Multi scaffold-cell construct and use thereof

Abstract

The present invention is directed to a multi scaffold-cell construct including: (a) a first scaffold including photosynthetic cells embedded therein, thereon, or both; and (b) a second scaffold comprising non-photosynthetic cells embedded therein, thereon, or both, wherein the first scaffold and the second scaffold are positioned at a distance from one another allowing oxygen flow from the first scaffold to second scaffold.

Description

MULTI SCAFFOLD-CELL CONSTRUCT AND USE THEREOFREFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0001] The contents of the electronic sequence listing (HUJI-P-0105-PCT.xml; size: 12,921 bytes; and date of creation: August 12, 2024) is herein incorporated by reference in its entirety.CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 533,929, titled “MULTI SCAFFOLD-CELL CONSTRUCT AND USE THEREOF”, and filed 22 August 2023, the contents of which are incorporated herein by reference in their entirety.FIELD OF THE INVENTION

[0003] The present invention relates generally to the field of a symbiotic interaction between non-photosynthetic cells and photosynthetic cells in a multi scaffold-cell construct.BACKGROUND

[0004] Growing thick tissues ex vivo is a central challenge in the engineering of functional tissues and organs. One of the major unresolved challenges in tissue engineering, regenerative medicine, and cultured food production is the sustained delivery of oxygen to the deeper tissue areas to support its viability and growth.

[0005] There is still a great need for constructs, and methods of using same to continuously supply oxygen and supporting the growth of thick ex vivo engineered tissues.SUMMARY

[0006] According to a first aspect, there is provided a multi scaffold-cell construct comprising: (a) a first scaffold comprising photosynthetic cells embedded therein, thereon, or both, wherein the first scaffold is suitable for culturing the photosynthetic cells; and (b) asecond scaffold comprising non-photosynthetic cells embedded therein, thereon, or both, wherein the second scaffold is suitable for culturing the non- photosynthetic cells, wherein the first scaffold and the second scaffold are positioned at a distance from one another allowing oxygen flow from the first scaffold to the second scaffold.

[0007] According to another aspect, there is provided a method for culturing nonphotosynthetic cells in, on, or both, a scaffold, the method comprising culturing and subjecting the multi scaffold-cell construct of the invention to an effective amount of light in a wavelength of between 300 to 800 nm.

[0008] According to another aspect, there is provided non-photosynthetic cells cultured according to the method of the invention.

[0009] According to another aspect, there is provided a composition comprising the nonphotosynthetic cells of the invention, and an acceptable carrier.

[0010] According to another aspect, there is provided an edible composition comprising the non-photosynthetic cells of the invention or the composition of the invention.

[0011] According to another aspect, there is provided a scaffold-cell construct comprising:(a) a scaffold comprising non-photosynthetic cells embedded therein, thereon, or both; and(b) at least one compound derived from photosynthetic cells.

[0012] In some embodiments, (i) the photosynthetic cells of the first scaffold do not migrate into the second scaffold; (ii) the non- photosynthetic cells of the second scaffold do not migrate into the first scaffold; or (iii) both (i) and (ii).

[0013] In some embodiments, the first scaffold and the second scaffold are positioned at a distance of between 0 and 0.5 mm from one another.

[0014] In some embodiments, the photosynthetic cells are selected from the group consisting of microalgae, plant cells, cyanobacteria, and synthetic cells.

[0015] In some embodiments, the photosynthetic cells are microalgae cells.

[0016] In some embodiments, the non-photosynthetic cells are any one of: mammalian cells, fish cells, chicken cells, and any combination thereof.

[0017] In some embodiments, the mammalian cells, fish cells, chicken cells, and any combination thereof, comprise muscle cells, fibroblasts, a precursor thereof, or any combination thereof.

[0018] In some embodiments, any one of the first scaffold, second scaffold, and both, is made of a polymer being biocompatible, biodegradable, bioerodible, or any combination thereof.

[0019] In some embodiments, the first scaffold and the second scaffold are made of the same polymer.

[0020] In some embodiments, the polymer comprises alginate.

[0021] In some embodiments, the alginate is present in the first scaffold, the second scaffold, or both, in a concentration of between 1 to 8% by weight of the first scaffold, the second scaffold, or both.

[0022] In some embodiments, the first scaffold comprises a culture medium suitable for culturing photosynthetic cells.

[0023] In some embodiments, the second scaffold comprises a culture medium suitable for culturing non- photosynthetic cells.

[0024] In some embodiments, the first scaffold allows light transmission at a wavelength of between 300 and 800 nm.

[0025] In some embodiments, the first scaffold and the second scaffold are interwoven.

[0026] In some embodiments, the first scaffold is organized in at least one first layer and the second scaffold is organized in a second layer.

[0027] In some embodiments, the at least one first layer comprises at least two first layers.

[0028] In some embodiments, the second layer is positioned between said at least two first layers.

[0029] In some embodiments, the at least one first layer and the second layer are organized as a stack.

[0030] In some embodiments, the at least one first layer and the second layer are organized as a fiber having a core and a shell surrounding the core, wherein the core comprises the at least one first layer and the shell comprises the second layer, or vice versa.

[0031] In some embodiments, the intensity of the light is at least 50 pmol / s / m2.

[0032] In some embodiments, the culturing is for a period of between 7 and 30 days.

[0033] In some embodiments, the method further comprises monitoring the levels of free oxygen in the second scaffold.

[0034] In some embodiments, a free oxygen level below a pre-determined threshold is indicative of shortage of free oxygen in the second scaffold, and the method further comprises further subjecting the multi scaffold-cell to light.

[0035] In some embodiments, a free oxygen level above a pre-determined threshold is indicative of excess of free oxygen in the second scaffold, and the method further comprises halting the subjecting of the multi scaffold-cell to light.

[0036] In some embodiments, the non-photosynthetic cells comprise muscle cells or a precursor thereof.

[0037] In some embodiments, the method further comprises a step proceeding the culturing the subjecting, comprising removing or separating the first scaffold from the second scaffold, thereby obtaining an isolated second scaffold comprising cultured and isolated non- photosynthetic cells.

[0038] In some embodiments, the carrier is a pharmaceutically acceptable carrier or a nutraceutically acceptable carrier.

[0039] In some embodiments, the at least one compound derived from photosynthetic cells is selected from the group consisting of: a fatty acid, a lipid, a polynucleotide, a saccharide, a pigment / carotenoid, or any combination thereof.

[0040] In some embodiments, the polynucleotide comprises DNA of the photosynthetic cells.

[0041] In some embodiments, the DNA comprises chloroplast derived DNA of the photosynthetic cells.

[0042] The following embodiments and aspects thereof are described and illustrated in conjunction with systems, tools and methods which are meant to be exemplary and illustrative, not limiting in scope.

[0043] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0044] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

[0045] In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by reference to the figures and by study of the following detailed description.BRIEF DESCRIPTION OF THE FIGURES

[0046] Figures 1A-1M include photographs showing solutions comprising different concentrations of Chlamydomonas reinhardtii cells (1A). (1B-1G) Photographs of cell plates showing the effect of alginate solution concentration on viability of encapsulated microalgae cells over a period of: 1 day (IB), 6 days (1C), 12 days (ID), 23 days (IE), 29 days (IF), and 37 days (1G). (1H-1M) Photographs of cell plates showing the effect of calcium chloride concentration on viability of encapsulated cells over a period of: 1 day (1H), 6 days (II), 12 days (1 J), 23 days (IK), 29 days (IL), and 37 days (IM).

[0047] Figures 2A-2F include micrographs showing mobility of C. reinhardtii cells in different alginate gel concentrations and media. (2A) Sodium alginate 2% and calciumchloride 2% [xlO]; (2B) Sodium alginate 2% and calcium chloride 3% [xlO]; (2C) Sodium alginate 1% and calcium chloride 1% [x20]; (2D); Sodium alginate 1% and calcium chloride 0.5% [x20]; (2E) Sodium alginate 1% and calcium chloride 0.1% [x20]; and (2F) TPA media [x20].

[0048] Figures 3A-3F include micrographs showing proliferation of C. einhardtii cells in: (3A-3C) Alginate gel of sodium alginate 2% and calcium chloride 2% in: day 1 (3A), day 3 (3B) and day 9 (3C); and (3D-3F) Alginate gel of sodium alginate 2% and calcium chloride 3% in: day 1 (3D), day 3 (3E) and day 9 (3F).

[0049] Figures 4A-4B include photographs showing a three dimensional (3D) printed mold and compress for gel preparation (4A); and an alginate disc shape gel (4B).

[0050] Figure 5 includes graphs showing the absorbance the C. reinhardtii cells.

