Editing system for regulating RNA methylation modification, and use thereof

Abstract

Disclosed are an editing system for regulating RNA methylation modification, and a use thereof. The editing system has a redox switch; when the system is in an oxidized state, the protein or structural domain where the switch is located has no biological activity; when the system is in a reduced state, the protein or structural domain where the switch is located has biological activity.

Description

An editing system for regulating RNA methylation modification and its application

[0001] This disclosure claims priority to the Chinese patent application filed with the Patent Office of China on August 29, 2023, with the invention name “An editing system for regulating RNA methylation modification and its application” and application number 202311099780.5. The entire contents of the above application are incorporated into this disclosure by reference. Technical Field

[0002] The present invention relates to the field of biotechnology, and in particular to an editing system for regulating RNA methylation modification and applications thereof. Background Art

[0003] RNA modification is a post-transcriptional regulatory mechanism that is widely present on various RNAs, including mRNA, tRNA, rRNA, and lncRNA. Methylation is one of the most commonly discovered RNA modifications. Several RNA methylation modifications, including 5-methylcytosine (m5C), N1-methyladenine (m1A), N6-methyladenine (m6A), pseudouracil, and 5-hydroxymethylcytosine (hm5C), have been detected in mammals. These RNA methylation modifications play an important role in biological processes such as mRNA splicing and transcription, protein translation, and maintaining genome stability. Their dynamic changes can regulate gene and protein expression, influence signal transduction, and determine cell fate (Zaccara S., et al. Nat. Rev. Mol. Cell Biol. 2019, 20, 608-624; He PC & He C. EMBO J. 2021, 40, e105977). Therefore, abnormal changes in RNA modification are closely related to the occurrence and development of various diseases (Wang T., et al. Mol. Cancer 2020, 19, 88; Jiang X., et al. Signal Trans. Target Ther. 2021, 6, 74).

[0004] Although RNA methylation modification plays an unparalleled important role in life activities, the current precise control methods for RNA methylation modification mostly use the CRISPR-Cas system. Liu XM et al. used Cas9 to fuse RNA methylase METTL3-METTL14, demethylase FTO and ALKBH5 to achieve precise editing of RNA m6A methylation (Liu XM et al., Nat. Chem. Biol. 2019, 15, 865-871). Subsequently, David R. Liu's laboratory used the Cas13 editing system to construct a new RNA m6A editing tool TRM (Wilson C. et al., Nat. Biotech. 2020, 38, 1431-1440). Compared with the Cas9 editing system, TRM has higher specificity and reduces the risk of off-target by 5.5 times. Although the above-mentioned RNA m6A editing tools based on the CRISPR-Cas system can achieve single-base RNA m6A methylation editing, after the CRISPR system is introduced into the cell, the editing tool will continue to edit, so it cannot be terminated or timed at any time, and it will also cause a large number of off-target effects.

[0005] Recently, Zhao J. et al. developed a light-controlled CRISPR-Cas13 editing system, PAMEC, which combines a light-sensitive protein with Cas13b, the m6A methyltransferases METTL3-METTL14, and the m6A demethylation protein FTO to achieve light-controlled precise m6A methylation editing (Zhao J. et al., Small 2020, 16, e1907301). Shi H. et al. developed a CRISPR-Cas13 editing system that uses the plant hormone abscisic acid as a switch. By fusing the abscisic acid-binding proteins PYL and ABI to Cas13b and the m6A methyltransferase METTL3, respectively, they achieved chemically induced precise m6A methylation editing (Shi H. et al., Nat. Commun. 2022, 13, 1958). Although the above two methods can control the temporal control of m6A methylation, both light-controlled and chemical induction will have certain effects on cells, thereby disrupting cell gene expression and RNA modification status.

[0006] Summary of the Invention

[0007] Problems to be solved by the invention

[0008] In response to the shortcomings of the existing technology, the present invention provides an editing system for regulating RNA methylation modification. By introducing a redox switch into the catalytic domain of Cas13 protein and adenine deaminase ADAR2, a controllable RNA editing system based on the CRISPR-Cas13 system is constructed.

[0009] Solutions for solving problems

[0010] The present invention provides an editing system for regulating RNA methylation modification, wherein the editing system comprises a targeting element and an editing element;

[0011] The targeting element comprises an inactivated Cas13 protein; and the editing element comprises the catalytic domain of adenine deaminase ADAR2.

[0012] Preferably, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild type or mutant of inactivated Cas13a, inactivated Cas13b, inactivated Cas13c, inactivated Cas13d, inactivated Cas13f, inactivated Cas13X and inactivated Cas13Y.

[0013] Preferably, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild type or mutant of inactivated Cas13a, inactivated Cas13b and inactivated Cas13X.

[0014] Preferably, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild type or mutant of inactivated Cas13X.

