Single-domain antibody targeting prame polypeptide and use thereof

Abstract

A single-domain antibody targeting a PRAME polypeptide. The single-domain antibody targeting the PRAME polypeptide can bind to the PRAME polypeptide with high affinity and has relatively good specificity, thereby laying a new material foundation for the development of an anti-tumor drug targeting the PRAME polypeptide. Further disclosed are a bispecific antibody, a chimeric antigen receptor, a chimeric antigen receptor-T cell, an ADC, etc., prepared by means of using the single-domain antibody.

Description

Single domain antibodies targeting PRAME polypeptide and their uses Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a single domain antibody targeting a PRAME polypeptide and uses thereof. Background Art

[0002] PRAME (Referentially expressed Antigen in MElanoma) is an intracellular protein encoded by the PRAME gene. PRAME is expressed at high levels in a variety of tumors, such as melanoma, non-small cell lung cancer, ovarian cancer, and breast cancer, but is rarely expressed in normal human tissues. These characteristics make PRAME an ideal target for tumor-targeted therapy (Am J Surg Pathol. 2018 Nov; 42(11): 1456-1465.). After being processed by the intracellular antigen presentation system, the PRAME protein has a special polypeptide sequence: SLLQHLIGL, which can be presented to the cell surface by the major histocompatibility antigen HLA-A02 molecule. The HLA-A02 complex bound to the PRAME polypeptide can be used as a cell membrane target to develop T cell receptor (TCR) or TCR-like antibody-related therapies.

[0003] Single-domain antibodies (sdAbs) are a special type of antibody with a relatively small molecular weight. They consist of only two identical heavy chains. Compared to the 150-160 kDa molecular weight of traditional double-chain antibodies, single-domain antibodies have a molecular weight of approximately 110 kDa. Single-domain antibodies generally have high specificity, high affinity, low immunogenicity, and good permeability. The antigen-binding region of a single-domain antibody consists of only one chain, and the variable region (VHH) of a single-domain antibody is only 12-15 kDa. Therefore, structural modification of single-domain antibodies is very simple, without the mispairing problems of traditional double-chain antibodies, nor the reduced affinity caused by modification of the antigen-binding region. Based on these advantages, the use of single-domain antibodies as the antigen recognition region of bispecific antibodies or chimeric antigen receptor T cells (CAR-T) is one of the future development trends (Serge Muyldermans. Annu. Rev. Biochem. 82:775-797 (2013)). Single-domain antibodies can recognize cell membrane proteins or peptides derived from intracellular proteins presented on the cell surface by major histocompatibility antigens. Using the HLA-A02 complex bound to the PRAME peptide as an antigen, specific single-domain antibody molecules can be screened. These candidate molecules can be used to develop bispecific antibodies, CAR-T cells, or ADCs (antibody drug conjugates) for biopharmaceuticals.

[0004] Summary of the Invention

[0005] The object of the present invention is to provide a specific single domain antibody targeting the PRAME polypeptide and corresponding specific humanized single domain antibodies, bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells and ADCs targeting the PRAME polypeptide.

[0006] The present invention also aims to provide uses of the single-domain antibodies, humanized single-domain antibodies, bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells and ADCs in treating tumors or preparing drugs for treating tumors.

[0007] In a first aspect, the present invention provides a VHH chain of a single-domain antibody targeting a PRAME polypeptide, wherein the VHH chain comprises CDR1, CDR2 and CDR3 as shown in the following table:

[0008] In a preferred embodiment, the amino acid sequence of the PRAME polypeptide is: SLLQHLIGL (SEQ ID NO: 121).

[0009] In a preferred embodiment, any one of the above amino acid sequences further comprises a derivative sequence that is optionally subjected to addition, deletion, modification and / or substitution of at least one (e.g., 1-3, preferably 1-2, more preferably 1) amino acid and can retain high affinity binding to the PRAME polypeptide.

[0010] In a preferred embodiment, the VHH chain further comprises framework regions FR1, FR2, FR3 and FR4.

[0011] In a preferred embodiment, the amino acid sequence of the VHH chain of the single domain antibody targeting the PRAME polypeptide is shown in the following table:

[0012] In a second aspect, the present invention provides a heavy chain variable region of an antibody targeting a PRAME polypeptide, wherein the heavy chain variable region comprises CDR1, CDR2 and CDR3 as shown in the following table:

[0013] In a preferred embodiment, the amino acid sequence of the heavy chain variable region of the antibody targeting the PRAME polypeptide is shown in the following table:

[0014] In a third aspect, the present invention provides a single domain antibody targeting a PRAME polypeptide, which has the VHH chain described in the first aspect.

[0015] In a fourth aspect, the present invention provides a humanized VHH chain of a single-domain antibody targeting a PRAME polypeptide, wherein the framework regions FR1, FR2, FR3 and FR4 are humanized based on the VHH chain described in the first aspect.

[0016] In a preferred embodiment, the variable region sequence of the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide is as follows:

[0017] In a fifth aspect, the present invention provides an antibody targeting a PRAME polypeptide, comprising one or more VHH chains of the single-domain antibody targeting a PRAME polypeptide according to the first aspect or the VHH chains of the humanized single-domain antibody targeting a PRAME polypeptide according to claim 4.

[0018] In a preferred embodiment, the antibody targeting the PRAME polypeptide includes a monomer, a bivalent antibody, and / or a multivalent antibody.

[0019] In a sixth aspect, the present invention provides a bispecific antibody, comprising a first antibody and a second antibody, wherein the first antibody comprises the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, or the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, or the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, or the antibody targeting the PRAME polypeptide according to the fifth aspect.

[0020] In a preferred embodiment, the second antibody may bind to the same or a different antigen as the first antibody, or bind to a different epitope on the same antigen as the first antibody.

[0021] In a preferred embodiment, the second antibody is a single domain antibody, a single chain antibody or a double chain antibody.

[0022] In a preferred embodiment, the bispecific antibody comprises 2-4 single-domain antibodies targeting the PRAME polypeptide; preferably, it comprises 2 single-domain antibodies targeting the PRAME polypeptide; more preferably, the 2 single-domain antibodies targeting the PRAME polypeptide form a single-domain antibody dimer targeting the PRAME polypeptide.

[0023] In a preferred embodiment, the sequence of the bispecific antibody is shown in the following table:

[0024] In the seventh aspect, the present invention provides a fusion protein, comprising the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, or the antibody targeting the PRAME polypeptide according to the fifth aspect, an optional linker sequence and an Fc fragment or a half-life extension domain of an immunoglobulin.

[0025] In a preferred embodiment, the immunoglobulin is IgG1, IgG2, IgG3, IgG4; preferably IgG4.

[0026] In an eighth aspect, the present invention provides a chimeric antigen receptor, which is made of the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, or the antibody targeting the PRAME polypeptide according to the fifth aspect.

[0027] In a preferred embodiment, the amino acid sequence of the chimeric antigen receptor is as follows:

[0028] In a ninth aspect, the present invention provides an immune effector cell, wherein the immune effector cell expresses the chimeric antigen receptor according to the eighth aspect.

[0029] In a preferred embodiment, the immune effector cells include but are not limited to: T cells, NK cells, TIL cells; preferably T cells.

[0030] In the tenth aspect, the present invention provides a nucleic acid molecule encoding the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, the antibody targeting the PRAME polypeptide according to the fifth aspect, the bispecific antibody according to the sixth aspect, the fusion protein according to the seventh aspect, or the chimeric antigen receptor according to the eighth aspect.

[0031] In the eleventh aspect, the present invention provides an expression vector comprising the nucleic acid molecule described in the tenth aspect.

[0032] In the twelfth aspect, the present invention provides a host cell, which comprises the expression vector described in the eleventh aspect, or the nucleic acid molecule described in the tenth aspect is integrated into its genome.

[0033] In a thirteenth aspect, the present invention provides a method for preparing the VHH chain of the single-domain antibody targeting the PRAME polypeptide of the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide of the second aspect, the single-domain antibody targeting the PRAME polypeptide of the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide of the fourth aspect, the antibody targeting the PRAME polypeptide of the fifth aspect, the bispecific antibody of the sixth aspect, or the fusion protein of the seventh aspect, the method comprising the following steps:

[0034] 1) culturing the host cell according to the eleventh aspect under suitable conditions to obtain a culture containing the VHH chain of the single domain antibody targeting the PRAME polypeptide, the heavy chain variable region of the antibody targeting the PRAME polypeptide, the single domain antibody targeting the PRAME polypeptide, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide, the antibody targeting the PRAME polypeptide, the bispecific antibody or the fusion protein; and

[0035] 2) Optionally, isolating or recovering the VHH chain of the single domain antibody targeting the PRAME polypeptide, the heavy chain variable region of the antibody targeting the PRAME polypeptide, the single domain antibody targeting the PRAME polypeptide, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide, the single domain antibody targeting the PRAME polypeptide, the bispecific antibody or the fusion protein from the culture.

