, the mouse tumors were prepared into single-cell suspensions for flow cytometry analysis. As shown in Figure 6C, C. faecalis ibiome007 significantly inhibited programmed death receptor 1 (PD-1) expression on CD8 T cells infiltrating B16 melanoma tumors. Colonic lamina propria lymphocytes (LPLs) were also collected from the mice and stimulated with the eBioscience™ Cell Stimulation Cocktail for 4 hours before flow cytometry analysis. As shown in Figure 6D, C. faecalis ibiome007 significantly increased tumor necrosis factor-α (TNF-α) secretion by CD8 T cells in the LPLs. This suggests that C. faecalis ibiome007's tumor-suppressing effect is due to its ability to reduce PD-1 expression on CD8 T cells infiltrating B16 melanoma tumors, preventing these tumor cells from escaping immune defenses. Furthermore, C. faecalis ibiome007 stimulates CD8 T cells in the lamina propria to secrete TNF-α, further cytotoxicizing the tumor cells. The overall experiment showed that the fecal anaerobic bacterium ibiome007 not only inhibited the growth of mouse colon cancer MC38, but also had a significant inhibitory effect on the growth of mouse melanoma B16.

[0081] Example 9: Colonization of germ-free (GF) mice with Anaerostipes caccae ibiome007

[0082] Jicui Yaokang C57 / B6J male GF mice were randomly divided into a control group and a fecal anaerobic Corynebacterium colonization group. The control group was not treated, while the fecal anaerobic Corynebacterium colonization group was gavaged with the fecal anaerobic Corynebacterium ibiome007 bacterial solution (200 μL per mouse, 5×10 6 CFU / mL, once. On the fifth day after colonization, mice in the fecal anaerobic Corynebacterium colonization group were tested for bacterial colonization (qPCR, as in Example 4). Mice in the control group were tested for sterility (sterile mouse feces were added to sterile water, and the supernatant was used to plate GAM broth).

[0083] The results are shown in Figure 7. No bacteria grew in sterile mouse feces (Figure 7A). However, after colonization with anaerobic Corynebacterium faecalis ibiome007, a single colony was observed on the mouse feces (Figure 7B). Colony identification results in Figure 7C indicate that only anaerobic Corynebacterium faecalis colonized the mouse feces after colonization.

[0084] Example 10: Anaerostipes caccae ibiome007 and PD-1 Antibody Enhance Anti-MC38 Tumor Effects in Germ-Free (GF) Mice

[0085] Jicui Yaokang C57 / B6J male GF mice were randomly divided into two groups: PD-1 antibody treatment group and anaerobic Corynebacterium faecalis combined with PD-1 antibody treatment group. The anaerobic Corynebacterium faecalis combined with PD-1 antibody treatment group was orally administered with anaerobic Corynebacterium faecalis ibiome007, 200 μL per mouse, 5×10 6 CFU / mL. After 1 week of colonization, all mice in the groups were shaved and subcutaneously loaded with MC38 tumors, 3*10 5 Tumor volume was measured every other day after tumor implantation, and was approximately calculated using the ratio 0.5*length*width*width. Mice were intraperitoneally injected with anti-PD-1 at a dose of 200 μg / mouse on days 7, 9, 11, and 13 after tumor implantation. Around day 16 after tumor implantation, mice were sacrificed, and tumors were photographed. As shown in Figure 8, the combination of Anaerobic Corynebacterium faecalis ibiome007 and PD-1 antibodies further inhibited tumor growth, demonstrating that a single strain of Anaerobic Corynebacterium faecalis ibiome007 can achieve the same combined effects as PD-1.

