Height-controlled gramineous plant, and method for producing same

Abstract

Provided is a method for producing a height-controlled gramineous plant, said method including a step for introducing a mutation into a highly conserved non-coding sequence located upstream of the SD1 gene.

Description

Height-controlled grass plants and method for producing same

[0001] The present invention relates to a grass family plant having a controlled plant height and a method for producing the same. More specifically, the present invention relates to a grass family plant having a controlled plant height, characterized by introducing a mutation into a conserved non-coding sequence located upstream of the SEMIDWARF1 (SD1) gene, and a method for producing the same.

[0002] Plant height is a very important agricultural trait that is directly linked to yield. SD1 is a key gene involved in plant height in rice. The translation product of the SD1 gene is involved in the synthesis of the plant hormone gibberellin and is also called gibberellin 20 oxidase 2 (OsGA20ox2) (Non-Patent Document 1). Furthermore, the SD1 gene is also known as a "green revolution gene," and loss-of-function mutations result in short culms (dwarfism) and semi-dwarf plants with short plant height. Therefore, even with heavy fertilization, the plant does not fall over, resulting in increased yields.

[0003] Semi-dwarf rice varieties such as Teigeowujian have naturally occurring loss-of-function mutations in the SD1 gene, which are widely used in crossbreeding. Furthermore, loss-of-function mutations in the coding region of the SD1 gene have also been reported, with two amino acid substitutions causing reduced enzyme activity and being utilized in the domestication of Japonica rice (Non-Patent Document 2). Furthermore, base substitution mutations causing single amino acid substitutions have been reported in semi-dwarf varieties such as Jikkoku, Reimei, and Callulose 76. However, among these, the mutations in Reimei and Callulose 76 are presumed to be loss-of-function mutations rather than loss-of-function mutations (Non-Patent Documents 1, 3, and 4).

[0004] In recent years, many genome editing attempts have been made to "deficiency" the SD1 gene, and it has been reported that in various rice varieties, mutations introduced by genome editing into the coding region of the SD1 gene cause a semi-dwarf phenotype. More specifically, semi-dwarfism has been reported not only in cultivated rice such as Japonica rice (Non-Patent Document 5, Non-Patent Document 6, Non-Patent Document 7) and Indica rice (Non-Patent Document 8, Non-Patent Document 9), but also in the allotetraploid wild rice Oryza alta due to functional deficiency caused by genome editing of the SD1 gene coding region (Non-Patent Document 10).

[0005] However, on the other hand, if plant height is too low, yield will decrease, so the reduced plant height caused by SD1 deficiency may not maximize the potential for increased crop yield depending on the variety. It has also been reported that loss-of-function mutations in the SD1 gene increase the protein content of brown rice and reduce its flavor, while loss-of-function mutations such as Reimei do not increase the protein content (Non-Patent Document 11). For these reasons, genome editing is needed to moderately reduce SD1 function rather than completely eliminate it.

[0006] In this regard, only one case has been reported in which a mutation causing "functional impairment" of SD1 by genome editing was introduced (Non-Patent Document 12). This report showed that a large deletion (1.4 kb) or two small deletions in the upstream region of the SD1 gene caused a phenotype intermediate between the wild type and the functional impairment type. However, the region essential for causing functional impairment of SD1 has not yet been identified, and a satisfactory method for controlling plant height in rice and other plants has not yet been established.

[0007] Sasaki, A. et al., Nature, 2002, Vol. 416, pp. 701-702; Asano, K. et al., Proc Natl Acad Sci USA, 2011, Vol. 108, pp. 11034-11039; Ashikari, M. et al., Breeding Science, 2002, Vol. 52, pp. 143-150; Spielmeyer, W. et al., Proc Natl Acad Sci USA, 2002, Vol. 99, pp. 9043-9048; Chen, X. et al., Plant Physiol, 2019, Vol. 180, pp. 2091-2105; Biswas, S. et al., Genet Genomics, 2020, Vol. 47, pp. 273-280; Su, S., et al., Plant Biotechnol J, 2021, Vol. 19, pp. 2304-2318; Andrew-Peter-Leon et al., Front Plant Sci, 2021, 12:714066; Nawaz, G., et al., Int J Mol Sci, 2020, 21(17), 6170; Hsiao, Y. Y., et al., BMC Plant Biol, 2021, 21:371. Terao, T. Zhou, J. et al., Mol Genet Genomics, 2015, vol. 290, pp. 939-954; Zhou, J. et al., Nat Plants, 2023, vol. 9, pp. 588-604

[0008] The present invention has been made in consideration of the problems associated with the prior art, and aims to identify a region in the SD1 gene that controls plant height, and to provide a method for producing a grass plant with controlled plant height by targeting that region.

[0009] To achieve the above-mentioned object, the present inventors conducted extensive research and, as a result, focused on "Conserved Noncoding Sequences (CNSs)" (conserved noncoding sequences), which are detected as highly conserved regions in genome comparisons between species, as candidates for regions in the SD1 gene involved in its functional decline. CNSs are sequences conserved among species in noncoding regions, and are known to exist in large numbers in genomes, ranging from several tens to several thousand base pairs in length, but the functions of the majority of them remain unknown.

[0010] The inventors hypothesized that such CNSs are involved in the fine-tuning of gene function and suspected that plant height could be controlled by precisely modifying the sequences. Based on this hypothesis, comparative genome analysis was first performed on a combination of 11 monocotyledonous plant species, 9 grass species, and 5 species that constitute the BEP clade, and an attempt was made to extract the CNSs. As a result, upstream of the SD1 gene, a region consisting of 41 to 54 bases (SD1-CNS, a DNA sequence set forth in any of SEQ ID NOS: 10 to 18) was successfully identified as a CNS whose sequence is conserved between grasses and the BEP clade (conservation score of 0.2 or higher). Furthermore, within the SD1-CNS, a region consisting of 12 to 14 bases (SD1-hCNS, a DNA sequence set forth in any of SEQ ID NOS: 1 to 9) was also successfully identified as a region with a particularly high degree of conservation (conservation score of 0.8 or higher).