[0036] In a fourteenth aspect, the present invention provides an immunoconjugate comprising:

[0037] 1) the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, the antibody targeting the PRAME polypeptide according to the fifth aspect, the bispecific antibody according to the sixth aspect, or the fusion protein according to the seventh aspect; and

[0038] 2) A conjugated moiety selected from the group consisting of a detectable label, a drug, a toxin, a cytokine, a radionuclide, or an enzyme.

[0039] In a preferred embodiment, the conjugated moiety is a drug or a toxin.

[0040] In a preferred embodiment, the immunoconjugate is an antibody-drug conjugate (ADC).

[0041] In a preferred embodiment, the conjugated moiety is a detectable label.

[0042] In a preferred embodiment, the conjugate is selected from: fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (such as IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorods, viral particles, liposomes, nanomagnetic particles, prodrug-activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)), chemotherapeutic agents (for example, cisplatin) or any form of nanoparticles, etc.

[0043] In a preferred embodiment, the immunoconjugate contains: a multivalent (e.g., bivalent) VHH chain of a single-domain antibody targeting a PRAME polypeptide as described in the first aspect, the heavy chain variable region of an antibody targeting a PRAME polypeptide as described in the second aspect, the single-domain antibody targeting a PRAME polypeptide as described in the third aspect, the VHH chain of a humanized single-domain antibody targeting a PRAME polypeptide as described in the fourth aspect, the antibody targeting a PRAME polypeptide as described in the fifth aspect, the bispecific antibody as described in the sixth aspect, or the fusion protein as described in the seventh aspect.

[0044] In a preferred embodiment, the multivalency refers to the presence of multiple repeating portions in the amino acid sequence of the immunoconjugate.

[0045] In the fifteenth aspect, the present invention provides a pharmaceutical composition, comprising a therapeutically or diagnostically effective amount of the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, the antibody targeting the PRAME polypeptide according to the fifth aspect, the bispecific antibody according to the sixth aspect, the fusion protein according to the seventh aspect, the chimeric antigen receptor according to the eighth aspect, the immune effector cell according to the ninth aspect, or the immunoconjugate according to the fourteenth aspect, and optionally a pharmaceutically acceptable excipient.

[0046] In a preferred embodiment, the pharmaceutical composition is used to treat tumors, and the tumors are PRAME polypeptide-associated tumors; preferably melanoma, non-small cell lung cancer, ovarian cancer, breast cancer, etc.

[0047] In the sixteenth aspect, the present invention provides uses of the VHH chain of the single-domain antibody targeting the PRAME polypeptide of the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide of the second aspect, the single-domain antibody targeting the PRAME polypeptide of the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide of the fourth aspect, the antibody targeting the PRAME polypeptide of the fifth aspect, the bispecific antibody of the sixth aspect, the fusion protein of the seventh aspect, the chimeric antigen receptor of the eighth aspect, the immune effector cell of the ninth aspect, or the immunoconjugate of the fourteenth aspect, for preparing the following reagents:

[0048] 1) Reagents for detecting PRAME polypeptide;

[0049] 2) agents that block the binding of PRAME polypeptide to PD-L1;

[0050] 3) Drugs for treating tumors.

[0051] In a preferred embodiment, the tumor is a PRAME polypeptide-associated tumor, preferably melanoma, non-small cell lung cancer, ovarian cancer, breast cancer, etc.

[0052] In a seventeenth aspect, the present invention provides a kit comprising:

[0053] 1) the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, the antibody targeting the PRAME polypeptide according to the fifth aspect, the bispecific antibody according to the sixth aspect, the fusion protein according to the seventh aspect, the chimeric antigen receptor according to the eighth aspect, the immune effector cell according to the ninth aspect, the immunoconjugate according to the fourteenth aspect, or the pharmaceutical composition according to the fifteenth aspect;

[0054] 2) container; and

[0055] 3) Optional instruction manual.

[0056] In an eighteenth aspect, the present invention provides a method for detecting PRAME polypeptide protein in a sample, the method comprising the steps of:

[0057] 1) contacting the sample to be tested with the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to the second aspect, the single-domain antibody targeting the PRAME polypeptide according to the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to the fourth aspect, the antibody targeting the PRAME polypeptide according to the fifth aspect, the bispecific antibody according to the sixth aspect, the fusion protein according to the seventh aspect, or the immunoconjugate according to the fourteenth aspect;

[0058] 2) Detecting whether an antigen-antibody complex is formed. If a complex is formed, it indicates that the PRAME polypeptide protein is present in the sample.

[0059] In the nineteenth aspect, the present invention provides a method for treating a disease, comprising administering to a subject in need thereof a therapeutically effective amount of the VHH chain of the single-domain antibody targeting the PRAME polypeptide of the first aspect, the heavy chain variable region of the antibody targeting the PRAME polypeptide of the second aspect, the single-domain antibody targeting the PRAME polypeptide of the third aspect, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide of the fourth aspect, the antibody targeting the PRAME polypeptide of the fifth aspect, the bispecific antibody of the sixth aspect, the fusion protein of the seventh aspect, the chimeric antigen receptor of the eighth aspect, the immune effector cell of the ninth aspect, the immunoconjugate of the fourteenth aspect, or the pharmaceutical composition of the fifteenth aspect.

[0060] In a preferred embodiment, the subject comprises a mammal; preferably a human.

[0061] In a preferred embodiment, the disease is a PRAME polypeptide-related disease; preferably a PRAME polypeptide-related tumor; more preferably melanoma, non-small cell lung cancer, ovarian cancer, breast cancer, etc.

[0062] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 shows that all 14 single-domain antibodies of the present invention are able to bind to protein antigens with high affinity;

[0064] FIG2 shows that all 14 single-domain antibodies of the present invention are able to bind to antigens at the cellular level with high affinity;

[0065] FIG3 shows that the single domain antibody molecules of the present invention have good specificity;

[0066] FIG4 shows that the bispecific antibody molecule of the present invention has good cell killing activity;

[0067] Figure 5 shows that the CAR molecules of the present invention can be efficiently expressed on the surface of T cells;

[0068] Figure 6 shows the killing effect of candidate CAR-T cells on target cells under different effector-target ratios;

[0069] Figure 7 shows that the CAR-T cells of the present invention can effectively recognize T2 loaded with target polypeptides, activate and transmit immune signals, and secrete IFN-γ cytokines;

[0070] Figure 8 shows that the humanized single-domain antibodies obtained after humanization of the LL-PR001 molecule are able to bind to protein antigens with high affinity;

[0071] Figure 9 shows that the humanized single-domain antibodies obtained after humanization of the LL-PR004 molecule are able to bind to protein antigens with high affinity. DETAILED DESCRIPTION

[0072] After extensive and in-depth research, the inventors unexpectedly discovered a class of single-domain antibodies targeting the PRAME polypeptide. These single-domain antibodies bind to the PRAME polypeptide with high affinity and good specificity. The present invention also provides bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells, and ADCs prepared using these single-domain antibodies. This work has led to the present invention.

[0073] Definition of terms

[0074] The terms used herein have the same or similar meanings as those commonly understood by those skilled in the art. For the sake of clarity, some of the terms are defined below.

[0075] Single domain antibodies

[0076] In this article, the terms "single-domain antibody," "single-domain antibody," and "nanoantibody" have the same or similar meanings and refer to a class of antibody molecules that lack the light chain and only have the heavy chain variable region. A single-domain antibody is the smallest antigen-binding unit, that is, the smallest antigen-binding fragment with complete function. Typically, antibodies naturally lacking the light chain and heavy chain constant region 1 (CH1) are first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single-domain antibody (VHH) consisting of only a single heavy chain variable region.

[0077] The single-domain antibody VHH chain targeting the PRAME polypeptide of the present invention further comprises framework regions FR1, FR2, FR3 and FR4.

[0078] Based on the VHH chain of the single-domain antibody targeting the PRAME polypeptide of the present invention, the present inventors also humanized the VHH chain, thereby obtaining a humanized VHH chain of the single-domain antibody targeting the PRAME polypeptide.

[0079] Based on the VHH chain or humanized VHH chain of the single-domain antibody targeting the PRAME polypeptide of the present invention, the present invention also provides an antibody targeting the PRAME polypeptide, which comprises one or more VHH chains of the single-domain antibody targeting the PRAME polypeptide or the humanized VHH chain of the single-domain antibody targeting the PRAME polypeptide. The present invention also provides a bispecific antibody, which comprises a first antibody and a second antibody, wherein the first antibody can be the VHH chain or humanized VHH chain of the single-domain antibody targeting the PRAME polypeptide of the present invention. Those skilled in the art can select the second antibody in the bispecific antibody according to actual needs. For example, the second antibody can bind to the same or different antigen as the first antibody; if the second antibody binds to the same antigen as the first antibody, it preferably binds to a different epitope. In specific embodiments, the second antibody can be a single-domain antibody, a single-chain antibody, or a double-chain antibody.