[0086] Example 11: Anaerostipes caccae ibiome007 has good safety

[0087] After one week of adaptive feeding, male Jicui Yaokang C57 / B6J mice were treated with a quadruple antibiotic (ABX) to eliminate intestinal bacteria. 0.25g of ampicillin, neomycin, and metronidazole, as well as 0.125g of vancomycin hydrochloride, were added to every 250mL of water. The mice were allowed to drink freely for 24 days. Four days after discontinuing the quadruple antibiotic (ABX), the mice were randomly divided into two groups: a PBS control group and a fecal anaerobic Corynebacterium treatment group. The fecal anaerobic Corynebacterium treatment group was gavaged with ibiome007 bacterial powder every other day. The bacterial powder was dissolved in sterile PBS, and each mouse was gavaged with 200μL (1×10 12 CFU). Each mouse in the PBS control group was gavaged with 200 μL PBS every other day. Antibiotic treatment began on day 0. On day 42, all mice in the groups were shaved and subcutaneously loaded with B16 tumors, 5*10 5 The mice were given 100 mg of the bacterium, and their body weights were monitored throughout the experiment until day 73 (Figure 9). Body weights were measured at random intervals (to one decimal place) during the monitoring period. No adverse reactions were observed in the mice throughout the experiment, and there was no significant difference in body weight between the two groups (P=0.55). This preliminarily suggests that oral administration of the bacterium has no adverse effects on mice and is therefore safe.

[0088] Example 12: Anti-tumor effect of Anaerostipes caccae ibiome007 on subcutaneous E0771 breast cancer in SPF mice

[0089] After one week of adaptive feeding of Jicui Yaokang C57 / B6J male mice, intestinal bacteria were eliminated with quadruple antibiotics (ABX). 0.75g of ampicillin sodium, neomycin, metronidazole, and 0.375g of vancomycin hydrochloride were added to each 250mL of water and gavage was performed for 1 week. Ten days after the discontinuation of quadruple antibiotics (ABX), the mice were randomly divided into two groups: a PBS control group and a fecal anaerobic coryneformis treatment group. The fecal anaerobic coryneformis treatment group was gavaged with fecal anaerobic coryneformis ibiome007 bacterial powder at a frequency of 6 times a week. The bacterial powder was dissolved in sterile PBS and each mouse was gavaged with 200μL (10 6 CFU). In the PBS control group, each mouse was gavaged with 200 μL PBS 6 times a week. After 7 gavages, all mice in the groups were shaved and subcutaneously loaded with E0771 breast cancer cells, 5*10 5 / mouse. Tumor volume was measured and recorded starting from the 11th day after tumor bearing, and was measured every 2-3 days thereafter. The tumor volume was approximately calculated using 0.5*length*width*width. Mice were sacrificed on the 35th day after tumor bearing, and the tumors were photographed and weighed. The results are shown in Figure 10. Whether from the overall tumor growth curve (Figure 10A), volume (Figure 10C), or the final tumor weight (Figure 10B), the experiment can prove that anaerobic coryneform bacteria ibiome007 can significantly inhibit the growth of E0771 breast cancer. The overall experiment shows that anaerobic coryneform bacteria ibiome007 not only has an inhibitory effect on the growth of mouse colon cancer MC38 and mouse melanoma B16, but also has a significant inhibitory effect on the growth of mouse breast cancer E0771.

[0090] The above-described embodiments are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention. Industrial Applicability

[0091] The strain, Anaerobic Corynebacterium faecalis ibiome007, was isolated from healthy volunteers, is easily cultured in vitro, and can colonize the mouse intestine. In vitro experiments demonstrated that this strain enhanced the secretion of the effector IFN-γ by CD8 T cells, improving their effector function. This enhancement of CD8 T cell effector function is primarily dependent on the production of small molecule metabolites. In vivo experiments in mice, by measuring the secretion of effector factors by CD8 T cells in the mouse intestine after colonization, it was found that this strain promoted IFN-γ secretion by mouse LPL (innate lymphocyte) cells, a finding consistent with the in vitro experiments. In SPF mice bearing MC38 tumors subcutaneously and receiving oral administration of Anaerobic Corynebacterium faecalis ibiome007, the strain exhibited tumor suppression regardless of antibiotic pretreatment. Furthermore, the strain exhibited even greater tumor suppression in combination with PD-1 antibodies, broadening the scope of clinical application and minimizing the impact of individual differences in prior antibiotic use on drug efficacy. In germ-free mice bearing MC38 tumors subcutaneously and receiving oral administration of the anaerobic Corynebacterium faecium ibiome007, the strain was shown to combine with PD-1 antibodies to exert tumor-suppressing effects, demonstrating that a single strain of the anaerobic Corynebacterium faecium can achieve the same PD-1-combining effect. In SPF mice bearing B16 melanoma tumors subcutaneously and receiving oral administration of the anaerobic Corynebacterium ibiome007, the strain also exhibited tumor-suppressing effects, significantly inhibiting programmed death receptor 1 (PD-1) expression on CD8 T cells infiltrating B16 melanoma tumors and significantly increasing tumor necrosis factor-α (TNF-α) secretion by CD8 T cells in LPL. This strain has the potential to synergize with tumor immunotherapy, enhance the efficacy of immune checkpoint blockade therapy, improve the response rate to anti-PD-1 therapy, and increase patient survival. Therefore, the present invention has industrial applicability.