[0011] They then performed genome editing targeting multiple locations in the SD1-CNS and introduced various insertions or deletions of various lengths in the region. They found that genome-edited lines lacking part or all of the SD1-hCNS gene exhibited shorter culm lengths compared to non-genome-edited controls, but the degree of shortening was reduced compared to lines lacking the SD1 gene's function. On the other hand, even in genome-edited lines lacking insertions or deletions in the SD1-CNS gene, no significant shortening of culms was observed compared to the control.

[0012] In this way, the present inventors discovered that targeting the particularly highly conserved region SD1-hCNS upstream of the SD1 gene reduces the function of the gene, thereby enabling control of the plant height (culm length, etc.) of grasses, and thus completed the present invention.

[0013] That is, the present invention provides the following aspects.

[0014] [1] A method for producing a grass family plant with controlled plant height, comprising the step of introducing a mutation into a conserved non-coding sequence that is located upstream of the SD1 gene and that contains a DNA sequence that has 90% or more identity to any of the DNA sequences set forth in SEQ ID NOs: 1 to 9.

[0015] [2] The method according to [1], wherein the mutation is one or more deletions, insertions, and / or substitutions of DNA.

[0016] [3] A grass family plant in which plant height is controlled by artificially introducing a mutation into a conserved non-coding sequence that is located upstream of the SD1 gene and includes a DNA sequence that has 90% or more identity to any of the DNA sequences set forth in SEQ ID NOs: 1 to 9.

[0017] [4] The grass family plant according to [3], wherein the mutation introduced is one or more deletions, insertions, and / or substitutions of DNA.

[0018] According to the present invention, it is possible to provide a grass plant having a controlled plant height and a method for producing the same.

[0019] This figure shows an overview of the SD1 gene and the conserved non-coding sequence (SD1-CNS) detected upstream of it. This figure shows the alignment (first half) of SD1-CNS and its surrounding sequences, which are conserved among nine species of the Poaceae family. In the figure, the wavy line frame indicates a CNS region (SD1-CNS) with a conservation score of 0.2 or higher. The solid line frame indicates a highly conserved CNS region (SD1-hCNS) with a conservation score of 0.8 or higher. "mRNA" in the figure indicates the transcription start site. Also shown in the figure are the first half of the DNA sequences derived from Oryza sativa (rice), Leersia perrier (swallowweed), Aegilops tauschii (wheatgrass), Hordeum vulgare (barley), Brachypodium distachyon (wheatgrass), Sorghum bicolor (sorghum), Zea mays (corn), Setaria italica (foxtail millet), and Panicum hallii (millet), respectively. This figure shows the second half of the alignment of SD1-CNS and its surrounding sequences, which are conserved among nine species of the Poaceae family. The notations in the figure are the same as in Figure 2A. "CDS" in the figure indicates the translation initiation site. The DNA sequences derived from each grass plant shown in the figure are the latter half of those set forth in SEQ ID NOS: 19 to 27. This figure shows an outline of the vector used for genome editing. This figure shows the PAM recognition sequence of Cas9 in the guide RNA designed in SD1-CNS and the insertion and deletion sites introduced by genome editing in "Nipponbare." In the figure, the wavy and solid framed regions represent SD1-CNS and SD1-hCNS, respectively. In the figure, the top sequence (sequence set forth in SEQ ID NOS: 28) shows the sequence adjacent to SD1-CNS and the PAM recognition sequence of Cas9 in the guide RNA (arrows). The other seven sequences (sequences set forth in SEQ ID NOS: 29 to 35) show the insertion and deletion sites in SD1-CNS confirmed in each genome-edited cell. "+" indicates insertion, and "Δ" indicates deletion. This figure shows an overview of the genome-edited sites in SD1-CNS and its surrounding regions and their respective phenotypes for genome-edited cells of "Nipponbare." In the figure, the insertion and deletion regions due to genome editing are shown as triangles and squares, respectively, and the lines with low (white) to high (black) degree of culm shortening are color-coded.The numbers indicate the average culm length. The average culm length of the control line transformed with only the vector was 76.4. The wavy and solid line frames indicate SD1-CNS and SD1-hCNS, respectively. The DNA sequence in the figure is that of SEQ ID NO: 19. This is a graph showing the culm length of the "Nipponbare" SD1-CNS genome-edited plant. "Control" indicates the culm length of rice transformed with only the vector, and "Function-deficient" indicates the culm length of a genome-edited plant in which a single-base insertion mutation occurred in the second exon. This is a photograph showing the phenotype of the "Nipponbare" SD1-CNS genome-edited plant Δ40 at maturity. "Control" indicates the phenotype of rice transformed with only the vector, and "Function-deficient line" indicates the phenotype of a genome-edited plant in which a single-base insertion mutation occurred in the second exon. This figure shows the PAM recognition sequence of Cas9 in the guide RNA designed in SD1-CNS and the deletion site introduced by genome editing in "NIL-1+12". In the figure, the wavy line frame and the solid line frame represent SD1-CNS and SD1-hCNS, respectively. In the figure, the top sequence (sequence described in SEQ ID NO: 28) shows the SD1-CNS neighboring sequence and the PAM recognition sequence of Cas9 in the guide RNA (arrow). The other three sequences (sequences described in SEQ ID NOs: 48 to 50) show the deletion site in SD1-CNS confirmed in each genome-edited organism. Δ indicates deletion. This is a graph showing the culm length of the "NIL-1+12" SD1-CNS genome-edited organism. "Control" shows the culm length of rice transformed with only the vector, and "functionally deficient" shows the culm length of a genome-edited organism in which a single-base insertion mutation occurred in the second exon.