[0051] Figures 6A-6F include photographs and illustrations representing organization set up of different symbiotic experiments performed under different conditions, including exposure to light on day 1 (6A) and after 7 days (6B); exposure to light and medium (the bottom layer is submerged in medium) on day 1 (6C) and after 7 days (6D); and no exposure to both light and medium on day 1 (6E) and after 7 days (6F).

[0052] Figures 7A-7J include photographs showing two disconnected alginate layers comprising a microalgae layer and a HepG2 layer (7A). (7B-7D) Photographs of decrosslinked microalgae alginate layers: (7B) exposed to light without medium, (7C) not exposure to light without medium, and (7D) exposure to light with medium; (7E-7G) microalgae cells pellet after centrifugation: (7E) exposed to light without medium, (7F) no exposure to light and without medium, (7G) exposure to light without medium; and (7H-7J) microalgae cells in TAP solution: (7H) exposed to light without medium, (71) no exposure to light and without medium, (7J) exposure to light without medium.

[0053] Figures 8A-8B include vertical bar graphs showing microalgae cell viability represented as absorption (8A), and microalgae cell number (8B). Microalgae cells were either exposed to light and medium (light-1-med+), exposed to light without medium (light+med ), or not exposed to light and without medium (light med-).

[0054] Figures 9A-9J include vertical bar graphs showing the effect of different exposure conditions on the viability of HepG2 cells. (9A, 9C,9E,9G and 91) Bar graphs showing viability of HepG2 cells. (9B, 9D, 9F, 9H and 9J) Bar graphs showing cell number of HepG2 cells. (9A-9B) Viability and cell number of HepG2 layer attached to microalgae cells alginate gel, exposed to light with or without a medium, respectively. (9C-9D) Viability and cell number of HepG2 layer attached to alginate gel devoid of microalgae (MA) or an alginate gel comprising microalgae cells with medium, respectively. (9E-9F) Viability and cell number of HepG2 layer attached to alginate gel devoid of microalgae (MA) or an alginate gel comprising microalgae cells without medium, respectively; (9G-9H) Viability and cell number of HepG2 layer attached to alginate gel comprising microalgae cells with medium, and either exposed to light or not exposed to light; and (9I-9J) Viability and cell number of HepG2 layer attached to alginate gel devoid of microalgae (MA) or an alginate gel comprising microalgae cells with medium, and no exposure to light, respectively.

[0055] Figure 10 includes a photograph of alginate fibers.

[0056] Figure 11 includes graphs and photographs showing biomass accumulation of Chlamydomonas reinhardtii and Chlorella sorokiniana as was measured in various light intensities in 21 °C. Each measurement was taken from two replicates (750 nm).

[0057] Figure 12 includes a vertical bar graph showing Chlamydomonas biomass accumulation as was tested in variable SA and CC concentrations. Variable combinations of sodium alginate (SA) cross-linked with calcium chloride (CC) discs were embedded with Chlamydomonas cells (around 0.25 O.D. in each disc). Microalgae (MA) biomass was measured following three weeks at 22 °C on the bench (O.D. 680 nm).

[0058] Figures 13A-13B include vertical bar graphs showing Chlamydomonas and Chlorella optimally prosper in Tris-Acetate-Phosphate (TAP)-based alginate gels. Alginate gel discs based on TAP or TP were seeded with 0.5xl06Chlamydomonas cells (13A) or Chlorella cells (13B) and incubated with variable light intensities in 21 °C. Following six days discs were dissolved and biomass was measured by spectrophotometer (750 nm) and lethal fraction was stained with Sytox Green and measured by flow cytometry. Numbers above the bars represent the lethal fraction in %.

[0059] Figure 14 includes a vertical bar graphs showing additional microalgae species which prosper in alginate -based discs. Optical density and cell viability of various photosynthetic microorganisms after 6 days of encapsulation in alginate. Microalgae strains were cultured in TAP medium, while cyanobacteria were grown in BG-11 medium, both at 27 °C with continuous illumination at 30 PPFD. Each strain was encapsulated at an initial optical density (OD) of 0.1 in 2% alginate. Error bars indicate the standard deviation from three measurements. Species included: Haematococcus pluvialis, Chlorella sorokiniana, Chlorella vulgaris, and Synechocystis.

[0060] Figure 15 includes micrographs of the MA species presented in Fig. 14.

[0061] Figure 16 includes a vertical bar graph showing that Chlamydomonas prosper in TAP-based alginate gels for 14 days. Alginate gel discs based on TAP were seeded with 0.5xl06Chlamydomonas cells and incubated in 21 °C. Following 14 days discs were dissolved and biomass was measured by spectrophotometer (750 nm) and lethal fraction was stained with Sytox Green and measured by flow cytometry. Numbers above the bars represent the lethal fraction in %.

[0062] Figure 17 includes a vertical bar graph showing the rigidities of gel over time. Disc-shaped gels of SA 2% and CC 3% were tested for stiffness on the first day and following 14 days of incubation using a micro tester apparatus (control = empty disc, Sample = 0.5x106Chlamydomonas cells).

[0063] Figure 18 includes a vertical bar graph showing growth of mouse 3T3 cells in hydrogels scaffolds. Quantification of 3T3 cells grown in various combinations of alginate and agar for three days was performed. Dashed line represents the control threshold, e.g., growth in 3% agar.

[0064] Figures 19A-19B include a photograph and a vertical bar graphs showing growth of Chlamydomonas cells in hydrogels scaffolds. Qualitative (19A) and quantitative (19B) quantification of Chlamydomonas grown in various combinations of alginate, agar and gelatin for eight days.

[0065] Figure 20 includes a scheme of a non-limiting set-up for EDTA-based dissolution of alginate gel to allow tissue examination.

[0066] Figures 21A-21B include vertical bar graphs showing various EDTA concentrations tested to dissolve disc gels containing Chlamydomonas or HepG2 cells. PBS / EDTA solution at different concentrations was applied onto alginate discs containing Chlamydomonas (21A) or HepG2 (21B).

[0067] Figure 22 includes a vertical bar graph showing TAP toxicity on HepG2 cells. HepG2 cell viability (detected by WST-1) was measured following overnight incubation either encapsulated in a gel or on a dish. Controls contain DMEM -based media only, whereas samples tested in “Gel” or “Media” contain 50% mixture of DMEM-media and TAP.

[0068] Figure 23 includes a vertical bar graph showing DMEM-based medium is nontoxic on Chlamydomonas cells. One million (IxlO6) Chlamydomonas cells were embedded within TAP-alginate disc gels and soaked into DMEM-media. Following three days, dissolved discs were analyzed for biomass and lethality (stained with Sytox Green). Numbers above the bars represent the lethal fraction in %.

[0069] Figure 24 includes a scheme of a non-limiting set-up of two disc-shaped scaffolds that are poured and compressed together to allow gas and nutrient exchange. The top layer is embedded with or without microalgae cells while the bottom layer is embedded with or without HepG2 cells. Each scaffold is based on alginate gel dissolved in the optimal media composition for each tissue.

[0070] Figure 25 includes photographs showing that separation of the two scaffolds allows examination of each culture individually. A duo-layer structure can be easily separated using a scalpel (left), and each separated disc can be dissolved and analyzed (right).

[0071] Figure 26 includes a scheme (left) and a vertical bar graph (right) showing that Chlamydomonas cells do not affect viability measurements of HepG2 cells.

[0072] Figures 27A-27B include vertical bar graphs showing that the presence of microalgae is advantageous to HepG2 cells viability in light but not in dark (in TP). The symbiotic experimental setup was as described in Fig. 24. Viability and OD measurements were recorded following 7 days of incubation for HepG2 (27A) or MA (27B) cells. The benefit of microalgae to the growth of HepG2 cells was only observed in conditions thatfavored photosynthesis- light, presence of microalgae and no acetate. As previously mentioned, acetate serves as a carbon source and therefore is not favor for photosynthesis.

[0073] Figures 28A-28B include vertical bar graphs showing DF-1 chicken fibroblasts viability (28A) and cell number (28B) after overnight in sealed plates and RT under light. Co-culture was compared to monoculture. Cell viability was measured by WST-8 and followed cell count using automated cell counter apparatus.

[0074] Figure 29 includes photographs and vertical bar graphs showing a symbiosis experiment sealed within a sterile bag (left). HepG2 cell viability (middle) and MA number (right) after a week in 25 °C in sealed bag and light. The co-culture was compared to a monoculture. Cell viability was measured by WST-8 and MA number was measured in 750 nm.