[0080] Those skilled in the art can also prepare a fusion protein from the single-domain antibody VHH chain or humanized VHH chain targeting the PRAME polypeptide of the present invention, for example, a fusion protein further comprising an Fc fragment or a half-life extension domain of an immunoglobulin. The fusion protein thus obtained not only possesses the biological activity of the single-domain antibody VHH chain itself, but also possesses other properties conferred by the Fc fragment of the immunoglobulin, such as extended plasma half-life, reduced immunogenicity, improved stability, and the like. In a specific embodiment, the fusion protein comprises the VHH chain or humanized VHH chain of the single-domain antibody targeting the PRAME polypeptide of the present invention, an optional linker sequence, and an Fc fragment of an immunoglobulin. In a specific embodiment, the immunoglobulin is IgG1, IgG2, IgG3, IgG4; preferably IgG4. In a specific embodiment, the half-life extension domain is as shown in the following amino acid sequence:

[0081] The present invention includes not only intact antibodies, but also fragments, derivatives and analogs of the antibodies. As used herein, the terms "fragment," "derivative," and "analog" refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present invention. The polypeptide fragments, derivatives, or analogs of the present invention may be (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) polypeptides having a substituent group in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). Based on the teachings herein, these fragments, derivatives, and analogs are within the scope known to those skilled in the art.

[0082] The antibodies of the present invention refer to polypeptides that have PRAME polypeptide protein binding activity and include the above-mentioned CDR regions. The term also includes variant forms of polypeptides that have the same function as the antibodies of the present invention and include the above-mentioned CDR regions. These variant forms include (but are not limited to): deletion, insertion and / or substitution of one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids with similar or similar properties generally does not alter the function of the protein. For another example, addition of one or more amino acids to the C-terminus and / or N-terminus generally does not alter the function of the protein. The term also includes active fragments and active derivatives of the antibodies of the present invention. Variant forms of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibody of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using antiserum against the antibody of the present invention.

[0083] In addition to substantially full-length polypeptides, the present invention also encompasses fragments of the single domain antibodies of the present invention. Typically, such fragments comprise at least about 50 contiguous amino acids of an antibody of the present invention, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids.

[0084] In the present invention, "conservative variants of the antibodies of the present invention" refer to polypeptides in which no more than 10, preferably no more than 8, more preferably no more than 5, and most preferably no more than 3 amino acids are replaced with amino acids having similar or similar properties, compared to the amino acid sequence of the antibodies of the present invention. These conservative variant polypeptides are preferably generated by making amino acid substitutions according to the table below.

[0085] The present invention also provides polynucleotide molecules encoding the above-mentioned antibodies or fragments thereof or fusion proteins thereof. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand. Polynucleotides encoding the mature polypeptides of the present invention include: a coding sequence that encodes only the mature polypeptide; a coding sequence for the mature polypeptide and various additional coding sequences; a coding sequence for the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0086] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide or a polynucleotide further including additional coding and / or non-coding sequences. The present invention also relates to polynucleotides that hybridize with the above-mentioned sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0087] The full-length nucleotide sequence of the antibody of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. A feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is short. Generally, by first synthesizing multiple small fragments and then connecting them, a fragment with a very long sequence can be obtained. In addition, the coding sequence of the heavy chain and the expression tag (such as 6His) can be fused together to form a fusion protein. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombination. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the host cells after proliferation by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in isolated form.

[0088] Currently, DNA sequences encoding proteins of the present invention (or fragments thereof, or derivatives thereof) can be obtained entirely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into protein sequences of the present invention by chemical synthesis.

[0089] The present invention also relates to vectors comprising the aforementioned appropriate DNA sequences and appropriate promoters or control sequences. These vectors can be used to transform appropriate host cells to express the protein. Host cells can be prokaryotes, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells of Drosophila S2 or Sf9; and animal cells such as CHO, COS7, and 293 cells.

[0090] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0091] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0092] The recombinant polypeptide in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0093] The antibodies of the present invention can be used alone or in combination with a detectable marker (for diagnostic purposes), a therapeutic agent, a PK (protein kinase) modifying moiety, or any combination thereof. Detectable markers for diagnostic purposes include, but are not limited to, fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing a detectable product.

[0094] Therapeutic agents that can be combined or coupled with the antibodies of the present invention include but are not limited to: 1. radionuclides; 2. biological toxins; 3. cytokines, such as IL-2, etc.; 4. gold nanoparticles / nanorods; 5. viral particles; 6. liposomes; 7. nanomagnetic particles; 8. drug-activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 9. therapeutic agents (for example, cisplatin) or any form of nanoparticles, etc.

[0095] Bispecific antibodies

[0096] Bispecific antibodies are recombinant antibodies that have been engineered through protein engineering. Bispecific antibodies can simultaneously target two different antibody binding epitopes, which can be from different antigens or from the same antigen. Many current studies have shown that bispecific antibodies have great therapeutic potential in the treatment of diseases such as tumors, autoimmune diseases, and viral infections. Compared with monoclonal antibodies, the main advantage of bispecific antibodies is that they can mediate the spatial effects of two recognition epitopes and the synergistic effect of dual targeting, producing biological effects that cannot be achieved by the combined use of two antibodies. A more special bispecific antibody is called a T cell engager, which can simultaneously bind to targets and T cells on the surface of tumor cells, activate endogenous T cells, and cause tumor cell lysis, thereby achieving the purpose of treating tumors. T cell engagers have been proven to be used to treat tumors. A bispecific T cell engager targeting CD20 and CD19 has been approved by the FDA for marketing (Nat Rev Clin Oncol. 2020 Jul; 17(7): 418-434.). Because of its complexity, which is different from that of monoclonal antibodies, bispecific antibodies have higher technical barriers and R&D costs.

[0097] immune cells

[0098] In this article, immune cell and immune effector cell have the same meaning, and are the same as those conventionally understood by those skilled in the art. It refers to cells participating in or associated with an immune response, including lymphocytes and phagocytes. In a specific embodiment, the immune cell refers to lymphocytes that can recognize antigens, thereby producing a specific immune response. The lymphocytes are mainly T lymphocytes, B lymphocytes, K lymphocytes and NK lymphocytes. In addition to lymphocytes, the cells participating in the immune response also have plasma cells, granulocytes, mast cells, antigen presenting cells and cells of the mononuclear phagocyte system (such as macrophages).

[0099] Chimeric antigen receptor T cells

[0100] Chimeric antigen receptor T cell therapy is a very promising cellular immunotherapy. CAR-T cells express CAR (Chimeric Antigen Receptor) molecules. The structure of CAR is divided into: antigen binding region, hinge region, transmembrane domain and intracellular signal transduction domain. Current CAR-T cells usually use scFv (Single Chain Fragment Variables) segments derived from the single chain modification of the antigen binding region of monoclonal antibodies as antigen binding regions. However, when performing scFv structural modification, problems such as reduced affinity and changed specificity are prone to occur. At the same time, scFv has a relatively large molecular weight and is prone to forming multimers, which affects the function of CAR (Nat Rev Cancer. 2021 Mar; 21 (3): 145-161.). Therefore, CAR containing an antigen binding region with a novel structure. Using single domain antibodies to construct a CAR structure, the variable region of the single domain antibody can be directly connected to the CAR structure, which is simple and convenient to design.

[0101] Immunoconjugates

[0102] ADC is an antibody that carries a cytotoxic drug and can deliver the cytotoxic drug to tumor cells to achieve specific killing of tumor cells. ADC drugs targeting targets such as HER2, CD30, and Trop2 have shown good clinical efficacy and safety in clinical studies (Nat Rev Clin Oncol. 2021 Jun; 18(6): 327-344.). In recent years, a number of ADC drugs have been approved by the FDA for marketing. However, the targets of current ADC drugs are all cell membrane proteins, and ADC drugs targeting intracellular proteins are one of the hot directions for future development.

[0103] ADC drugs can specifically target target cells and deliver cytotoxic molecules into them, resulting in a specific killing effect. Cytotoxic molecule-induced cell killing can disrupt and improve the suppressive tumor microenvironment, potentially enhancing the efficacy of other therapies such as immunotherapy. The single-domain antibodies of the present invention can be internalized into cells, thus promising the future development of ADC drugs based on the single-domain antibodies of the present invention.

[0104] The present invention also provides an immunoconjugate comprising a VHH chain, a humanized VHH chain, etc., of a single-domain antibody targeting a PRAME polypeptide of the present invention, and a coupling moiety. In specific embodiments, the coupling moiety can be a detectable marker, a drug, a toxin, a cytokine, a radionuclide, or an enzyme, thereby achieving diagnostic, detection, or therapeutic purposes.

[0105] In a preferred embodiment, the immunoconjugate is an antibody-drug conjugate (ADC).

[0106] Pharmaceutical composition

[0107] The present invention also provides a composition. Preferably, the composition is a pharmaceutical composition comprising the above-mentioned antibody, active fragment thereof, or fusion protein thereof, and a pharmaceutically acceptable carrier. Typically, these substances can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, although the pH value may vary depending on the properties of the formulated substance and the condition to be treated. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intratumoral, intraperitoneal, intravenous, or topical administration.

[0108] The pharmaceutical compositions of the present invention can directly target the PRAME polypeptide expressed by tumor cells. Therefore, the pharmaceutical compositions of the present invention can be used to treat tumors. In specific embodiments, the tumor is a PRAME polypeptide-associated tumor. In preferred embodiments, the tumor is melanoma, non-small cell lung cancer, ovarian cancer, or breast cancer. Furthermore, the pharmaceutical compositions of the present invention can be used in combination with other therapeutic agents.