[0015] Preferably, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild type or mutant of the inactivated Cas13X.1.

[0016] Preferably, the inactivated Cas13 protein comprises one or more of the following sequences:

[0017] 1) the amino acid sequence shown in SEQ ID NO: 2;

[0018] II) an amino acid sequence that is at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 2;

[0019] III) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 2, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 2; or

[0020] IV) A nucleic acid that is partially complementary or completely complementary to any one of I) to III).

[0021] Preferably, the inactivated Cas13 protein comprises the amino acid sequence shown in SEQ ID NO: 3.

[0022] Preferably, the catalytic domain of the adenine deaminase ADAR2 has a specific catalytic function for the RNA methylation motif "RRACH", wherein R represents guanine or adenine, and H represents adenine, cytosine or uracil.

[0023] Preferably, the catalytic domain of the adenine deaminase ADAR2 comprises one or more of the following sequences:

[0024] a) the amino acid sequence shown in SEQ ID NO: 8;

[0025] b) an amino acid sequence that is at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 8, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 8;

[0026] c) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 8, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 8; or

[0027] d) A nucleic acid that is partially complementary or completely complementary to any one of a) to c).

[0028] Preferably, the catalytic domain of the adenine deaminase ADAR2 comprises the amino acid sequence shown in SEQ ID NO:10.

[0029] Preferably, the editing system further comprises a guide element.

[0030] Preferably, the guide element comprises crRNA or gRNA targeting a target sequence.

[0031] Preferably, the length of the crRNA or gRNA is 19-120 bp.

[0032] Preferably, the RNA methylation modification is selected from 5-methylcytosine (m5C), N1-methyladenine (m1A), N6-methyladenine (m6A), pseudouracil and 5-hydroxymethylcytosine (hm5C).

[0033] Preferably, the RNA methylation modification is selected from N1-methyladenine (m1A) and N6-methyladenine (m6A).

[0034] The present invention provides a polynucleotide encoding the editing system described above.

[0035] The present invention provides a vector comprising the polynucleotide described above.

[0036] The present invention provides a cell comprising one or more of the editing system, the polynucleotide and the vector as described above.

[0037] The present invention provides a pharmaceutical composition comprising one or more of the editing system, the polynucleotide, the vector, and the cell as described above, and a pharmaceutically acceptable carrier.

[0038] The present invention provides use of the editing system, the polynucleotide, the vector, the cell or the composition described above in the preparation of a drug for regulating RNA methylation modification.

[0039] Effects of the Invention

[0040] The editing system provided by the present invention has excellent editing efficiency and an extremely narrow editing window, which can specifically regulate RNA methylation modification in cancer cell lines, promote targeted treatment of diseases, and promote the application of base editors in precision medicine.

[0041] The editing system provided by the present invention has a redox switch. When the system is in an oxidized state, the protein or domain where the switch is located has no biological activity. When the system is in a reduced state, the protein or domain where the switch is located has biological activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1: Schematic diagram of the structures of the oxidized targeting element oxCas13x (A) and the reduced targeting element reCas13x (B) binding to crRNA.

[0043] Figure 2: Schematic diagram of the steady-state kinetic characteristics of oxidized (oxCas13x) and reduced (reCas13x) targeting elements.

[0044] Figure 3: Schematic diagram of the structures of the oxidized editing element oxADAR2-DD (A) and the reduced editing element reADAR2-DD (B) binding to adRNA.

[0045] Figure 4: Schematic diagram of the editing efficiency of wild-type ADAR2-DD, ADAR2-DD-E488Q, oxidative editing element oxADAR2-DD and reduced editing element reADAR2-DD at GAC and GAU sites.

[0046] Figure 5: Schematic diagram of the editing efficiency of m6A methylation at nucleotide 2577 of MALAT1 by the Cas13x-ADAR2-DD fusion protein with a redox switch. DETAILED DESCRIPTION

[0047] To make the technical solutions and beneficial effects of the present invention more clearly understood, the following detailed description is given by way of specific embodiments. The accompanying drawings are not necessarily drawn to scale, and local features may be enlarged or reduced to more clearly illustrate the details of the local features. Unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application belongs.

[0048] The present invention provides an editing system for regulating RNA methylation modification, wherein the editing system comprises a targeting element and an editing element;

[0049] The targeting element comprises an inactivated Cas13 protein; and the editing element comprises the catalytic domain of adenine deaminase ADAR2.

[0050] In certain embodiments, the inactivated Cas13 protein is selected from the full-length or partial sequence of a wild type or mutant of inactivated Cas13a, inactivated Cas13b, inactivated Cas13c, inactivated Cas13d, inactivated Cas13f, inactivated Cas13X and inactivated Cas13Y.