[0075] Figure 30 includes a photograph of a gel after electrophoresis showing detection of residual algal markers amplified using PCR. PCR analysis detected algae specific markers (lanes 3 and 4) in all algae-animal cell mixtures and not in animal alone (condition - 0), whereas an animal specific marker (lane 1) was detected in all conditions. The B2M gene marker (lane 2) did not work.DETAILED DESCRIPTION

[0076] According to one aspect of the invention, there is provided a multi scaffold-cell construct comprising at least two scaffolds, comprising at least one photosynthetic cell and at least one non-photosynthetic cell.

[0077] In some embodiments, the first scaffold comprising photosynthetic cells embedded therein, thereon, or both.

[0078] In some embodiments, the second scaffold comprising non -photosynthetic cells embedded therein, thereon or both.

[0079] In some embodiments, the first scaffold is suitable for culturing photosynthetic cells. In some embodiments, the photosynthetic comprises an alga. In some embodiments, an alga comprises microalga, macroalga, or both. In some embodiments, an alga comprisesa plurality of types of alga. In some embodiments, a photosynthetic cell comprises a plant cell. In some embodiments, a cell comprises a cell line.

[0080] In some embodiments, a plurality encompasses any integer equal to or greater than 2.

[0081] In some embodiments, a microalga is selected from: Haematococcus pluvialis, Chlorella sorokiniana, Chlorella vulgaris, or any combination thereof.

[0082] In some embodiments, a photosynthetic cell comprises cyanobacteria, volvox, , dinoflagellate, chlorobi, proteobacteria, chloroflexi, or any combination thereof. In some embodiments, a cyanobacteria comprises or is a Synechocystis sp.

[0083] In some embodiments, a photosynthetic cell comprises a synthetic cell.

[0084] In some embodiments, the second scaffold is suitable for culturing nonphotosynthetic cells. In some embodiments, the non-photosynthetic cells comprise or are mammalian cells, fish cells, chicken cells, or any combination thereof. In some embodiments, the second scaffold is devoid of microalgae cells. In some embodiments, mammalian cells, fish cells, chicken cells, or any combination thereof, comprise or are muscle cells, fibroblasts, a precursor thereof, or any combination thereof.

[0085] In some embodiments, the first scaffold is suitable for culturing the microalgae cells.

[0086] In some embodiments, the second scaffold is suitable for culturing the nonmicroalgae cells.

[0087] In some embodiments, the first scaffold and the second scaffold are positioned at a distance from one another allowing oxygen flow from the first scaffold to the second scaffold.

[0088] In some embodiments, the first scaffold and the second scaffold are positioned at a distance from one another that is sufficient to maintain cell viability, growth, or both, of the non-photosynthetic cells and the photosynthetic cells.

[0089] In some embodiments, the first scaffold and the second scaffold are positioned at a distance from one another that allows an effective diffusion from the first scaffold to thesecond scaffold. In some embodiments, effective diffusion refers to a diffusion that is sufficient to maintain cell viability, growth, or both. In some embodiments, diffusion that is sufficient to maintain cell viability, growth, or both means that at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%, including any combination thereof of the non-photosynthetic cells, the photosynthetic cells, or both, are living, proliferating, or both. In some embodiments, the distance between a first and a second scaffold allows a two- way diffusion.

[0090] In some embodiments, diffusion refers to oxygen diffusion, nutrients diffusion, waste diffusion, metabolites diffusion, or any combination thereof. Each possibility represents a separate embodiment of the invention.

[0091] In some embodiments, the first scaffold and a second scaffold are positioned at a distance from one another allowing oxygen flow from the first scaffold to second the scaffold. In some embodiments, the first scaffold and the second scaffold are positioned at a distance from one another allowing waste flow from the second scaffold to the first scaffold. In some embodiments, the waste is consumed, utilized, taken up, broken down, treated, or any combination thereof, by the photosynthetic cells.

[0092] Non-limiting examples of metabolites include but are not limited to: amino-acids, lipids, sugars, glutamic acid, lactic acid, or acetic acid, including any combination thereof. Non-limiting examples of nutrients include but are not limited to: minerals, fiber, water, fats, proteins, vitamins, or carbohydrates, including any combination thereof.

[0093] In some embodiments, the distance between the first and the second scaffolds allows a flow of oxygen, metabolites, nutrients, waste, or any combination thereof from the first scaffold to the second scaffold, from the second scaffold to the first scaffold, or both.

[0094] In some embodiments, the multi scaffold-cell further comprises a membrane. In some embodiments, the membrane is a porous membrane. In some embodiments, the membrane is positioned or located between the first scaffold and the second scaffold. In some embodiments, the membrane is configured to control the rate of diffusion from the first scaffold to the second scaffold, from the second scaffold to the first scaffold, or both. In some embodiments, the membrane is configured to control the type of compounds diffusing from the first scaffold to the second scaffold, from the second scaffold to the first scaffold,or both. In some embodiments, the membrane controls diffusion from the first scaffold to the second scaffold, from the second scaffold to the first scaffold, or both, based on the size of pores in the membrane.

[0095] In some embodiments, the scaffolds of the multi scaffold-cell construct of the invention do not allow or prevent cell migration of the photosynthetic cells to the second scaffold, of the non-photosynthetic cells to the first scaffold, or both. In some embodiments, the non-photosynthetic cells, the photosynthetic cells, or both are mobile within the first and scaffolds, respectively. In some embodiments, mobility can be determined or controlled by adjusting the cross-linking degree or level of the scaffold.

[0096] In some embodiments, the photosynthetic cells do not migrate to the second scaffold. In some embodiments, the non-photosynthetic cells do not migrate to the second scaffold.

[0097] In some embodiments, the first and second scaffolds are positioned at a distance of between 0 mm and 1 mm, between 0.001 mm and 1 mm, between 0.01 mm and 1 mm, between 0.1 mm and 1 mm, between 0.01 and 0.8 mm, between 0.01 and 0.6mm, between 0.1 mm and 0.8 mm, between 0.1 mm and 0.6 mm, between 0.2 mm and 0. 8 mm, or between 0.3 mm and 0.7 mm from one another. Each possibility represents a separate embodiment of the invention.

[0098] In some embodiments, a first scaffold and a second scaffold at least partially overlap. In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of a first scaffold and a second scaffold overlap. In some embodiments, between 10% and 100%, between 15% and 100%, between 20% and 100%, between 30% and 100%, between 40% and 100%, or between 50% and 100%, of a first scaffold and a second scaffold overlap. Each possibility represents a separate embodiment of the invention.

[0099] In some embodiments, the first scaffold and the second scaffold at least partially overlap, such that the overlapped area provides or is sufficient to allow cell viability, cell proliferation, diffusion, or any combination thereof, between the first and second scaffolds.

[0100] In some embodiments, a surface area of a first scaffold and a second scaffold is in contact in a manner that allows cell viability, cell proliferation, or diffusion between thescaffolds, including any combination thereof. In some embodiments, a surface area of a first scaffold and a second scaffold are at least partially in contact. In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of a surface area of a first scaffold and a second scaffold are in contact. In some embodiments, between 10% and 100%, between 15% and 100%, between 20% and 100%, between 30% and 100%, between 40% and 100%, or between 50% and 100%, of a surface area of a first scaffold and a second scaffold are in contact.

[0101] In some embodiments, the first scaffold and the second scaffold are interwoven.

[0102] In some embodiments, the multi-scaffold construct comprises a cell ratio between the photosynthetic cells and the non-photosynthetic cells, such that at least 40%, 50%, 60%, 70%, 80%, 90%, 95% viability, growth, or both, or any value and range thereof between, of the photosynthetic cells, the non-photosynthetic cells, or both, is obtained.

[0103] Methods for determining cell viability and growth are common and would be apparent to one of ordinary skill in the art of cell biology.

[0104] In some embodiments, any one of a first scaffold, a second scaffold, or both are made of a polymer. In some embodiments, a polymer comprises or is a biocompatible, biodegradable, bioerodible, or any combination thereof. In some embodiments, the first scaffold and the second scaffold comprise or are made of a different polymer. In some embodiments, a first scaffold and a second scaffold comprise or are made of the same polymer. In some embodiments, the first scaffold and the second scaffold comprise or are made of at least one different polymer. In some embodiments, a polymer comprises or is alginate.

[0105] In some embodiments, a polymer weight concentration within any one of a first scaffold and a second scaffold is between 0.5% and 20%, between 0.5% and 15%, between 0.5% and 10%, between 1% and 10%, between 1% and 8%, between 1% and 7%, between 1% and 6%, or between 1% and 5% by weight of the first scaffold, the second scaffold, or both. Each possibility represents a separate embodiment of the invention.

[0106] In some embodiments, alginate is present in a first scaffold, a second scaffold, or both, in a concentration of between 0.1 to 10%, 1 to 10%, 1 to 5%, 1 to 8%, 2 to 12%, by weight of a first scaffold, a second scaffold, or both.