[0020] <Method for producing grasses with controlled plant height> As shown in the Examples below, it has been demonstrated that the plant height of grasses can be controlled by introducing a mutation into an extremely highly conserved non-coding sequence located upstream of the SD1 gene. Therefore, the present invention relates to a method for producing grasses with controlled plant height, which includes the step of introducing a mutation into the highly conserved non-coding sequence located upstream of the SD1 gene.

[0021] In the present invention, the "grass family" that is the target of plant height control is not particularly limited as long as it is a plant that belongs to the family, and examples thereof include plants that belong to the BEP clade (subfamily Bambusoideae, subfamily Ehrhartoideae, also known as subfamily Oryzoideae, subfamily Pooideae) or the PACCAD clade (subfamily Aristidoideae, subfamily Arundinoideae, subfamily Centothecoideae, subfamily Chloridoideae, subfamily Danthonioideae, subfamily Panicoidea). More specifically, examples of plants belonging to the BEP clade include rice, field grass, Aegilops sieboldii, barley, wheatgrass, wheat, oats, and rye, while examples of plants belonging to the PACCAD clade include millet, foxtail millet, corn, and sorghum. Furthermore, preferred examples of grass plants that are the subject of plant height control in the present invention include rice, barley, wheat, and corn.

[0022] The grasses of the present invention may be wild species or cultivated species. Furthermore, they may be genetically modified or genome-edited versions of these plants (e.g., disease-resistant crops, herbicide-resistant crops, pest-resistant crops, crops with improved taste, crops with improved shelf life, or crops with improved yield). Thus, the grasses to be subjected to height control in the present invention are not particularly limited. However, from the viewpoint of maintaining yield per unit area even when plant height is reduced, grasses having at least one of the following characteristics are preferred: (1) high nutrient absorption and utilization efficiency, (2) a high number of fruits per individual, and (3) high photosynthetic ability.

[0023] In the present invention, the "plant height" to be controlled refers to the length from the base (ground level) to the tip of the branch or leaf when the grass is grown upright. It also includes the stem length and culm length that are reflected in this length. "Stalk length" refers to the length from the base to the tip of the main stem when the grass is grown upright. "Culm length" refers to the stem length of rice and the like, and refers to the length from the base to the panicle node on the main stem when the grass is grown upright. "Control of plant height" includes, for example, reducing the plant height compared to the grass before the introduction of the mutation described below. A more specific example is reducing the plant height by 20 to 30%. There are no particular limitations on the timing of measuring the plant height, but it is preferably measured when the plant has grown to a state where it has emerged, flowered, and has matured seeds.

[0024] The "SD1 gene" to be mutagenized in the present invention is also known as the SEMIDWARF1 gene or OsGA20ox2 gene (gibberellin 20 oxidase 2 [Oryza sativa] gene). In rice, for example, this gene is located on chromosome 1 and typically encodes a protein identified by UniProtKB: Q0JH50 or RefSeq: XP_015627721. Genetic information and the like for SD1 genes derived from other grasses can also be obtained based on information registered in such databases (uniprot.org, NCBI, etc.). Mutations in DNA sequences can also occur in nature, and the amino acids encoded thereby can change. Therefore, the SD1 gene is not limited to genes encoding proteins consisting of the typical amino acid sequences described above, but also includes mutants thereof. Furthermore, the same protein derived from plants belonging to the same family has a high amino acid sequence identity. Thus, the SD1 gene of the present invention includes, for example, a gene encoding a protein having a high identity to the amino acid sequence identified by RefSeq: XP_015627721. Here, "high identity" means a sequence identity of at least 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and more preferably 90% or more (e.g., 95%, 96%, 97%, 98%, or 99%).

[0025] The identity of amino acid sequences or DNA sequences can be determined using the BLAST program (Altschul et al. J. Mol. Biol., 215: 403-410, 1990). This program is based on the BLAST algorithm by Karlin and Altschul (Proc. Natl. Acad. Sci. USA, 87: 2264-2268, 1990, Proc. Natl. Acad. Sci. USA, 90: 5873-5877, 1993). For example, when analyzing a DNA sequence using BLAST, the parameters are set to, for example, score = 100 and wordlength = 12. For example, when analyzing an amino acid sequence using BLAST, the parameters are set to, for example, score = 50 and wordlength = 3. Furthermore, when analyzing amino acid sequences using the Gapped BLAST program, the method can be performed as described by Altschul et al. (Nucleic Acids Res. 25: 3389-3402, 1997). When using the BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific techniques for these analysis methods are known.

[0026] In the present invention, the mutations described below are introduced into a highly conserved non-coding sequence located upstream of the SD1 gene. "Upstream" means upstream from the transcription direction of the region encoding the SD1 protein. The location of the highly conserved non-coding sequence may be any region from the start codon of the SD1 gene of a grass plant to the transcription termination point of the adjacent gene located upstream, and may be, for example, within 80 to 200 bases upstream of the start codon, more preferably within 90 to 180 bases upstream, and even more preferably within 100 to 170 bases upstream.