[0109] The pharmaceutical composition of the present invention contains a safe and effective amount (e.g., 0.001-99 wt%, preferably 0.01-90 wt%, more preferably 0.1-80 wt%) of the above-mentioned single domain antibody of the present invention (or its conjugate) and a pharmaceutically acceptable carrier or excipient. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should be compatible with the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, using physiological saline or an aqueous solution containing glucose and other adjuvants by conventional methods. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions.

[0110] The active ingredient is administered in a therapeutically effective amount, for example, from about 10 μg / kg body weight to about 50 mg / kg body weight per day. When using the pharmaceutical composition, a safe and effective amount of the immunoconjugate is administered to a mammal, wherein the safe and effective amount is generally at least about 10 μg / kg body weight and, in most cases, does not exceed about 50 mg / kg body weight. Preferably, the dose is from about 10 μg / kg body weight to about 10 mg / kg body weight. Of course, the specific dosage will also take into account factors such as the route of administration and the patient's health status, all of which are within the skill of a skilled physician.

[0111] Reagent test kit

[0112] The present invention also provides a kit containing the VHH chain of the single-domain antibody targeting the PRAME polypeptide of the present invention, or a humanized VHH chain, antibody, fusion protein or immunoconjugate, etc. In a specific embodiment, the kit further includes a container, instructions for use, a buffer, etc.

[0113] Advantages of the present invention:

[0114] 1. The single domain antibody targeting the PRAME polypeptide of the present invention binds to the PRAME polypeptide with high affinity;

[0115] 2. The single-domain antibody targeting the PRAME polypeptide of the present invention has good specificity;

[0116] 3. The single-domain antibodies targeting the PRAME polypeptide of the present invention can be further used to prepare bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells, and ADCs, thereby laying a new material foundation for the development of therapeutic or diagnostic drugs targeting the PRAME polypeptide.

[0117] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0118] Example 1: Acquisition of single domain antibody sequences

[0119] Two healthy adult alpacas (Alpaca) were selected as experimental animals for immunization. Recombinantly expressed pMHC (peptide-Major histocompatibility complex) recombinant protein carrying the target polypeptide was used as an antigen to immunize the alpacas. A total of 4-5 immunizations were performed. Peripheral blood was collected from the alpacas at different time points to detect the immune titer. After the immunization, peripheral blood was collected from the alpacas, and the mRNA of the peripheral blood PBMCs cells was extracted and reverse transcribed to obtain cDNA. Specific primers were used to amplify the cDNA to obtain a PCR product containing a single-domain antibody gene fragment. The PCR product and the yeast library vector were then introduced into yeast competent cells using an electroporation method to prepare a yeast library. The yeast library was screened using recombinantly expressed protein antigens or T2 cells loaded with target polypeptides. The present invention uses a pMHC recombinant protein carrying the target polypeptide as a positive antigen and a pMHC recombinant protein carrying a negative polypeptide as a negative antigen. After three rounds of positive screening and three rounds of negative screening, a single-domain antibody clone that specifically binds to the positive antigen but not to the negative antigen was obtained.

[0120] Sanger sequencing was performed on the single-domain antibody clones to obtain the full-length sequences of the single-domain antibodies of the present invention that specifically bind to the target protein. A total of 14 different single-domain antibody clones were obtained, designated LL-PR001-LL-PR014. The full-length amino acid sequences and CDR region amino acid sequences of the single-domain antibodies are shown in Table 1.

[0121] Table 1. Amino acid sequence list of candidate single domain antibodies

[0122] Example 2: Expression and purification of single domain antibodies

[0123] The present invention uses conventional monoclonal antibody expression and purification methods to express and purify the single domain antibodies of the present invention. First, a single domain antibody expression vector is constructed using conventional molecular cloning technology. After the vector is successfully constructed, the above-mentioned single domain antibody is expressed using the transient transfection method of the HEK293 suspension cell line. Basic steps: The single domain antibody gene is cloned into the expression vector pCDNA4 (Invitrogen, Cat V86220). Different single domain antibodies are expressed using the transient transfection method of HEK293 suspension cells. After expression is completed, the supernatant is collected and the single domain antibody of the present invention is purified using a conventional monoclonal antibody purification method to finally obtain a purified single domain antibody.

[0124] After purification of the single-domain antibodies, the protein concentration and total protein content of the different antibodies were determined using UV spectrophotometry. The expression level of each bispecific antibody was then calculated based on the expression volume. The sample solution absorbance (A280) was measured at 280 nm using a NanoDrop 1000. The protein concentration was calculated using the formula C (mg / mL) = A280 / ε (ε = 1.482 mL / mg·cm-1). The purity of the different antibodies was also assessed using conventional gel electrophoresis (SDS-PAGE). The basic steps were as follows: the samples were separated by electrophoresis using an Invitrogen electrophoresis tank and an SDS-PAGE gradient gel. The sample was diluted to approximately 1 mg / mL, and appropriate amounts of reducing agent, loading buffer, and purified water were added. After mixing, the sample was heated at 70°C for approximately 10 minutes. A sample load of 2 to 10 μg was applied, and the electrophoresis voltage was approximately 200 V for approximately 35 minutes. The gel was then stained and destained. After destaining, the gel was photographed using a conventional gel imaging system, and the purity of the main band was analyzed and calculated. In addition, the purity of different antibodies was evaluated using size-exclusion high-performance liquid chromatography (SEC-HPLC). The basic steps are as follows: the sample was diluted to approximately 1.0 mg / mL, and a TSKgel G3000SWXL column was used. The column temperature was set at 25°C, and the mobile phase was 100 mM phosphate buffer, 100 mM sodium sulfate, pH 7.0 ± 0.2. The injection volume was 20-50 μL. The flow rate was 1.0 mL / min, and the elution was isocratic for 20 minutes. The detection was performed at a wavelength of 280 nm, and the monomer content was determined by peak area normalization.

[0125] The expression levels and purity information for different single-domain antibodies are shown in Table 2. The expression levels of the single-domain antibodies of the present invention using a transient expression system ranged from 650-850 mg / L, demonstrating that the bispecific antibody structure of the present invention has high expression levels. The purity of most single-domain antibodies of the present invention by reducing SDS-PAGE and SEC-HPLC was above 95%. These results demonstrate that the single-domain structures of the present invention have good expression levels and high purity.

[0126] Table 2. Expression and purity test results of single domain antibodies

[0127] Example 3: Detection of the binding ability of single domain antibodies to targets

[0128] To investigate the antigen-binding ability of the candidate single-domain antibodies of the present invention, this example employed ELISA and flow cytometry to perform assays at both the protein and cell levels, thereby comprehensively comparing the affinity of the candidate molecules for the target antigen. The specific steps are as follows:

[0129] 3.1 Protein level binding capacity detection

[0130] 1) Dilute SA protein to 0.3 μg / mL with PBS and add 100 μL / well to a 96-well transparent ELISA plate. Seal the plate with sealing film and incubate at 37°C for 1 hour.

[0131] 2) Discard the protein and wash the plate three times with 200 μL PBST solution (PBS containing 0.05% Tween 20);

[0132] 3) Add 100 μL / well of blocking solution (PBS solution containing 2% BSA), seal the plate with sealing film, and incubate at 37°C for 1 hour;

[0133] 4) Repeat the plate washing step 2);

[0134] 5) Dilute the biotinylated MHC-PRAME peptide complex to 2 μg / ml with blocking buffer, add 100 μL of diluent to each well, seal the plate with sealing film, and incubate at 37°C for 1 hour;

[0135] 6) Repeat the plate washing step 2);

[0136] 7) Dilute the candidate antibody to 12 different concentrations with blocking solution, with the highest concentration being 0.3 μg / mL. 3-fold serial dilutions were added to each well. 100 μL of dilution solution was added to each well. Seal the plate with sealing film and incubate at 37°C for 1 hour.

[0137] 8) Repeat the plate washing step 2);

[0138] 9) Dilute SA-HRP with blocking solution at a ratio of 1:1000, add 100 μL to each well, seal the plate with sealing film, and incubate at 37°C for 30 minutes;

[0139] 10) Repeat the plate washing step 2);

[0140] 11) Add 100 μL of TMB reaction solution to each well, seal the plate with a sealing film, and incubate on a microplate shaker for 10 minutes. Then, add 100 μL of 2N H2SO4 solution to terminate the reaction. Read the absorbance at 450 nm using a microplate reader.

[0141] The results are shown in Figure 1. The results show that the 14 single-domain antibodies screened by the present invention are all able to bind to protein antigens with high affinity.

[0142] 3.2 Cell-level binding ability detection

[0143] 1) Cell preparation: Take an appropriate amount of T2 cells (cell bank of Shanghai Institute of Biochemistry and Cell Biology) and adjust the cell density to 2×10 6 / ml, dispensed into 96-well U-bottom plates, 50 μL per well (about 1E5 cells);

[0144] 2) Peptide loading: Prepare a peptide at a concentration of 60 μM in 1640 medium. Add 50 μL / well of the peptide dilution to the plate and mix thoroughly with the cells. Incubate at 37°C for 2 hours to allow the peptide to load onto the T2 cells. Resuspend the cells in 200 μL of 1640 medium, centrifuge at 400 g for 5 minutes, and remove the supernatant.