[0017] In some embodiments, the multi scaffold-cell construct further comprises a culture medium. In some embodiments, a first scaffold comprises a culture medium suitable for culturing photosynthetic cells. In some embodiments, a first scaffold comprises a culture medium suitable for culturing microalgae cells. In some embodiments, a first scaffold is devoid of a culture medium.

[0108] In some embodiments, a second scaffold comprises a culture medium suitable for culturing non-photosynthetic cells. In some embodiments, a second scaffold comprises a culture medium suitable for culturing mammalian cells.

[0109] In some embodiments, a first scaffold allows transmission of light. In some embodiments, a first scaffold allows transmission of light at a wavelength of between 300 nm and 700 nm, between 320 nm and 700 nm, between 320 nm and 400 nm, or between 400 nm and 700 nm. In some embodiments, a first scaffold allows transmission of light at a wavelength of between 400 nm and 700 nm. In some embodiments, a first scaffold allows transmission light of white light. In some embodiments, the white light intensity is of at least 50 pmol / s / m2, at least 55 pmol / s / m2, at least 60 pmol / s / m2, at least 65 pmol / s / m2, at least 70 pmol / s / m2, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.

[0110] One skilled in the art will appreciate that the exact shape of each of the scaffolds may differ from one particle to another. In some embodiments, the exact shape of a first scaffold, a second scaffold, or both, is of any geometric form.

[0111] In some embodiments, a multi scaffold-cell construct comprises at least two layers. In some embodiments, a first scaffold is organized in at least one first layer. In some embodiments, a second scaffold is organized in at least one-second layer. In some embodiments, a second layer is positioned / stacked on top or beneath a first layer. In some embodiments, at least one first layer comprises at least two first layers. In some embodiments, a second layer is positioned between at least two first layers. In some embodiments, at least one first layer and a second layer are organized as a stack. In someembodiments, at least one first layer is exposed to light. In some embodiments, a second layer is in contact with a culturing medium.

[0112] In some embodiments, at least one first layer and a second layer are in a form of a fiber. In some embodiments, a fiber comprises a core and a shell surrounding the core. In some embodiments, a core comprises at least one first layer, and a shell comprises a second layer, or vice versa.

[0113] In some embodiments, the term “layer” refers to a substantially homogeneous substance of substantially uniform-thickness which maintains its physico-chemical properties such as mechanical strength or chemical composition, with the entire dimensions (lengths and width dimensions) thereof.

[0114] In some embodiments, the multi scaffold-cell contract can be used to grow nonphotosynthesis cells.

[0115] According to another aspect, there is provided a method for culturing nonphotosynthetic cells in, on, or both, a scaffold.

[0116] In some embodiments, the method comprises culturing and subjecting a multi scaffold-cell construct of the invention at an effective amount of light.

[0117] In some embodiments, the light is of a wavelength of between 300 nm to 700 nm, between 320 nm and 700 nm, between 320 nm and 400 nm or between 400 nm and 700 nm. In some embodiments, an effective amount of light refers to light with an intensity of at least 50 pmol / s / m2, at least 55 pmol / s / m2, at least 60 pmol / s / m2, at least 65 pmol / s / m2, or at least 70 pmol / s / m2. Each possibility represents a separate embodiment. In some embodiments, an effective amount of light refers is a sufficient amount of light to produce enough oxygen by the photosynthesis cells, that are required for at least 50%, at least 60%, at least 70%, or at least 75% of viability of a non-photosynthesis cell.

[0118] In some embodiments, the method comprises culturing non-photosynthetic cells for a period of time of between 7 and 50 days, between 7 and 40 days, between 7 and 30 days, between 8 and 35 days, between 9 and 40 days, or between 10 and 30. Each possibility represents a separate embodiment of the invention.

[0119] In some embodiments, culturing comprises growing, suspending, supplementing, contacting, or any combination thereof, the non-photosynthetic cells in a suitable medium.In some embodiments, a suitable medium provides components, nutrients, growth factors, or any agent capable of supporting, maintaining, or promoting cell growth.

[0120] Media suitable for in vitro culture of cells are common and would be apparent to one of ordinary skill in the art of molecular and cellular biology.

[0121] In some embodiments, subjecting comprises exposing a multi scaffold-cell construct to light. In some embodiments, subjecting comprises exposing a first scaffold, at least one first layer, or both, to light. In some embodiments, subjecting comprises contacting the photosynthetic cells with an effective amount of light. In some embodiments, subjecting comprises subjecting to at least one light source. In some embodiments, subjecting is or comprises contacting.

[0122] In some embodiments, subjecting is performed simultaneously to the culturing step. In some embodiments, subjecting comprises continuously subjecting. In some embodiments, subjecting comprises discontinuously subjecting (in intervals). In some embodiments, subjecting is for a period of time correlating with the culturing time. In some embodiments, subjecting is for a period of time of between 7 and 40 days, between 7 and 35 days, between 7 and 30 days, between 8 and 35 days, between 9 and 30 days, or between 10 and 30. Each possibility represents a separate embodiment of the invention.

[0123] In some embodiments, the method further comprises monitoring the levels of free oxygen in the second scaffold. In some embodiments, monitoring is performed simultaneously with the subjecting and culturing steps. In some embodiments, the method comprises increasing or decreasing exposure duration to light, light intensity, or both of the multi-scaffold cell construct. In some embodiments, the method comprises decreasing exposure duration to light, light intensity, or both, wherein oxygen level is above a predetermined threshold. In some embodiments, the method comprises increasing exposure duration to light, light intensity, or both, wherein oxygen is below a predetermined threshold.

[0124] In some embodiments, a pre-determined threshold is the amount of oxygen required for sufficient viability and cell proliferation of the non-photosynthesis cells.

[0125] In some embodiments, the method further comprising a step proceeding the culturing and subjecting, comprising removing or separating a first scaffold from a secondscaffold, thereby obtaining an isolated second scaffold comprising cultured and isolated nonmicroalgae cells.

[0126] In some embodiments, removing or separating comprises mechanically removing or separating.

[0127] In some embodiments, the method further comprises a step after the removing or separating, the step comprises isolating DNA, RNA, or both from the second scaffold. In some embodiments, the method further comprises determining the presence of at least one DNA, RNA, or both, polynucleotide derived from a photosynthetic cell.

[0128] In some embodiments, determining is by any method known to a person of skill in the art of molecular biology. Non-limiting examples for such methods include, but are nt limited to, PCR, RT-PCR, real time PCR, quantitative PCR, Southern blot, northern blot, RNA in situ hybridization, dot blot, next generation sequencing, or any equivalent thereof, for this purpose.

[0129] In another aspect, there are provided non-photosynthetic cells cultured according to the method disclosed herein.

[0130] According to another aspect, there is provided a composition comprising the nonphotosynthetic cells of the invention, and an acceptable carrier.

[0131] In some embodiments, a w / w percentage of an acceptable carrier within the composition is between 0.1% and 99.9%, between 10% and 99.9%, between 20% and 99.9%, between 1% and 50%, between 20% and 70%, or between 50 and 99.9%, between 30% and 90%. Each possibility represents a separate embodiment of the invention.

[0132] In some embodiments, a carrier is a pharmaceutically acceptable carrier or a nutraceutical acceptable carrier. In some embodiments, the composition is a pharmaceutical composition, a nutraceutical composition, or both. In one embodiment, a "pharmaceutical composition", or a “nutraceutical composition” refers to a preparation of a composition as described herein with other chemical components such as physiologically suitable carriers and excipients. In some embodiments, the term "pharmaceutically acceptable carrier” or “nutraceutical acceptable carrier” refers to a carrier approved by a regulatory agency such as the Federal or a state government for use in animals, and more particularly in humans.The purpose of a pharmaceutical composition, or a nutraceutical composition is to facilitate administration of the composition to an organism. In one embodiment, the phrase "physiologically acceptable carrier" refers to a carrier or a diluent that does not cause significant irritation to a mammal and does not abrogate the biological activity and properties of the administered composition. An adjuvant is included under these phrases.

[0133] In some embodiments, the composition is an edible composition. In some embodiments, the composition is a meat substitute. In some embodiments, the composition is characterized by chloroplast DNA traces of at most 10%, at most 8%, at most 5%, at most 3%, at most 1%, or at most 0.1%, determined by PCR. In some embodiments, the composition is characterized by chloroplast DNA traces of between 0.00001% and 10%, between 0.00001% and 5%, between 0.00001% and 1%, between 0.0001% and 1%, between 0.001 and 1%, or between 0.01 and 1%, by weight of the composition. Each possibility represents a separate embodiment of the invention.