[0027] "Highly conserved non-coding sequence" refers to a sequence that is detected as a highly conserved region in genome comparisons between grasses and does not encode a protein, and is also referred to as a high conserved non-coding sequence (hCNS). Here, "highly conserved" means that the degree of conservation determined using, for example, phastCons software is at least 0.8, as shown in the Examples below. Furthermore, the hCNS of the present invention may be a single region consisting of multiple consecutive bases, or may be multiple, non-adjacent, discontinuous regions consisting of multiple consecutive bases.

[0028] More specifically, as shown in the Examples below, the hCNS of the present invention has a degree of conservation of 0.8 or more (e.g., 0.8, 0.9, 1.0) and includes a sequence containing a highly conserved DNA sequence (SD1-hCNS). Typical sequences of the hCNS of the present invention are the DNA sequences set forth in SEQ ID NOS: 1 to 9 shown in Table 1 below. Examples of DNA sequences contained in the SD1-hCNS of the present invention include DNA sequences having 90% or more identity (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, or 100% identity) to the DNA sequence set forth in any of SEQ ID NOS: 1 to 9. The base length of the SD1-hCNS of the present invention is not particularly limited as long as it contains the DNA sequence, but is, for example, 10 to 20 bases, preferably 11 to 16 bases, and more preferably 12 to 14 bases.

[0029]

[0030] In the present invention, examples of mutations introduced into the above-mentioned hCNS include deletion, insertion, and / or substitution of one or more DNA fragments, preferably deletion of one or more DNA fragments. Here, the term "multiple" is not particularly limited as long as it can control plant height, and examples include 1 to 20 bases, 1 to 16 bases, 1 to 14 bases, 2 to 14 bases, 3 to 14 bases, 4 to 14 bases, 1 to 13 bases, 2 to 13 bases, 3 to 13 bases, 4 to 13 bases, 1 to 12 bases, 2 to 12 bases, 3 to 12 bases, 4 to 12 bases, 1 to 11 bases, 2 to 11 bases, 3 to 11 bases, 4 to 11 bases, 1 to 10 bases, 2 to 10 bases, 3 to 10 bases, 4 to 10 bases, 1 to 3 bases, and 1 or 2 bases. Furthermore, the number of mutations introduced into the hCNS of the present invention is not particularly limited as long as it reduces the function of the gene, and may be one or multiple (e.g., 2, 3 or less, 5 or less, 10 or less, 20 or less).

[0031] Introduction of mutations into the hCNS of the present invention can be achieved by those skilled in the art using known mutagenesis methods, including, but not limited to, genome editing, physical mutagenesis, methods using chemical mutagens, and methods of introducing transposons or the like into genomic DNA.

[0032] "Genome editing" is a method of modifying a target gene using a site-specific nuclease (e.g., a DNA double-strand cleavage enzyme such as zinc finger nuclease (ZFN), transcription activation-like effector nuclease (TALEN), or CRISPR-Cas enzyme). For example, fusion proteins such as ZFNs (U.S. Patent Nos. 6,265,196, 8,524,500, 7,888,121, and European Patent No. 1,720,995), TALENs (U.S. Patent Nos. 8,470,973 and 8,586,363), and nuclease domain-fused pentatricopeptiderepeat (PPR) (Nakamura et al., Plant Cell Physiol 53:1171-1179 (2012)), CRISPR-Cas9 (U.S. Patent No. 8,697,359, and International Publication No. 2013 / 176772), CRISPR-Cpf1 (Zetsche B. et al., al., Cell, 163(3):759-71, (2015)) and Target-AID (K. Nishida et al., Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems, Science, DOI: 10.1126 / science.aaf8729, (2016)) or a method using a guide RNA and protein complex, or a protein complex.

[0033] The "Cas enzyme" is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include type I CRISPR enzymes, type II CRISPR enzymes, and type III CRISPR enzymes, with Cas9, which is a type II CRISPR enzyme, being preferred. The "Cas9" is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include Cas9 from Streptococcus pneumoniae, Cas9 from Streptococcus pyogenes, and Cas9 from S. Examples of Cas9 include Streptococcus thermophilus Cas9 and Staphylococcus aureus Cas9, but Streptococcus pyogenes Cas9 (SpCas9) is preferred. Furthermore, it may be a mutant of Cas9 derived from these organisms, or it may be a D10A mutant of Cas9, which is known to function as a nickase (a DNA cleavage enzyme that nicks only one DNA strand), or it may be a Cas9 homolog or ortholog.

[0034] Examples of "physical mutagenesis methods" include heavy ion beam (HIB) irradiation, fast neutron irradiation, gamma ray irradiation, and ultraviolet irradiation (see Hayashi et al., Cyclotrons and Their Applications, 2007, 18th International Conference, pp. 237-239, and Kazama et al., Plant Biotechnology, 2008, Vol. 25, pp. 113-117).

[0035] An example of a "method using a chemical mutagen" is a method of treating seeds, etc. with a chemical mutagen (see, for example, Zwar and Chandler, Planta, 1995, vol. 197, pp. 39-48). Chemical mutagens are not particularly limited, and examples include N-methyl-N-nitrosourea (MNU), ethyl methanesulfonate (EMS), N-ethyl-N-nitrosourea (ENU), sodium azide, sodium bisulfite, hydroxylamine, N-methyl-N'-nitro-N-nitroguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methylhydroxylamine, nitrous acid, formic acid, and nucleotide analogs.

[0036] Examples of "methods for introducing transposons into genomic DNA" include, for example, ＯＳ Examples of such methods include inserting transposons such as 17, T-DNA, etc. into the genomic DNA of plants (see Kumar et al., Trends Plant Sci., 2001, Vol. 6, No. 3, pp. 127-134, and Tamara et al., Trends in Plant Science, 1999, Vol. 4, No. 3, pp. 90-96).