[0145] 3) Antibody incubation: Adjust the starting concentration of the original antibody to 1 μg / mL using antibody diluent (PBS + 0.5% FBS), dilute 4-fold, and set up 10 concentration gradients. Add 100 μL of the diluted antibody to the previously loaded cells, mix thoroughly by pipetting, and incubate at 4°C in the dark for 60 min.

[0146] 4) Antibody washing: Add 200 μL of antibody diluent to the incubated antibody-cell mixture, centrifuge at 400 g for 5 min, discard the supernatant, resuspend the cells in 200 μL of antibody diluent, and repeat the washing process.

[0147] 5) Secondary antibody incubation: Dilute the fluorescent secondary antibody APC anti-human IgG Fc (BD Biosciences) at 1:200 in antibody diluent, take 100 μL and add it to the cell pellet after discarding the supernatant. After pipetting to mix, incubate at 4°C in the dark for 30 min.

[0148] 6) Secondary antibody washing: Add 200 μL of antibody diluent to the incubated antibody-cell mixture, centrifuge at 400 g for 5 min, discard the supernatant, resuspend the cells in 200 μL of antibody diluent, and repeat the washing process.

[0149] 7) Detection on flow cytometer: Add 100 μL of antibody diluent to each tube to resuspend the cells. Transfer the cell suspension to a flow cytometer and detect the positive labeling rate using a flow cytometer.

[0150] 8) Analyze the data using FlowJo software to obtain the mean fluorescence intensity (MFI). Fit the dose-effect nonlinear curve based on the MFI value and antibody concentration to calculate the EC 50The antigen affinity activity of the candidate antibody molecule is evaluated.

[0151] The results are shown in FIG2 : The results show that the 14 single-domain antibodies screened by the present invention are all able to bind to antigens at the cellular level and have high affinity.

[0152] Example 4: Specificity detection of single domain antibodies for target recognition

[0153] T2 cell models loaded with different peptides

[0154] 1) Take T2 cells grown to the logarithmic phase and resuspend them in complete culture medium to 2×10 6 / mL;

[0155] 2) Dilute the target peptide and OTP peptide to 60 μM using complete culture medium. Mix the peptide dilution with the cell suspension at a volume ratio of 1:1. Incubate at 37°C for 1-2 hours to allow the peptide to be loaded onto the T2 cell surface.

[0156] 3) After incubation, the excess peptide was washed with culture medium, the cells were collected by centrifugation, and the cells were resuspended in buffer (PBS solution containing 2% FBS) to 2×10 6 / mL, and the peptide-loaded T2 cells were seeded into a 96-well U-bottom cell culture plate at 50 μL / well;

[0157] 4) Dilute the candidate antibody molecules with buffer to 10 μg / mL, 2 μg / mL, 0.4 μg / mL, and 0.08 μg / mL, respectively. Add 50 μL / well of the antibody dilution to the well plate, mix thoroughly with the cells, and incubate at 4°C for 1 hour.

[0158] 5) Centrifuge at 300g for 5 minutes, remove the antibody diluent, and wash the cells once with 200 μL buffer;

[0159] 6) Dilute the fluorescent secondary antibody APC anti-human IgG Fc (purchased from Biolegend, Cat. No. 366906) in buffer at a ratio of 1:200, add 100 μL / well of the antibody dilution to the well plate, resuspend the cells and mix well, and incubate at 4°C for 30 min;

[0160] 7) Centrifuge at 300 g for 5 min, remove the antibody diluent, and wash the cells once with 200 μL buffer;

[0161] 8) Resuspend the cells in 100 μL of buffer and measure the fluorescence binding intensity in the APC channel using flow cytometry;

[0162] 9) Analyze the data using FlowJo software to obtain the mean fluorescence intensity (MFI) and evaluate the nonspecific binding level of the candidate antibody molecules to the off-target peptides.

[0163] Table 3. Potential off-target peptide sequences used in the present invention

[0164] The present invention tested all candidate molecules for off-target effects. Figure 3 shows the off-target analysis results for some of the molecules. As shown in Figure 3, the single-domain antibody molecules screened by the present invention have good specificity and are suitable for further development.

[0165] Example 5: Design of bispecific antibodies based on single domain antibodies

[0166] We used the single-domain antibody molecule LL-PR005 as a representative example to design bispecific antibodies with different structures. The bispecific antibodies designed in this invention can simultaneously bind to the PRAME polypeptide-HLA-A02 complex and CD3. Some bispecific antibodies in this invention incorporate Fc structures or half-life extender structures. The amino acid sequence of the CD3 antibody used in the bispecific antibodies designed in this invention is:

[0167] Heavy chain variable region:

[0168] Light chain variable region:

[0169] The amino acid sequence of the half life extender used in the bispecific antibody molecule designed in the present invention is:

[0170] The present invention designed a total of 13 bispecific antibody molecules with different structures, and the amino acid sequences are shown in Table 3.

[0171] Table 4. Amino acid sequence list of the bispecific antibody molecules designed in the present invention based on single domain antibodies

[0172] Example 6: Expression and purification of bispecific antibodies

[0173] Referring to the experimental steps of Example 2, the bispecific antibody molecules designed by the present invention were expressed and purified, and the expression level and purity were tested. The expression level and purity information of different bispecific antibodies are shown in Table 4. The expression level of the bispecific antibody of the present invention is in the range of 600-850 mg / L, which proves that the bispecific antibody structure of the present invention has a high expression level. The monomer purity of the bispecific antibody of the present invention by SEC-HPLC is above 90%. At the same time, the purity of all bispecific antibodies by reducing SDS-PAGE is above 95%. These results prove that the bispecific antibody molecules designed by the present invention have good expression level and high purity.

[0174] Table 5 Expression level and purity test results of bispecific antibodies

[0175] Example 7: Functional evaluation of bispecific antibodies

[0176] The bispecific antibody molecule described in the present invention, also known as a T cell engager, can simultaneously and specifically bind to the target presented by pMHC in tumor cells and the CD3 protein on the surface of T cells, mediating the directional cruising of T cells to the vicinity of tumor cells, endogenously activating and releasing cytokines, leading to the lysis of tumor cells, thereby achieving the purpose of treating tumors. In order to evaluate the specific recognition and killing ability of the candidate bispecific antibody molecules expressed in Example 6 on tumor cells, this example co-cultures the target cells with CD3+ T cells at a certain effector-target ratio, and adds different concentrations of candidate antibody molecules to detect the antibody-mediated target cell apoptosis ratio and T cell activation and factor secretion levels; In addition, this example sets tumor cell lines NCI-H1755, HS695T, OVCAR3, U2OS with different antigen expression abundances, PRAME expression negative HLA-A2 positive T2, MCF7 and HLA-A2 and PRAME negative A549 cell lines as target cells, which can further evaluate the target specific recognition ability of the bispecific antibody molecules, thereby more comprehensively screening out suitable bispecific antibody molecules for in-depth research. The basic implementation steps are as follows:

[0177] 1) Cell co-culture: Different target cells were transfected with lentivirus carrying luciferase to prepare cell lines labeled with luciferase, including NCI-H1755-GFP, HS695T-GFP, OVCAR3-GFP, MCF7-GFP, and A549-GFP. Different target cells and effector cells were cultured at a rate of 2×10 5 / mL and 1×10 6 / mL concentration, resuspended, and plated into 96-well flat-bottom opaque white plates at 25 μL / well, and temporarily incubated at 37°C;

[0178] 2) Antibody Incubation: Dilute the antibody in a gradient fashion using culture medium, with a maximum concentration of 20 nM, to 10 dilution points. Add 50 μL of the corresponding bispecific antibody to each well. Mix thoroughly and centrifuge at 500 rpm for 3 minutes. Incubate the cells at 37°C for 24 hours.

[0179] 3) Killing detection: After 24 hours of cell co-culture, the remaining luciferase activity (relative light unit, RLU) of the target cells is measured to detect the killing ability of T cells against target cells in the presence of different specific antibodies. The specific steps are: take out the opaque 96-well flat-bottom plate after co-culture, add 100 μL of equal volume of D-luciferin substrate (Thermo Fisher Scientific: 88293) to the well, mix well and develop color in the dark for 5 minutes, and detect the fluorescence intensity in chemiluminescence mode on a microplate reader. Since luciferase is only expressed in target cells, the remaining luciferase activity in the well is directly related to the number of live target cells in the well. In the absence of effector cells and antibodies, the maximum luciferase activity is obtained by adding culture medium to the target cells as a control;

[0180] 4) Data Analysis: Calculate the target cell killing efficiency corresponding to the test well using the maximum luciferase activity as a control. Fit a dose-dependent curve using the antibody concentration as the abscissa to estimate the EC50 value and evaluate the target cell killing level of the tested bispecific antibody molecule.