Claims

1. Anaerostipes caccae ibiome007, characterized by: The fecal anaerobic coryneform bacteria strain is deposited in the China Type Culture Collection, the address of which is China Type Culture Collection of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit date is August 11, 2023, and the deposit number is CCTCC NO: M 20231456.

2. Use of the anaerobic bacterium Anaerostipes caccae ibiome007 according to claim 1 in the preparation of a drug for preventing or treating tumors, characterized in that: The Anaerostipes caccae ibiome007 is preferably a live bacterium or a metabolite thereof, more preferably a metabolite with a molecular weight of less than 3 kDa; when the drug is used to treat tumors, it can be used alone or in combination with other anticancer treatments to enhance the anticancer effect.

3. The use according to claim 2, characterized in that The prevention of tumor generation or treatment of tumors includes but is not limited to at least one of the following phenotypes: (a) Promote the secretion of CD8 T cell effector factors in vitro; (b) promoting the secretion of TNF-α and / or IFN-γ, the effector factors of CD8 T cells, in the intestinal lamina propria lymphocytes in vivo; (c) promoting the secretion of TNF-α and / or IFN-γ, the effector factors of CD8 T cells, in tumor-infiltrating lymphocytes in vivo; (d) slowing tumor growth; (e) reduction of tumor volume; (f) Reduction of tumor weight.

4. The use according to claim 2, characterized in that: The other anti-cancer treatments include anti-PD-1 therapeutic agents (preferably anti-PD-1 antibodies, CTLA-4 antibodies, PD-L1 antibodies and / or PD-L1 inhibitors), or other antibody drugs other than anti-PD-1 antibodies (preferably at least one of chemotherapeutic drugs, photosensitizers, photothermal agents, and immunotherapy drugs).

5. The use according to any one of claims 2 to 4, characterized in that: The tumor is a solid tumor (preferably one or more selected from the group consisting of gastric cancer, esophageal cancer, colon cancer, rectal cancer, liver cancer, pancreatic cancer, breast cancer, kidney cancer, fibrosarcoma, lung cancer, bile duct cancer, and melanoma, more preferably colon cancer, melanoma or breast cancer).

6. Use of the anaerobic bacterium (Anaerostipes caccae) ibiome007 or its culture supernatant according to claim 1 in the preparation of a drug for promoting the secretion of IFN-γ by CD8 T cells.

7. A pharmaceutical composition, characterized in that: The invention comprises the anaerobic bacterium (Anaerostipes caccae) ibiome007 according to claim 1, or a culture of the anaerobic bacterium (Anaerostipes caccae) ibiome007 or a processed product thereof (preferably a live bacterium, a live bacterium metabolite, and more preferably a metabolite with a molecular weight of less than 3 kDa), and a pharmaceutically acceptable carrier.

8. The pharmaceutical composition according to claim 7, characterized in that: It also includes anti-PD-1 therapeutic agents (preferably anti-PD-1 antibodies, CTLA-4 antibodies, PD-L1 antibodies and / or PD-L1 inhibitors), or other antibody drugs other than anti-PD-1 antibodies (preferably at least one of chemotherapeutic drugs, photosensitizers, photothermal agents, and immunotherapy drugs).

9. The pharmaceutical composition according to claim 7 or 8, characterized in that: The dosage form of the pharmaceutical composition is selected from tablets, granules, capsules, suspensions, and lyophilized preparations.

10. A method for improving an immune response of an organism, comprising administering the Anaerostipes caccae ibiome007 of claim 1, or a culture or processed product of the Anaerostipes caccae ibiome007, or the pharmaceutical composition of claim 7 or 8 to the organism.

Images