[0037] For grasses into which mutations have been introduced by the above methods, the introduction of a mutation into the hCNS of the present invention can be confirmed by known methods. Such known methods include, for example, DNA sequencing (next-generation sequencing, etc.), PCR, microarray analysis, and Southern blotting. Using these methods, it is possible to determine whether a mutation has been introduced into the hCNS of the present invention by comparing the sequence or length of the hCNS before and after the introduction of the mutation.

[0038] Another method for confirming that a mutation has been introduced into the hCNS of the present invention is TILLING (Targeting Induced Local Lesions IN Genomes) (see Slade et al., Transgenic Res., 2005, Vol. 14, pp. 109-115, and Comai et al., Plant J., 2004, Vol. 37, pp. 778-786). In particular, when a non-selective mutation has been introduced into the genome of a grass family plant using the aforementioned heavy ion beam irradiation or chemical mutagen, the hCNS of the present invention or a portion thereof can be amplified by PCR, and individuals having a mutation in the amplification product can be selected by the TILLING method or the like.

[0039] Furthermore, by crossing a grass plant into which a mutation has been introduced by the above-mentioned method with a wild-type plant and performing backcrossing, it is possible to remove mutations introduced into sequences other than the target hCNS sequence of the present invention.

[0040] A grass plant whose height has been controlled by introducing a mutation into the hCNS of the present invention may be a heterozygote consisting of a wild-type plant and an hCNS mutation of the present invention. In such cases, for example, such heterozygotes are crossed to obtain F1 plants, and homozygotes having the hCNS of the present invention into which the mutation has been introduced are selected from the F1 plants. In this case, the term "grass plant that is a homozygote having the hCNS of the present invention into which the mutation has been introduced" includes not only grass plants having two alleles of the hCNS of the present invention having identical mutations, but also grass plants having a first hCNS of the present invention having a first mutation and a second hCNS of the present invention having a second mutation.

[0041] In the present invention, the introduction of mutations into the hCNS of the present invention can be carried out on the whole plant, seeds, or plant cells of a grass family plant according to the above-mentioned methods. Plant cells include not only cultured cells derived from grass family plants, but also cells within the whole plant. Furthermore, various forms of grass family plants, such as suspension culture cells, protoplasts, leaf segments, callus, immature embryos, and pollen, are also included.

[0042] Furthermore, in the present invention, the above-mentioned DNA encoding the site-specific nuclease, fusion protein, or guide RNA-protein complex, DNA encoding a transposon, etc. may be introduced into a cell of a grass plant in the form of being inserted into a vector.

[0043] The vector into which the DNA for introducing a mutation into the hCNS of the present invention is inserted is not particularly limited as long as it is capable of expressing the inserted gene in the cells of a grass family plant, and may contain a promoter for constitutive or inducible expression of the DNA. Examples of promoters for constitutive expression include the rice ubiquitin promoter, the cauliflower mosaic virus 35S promoter, the rice actin promoter, and the maize ubiquitin promoter. Examples of promoters for inducible expression include promoters known to be expressed in response to external factors such as infection or invasion by filamentous fungi, bacteria, or viruses, low temperature, high temperature, drought, ultraviolet radiation, and spraying with specific compounds. Furthermore, pol III promoters such as the U6 promoter are preferably used as promoters for expressing DNA encoding short RNAs such as guide RNAs as DNA of the present invention.

[0044] As a method for introducing the DNA or a vector into which the DNA has been inserted into the cells of a grass plant, various methods known to those skilled in the art can be used, such as particle bombardment, agrobacterium-mediated method (Agrobacterium method), polyethylene glycol method, and electroporation.

[0045] Mutations can also be introduced into the cells of grasses by introducing the above-mentioned site-specific nucleases, fusion proteins, and transposons as proteins, and the above-mentioned guide RNAs as RNA, even if they do not take the form of DNA.

[0046] Thus, in the present invention, the plant height of a grass family plant can be controlled by using a substance that targets the CNS of the present invention, such as the DNA, a vector into which the DNA has been inserted, the protein, or the RNA. Therefore, the present invention can also provide a drug for controlling the plant height of a grass family plant, comprising as an active ingredient at least one substance that targets the CNS of the present invention, selected from the group consisting of the DNA, a vector into which the DNA has been inserted, the protein, and the RNA.

[0047] Such a pharmaceutical preparation may be in an embodiment in which the two active ingredients are contained in a single composition, or in an embodiment in which the two active ingredients are contained in separate compositions (a so-called kit). In addition to the above substances, the pharmaceutical preparation of the present invention may also contain other ingredients such as a buffer solution, a stabilizer, a preservative, an antiseptic, etc.

[0048] Furthermore, by regenerating grass plants from cells into which a mutation has been introduced into the hCNS of the present invention by the above-mentioned method or the like, grass plants with controlled plant height can be obtained.

[0049] For example, methods for producing transformed rice plants include a method in which a gene is introduced into protoplasts using polyethylene glycol to regenerate the plant (Datta, S.K. In Gene Transfer To Plants (Potrykus I and Spangenberg Eds.) pp. 66-74, 1995), a method in which a gene is introduced into protoplasts using electric pulses to regenerate the plant (Toki et al. Plant Physiol. 100, 1503-1507, 1992), a method in which a gene is directly introduced into cells using a particle gun method to regenerate the plant (Christou et al. Bio / technology, 9: 957-962, 1991), and a method in which a gene is introduced via Agrobacterium to regenerate the plant (Hiei et al. Some techniques have already been established and are widely used in the technical field of the present invention, such as the technique described in "Plant J. 6:271-282, 1994."