[0181] The results showed that the bispecific antibodies of the present invention can effectively mediate T cell activation and kill cells expressing positive target sites ( FIG. 4 ).

[0182] Example 8: Design of CAR sequence molecules targeting PRAME and construction of lentiviral vector

[0183] 8.1 Design of CAR gene sequences targeting PRAME

[0184] The CAR targeting PRAME comprises a single-domain antibody sequence of anti-human PRAME, a CD28 hinge region and a transmembrane domain, a CD28 costimulatory signal transduction region, and a CD3zeta signal transduction domain, which are connected in series. The present invention selected five single-domain antibody sequences and designed a total of five CAR structures. The five different CAR molecules were named as PRAME-CAR-01, PRAME-CAR-02, PRAME-CAR-03, PRAME-CAR-04, and PRAME-CAR-05, and the amino acid sequences corresponding to different CARs are shown in Table 6. The five CAR gene sequences targeting PRAME designed by the present invention were subjected to gene synthesis and subcloned into a pUC57 vector (Suzhou Jinweizhi Biotechnology Co., Ltd.).

[0185] Table 6. Amino acid sequence list of CAR targeting PRAME

[0186] 8.2 Construction of CAR Lentiviral Vector

[0187] Primers were designed to amplify five different CAR molecules from the pUC57 vector using PCR. The forward and reverse primers were designed to include homology arms to the lentiviral vector at their 5' ends. The amplified PCR products were analyzed by agarose gel electrophoresis and then purified (Nanjing Novozymes Biotech Co., Ltd., Cat. No. DC301) to obtain DNA fragments. The DNA fragments, recovered by restriction digestion, were cloned into the lentiviral vector via homologous recombination. The lentiviral vector was digested and purified with the restriction endonucleases BamHI (NEB: R3136V) and SalI (NEB: R3138V). This method yielded five different recombinant plasmids: p-lenti-PRAME-CAR-01, p-lenti-PRAME-CAR-02, p-lenti-PRAME-CAR-03, p-lenti-PRAME-CAR-04, and p-lenti-PRAME-CAR-05. The five lentiviral vectors were sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification. The sequencing primers were: Lenti-seqF: TTGAGTTGGATCTTGGTTC (SEQ ID NO: 103), Lenti-seqR: CAGCAACCAGGATTTATACA (SEQ ID NO: 104). Sanger sequencing verified that all five lentiviral vector plasmids were constructed correctly.

[0188] Example 9: Preparation and functional evaluation of CAR-T cells targeting PRAME

[0189] 9.1 Preparation of Lentivirus

[0190] The correct lentiviral plasmids verified by sequencing were transformed into Escherichia coli stbl3 (purchased from Yisheng Biotechnology Co., Ltd.) on the second day. Single clones were picked from the transformed plates and placed in 2 ml liquid LB culture tubes. The culture medium already contained kanamycin (50 ug / ml) and was cultured on a shaker at 37°C and 220 rpm for 8 hours. 1 ml of the activated bacterial solution was inoculated into 250 ml of liquid LB culture medium containing kanamycin and cultured on a shaker at 37°C and 220 rpm for 12-16 hours. Plasmids were extracted using the NucleoBond Xtra Midi Plus (MN, Cat. No. 740412.50) large extraction kit according to the experimental procedure provided by the kit. After plasmid extraction, the plasmid concentration was determined using Nanodrop (Thermo Fisher Scientific) and verified by Sanger sequencing. The supercoiled plasmid content was also detected by DNA agarose gel.

[0191] The frozen 293T cells (purchased from the Cell Bank of the Chinese Academy of Sciences) were taken out of liquid nitrogen, thawed in a 37°C water bath, and then the tube mouth was wiped with 75% alcohol and transferred to a tube containing 10 ml of preheated DMEM complete medium (90% DMEM +

[0192] Place the cells in a 15ml centrifuge tube containing 10% FBS + 1% penicillin / streptomycin, gently pipette to mix, centrifuge at 400g for 4 minutes, and discard the supernatant. Add 10ml of complete DMEM medium, gently pipette to mix, and then inoculate into a T25 or T75 culture flask. Culture in a 37°C incubator with 5% CO2. The next day, when the cell density reaches over 80%, passage the cells and continue culturing. 293T cells cultured for more than three generations can be used to package lentivirus. The specific steps are as follows:

[0193] 1) On the first day, seed 293T cells at a density of approximately 1.0 × 10^7 cells / T175 flask (cultured in 40 mL of culture medium). Transfection can be performed when the cell density reaches 90% on the second day.

[0194] 2) The next day, plasmid transfection: Before transfection, replace the culture medium with DMEM supplemented with 10% FBS but without the anti-antibody. Prepare the plasmid complex by adding the following plasmids to 1.5 ml of Opti-MEM (Thermo Fisher Scientific; 31985-070) and mixing thoroughly: 18 μg of psPAX2 plasmid (Addgene; Catalog No. 12260), 9 μg of pMD2.G plasmid (Addgene; Catalog No. 12259), and 18 μg of lentiviral vector plasmid. The lentiviral plasmids are: p-lenti-PRAME-CAR-01, p-lenti-PRAME-CAR-02, p-lenti-PRAME-CAR-03, lenti-PRAME-CAR-04, and lenti-PRAME-CAR-05. Next, prepare the transfection reagent complex: at a plasmid to PEI mass ratio of 1:3, add 67.5 μL (2 mg / mL) of PEI (Polysciences: 24765) to 1.5 mL of Opti-MEM, mix thoroughly, and let stand at room temperature for 5 minutes. Then, add the transfection reagent complex dropwise to the plasmid complex, mix thoroughly, and let stand for 20 minutes. Finally, slowly drip the transfection complex into the 293T cell culture flask, gently mix, and continue culturing in a 37°C cell culture incubator with 5% CO2.

[0195] 3) On the fourth day, virus collection: 48 hours after transfection, the culture supernatant was collected and centrifuged at 2000 rpm for 10 minutes to remove cell debris. Filter the supernatant using a 0.45 μM filter membrane (Millex-HV, product number SLHVR33RB), and transfer the filtrate to a dedicated centrifuge tube for balancing. Ultracentrifuge at 25000 rpm for 2 hours using an ultracentrifuge. After discarding the supernatant, resuspend the lentivirus in 1 ml of X-VIVO-15 culture medium, aliquot the lentivirus, and store it in an ultra-low temperature freezer at -80°C. According to this process, lentivirus containing PRAME-CAR-01, PRAME-CAR-02, PRAME-CAR-03, PRAME-CAR-04, and PRAME-CAR-05 were prepared respectively.

[0196] 9.2 Preparation of CAR-T cells and detection of CAR molecule expression

[0197] Prepared lentivirus containing PRAME-CAR-01, PRAME-CAR-02, PRAME-CAR-03, PRAME-CAR-04, and PRAME-CAR-05 were used to infect primary human T cells to prepare CAR-T cells carrying different CAR genes. The CAR-T cells carrying the five CAR genes were named: PRAME-CAR-T-01, PRAME-CAR-T-02, PRAME-CAR-T-03, PRAME-CAR-T-04, and PRAME-CAR-T-05. Untransfected T cells were used as negative controls and named NT. The specific steps are as follows:

[0198] 1) CD3+ T cells from healthy human peripheral blood (Miaoshun (Shanghai) Biotechnology Co., Ltd.) were resuspended in T cell culture medium containing 300 IU / mL IL-2 to a density of 1×10 6 / mL, add T cell activator CD3 / CD28 magnetic beads (ACRO Biosystems, catalog number: MBS-C001) at a ratio of 1:1 between cells and magnetic beads, mix thoroughly, and then seed the cells in a 6-well plate for culture;

[0199] 2) After 24 hours of T cell activation, the T cells were counted and seeded into a new 24-well plate at a concentration of 500 μl per well, 5 × 10 5 Cells were inoculated into cells / well. After inoculation, 100 μL of lentiviral solution carrying different CAR genes was added to infect T cells. T cells without virus solution were used as negative control NT. The cells were placed in an incubator for further culture.

[0200] 3) 48 hours after lentiviral infection, cells were aspirated from the culture wells, the magnetic beads were removed by magnetic adsorption using a magnetic stand, and the cells were collected by centrifugation and resuspended in fresh T cell culture medium.

[0201] 4) Simultaneously, 100 μL of the cell suspension containing lentivirus and the negative control were taken, the cells were collected by centrifugation, and the cells were resuspended in 100 μL FACS buffer. APC-labeled pMHC protein complex tetramer was added to each tube of cells, mixed well, and incubated at 4°C in the dark for 30 minutes.

[0202] 5) Wash the cells twice with PBS and resuspend them in 100 μL FACS buffer. Flow cytometry was used to detect the expression efficiency of the four CARs on T cells.

[0203] The results showed that all five CAR molecules described in the present invention were successfully expressed on T cells, with relatively consistent expression efficiencies of 30-45% ( FIG. 5 ).