[0134] According to another aspect, there is provided a scaffold-cell construct comprising:(a) a scaffold comprising non-photosynthetic cells embedded therein, thereon, or both; and(b) at least one compound derived from photosynthetic cells.

[0135] In some embodiments, at least one compound derived from photosynthetic cells is selected from: a fatty acid, a lipid, a polynucleotide, a saccharide, a pigment / carotenoid, or any combination thereof. In some embodiments, the scaffold-cell construct is characterized by chloroplast DNA traces of between 0.00001% and 10%, between 0.00001% and 5%, between 0.00001% and 1%, between 0.0001% and 1%, between 0.001 and 1%, or between 0.01 and 1%., by weight. Each possibility represents a separate embodiment of the invention. In some embodiments, the scaffold-cell construct is characterized by traces of DNA unique to photosynthetic cells of between 0.00001% and 10%, between 0.00001% and 5%, between 0.00001% and 1%, between 0.0001% and 1%, between 0.001 and 1%, or between 0.01 and 1%., by weight.

[0136] In some embodiments, DNA unique to photosynthetic cells is absent from any cell not being a photosynthetic cell. In some embodiments, DNA unique to photosynthetic cells is absent from animal cells. In some embodiments, animal cells do not comprise a DNA unique to photosynthetic cells.General

[0137] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.

[0138] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a”, “an” and “at least one” are used interchangeably in this application.

[0139] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0140] In the description and claims of the present application, each of the verbs, “comprise”, “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb.

[0141] Other terms as used herein are meant to be defined by their well-known meanings in the art.

[0142] Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive.

[0143] Throughout this specification and claims, the word “comprise” or variations such as “comprises” or “comprising,” indicate the inclusion of any recited integer or group of integers but not the exclusion of any other integer or group of integers.

[0144] As used herein, the term “consists essentially of’, or variations such as “consist essentially of’ or “consisting essentially of’ as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition.

[0145] As used herein, the terms "comprises", "comprising", "containing", "having" and the like can mean "includes", "including", and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. In one embodiment, the terms "comprises", "comprising", "having" are / is interchangeable with "consisting".

[0146] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.EXAMPLES

[0147] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include chemical, molecular, biochemical, and cell biology techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I- III Ausubel, R. M., ed. (1994); "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); The Organic Chemistry of BiologicalPathways by John McMurry and Tadhg Begley (Roberts and Company, 2005); Organic Chemistry of Enzyme-Catalyzed Reactions by Richard Silverman (Academic Press, 2002); Organic Chemistry (6thEdition) by Leroy "Skip" G Wade; Organic Chemistry by T. W. Graham Solomons and, Craig Fryhle.Material and MethodsMaterials

[0148] Sodium alginate, (W201502), calcium chloride (C4901) and WST-1 reagent were purchased from Sigma- Aldrich. MEM-EAGLE medium was purchased from SARTORIUS. EDTA tetrasodium salt hydrate (A 17385) was purchased from Alfa Aesar.MethodsGel solutions preparationSolutions for Chlamydomonas reinhardtii cells

[0149] Sodium alginate was dissolved in TAP medium at a final weight per volume (w / v) concentration of 1%, to 4% (w / v). The solutions were then stirred at room temperature for a minimum of 30 min, until sodium alginate was completely dissolved and a clear solution was formed.

[0150] Calcium chloride was dissolved in TAP medium at a final concentration of between 0.1% and 7% (w / v).Solutions for HepG2 cells

[0151] sodium alginate was dissolved in MEM-EAGLE media at a final concentration of 2%. (MEM-EAGLE is the media of HepG2 cells). The solutions were then stirred at room temperature for a minimum of 40 min, until sodium alginate was completely dissolved, and a clear solution was formed.

[0152] Calcium chloride was dissolved in MEM-EAGLE media at a final concentration of 3%.Solutions for alginate fiber

[0153] Sodium alginate was dissolved in double distilled water (DDW) at a final concentration of 2% (w / v). The solutions were then stirred at room temperature for a minimum of 30 min, until sodium alginate was completely dissolved, and a clear solution was formed.

[0154] Calcium chloride in DDW at a final concentration of 3%, and 5%(w / v).

[0155] All solutions were sterilized by an autoclave prior to use.Cultivation of microalgae cells and the HepG2 cell solution

[0156] A solution comprising microalgae cells in TAP was prepared and a number of cell solutions were prepared by diluting the concentrated in TAP solutions and cultured. HepG2 cells solution were prepared in MEM-EAGLE media and cultured.Preparation of alginate gel layers

[0157] An empty gel solution is prepared by mixing (a) 1 ml of sodium alginate solution in MEM-EAGLE or in TAP solution, and (b) 1 ml of calcium chloride solution (in MEMEAGLE media or with TAP solution).

[0158] A microalgae gel solution is prepared by mixing (a) 1 ml of sodium alginate solution in TAP, (b) 1 ml of calcium chloride solution in TAP, and (c) 1 ml of microalgae cells solution (1 ml of microalgae cell solution contains 2.05 x 106cells).

[0159] The HepG2 gel solution is prepared by mixing (a) 1 ml of sodium alginate solution in MEM-EAGLE, (b) 1 ml of calcium chloride solution in MEM-EAGLE, and (c) 1 ml of HepG2 cells solution (1ml of HepG2 cell solution containing 0.3 x 106cells).

[0160] The gel solution is then poured into a three dimensional (3D)-printed disc mold with a radius of 10 mm and a height of 14 mm and compressed into the mold by a printed mold compressor to get a smooth, flat, disc shape alginate gels.

[0161] After the preparation of the alginate gel layers, the gels were poured into 6, 12, or 24-well plates (the number of the wells plate was chosen dependent on the experiments).Layers adherence

[0162] The two layers, the microalgae gel layer, and the HepG2 gel layer, were adhered to one another, or to an empty alginate gel layer, by compressing them together within the mold to glue the layers together.Layers detachment

[0163] Detachment is done using a scalpel.Viability test / WST-1 assay

[0164] The viability of HepG2 cells was examined by WST- 1 test. For the WST- 1 method, 48-well plates were used. Before de-crosslinking the HepG2 alginate layers, the medium was removed, and 700 pl of WST-1 reagent was added to each well, and the cells were incubated. After 2 h of incubation, absorbance was measured at 450 nm by a microplate apparatus.De-crosslinking the alginate gel

[0165] To de-crosslink the different alginate gel layers, the layers were detached and each gel layer was submerged in EDTA (10% w / v) and incubated for 15 min at room temperature. The de-crosslinked gel is solubilized back to a solution state, which is then centrifuged in order to retrieve the encapsulated cells. The pellet is resuspended in 1 ml of cell culture medium (depending on the cell used) for another test.Direct cell viability counting

[0166] After the detachment and the de-crosslinking of the gel, the viability of the cells (microalgae cells / HepG2 cells) was assessed using a countess automated cell counter from Thermo Scientific (the trypan blue staining was added to the HepG2 cells before counting).Chlamydomonas reinhardtii cells absorbance

[0167] To determine the wavelength absorbance of Chlamydomonas reinhardtii cells, a 20 ml solution of microalgae cells having a cells density of 2.05 x 106cells in TAP solution was prepared, and the absorbance of the solution was determined using a microplate apparatus. As can be observed in Figure 5, the absorbance of Chlamydomonas reinhardtii cells should be measured at 680 nm.Disc molds of alginate gel

[0168] Homogeneous and orderly disc structures of alginate gel were prepared using 3D printed disc molds with a radius of 10 mm and a height of 14mm (Figure 4A). Gels having disc shape were produced by compressing the gel into the molds using a 3D printed compressor to produce a smooth and flat disc shape gel (Figure 4B).EXAMPLE 1

[0169] The viability of microalgae cells encapsulated in different concentrations within the alginate gel was examined (Figure 1A). Gels were prepared by setting the gels into a 24- well plate without the usage of the disc. Samples were left for 37 days on the bench at 22 °C under light and ventilation. Viability was assessed by the visual observation of a green color indicating microalgae growth and the viability

[0170] The viability of concentrated solution of microalgae cells grew in gels made of an alginate solution with a final concentration of 2%, 3%, or 4% (w / v) and 5% (w / v) of calcium chloride solution was observed throughout the experiment on days: 6, 12, 23, 29, and 37 days (Figure IB). The microalgae cells diluted solution (1:2) grew in the gel made of a 2 %(w / v) alginate solution and a 5% (w / v) calcium chloride solution after 6 days (Figure IB).