[0050] For example, methods for producing transformed wheat plants include those described by Tingay et al. (Tingay S. et al. Plant J. 11:1369-1376, 1997), Murray et al. (Murray F et al. Plant Cell Report 22:397-402, 2004), Travalla et al. (Travalla S et al. Plant Cell Report 23:780-789, 2005), Vasil et al. (Vasil V. et al. Nat Biotechnology 10:667-674, 1992), and Ishida et al. (Ishida Y. et al. Methods in Examples of such methods include those described in J. Molecular Biology 1223: 189-193, 2015.

[0051] Suitable methods for regenerating sorghum plants include, for example, a method of regenerating plants by introducing genes into immature embryos or calluses using the Agrobacterium method or the particle gun method, and a method of pollinating with pollen into which genes have been introduced using ultrasound (J.A. Able et al., In Vitro Cell. Dev. Biol. 37: 341-348, 2001; A.M. Casas et al., Proc. Natl. Acad. Sci. USA 90: 11212-11216, 1993; V. Girijashankar et al., Plant Cell Rep 24: 513-522, 2005; J.M. JEOUNG et al., Hereditas 137:20-28, 2002, V Girijashankar et al. , Plant Cell Rep 24(9):513-522, 2005, Zuo-yu Zhao et al. , Plant Molecular Biology 44:789-798, 2000, S. Gurel et al. , Plant Cell Rep 28(3):429-444, 2009, ZY Zhao, Methods Mol Biol, 343:233-244, 2006, AK Shrawat and H Lorz, Plant Biotechnol J, 4(6): 575-603, 2006, D Syamala and P Devi Indian J Exp Biol, 41(12): 1482-1486, 2003, Z Gao et al. , Plant Biotechnol J, 3(6):591-599, 2005).

[0052] Transformation and regeneration into plants can also be performed using the method described in Tabei et al. (Yutaka Tabei, ed., "Transformation Protocol [Plant Edition]", Kagaku Dojin Co., Ltd., published September 20, 2012).

[0053] (Grassaceae plants with controlled plant height) A height-controlled grass plant can be obtained by artificially introducing a mutation into the hCNS of the present invention using the methods described above, etc. Accordingly, the present invention relates to a grass family plant with controlled plant height, which is obtained by artificially introducing a mutation into a highly conserved non-coding sequence located upstream of the SD1 gene.

[0054] The hCNS of the present invention, the introduction of mutations therein, and the grasses whose height has been controlled by the introduction of the mutations are as described above. Furthermore, once a grass plant with controlled height has been obtained by artificially introducing mutations into the hCNS of the present invention, it is possible to obtain progeny from the plant through sexual or asexual reproduction. Furthermore, it is also possible to obtain propagation materials (e.g., seeds, cuttings, stumps, callus, protoplasts, etc.) from the plant, its progeny, or clones, and mass-produce the plant based on these. Therefore, the present invention includes progeny and clones of grasses whose height has been controlled, as well as their propagation materials. Examples of propagation materials include seeds, stumps, callus, and protoplasts.

[0055] The present invention will be described in more detail below based on examples, but the present invention is not limited to the following examples.

[0056] Example 1 The genome sequences of 11 monocotyledonous plants (Dioscorea japonica, Banana tsargassum, Millet, Foxtail millet, Corn, Sorghum, Barley, Aegilops squarrosa, Brachypodium indicum, Brachypodium serrata, and Rice) were obtained from the Ensembl Plants database (https: / / plants.ensembl.org / index.html). Comparative genome analysis was performed on a combination of these 11 monocotyledonous plants, nine grass species (Pungent millet, Foxtail millet, Corn, Sorghum, Barley, Aegilops squarrosa, Brachypodium serrata, Brachypodium serrata, and Rice), or five species that constitute the BEP clade (Barley, Aegilops squarrosa, Brachypodium serrata, Brachypodium serrata, and Rice).

[0057] Specifically, pairwise alignments were performed using [LASTZ] (https: / / www.bx.psu.edu / miller_lab / ) for the genome sequences of rice and other species obtained from the Ensembl Plants database. Furthermore, [MULTIZ] (https: / / www.bx.psu.edu / miller_lab / ) was used to combine the pairwise aligned sequences and perform multiple alignments. The degree of conservation of the aligned sequences was quantified using [phastCons] (http: / / compgen.cshl.edu / phast / ). The degree of conservation ranges from 0 to 1, with values ​​closer to 1 indicating higher conservation. In this example, regions of 15 bp or more with a conservation degree greater than 0 were treated as conserved regions. Furthermore, among these conserved regions, regions consisting of bases with a particularly high degree of conservation (conservation score of 0.8 or higher) were treated as highly conserved regions. Protein-coding regions were then excluded from the conserved regions using R and the [BioConductor] (https: / / www.bioconductor.org / ) package group, and conserved non-coding sequences (CNSs) were identified.

[0058] As a result, we identified approximately 180,000 CNSs, totaling 38 Mbp, across the entire rice genome. Among the CNSs obtained, we successfully identified a 47-base region (rice SD1-CNS, DNA sequence set forth in SEQ ID NO: 10) upstream of the rice SD1 gene as a CNS whose sequence is conserved among grasses or BEP clades (conservation score of 0.2 or higher) (Figure 1). Furthermore, we also successfully identified a 14-base region (rice SD1-hCNS, DNA sequence set forth in SEQ ID NO: 1) in the rice SD1-CNS as a region with a particularly high degree of conservation (conservation score of 0.8 or higher) (Figures 2A and 2B).