[0204] 9.3 Detection of CAR-T Cell Killing Ability

[0205] This experiment used two HLA-A2 and PRAME double-positive cell lines as target cells, namely non-small cell lung cancer NCI-H1755 and melanoma HS695T. Two PRAME and HLA-A2 negative A549 and 293T cells were used as negative cells, respectively. The five CAR-T cells prepared in Example 2 above were co-cultured with the target cells to detect the killing effect and evaluate the biological functions of different CAR-T cells. The specific steps are as follows:

[0206] 1) Use lentiviral solution expressing GFP luciferase (GenBank: AAR29591.1) to transfect different target cells to obtain cell lines labeled with luciferase: NCI-H1755-GFP-luc, HS695T-GFP-luc, 293T-GFP-luc and A549-GFP-luc;

[0207] 2) NCI-H1755-GFP-luc, HS695T-GFP-luc, 293T-GFP-luc and A549-GFP cells were cultured at a cell concentration of 1×10 5 / mL, 50 μL / well was inoculated into a 96-well flat-bottom opaque cell culture plate and temporarily incubated at 37°C;

[0208] 3) Adjust the positive ratio of the five CAR-T cells to 15% using CT. Set four effector-target ratios of 5:1, 2.5:1, 1:1, and 0.5:1. Inoculate the five different CAR-T cells and control T cells into the target cells at 50 μL / well for co-culture. After thorough mixing, incubate in a 37°C incubator overnight.

[0209] 4) Remove the opaque 96-well flat-bottom plate after co-culture, add 100 μL of an equal volume of D-luciferin substrate (Thermo Fisher Scientific: 88293) to the wells, mix well, and react in the dark for 10 minutes. Detect fluorescence intensity using a microplate reader in chemiluminescence mode. Since luciferase is only expressed in target cells, the remaining luciferase activity in the well is directly related to the number of live target cells. Add culture medium to the target cells to obtain maximum luciferase activity as a control. By subtracting the live cell fluorescence signal value, the target cell apoptosis ratio is calculated, which is the killing effect of CAR-T cells on target cells. The results are shown in Figure 6.

[0210] The results showed that the five CAR molecules described in the present invention can all mediate T cell killing of three target-positive cells, among which NCI-H1755 cells have the strongest killing effect.

[0211] 9.4 Detection of CAR-T Cell Cytokine Secretion

[0212] To further evaluate the level of target cell-specific activation of the CAR-T cells of the present invention and the release of cytokines, the five CAR-T cells prepared in Example 2 were co-cultured with the target cells in Example 4 at a 1:1 effector-target ratio for 24 hours, and the levels of IFN-γ and IL-2 cytokines secreted by the T cells in the culture supernatant were measured. The specific steps are as follows:

[0213] 1) Take target cells NCI-H1755, HS695T, A549 and 293T and resuspend them in complete culture medium to 1×10 6 / mL, the cell suspension was inoculated into a 96-well U-bottom deep-well plate at 100 μL / well;

[0214] 2) Count the five CAR-T cells and control T cells and set the target ratio to 1:1, i.e., the cell concentration was 1×10 6 / mL, 100 μL / well was added to different target cells for co-culture;

[0215] 3) After co-culturing the cells overnight, 50 μL of the culture supernatant was collected and transferred to a new U-bottom 96-well plate. ELISA kits (Thermo Fisher Scientific; Cat. No. 88-7316) were used to detect the secretion of IFN-γ and IL-2 cytokines in T cells. Plate preparation and supernatant cytokine detection were performed according to the instructions provided by the kit.

[0216] 4) Graphpad Prism software was used for data analysis, dose-dependent curve fitting, and EC calculation. 50 value.

[0217] The results are shown in Figure 7. The results show that all candidate CAR-T cells can effectively recognize T2 loaded with target peptides, activate and transmit immune signals, and secrete IFN-γ cytokines. Among them, the biological activity of the CAR-T-01 molecule is relatively better. Based on the above results, the CAR sequence of the present invention has good affinity activity and biological function, suggesting that the CAR molecule of the present invention has the value of further development and application.

[0218] Example 10: Humanization of single domain antibodies

[0219] The present invention humanizes two single-domain antibody candidate molecules, LL-PR001 and LL-PR004. The basic steps are:

[0220] 1) The sequences of the single-domain antibody candidate molecules LL-PR001 and LL-PR004 were entered into the IMGT database for antibody sequence alignment. Based on the database sequence alignment results, IGHV3-23*04 was selected as the parent vector for humanization of LL-PR001, and IGHV3-23*02 was selected as the parent vector for humanization of LL-PR004.

[0221] 2) The CDR region of the LL-PR001 single-domain antibody was transplanted into IGHV3-23*04, and the CDR region of the LL-PR004 single-domain antibody was transplanted into IGHV3-23*02;

[0222] 3) Refer to the existing technical literature to perform back mutation on the transplanted humanized antibody to ensure the affinity of the humanized antibody.

[0223] Using the above method, ten candidate humanized single-domain antibodies were designed using LL-PR001 as the humanized parent, and the antibody sequences are shown in Table 7. Six candidate humanized single-domain antibodies were designed using LL-PR004 as the humanized parent, and the antibody sequences are shown in Table 8.

[0224] Table 7. Sequences of humanized single domain antibodies designed based on LL-PR001 humanized parent

[0225] Table 8. Humanized single domain antibody sequences designed based on LL-PR004 humanized parent

[0226] Example 11: Expression and functional characterization of humanized single-domain antibody molecules

[0227] 11.1 Expression of Humanized Single-Domain Antibody Molecules

[0228] The humanized antibody molecule was first codon-optimized to obtain a nucleotide sequence. The full-length gene for the humanized antibody molecule was then constructed into a single-domain antibody expression vector via gene synthesis. Following successful vector construction, the single-domain antibody was expressed using transient transfection of HEK293 suspension cells. The specific steps are described in Example 2.

[0229] The expression levels and purities of different humanized single-domain antibodies are shown in Table 9. The expression levels of the humanized single-domain antibodies of the present invention using a transient expression system ranged from 700-900 mg / L, demonstrating that the humanized single-domain antibodies of the present invention have high expression levels. Furthermore, the purities of most humanized single-domain antibodies measured by reducing SDS-PAGE and SEC-HPLC were above 95%. These results demonstrate that the humanized single-domain antibodies of the present invention have good expression levels and high purity.

[0230] Table 9. Expression level and purity detection of humanized single domain antibodies

[0231] 11.2 Protein level binding capacity detection

[0232] The binding ability of the humanized molecule to the target antigen was detected by ELISA to determine the affinity of the humanized molecule. For specific experimental steps, refer to Example 3 3.1. The results showed that the 10 candidate humanized single domain antibodies (huLL-PR001-1 to huLL-PR001-10) obtained after the humanization of the LL-PR001 molecule were all able to bind to the protein antigen and had a high affinity (the results are shown in Figure 8). The affinity of the molecule after partial humanization decreased slightly, but still had a high affinity. It can be applied to the research and development of subsequent bispecific antibodies, CAR-T, ADC and RDC and other biopharmaceutical projects. Similarly, the 6 candidate humanized single domain antibodies (huLL-PR004-1 to huLL-PR004-6) obtained after the humanization of the LL-PR004 molecule were also able to bind to the protein antigen and had a high affinity. The six affinities after humanization were slightly lower than those of the parent molecule, but still had a high affinity (the results are shown in Figure 9). It can be applied to the subsequent research and development of biologic drug projects such as bispecific antibodies, CAR-T, ADC and RDC.

[0233] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A VHH chain of a single domain antibody targeting a PRAME polypeptide, the VHH chain comprising CDR1, CDR2 and CDR3 as shown in the following table:

2. The VHH chain of a single domain antibody targeting a PRAME polypeptide according to claim 1, characterized in that The amino acid sequence of the PRAME polypeptide is: SLLQHLIGL (SEQ ID NO: 121).

3. The VHH chain of a single domain antibody targeting a PRAME polypeptide according to claim 1, characterized in that The amino acid sequence of the VHH chain of the single-domain antibody targeting the PRAME polypeptide is selected from the following group: SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:13, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:33, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:49 and SEQ ID NO:

53.

4. A heavy chain variable region of an antibody targeting a PRAME polypeptide, wherein the heavy chain variable region comprises CDR1, CDR2 and CDR3 as shown in the following table:

5. The heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4, characterized in that: The amino acid sequence of the heavy chain variable region of the antibody targeting the PRAME polypeptide is selected from the following group: SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:13, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:33, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:49 and SEQ ID NO:

53.

6. A single domain antibody targeting a PRAME polypeptide, comprising the VHH chain of any one of claims 1 to 3.

7. A humanized VHH chain of a single domain antibody targeting a PRAME polypeptide, wherein the framework regions FR1, FR2, FR3 and FR4 are humanized based on the VHH chain of any one of claims 1 to 3.

8. The VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to claim 7, characterized in that: The variable region sequence of the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide is selected from the following group: SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:107, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:110, SEQ ID NO:111, SEQ ID NO:112, SEQ ID NO:113 and SEQ ID NO:

114.

9. An antibody targeting a PRAME polypeptide, said antibody comprising one or more VHH chains of the single domain antibody targeting a PRAME polypeptide according to any one of claims 1 to 3 or the VHH chains of the humanized single domain antibody targeting a PRAME polypeptide according to claim 7 or 8.