[0171] The viability of microalgae cells was examined after 37 days, in the concentrated and the diluted solutions 1:2, 1:4, 1:8, and 1: 10 within the alginate gels. Cell growth was observed in gels made of a 2% or 3% alginate solution (w / v) and 3% (w / v) of calcium chloride after 6 days. The cell viability was maintained even after 37 days, excluding diluted solution 1:8 sample made of 2% alginate solution(w / v) and 3% (w / v) of calcium chloride, which was contaminated (Figure 1C).

[0172] The mobility of encapsulated cells in different alginate gel concentrations was examined. Gel samples were studied under a microscope on the day of preparation. Cell mobility was observed in different gel percentages and in TAP media. Interestingly, the inventors observed cell movement within the TAP media, but not in the gel itself (Figures 2A-2F).

[0173] The proliferation of encapsulated cells in different alginate gel concentrations was examined under a microscope at the first day of preparation, after three days, and after nine days. Cell proliferation was inferred from cellular aggregates (Figure 3A-3F).

[0174] Next, the ability of a mammalian culture to survive outside of an incubator while oxygen is exclusively supplied by microalgae was examined. Both cell cultures were encapsulated within an alginate disc shape gel, and the discs were attached to one another. The first layer, an alginate gel encapsulating 0.3 x 106of HepG2 cells, acts as the bottom layer, and an alginate gel or an alginate gel encapsulating 1.025 x 105(OD = 0.565) of microalgae cells, as the top layer. Upon fabrication of the different layers, they were compressed together to promote adherence.

[0175] Three (3) 6-well plates were prepared each comprising triplicates of the samples (an alginate gel layer with and without microalgae cells). The plates were stored for 7 days under different conditions. The first and second plates were stored in ambient conditions (e.g., on the bench) and exposed to light, whereas the bottom layer (alginate gel with HepG2 cells) of the second plate was submerged in cell media. The third plate was stored in the hood and wasn’t exposed to light.

[0176] A color change was observed in the microalgae cell gel layer that was exposed to light, representing the growth of the microalgae cells. This result indicates a symbiotic interaction occurred between the two layers (Figures 6A-6F).

[0177] Then, the alginate gel encapsulating HepG2 cells and the alginate gel encapsulating microalgae cells were detached (Figure 7A). The alginate gel encapsulating microalgae cell was de-crosslinked (Figures 7B-7D) and the viability of the cells was determined by means of absorbance detection at 680 nm. The viability of microalgae cells in the presence of light was increased (Figure 8A). In addition, the growth was not affected by the presence of HepG2 cells or HepG2 media. The automated counter apparatus counts live and dead cells, and thus the cell number reflects dead and living cells (Figure 8B).

[0178] The viability of HepG2 cells within the detached layer was measured by using the WST-1 assay, and the number of cells was examined after the layer was de-crosslinked. The presence of light did not affect the viability of the HepG2 cells (Figure 9G), whereas the presence of media increased cell viability (Figure 9A). Additionally, the presence of microalgae increased the HepG2 cell viability, indicating that a positive symbiotic interaction occurred between the cells of the different layers (Figures 9C, 9E and 91).Preparation of alginate fiber

[0179] To prepare calcium alginate fiber, a syringe filled with alginate solution 2% (w / v) was extruded into a coagulation bath of CaCh solution 3%, or 5% (w / v), where ion exchange occurred, and a fiber was formed.

[0180] Alginate fibers were prepared (Figure 10) and their ability to transmit blue light was examined by exposing them to a blue light laser. Blue light was found to be transmitted through an alginate fiber.EXAMPLE 2Generating an alginate-based scaffold structure

[0181] By designing a thin disc, surface area / volume ratio is maximized between pair of discs to allow efficient gas and nutrient exchange. Discs should be composed of edible matrix, and therefore the inventors next set out to optimize biomaterials of the edible scaffold to ensure microalgae (MA) proliferation and prosperity as similar to liquid-based culture (Figure 11). The inventors selected alginate as a relatively cheap and edible biocompatible material for the co-cultures. Sodium alginate (SA) solutions were prepared by dissolving sodium alginate in TAP (Tris-Acetate-Phosphate) medium at concentrations of 1-4% (w / v) and a crosslinker, calcium chloride (CC) solutions at concentrations that range from 0.1 % to 7% (w / v). Similarly, for mammalian cells (e.g., human hepatocellular carcinoma HepG2), sodium alginate solutions were made by dissolving sodium alginate in a MEM-EAGLE medium. Calcium chloride solutions for HepG2 cells were prepared by dissolving calcium chloride in a MEM-EAGLE medium. To achieve a complete and homogenous gel, the solutions were heated and stirred for at least 30 minutes to form a clear solution. The crosslinker is a critical parameter that governs gel porosity, stability, and diffusion. In order to optimize crosslinking, Chlamydomonas cells (-0.25 O.D. in each gel disc) were encapsulated within the alginate gel in various SA and CC concentrations, and biomass accumulation was measured following 21 days on the bench at 22 °C with a light (50 pE) and a ventilator to avoid over-heating. Based on these studies the inventors concluded that the optimal gel for Chlamydomonas is SA 2% and CC 3% (Figure 12), and same concentrations were used for encapsulating the HepG2 cells.

[0182] In order to choose an industrial and edible microalgae strain that would be ideal for co-culture (photosynthesis productivity and oxygen excretion levels), the inventors have tested two MA species (Chlamydomonas reinhardtii and Chlorella sorokiniana) in various light intensities in liquid TAP (Tris-Acetate-Phosphate) medium. As shown in Figure 11 and in agreement with previous knowledge from the literature Chlamydomonas proliferation rate increases with increased light intensities, yet reaches higher biomass with dimmer light, whereas Chlorella proliferates in similar rate, yet with longer lag phase in higher light intensities (Figure 11). Cultivation was assayed both in 21 °C and in 33 °C, however growth was rather poor in high temperature in liquid culture data not shown).EXAMPLE 3Alginate-based scaffold structure is applicable for various photosynthetic cells

[0183] With the optimized gel composition, the inventors sought to reproduce MA biomass accumulation as measured in liquid culture (Figure 11). The inventors seeded Chlamydomonas or Chlorella cells (O.D. 750 nm): 0.02) into each disc and measured their viability and proliferation following six days in TAP vs. TP (Acetate is excluded as a carbon source thus conditions are in favor for photosynthesis), and in various light intensities (Figure 13). In agreement with liquid-based growth, Chlamydomonas was found to reach higher biomass in TAP and 60 pE light intensity. Interestingly all light intensities tested yielded similar biomass accumulation of Chlamydomonas in TP suggesting already in 60 p E its photosynthetic capacity is saturated or alternatively light transfer is a bottleneck within the alginate gel. Moreover, calculation of lethal fractions (percentage of dead cells out of the entire cell population) within the population show that higher light intensities damaged cell viability both in TAP and in TP (Figure 13A), with less proliferation and increased lethality (Figure 13B). Similarly, the inventors have tested the applicability to three other microalgae species: H. pluviallis, C. sorokiniana, C. vulgaris, and the cyanobacteria Synechocystis in 30 pE (Figure 14). Microscopy images were taken following alginate dissolution to assess the physiological and proliferative state of the cells. All species were found to be viable and healthy (Figure 15). Importantly, for future applications of the current system, the inventors validated whether Chlamydomonas cells were viable within alginate disc following 14 days growth (Figure 16).

[0184] In order to ensure gel mechanical stability and to determine whether microalgae may modify matrices stiffness, the inventors have determined the stiffness of microalgae cells in alginate gel (SA 2%, CC 3%) and a control sample of alginate gel (SA 2%, CC 3%) without cells at two time points (Day 1 and Day 14). The inventors found no significant difference in the microalgae gel layer stiffness between the sample and the control gel layer on the first day or following 14 days (Figure 17), suggesting a marginal to negligible contribution of Chlamydomonas cells to the matrices rigidity. Although there is a slight increase in the rigidity, the inventors found no significant difference between day 1 and day 14 both for the control and the sample, demonstrating that the stiffness of the gels is maintained or preserved over a period of at least two weeks.EXAMPLE 4Alginate-based scaffold structure is applicable for various animal cell lines

[0185] Further to the above, the inventors have shown that alginate -based scaffolds can support the expansion of a diverse repertoire of cell lines from different species, including mouse (NIH / 3T3), human (HepG2), and chicken (DF1) (Figures 18, 27, and 28, respectively).EXAMPLE 5Scaffold structure composition is variableAnimal cell lines

[0186] Cells of the mouse fibroblast cell line NIH 3T3 were encapsulated in various combinations of alginate and agar. First, a 6% (w / v) alginate solution was prepared by dissolving alginate in Dulbecco's Modified Eagle Medium (DMEM). The solution was heated to approximately 100 °C in a sealed vessel and continuously stirred at 400 rpm using a magnetic stirrer to aid dissolution. Next, a 3% (w / v) agar solution was prepared by dissolving agar in DMEM, and the mixture was heated in a microwave until boiling.