[0059] The DNA sequences of SD1-CNS derived from each grass family plant are as follows: The underlined parts indicate highly conserved CNS regions (SD1-hCNS) with a conservation score of 0.8 or higher. Rice (Oryza sativa) TCCCCCTGTTACAAATACCCCACCCTCCCTGCCCAGACAGCTCGCCCTG (DNA sequence set forth in SEQ ID NO: 10) Swallowtail (Leersia perrieri) TCTCCTGTTACAAATACCCCACCCGCGCCCCTGCCCCGCCCAGACACACTCCCTCG (DNA sequence set forth in SEQ ID NO: 11) Wheatgrass (Aegilops tauschii) CCCCCGATTACAAATACCCCACCATGCCAGACAGCTCTCCCCG (DNA sequence set forth in SEQ ID NO: 12) Barley (Hordeum vulgare) CCCCGATTACAAATACCCCACCATCCCGGACAGCTCTCCCCG (DNA sequence set forth in SEQ ID NO: 13) Brachypodium distachyon CCCCCCATTACAAATACCCCACCAGCCAAGACAGCTCTCCCTG (DNA sequence set forth in SEQ ID NO: 14) Sorghum (Sorghm bicolor) TCCCCCTGTTACAAATACCCCCACCCGCCCCAGACAGCTTCCCTG (DNA sequence set forth in SEQ ID NO: 15) Maize (Zea mays) TCCCCTGTTACAAATACCCCCACCCGCCCCGGACAGCTTCCCTG (DNA sequence set forth in SEQ ID NO: 16) Foxtail millet (Setaria italica) TCCCCCTGCTACAAATACCCCCACCGGCCCGGACAGGTCTCCTG (DNA sequence set forth in SEQ ID NO: 17) Proso millet (Panicum hallii) TCCCCTGCTACAAATACCCCCACCGGCCCGGACTGGCCCCCCCG (DNA sequence set forth in SEQ ID NO: 18).

[0060] (Example 2) Genome editing was performed in rice, targeting SD1-CNS, using a genome editing vector containing a guide RNA expression cassette, a Cas9 expression cassette, and an expression cassette for a drug resistance gene.

[0061] Guide RNAs were designed to target genome editing in SD1-CNS and its surrounding sequences. The sequences of the guide RNAs used for SD1-CNS genome editing are as follows: HY1: TGTGTGCAGGGCGAGCTGTC (SEQ ID NO: 36) EBS: AGGGTGGGGGTATTTGTAACA (SEQ ID NO: 37) del1F: CCCCTGTGGTGGGCCCCCCCA (SEQ ID NO: 38) del1R: GCTGTCTGGGCAGGAGGGTG (SEQ ID NO: 39).

[0062] To prepare a functionally defective SD1 mutant as a positive control, the following guide RNAs were designed to target the first and second exons of the SD1 gene: KOF: GGACATGCCCGTGGTCGACG (SEQ ID NO: 40) KOR: ATCCTCCTCCAGGACGACGT (SEQ ID NO: 41).

[0063] Vectors for expressing each guide RNA and SpCas9 (genome editing expression vectors) were prepared according to standard methods. This vector is based on the pZNH2GTR-U6 vector (Figure 3), and DNA encoding the guide RNA is inserted between the OsU6-2 promoter and the Scaffold sequence as a guide RNA expression cassette. Furthermore, DNA encoding SpCas9 is inserted between the rice Ubi1b promoter and the rice Ubi1b terminator sequence. This genome editing expression vector also contains the sequence of a cassette for expression of a hygromycin resistance gene for the selection of transformants.

[0064] The vector thus prepared was introduced into callus derived from rice seeds of the rice cultivar Nipponbare by Agrobacterium-mediated transformation (see Y. Hiei et al., Plant J. 1994, Aug;6(2):271-82). Transformed callus was then selected by culturing in a medium containing hygromycin. The transformed rice plants selected and redifferentiated with hygromycin were transplanted into culture soil (Bonsol No. 1), and DNA was extracted from newly elongated leaves and subjected to PCR to confirm the presence or absence of genome editing. The primer sequences used are as follows:

[0065] <SD1-CNS genome editing> SD1_CNS1_seqF3 5'-TAAACTTGGTCTAAAAGGAATGGACA-3' (SEQ ID NO: 42) Ox2-CNS1-seqR 5'-TGGAGATGAGAAGTGAGCGC-3' (SEQ ID NO: 43) <Detection of SD1 loss-of-function mutations> SD1_KO_seqF1 5'-ACTTCTCATCTCCAATCTCATGGT-3' (SEQ ID NO: 44) SD1_KO_seqR1 5'-CGAGGGTGCTGGAGAAGTAGTC-3' (SEQ ID NO: 45) SD1_KO_seqF2 5'-GTACCAGAAGTACTGCGAGGAGAT-3' (SEQ ID NO: 46) SD1_KO_seqR2 5'-GATCTTATTTTTCTCGTCAATTTCG-3' (SEQ ID NO: 47).

[0066] Seeds were obtained from individuals in the T0 generation in which genome editing was confirmed, and homozygous genome-edited individuals were selected by PCR from the T1 generation onwards and established as lines. The phenotypes of the established homozygous genome-edited individuals were compared with a line transformed with only an empty vector (vector control) as a comparison (negative control). For phenotypic analysis, each individual was grown in an isolated greenhouse in a 9 cm pot filled with culture soil (Bonsol No. 1). After the individual had emerged, flowered, and grown to a state where the seeds were fully mature, the length from the head node to the base of the main stem was measured as the culm length.