10. The antibody targeting PRAME polypeptide according to claim 9, characterized in that The antibodies targeting PRAME polypeptide include monomers, bivalent antibodies, and / or multivalent antibodies.

11. A bispecific antibody, comprising a first antibody and a second antibody, wherein the first antibody comprises the VHH chain of a single-domain antibody targeting a PRAME polypeptide as described in any one of claims 1-3, or the heavy chain variable region of an antibody targeting a PRAME polypeptide as described in claim 4 or 5, or the single-domain antibody targeting a PRAME polypeptide as described in claim 6, the VHH chain of a humanized single-domain antibody targeting a PRAME polypeptide as described in claim 7 or 8, or the antibody targeting a PRAME polypeptide as described in claim 9 or 10.

12. The bispecific antibody according to claim 11, characterized in that The second antibody may bind to the same or a different antigen as the first antibody, or bind to a different epitope on the same antigen as the first antibody.

13. The bispecific antibody according to claim 11, characterized in that The second antibody is a single domain antibody, a single chain antibody or a double chain antibody.

14. The bispecific antibody according to claim 11, characterized in that The bispecific antibody comprises 2-4 single-domain antibodies targeting PRAME polypeptide; preferably, it comprises 2 single-domain antibodies targeting PRAME polypeptide; more preferably, the 2 single-domain antibodies targeting PRAME polypeptide form a single-domain antibody dimer targeting PRAME polypeptide.

15. The bispecific antibody according to claim 11, characterized in that The sequence of the bispecific antibody is shown in the following table:

16. A fusion protein, comprising the VHH chain of a single domain antibody targeting a PRAME polypeptide according to any one of claims 1 to 3, the heavy chain variable region of an antibody targeting a PRAME polypeptide according to claim 4 or 5, the single domain antibody targeting a PRAME polypeptide according to claim 6, the VHH chain of a humanized single domain antibody targeting a PRAME polypeptide according to claim 7 or 8, or the antibody targeting a PRAME polypeptide according to claim 9 or 10, an optional linker sequence, and an Fc fragment of an immunoglobulin or a half-life extension domain.

17. The fusion protein according to claim 16, characterized in that The immunoglobulin is IgG1, IgG2, IgG3, IgG4, preferably IgG4.

18. A chimeric antigen receptor, which is made of the VHH chain of the single domain antibody targeting the PRAME polypeptide according to any one of claims 1-3, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4 or 5, the single domain antibody targeting the PRAME polypeptide according to claim 6, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide according to claim 7 or 8, or the antibody targeting the PRAME polypeptide according to claim 9 or 10.

19. The chimeric antigen receptor according to claim 18, wherein The amino acid sequence of the chimeric antigen receptor is selected from the group consisting of SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101 and SEQ ID NO:

102.

20. An immune effector cell, wherein the immune effector cell expresses the chimeric antigen receptor according to claim 18 or 19.

21. The immune effector cell according to claim 20, characterized in that The immune effector cells include, but are not limited to, T cells, NK cells, and TIL cells; preferably, T cells.

22. A nucleic acid molecule, which encodes the VHH chain of the single-domain antibody targeting the PRAME polypeptide according to any one of claims 1-3, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4 or 5, the single-domain antibody targeting the PRAME polypeptide according to claim 6, the VHH chain of the humanized single-domain antibody targeting the PRAME polypeptide according to claim 7 or 8, the antibody targeting the PRAME polypeptide according to claim 9 or 10, the bispecific antibody according to any one of claims 11-15, the fusion protein according to claim 16 or 17, or the chimeric antigen receptor according to claim 18 or 19.

23. An expression vector comprising the nucleic acid molecule of claim 22.

24. A host cell, comprising the expression vector of claim 23, or the nucleic acid molecule of claim 22 integrated into its genome.

25. A method for preparing the VHH chain of the single domain antibody targeting the PRAME polypeptide according to any one of claims 1 to 3, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4 or 5, the single domain antibody targeting the PRAME polypeptide according to claim 6, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide according to claim 7 or 8, the antibody targeting the PRAME polypeptide according to claim 9 or 10, the bispecific antibody according to any one of claims 11 to 15, the fusion protein according to claim 16 or 17, or the chimeric antigen receptor according to claim 18 or 19, the method comprising the following steps: 1) Cultivating the host cell of claim 24 under suitable conditions to obtain a culture containing the VHH chain of the single domain antibody targeting the PRAME polypeptide, the heavy chain variable region of the antibody targeting the PRAME polypeptide, the single domain antibody targeting the PRAME polypeptide, the humanized VHH chain of the single domain antibody targeting the PRAME polypeptide, the antibody targeting the PRAME polypeptide, the bispecific antibody, the fusion protein or the chimeric antigen receptor; and 2) Optionally, isolating or recovering the VHH chain of the single domain antibody targeting the PRAME polypeptide, the heavy chain variable region of the antibody targeting the PRAME polypeptide, the single domain antibody targeting the PRAME polypeptide, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide, the single domain antibody targeting the PRAME polypeptide, the bispecific antibody, the fusion protein or the chimeric antigen receptor from the culture.

26. An immunoconjugate comprising: 1) the VHH chain of the single domain antibody targeting the PRAME polypeptide according to any one of claims 1 to 3, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4 or 5, the single domain antibody targeting the PRAME polypeptide according to claim 6, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide according to claim 7 or 8, the antibody targeting the PRAME polypeptide according to claim 9 or 10, the bispecific antibody according to any one of claims 11 to 15, or the fusion protein according to claim 16 or 17; and 2) A conjugated moiety selected from the group consisting of a detectable label, a drug, a toxin, a cytokine, a radionuclide, or an enzyme.

27. A pharmaceutical composition comprising a therapeutically or diagnostically effective amount of a VHH chain of a single domain antibody targeting a PRAME polypeptide according to any one of claims 1-3, a heavy chain variable region of an antibody targeting a PRAME polypeptide according to claim 4 or 5, a single domain antibody targeting a PRAME polypeptide according to claim 6, a humanized VHH chain of a single domain antibody targeting a PRAME polypeptide according to claim 7 or 8, an antibody targeting a PRAME polypeptide according to claim 9 or 10, a bispecific antibody according to any one of claims 11-15, a fusion protein according to claim 16 or 17, a chimeric antigen receptor according to claim 18 or 19, an immune effector cell according to claim 20 or 21, or an immunoconjugate according to claim 26, and an optional pharmaceutically acceptable excipient.

28. The pharmaceutical composition according to claim 27, characterized in that The pharmaceutical composition is used to treat tumors, and the tumors are PRAME polypeptide-related tumors; preferably melanoma, non-small cell lung cancer, ovarian cancer, breast cancer, etc.

29. Use of the VHH chain of the single domain antibody targeting the PRAME polypeptide according to any one of claims 1-3, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4 or 5, the single domain antibody targeting the PRAME polypeptide according to claim 6, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide according to claim 7 or 8, the antibody targeting the PRAME polypeptide according to claim 9 or 10, the bispecific antibody according to any one of claims 11-15, the fusion protein according to claim 16 or 17, the chimeric antigen receptor according to claim 18 or 19, the immune effector cell according to claim 20 or 21, the immunoconjugate according to claim 26, or the pharmaceutical composition according to claim 27 or 28, for preparing the following reagents: 1) Reagents for detecting PRAME polypeptide; 2) agents that block the binding of PRAME polypeptide to PD-L1; 3) Drugs for treating tumors.

30. The use according to claim 29, characterized in that The tumor is a PRAME polypeptide-associated tumor; preferably melanoma, non-small cell lung cancer, ovarian cancer, breast cancer, etc.

31. A kit, comprising: 1) the VHH chain of the single domain antibody targeting the PRAME polypeptide according to any one of claims 1 to 3, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4 or 5, the single domain antibody targeting the PRAME polypeptide according to claim 6, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide according to claim 7 or 8, the antibody targeting the PRAME polypeptide according to claim 9 or 10, the bispecific antibody according to any one of claims 11 to 15, the fusion protein according to claim 16 or 17, the chimeric antigen receptor according to claim 18 or 19, the immune effector cell according to claim 20 or 21, the immunoconjugate according to claim 26, or the pharmaceutical composition according to claim 27 or 28; 2) container; and 3) Optional instruction manual.

32. A method for detecting PRAME polypeptide protein in a sample, the method comprising the steps of: 1) contacting the sample to be tested with the VHH chain of the single domain antibody targeting the PRAME polypeptide according to any one of claims 1 to 3, the heavy chain variable region of the antibody targeting the PRAME polypeptide according to claim 4 or 5, the single domain antibody targeting the PRAME polypeptide according to claim 6, the VHH chain of the humanized single domain antibody targeting the PRAME polypeptide according to claim 7 or 8, the antibody targeting the PRAME polypeptide according to claim 9 or 10, the bispecific antibody according to any one of claims 11 to 15, the fusion protein according to claim 16 or 17, or the immunoconjugate according to claim 26; 2) Detect whether an antigen-antibody complex is formed. If a complex is formed, it indicates that the PRAME polypeptide protein is present in the sample.

Images