[0187] Hydrogels were created by combining initial solutions of 6% sodium alginate (SA) and 3% agar in ratios of 1:1, 1:2, and 1:4, resulting in final concentrations of 3% SA and 1.5% agar, 4% SA and 1% agar, and 4.8% SA and 0.6% agar, respectively. To each mixture,50 pL containing 2.5xl06cells / mL were added, and 50 pL of each hydrogel formulation were pipetted into 96-well plates. The hydrogels containing cells were cross-linked using 100 pL 2% CaCh. The samples underwent a triple wash with medium, and 200 pl of medium with 10% serum was added atop the hydrogels. Subsequently, the hydrogel-containing cells were incubated in an incubator for 3 days.

[0188] To determine viability, each well was treated with WST-8 reagent (Sigma- Aldrich, Japan) and incubated for 1 hour at 37 °C and 5% CO2. The absorbance was measured at 450 nm with a plate reader (Wallac 1420 VICTOR, Perkin-Elmer Life Sciences, USA).

[0189] Quantitative analysis of cells revealed no significant difference in growth rates between cells cultured in pure agar and those in sodium alginate. However, significant enhancements in proliferation were observed in composite hydrogels. Specifically, cells in hydrogels with a composition of 3% sodium alginate (SA) and 1.5% agar exhibited a 230% increase in proliferation compared to cells grown in pure agar. Additionally, hydrogels formulated with 4% SA and 1% agar showed a 260% increase, and those with 4.8% SA and 0.6% agar demonstrated a 291% increase in cell proliferation relative to the agar control.Algae

[0190] Chlamydomonas cells were encapsulated in various combinations of alginate with agar or gelatin, all dissolved in TAP medium, and crosslinked with 3% calcium chloride. The initial optical density of the algal culture was 0.1 O.D. / mL. The discs were maintained at a temperature of 21 °C and subjected to a light intensity of 60 pE for 8 days.

[0191] After the incubation period, the color of the disk turned green, indicating the growth of algae (Figure 19A). To quantify algae growth WST-1 reagent was used (Figure 19B).EXAMPLE 6A dual-scaffold structure with close proximity is designed to allow co-culture prosperity

[0192] Symbiosis setup is designed as two disc-shaped gels lying on top of each other, each embedded with either Chlamydomonas cells (top) or HepG2 human liver cell line(bottom). Following co-culture, the two discs are separated, and each is dissolved by EDTA in order to analyze the cell state post-symbiosis experiments (Figure 20). To determine the optimal concentration for de-crosslinking of the alginate discs, and measure the biomass production of encapsulated cells, different concentrations of de-crosslinking solutions PBS / EDTA (0.5%, 5%, and 10%) were applied on HepG2 embedded discs. The incubation time required for the gel to undergo de-crosslinking varied (3 min for 10%, 6 min for 5% and 90 min for 0.5%), and thus accordingly affected viability. Following dissolution, HepG2 cells were stained for viability by WST-1. The inventors discovered that the optimal concentration for de-crosslinking the gel with minimal toxicity to the cells is PBS / EDTA 5%, and these conditions are found to be suitable for cell analysis with high accuracy (Figure 21B). Similarly, the inventors wanted to minimize toxic effect of EDTA on Chkimydoinonas cells and applied different concentrations of de -crosslinking solutions PBS / EDTA (2.5%, 5%, and 10%) on Chlamydomonas embedded discs. As shown in Figure 21A, 2.5% EDTA was found to be rather safe with minimal toxic effect on cell viability and thus, in subsequent experiments discs were dissolved in accordance.

[0193] Next, the inventors tested whether the close proximity of two discs induces or has a toxic effect(s). The ability of microalgae cells to grow in close proximity to animal cells without producing toxicity is dependent on their cell-cell contact and diffusion of TAP media into the animal cell matrix compartment or vice versa. Since the cells are introduced in designated matrices the cell-cell contact is minimal, however, diffusion of media materials may affect cell viability. To determine the toxicity of TAP on HepG2 cells, 0.15xl06cells embedded within a disc gel or spread on a dish were incubated with TAP-DMEM-based media mixture overnight. The inventors found that TAP medium may be mildly toxic for HepG2 cells in encapsulated gel and dramatically toxic in liquid (Figure 22).

[0194] To ensure Chlamydomonas cells are not affected by DMEM -based media a similar experiment was conducted. DMEM-based medium was applied on Chlamydomonas- embedded disc gels (IxlO6cells with TAP) and incubated at 21 °C under 60 pE. Following three days, discs were dissolved, and cells were analyzed for biomass accumulation and lethality (Figure 23). DMEM-based medium was found to slightly yet not significantly posea toxic effect on cell viability. At any rate, DMEM-based medium did not affect biomass accumulation.EXAMPLE 7Mammalian cells demonstrate ~3-fold higher proliferation rate and metabolic activity when co-cultured with microalgae cells

[0195] In order to test the symbiotic effect of Chlamydomonas cells on the animal culture, the inventors established a symbiosis assay where duo-disc apparatuses are incubated for seven days at room temperature. As a control for the light effect, a duo-disc structure with no microalgae was included, and in order to assess the photosynthetic effect, duo-discs with microalgae were incubated either with or without light (Figure 24). A symbiosis experiment that can confirm the current innovative concept and provide proof of concept was performed in reactor-free conditions over 7 days on the bench at room temperature, using a sealed culture plate with white light only.

[0196] Following 7 days of incubation, each disc was separated manually using a scalpel and dissolved using 5% EDTA for further analysis (Figure 25). In order to assure that residuals of MA would not affect measurements of viability, increasing amounts of Chlamydomonas cells were mixed into a disc with fixed number of HepG2 (135,000) and dissolved immediately. As shown in Figure 26, up to 37-fold more MA does not affect viability measurements.

[0197] Following 7 days of incubation, the number of Chlamydomonas biomass cells was measured and analyzed for viability within the symbiosis experimental setup. As expected, in the absence of light, the microalgae hardly proliferated (Figure 27B). Strikingly, HepG2 cells rapidly proliferated in the presence of microalgae and light and increased their biomass accumulation ~3-fold compared to the light-only control, as indicated by the cell metabolic activity (Figure 27A).

[0198] These experiments provide convincing evidence that animal tissue culture can prosper outside an incubator context (namely, regulated temperature and CO2) with a minimal investment of energy and no media replacement in the presence of photosynthetic microalgae in two separated and optimized compartments. Moreover, microalgae biomassaccumulation provides an additional nutritious value to the biomass of a final product, as disclosed herein.EXAMPLE 8Symbiotic effect of co-culture is applicable for different animal cell lines

[0199] Preliminary feasibility experiment was performed with DF-1, spontaneously immortalized chicken fibroblasts cell lines. The inventors used 400,000 DF-1 cells / disc similarly as performed herein for HepG2 cells. In the presence of microalgae, cell viability was increased by -25% after overnight culture in RT and light, compared to cells only (Figure 28). Further studies may be warranted to adjust the gel conditions to DF-1 which are known to be fast-growing cells (e.g., characterized by doubling time being almost twice as that of HepG2 cells).EXAMPLE 9Co-culture can be upscaled in sterile bags

[0200] In order to explore the possibility to scale up the symbiotic culture, two independent experiments were performed using molds that could form gels with volume being 5 greater than that of the lab plate format. This was performed in a sterile cell culture bag (Figure 29; left). The cultures were placed inside the bags and sealed with minimal medium for a week. In a culture that was grown in 25 °C, the inventors found that the symbiotic co-culture condition was superior to a monoculture, and -25% increase in cell viability was observed (Figure 29; right). Interestingly, the inventors also found that the animal culture benefits the microalgae that increased in -30% as detected in 750 nm (Figure 29; middle). This suggests a potential CO2 absorption by the microalgae.EXAMPLE 10Animal cell culture is uniquely signatured following co-culture with microalgae

[0201] To assess the detection sensitivity of residual microalgae (MA) within animal cell culture, varying amounts of Chlamydomonas cells were mixed with a fixed number of HepG2 cells (IxlO6). After mixing the algae and animal cells, DNA was isolated andanalyzed using PCR with both animal-specific (18S (SEQ ID NO: 1) and B2M (SEQ ID NO: 4)) and algae-specific (PsbH (SEQ ID NO: 7) and mating type (SEQ ID NO: 10)) markers. The following primers were used per the tested genes: 18S For - GTAACCCGTTGAACCCCATT (SEQ ID NO: 2) and 18S Rev -CCATCCAATCGGTAGTAGCG (SEQ ID NO: 3); B2M For TTCTGGTGCTTGTCTCACTGA (SEQ ID NO: 5) and B2M Rev -CAGTATGTTCGGCTTCCCATTC (SEQ ID NO: 6); PsbH For CGCCGTTTCCATTTGCAGGATTTACAGAAAGTAAATAAAATAGCGCTAATAAC GCTTAATT (SEQ ID NO: 7) and PsbH RevATGTTAACTTTTTTAGATCTAGAAACTTTAGCTAAAGTTTCCCAACTCATAGAA ACGTC (SEQ ID NO: 8); and Mating type For - CGACGACTTGGCATCGACAGGTGG (SEQ ID NO: 11) and Mating type Rev - CTCGGCCAGAACCTTTCATAGGGTGG (SEQ ID NO: 12).