[0067] As described above, genome-edited constructs were first prepared using a vector carrying a guide RNA expression cassette targeting SD1-CNS. The genome-edited sites of these genome-edited constructs were then investigated by sequencing. As shown in Figure 4, genome-edited constructs prepared using a vector carrying an EBS guide RNA expression cassette yielded strains with 7- and 10-base deletions (Δ7, Δ10). Similarly, four strains were obtained using a vector carrying an HY1 guide RNA expression cassette (+A, Δ6, Δ18, Δ75). Furthermore, genome-edited constructs were prepared using a vector carrying two types of guide RNA expression cassettes (del1F, del1R), resulting in a strain with a 40-base deletion (Δ40). Of the genome-edited constructs obtained, Δ7, Δ10, Δ75, and Δ40 showed deletion of part or all of the SD1-hCNS sequence. Regarding the SD1 loss-of-function constructs used as a positive control, a strain with a single-base insertion (+T) that causes a frameshift within the second exon was obtained.

[0068] In addition to the resulting SD1-CNS genome-edited lines, vector controls and SD1 function-deficient individuals were simultaneously grown, and the culm length of mature individuals was measured and compared (Figures 5, 6, 7). As a result, in the Δ18, +A, and Δ6 lines without mutations in SD1-hCNS, almost no difference in culm length was observed compared to the vector control. On the other hand, for the Δ40 (13-base deletion), Δ7 (4-base deletion), Δ10 (10-base deletion), and Δ75 (14-base deletion) lines in which part or all of the SD1-hCNS sequence was deleted, the culm length was approximately 20 to 30% shorter than the vector control (the number of deleted bases in parentheses attached to each SD1-CNS genome-edited line indicates that of SD1-hCNS). Furthermore, in the SD1 function-deficient individuals, the culm length was approximately 40 to 50% shorter than the vector control.

[0069] (Example 3) Genome editing targeting SD1-CNS was performed in the same manner as in Example 2 above, except that "NIL-1+12" was targeted instead of "Nipponbare." Note that "NIL-1+12" is a near-isogenic line in which parts of chromosomes 1 and 12 were replaced with chromosomes from the floating rice variety "C9285" in the rice variety "Taichung 65" background, and is known to be endowed with internode elongation and a high plant height (see T. Kuroha et al., Science, July 13, 2018; 361(6398):181-186; Y. Hattori et al., Nature, August 20, 2009; 460(7258):1026-30; WO 2010 / 093015). "Taichung No. 65" (a Japanese rice variety, T65) is a rice variety that has been popular in Taiwan due to its high yield and disease resistance (this corresponds to the above (2) Gramineae plants that have the property of bearing a large number of fruits per individual).

[0070] Specifically, as described above, genome-edited clones of "NIL-1+12" were first prepared using a vector carrying a guide RNA expression cassette targeting SD1-CNS. The genome-edited sites of these clones were then investigated by sequencing. As a result, as shown in Figure 8, three genome-edited clones (Δ18, Δ32, and Δ5) were obtained in which part or all of the SD1-hCNS sequence was deleted.

[0071] In addition to the resulting SD1-CNS genome-edited lines, we also simultaneously cultivated vector control and SD1 knockout plants, and measured and compared the culm lengths of mature plants (Figure 9). As a result, these genome-edited lines showed culm lengths between those of the vector control and the knockout plants.

[0072] Therefore, it was confirmed that, similar to the above-mentioned "Nipponbare," the culm length of "NIL-1+12" can also be moderately reduced by introducing a mutation into SD1-hCNS.

[0073] These results demonstrate that SD1-hCNS is necessary for sufficient expression of the SD1 gene product. In other words, when genome editing causes deletions in SD1-hCNS, the functional expression of the SD1 gene is insufficient, resulting in suppressed culm elongation. Furthermore, because genome-edited SD1-hCNS lines have longer culm lengths than SD1-deficient lines, it is believed that the SD1 gene functions to some extent even when SD1-hCNS is deleted. It was also revealed that by causing a deletion of 4 to 14 bases in the SD1-hCNS base sequence, culm length can be shortened by between 20% and 30%.

[0074] Therefore, by targeting SD1-hCNS for genome editing, etc., it is possible to control rice culm length (for example, shortening the culm length by 20-30% compared to before introducing a mutation into SD1-hCNS). Furthermore, in grasses other than rice in which the SD1-hCNS sequence is conserved, similar genome editing can be used to control plant height.

[0075] As described above, according to the present invention, it is possible to produce a grass plant having a controlled plant height.

[0076] Plant height is a very important agricultural trait that is directly linked to yield. However, if plant height is too short, yield will decrease. Furthermore, loss-of-function mutations in the SD1 gene tend to increase the protein content of brown rice and reduce its palatability. In light of these points, the present invention makes it possible to control the loss of SD1 gene function and plant height in accordance with the type, variety, properties, etc., of the target grass plant.

[0077] Therefore, the present invention is extremely useful in addressing global food issues related to crop yields, as well as in supplying raw materials for biofuels.

Claims

1. A method for producing a grass family plant with controlled plant height, comprising the step of introducing a mutation into a conserved non-coding sequence that is located upstream of the SD1 gene and contains a DNA sequence having 90% or more identity to any of the DNA sequences set forth in SEQ ID NOs: 1 to 9.

2. The method according to claim 1, wherein the introduction of mutations is one or more deletions, insertions and / or substitutions of DNA.

3. A grass family plant in which a mutation has been artificially introduced into a conserved non-coding sequence that is located upstream of the SD1 gene and contains a DNA sequence having 90% or more identity to any of the DNA sequences set forth in SEQ ID NOs: 1 to 9, thereby controlling the plant height.

4. The grass family plant according to claim 3, wherein the mutation is one or more deletions, insertions and / or substitutions of DNA.

Images