[0202] As shown in Figure 30, PCR analysis detected algae markers even when algae cells made up only 1 % of the total sample.

[0203] Conventional PCR is less sensitive than real-time quantitative PCR (qPCR). qPCR typically requires much lower concentrations of target genomic DNA, often less than 171000thof what conventional PCR requires. Some studies indicate that qPCR can detect as few as 3 DNA molecules. Therefore, it is conservatively estimated that using a qPCR assay, the inventors will be able to detect algae cells representing as little as 0.01% of the total sample.EXAMPLE 11Evaluating the Effect of Distance Between Algae and Animal Cell Compartments on Cell Growth

[0204] To estimate the impact of distance between algae-containing and animal cellcontaining matrices on animal cell growth, a symbiotic experiment is conducted. In this experiment, the two compartments are separated using dialysis membranes, which allow the exchange of gases and growth factors.

[0205] To vary the distance between the compartments, multiple layers of dialysis membranes are employed.

[0206] After 7 days of co-culturing, the algae and animal cell-containing matrices are separated. The viability and cell number in the animal cell compartment are quantified using various assays, such as MTT, WST1 / 8, and alamarBlue.

[0207] The differences in cell growth and viability are then plotted as a function of the distance between the algae and animal cell compartments.

[0208] The inventors expect that: (a) a distance of 1-50 pm would have a great positive effect, that is an increase in cell number and viability; (b) a distance of more than 50 pm and up to 100 pm would have a medium or mild effect, that is medium or mild increase in cell number and viability; and (c) a distance of more than 100 pm and up to 300 pm would have a little or minute effect, that is little or minute increase in cell number and viability. The inventors foresee that a distance of more than 300 pm would have no positive effect on cell number and viability unless using high pressurized oxygenated air.

[0209] While the present invention has been particularly described, persons skilled in the art will appreciate that many variations and modifications can be made. Therefore, the invention is not to be construed as restricted to the particularly described embodiments, and the scope and concept of the invention will be more readily understood by reference to the claims, which follow.

Claims

CLAIMSWhat is claimed:

1. A multi scaffold-cell construct comprising: a. a first scaffold comprising photosynthetic cells embedded therein, thereon, or both, wherein said first scaffold is suitable for culturing said photosynthetic cells; and b. a second scaffold comprising non-photosynthetic cells embedded therein, thereon, or both, wherein said second scaffold is suitable for culturing said non- photosynthetic cells, wherein said first scaffold and said second scaffold are positioned at a distance from one another allowing oxygen flow from said first scaffold to said second scaffold.

2. The multi scaffold-cell construct of claim 1, wherein: (i) said photosynthetic cells of said first scaffold do not migrate into said second scaffold; (ii) said non- photosynthetic cells of said second scaffold do not migrate into said first scaffold; or (iii) both (i) and (ii).

3. The multi scaffold-cell construct of claim 1 or 2, wherein said first scaffold and said second scaffold are positioned at a distance of between 0 and 0.5 mm from one another.

4. The multi scaffold-cell construct of any one of claims 1 to 3, wherein said photosynthetic cells are selected from the group consisting of: microalgae, plant cells, cyanobacteria, and synthetic cells.

5. The multi scaffold-cell construct of any one of claims 1 to 4, wherein said photosynthetic cells are microalgae cells.

6. The multi scaffold-cell construct of any one of claims 1 to 5, wherein said nonphotosynthetic cells are any one of: mammalian cells, fish cells, chicken cells, and any combination thereof.

7. The multi scaffold-cell construct of claim 6, wherein said mammalian cells, fish cells, chicken cells, and any combination thereof, comprise muscle cells, fibroblasts, a precursor thereof, or any combination thereof.

8. The multi scaffold-cell construct of any one of claims 1 to 7, wherein any one of said first scaffold, second scaffold, and both, is made of a polymer being biocompatible, biodegradable, bioerodible, or any combination thereof.

9. The multi scaffold-cell construct of any one of claims 1 to 8, wherein said first scaffold and said second scaffold are made of the same polymer.

10. The multi scaffold-cell construct of any one of claims 1 to 9, wherein said polymer comprises alginate.

11. The multi scaffold-cell construct of claim 10, wherein said alginate is present in said first scaffold, said second scaffold, or both, in a concentration of between 1 to 8% by weight of said first scaffold, said second scaffold, or both.

12. The multi scaffold-cell construct of any one of claims 1 to 11, wherein said first scaffold comprises a culture medium suitable for culturing photosynthetic cells.

13. The multi scaffold-cell construct of any one of claims 1 to 12, wherein said second scaffold comprises a culture medium suitable for culturing non- photosynthetic cells.

14. The multi scaffold-cell construct of any one of claims 1 to 13, wherein said first scaffold allows light transmission at a wavelength of between 300 and 800 nm.

15. The multi scaffold-cell construct of any one of claims 1 to 14, wherein said first scaffold and said second scaffold are interwoven.

16. The multi scaffold-cell construct of any one of claims 1 to 15, wherein said first scaffold is organized in at least one first layer and said second scaffold is organized in a second layer.

17. The multi scaffold-cell construct of any one of claims 1 to 16, wherein said at least one first layer comprises at least two first layers.

18. The multi scaffold-cell construct of claim 17, wherein said second layer is positioned between said at least two first layers.

19. The multi scaffold-cell construct of any one of claims 16 to 18, wherein said at least one first layer and said second layer are organized as a stack.

20. The multi scaffold-cell construct of any one of claims 16 to 18, wherein said at least one first layer and said second layer are organized as a fiber having a core and a shell surrounding said core, wherein said core comprises said at least one first layer and said shell comprises said second layer, or vice versa.

21. A method for culturing non-photosynthetic cells in, on, or both, a scaffold, the method comprising culturing and subjecting the multi scaffold-cell construct of any one of claims 1 to 20 to an effective amount of light in a wavelength of between 300 to 800 nm.

22. The method of claim 21, wherein intensity of said light is at least 50 pmol / s / m2.

23. The method of claim 21 or 22, wherein said culturing is for a period of between 7 and 30 days.

24. The method of any one of claims 21 to 23, further comprising monitoring the levels of free oxygen in said second scaffold.

25. The method of claim 24, wherein a free oxygen level below a pre-determined threshold is indicative of shortage of free oxygen in said second scaffold, and the method further comprising further subjecting said multi scaffold-cell to said light.

26. The method of claim 24 or 25, wherein a free oxygen level above a pre-determined threshold is indicative of excess of free oxygen in said second scaffold, and the method further comprising halting the subjecting of said multi scaffold-cell to said light.

27. The method of any one of claims 21 to 26, wherein said non -photosynthetic cells comprise muscle cells or a precursor thereof.

28. The method of any one of claims 21 to 27, further comprising a step proceeding said culturing and subjecting, comprising removing or separating said first scaffold from said second scaffold, thereby obtaining an isolated second scaffold comprising cultured and isolated non- photosynthetic cells.

29. Non-photosynthetic cells cultured according to the method of any one of claims 21 to 28.

30. A composition comprising the non-photosynthetic cells of claim 29, and an acceptable carrier.

31. The composition of claim 30, wherein said carrier is a pharmaceutically acceptable carrier or a nutraceutically acceptable carrier.

32. An edible composition comprising the non-photosynthetic cells of claim 29 or the composition of claim 30.

33. A scaffold-cell construct comprising: a. a scaffold comprising non-photosynthetic cells embedded therein, thereon, or both; and b. at least one compound derived from photosynthetic cells.

34. The scaffold-cell construct of claim 33, wherein said at least one compound derived from photosynthetic cells is selected from the group consisting of: a fatty acid, a lipid, a polynucleotide, a saccharide, a pigment / carotenoid, or any combination thereof.

35. The scaffold-cell construct of claim 34, wherein said polynucleotide comprises DNA of said photosynthetic cells.

36. The scaffold-cell construct of claim 35, wherein said DNA comprises chloroplast derived DNA of said photosynthetic cells.

Images