[0051] In certain embodiments, the inactivated Cas13 protein is selected from the full-length or partial sequence of a wild-type or mutant of inactivated Cas13a, inactivated Cas13b, and inactivated Cas13X.

[0052] In certain embodiments, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild-type or mutant of inactivated Cas13X.

[0053] In certain embodiments, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild-type or mutant of inactivated Cas13X.1.

[0054] In certain embodiments, the inactivated Cas13 protein comprises one or more of the following sequences:

[0055] 1) the amino acid sequence shown in SEQ ID NO: 2;

[0056] II) an amino acid sequence that is at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 2;

[0057] In certain embodiments, an amino acid sequence that is 80%, 80.5%, 81%, 80.5%, 81.5%, 82%, 82.5%, 83%, 83.5%, 84%, 84.5%, 85%, 85.5%, 86%, 86.5%, 87%, 87.5%, 88%, 88.5%, 89%, 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% identical to the amino acid sequence set forth in SEQ ID NO:2, and which retains an activity as set forth in SEQ ID NO:2;

[0058] III) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 2, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 2; or

[0059] IV) A nucleic acid that is partially complementary or completely complementary to any one of I) to III).

[0060] In certain embodiments, the inactivated Cas13 protein comprises the amino acid sequence shown in SEQ ID NO:3.

[0061] In the present invention, the expression "retains the activity of an amino acid sequence," for example, "retains the activity of the amino acid sequence set forth in SEQ ID NO: 2," can mean that the activity of the original sequence is fully retained, or partially retained, for example, retaining 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the activity of the original sequence. In other embodiments, a modified sequence, for example, a sequence with amino acid substitutions, may also have greater activity than the original sequence.

[0062] In certain embodiments, the inactivated Cas13 protein is provided with a switch.

[0063] In certain embodiments, the switch is a redox switch. When the system is in an oxidized state, the protein or domain where the switch is located has no biological activity. When the system is in a reduced state, the protein or domain where the switch is located has biological activity.

[0064] In certain embodiments, the redox switch is a lysine-cysteine ​​switch. When the system is in an oxidized state, lysine and cysteine ​​are connected through reactive oxygen species and the editing activity or catalytic activity of the protein is turned off. When the system is in a reduced state, the connection between lysine and cysteine ​​is disconnected and the editing activity or catalytic activity of the protein is turned on.

[0065] In certain embodiments, the catalytic domain of the adenine deaminase ADAR2 has a specific catalytic function for the RNA methylation motif "RRACH", wherein R represents guanine or adenine, and H represents adenine, cytosine or uracil.

[0066] In certain embodiments, the catalytic domain of adenine deaminase ADAR2 comprises one or more of the following sequences:

[0067] a) the amino acid sequence shown in SEQ ID NO: 8;

[0068] b) an amino acid sequence that is at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 8, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 8;

[0069] In certain embodiments, an amino acid sequence that is 80%, 80.5%, 81%, 80.5%, 81.5%, 82%, 82.5%, 83%, 83.5%, 84%, 84.5%, 85%, 85.5%, 86%, 86.5%, 87%, 87.5%, 88%, 88.5%, 89%, 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% identical to the amino acid sequence set forth in SEQ ID NO:8, and which retains an activity as set forth in SEQ ID NO:8;

[0070] c) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 8, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 8; or

[0071] d) A nucleic acid that is partially complementary or completely complementary to any one of a) to c).

[0072] In certain embodiments, the catalytic domain of the adenine deaminase ADAR2 comprises the amino acid sequence shown in SEQ ID NO:10.

[0073] In certain embodiments, the catalytic domain of the adenine deaminase ADAR2 is switched.

[0074] In certain embodiments, the switch is a redox switch. When the system is in an oxidized state, the protein or domain where the switch is located has no biological activity. When the system is in a reduced state, the protein or domain where the switch is located has biological activity.

[0075] In certain embodiments, the redox switch is a lysine-cysteine ​​switch. When the system is in an oxidized state, lysine and cysteine ​​are connected through reactive oxygen species and the editing activity or catalytic activity of the protein is turned off. When the system is in a reduced state, the connection between lysine and cysteine ​​is disconnected and the editing activity or catalytic activity of the protein is turned on.

[0076] In certain embodiments, the editing system further comprises a guide element.

[0077] In certain embodiments, the guide element comprises a crRNA or a gRNA that targets a target sequence.

[0078] In certain embodiments, the crRNA or gRNA is 19-120 bp in length.

[0079] In certain embodiments, the RNA methylation modification is selected from 5-methylcytosine (m5C), N1-methyladenine (m1A), N6-methyladenine (m6A), pseudouracil and 5-hydroxymethylcytosine (hm5C).

[0080] In certain embodiments, the RNA methylation modification is selected from N1-methyladenine (m1A) and N6-methyladenine (m6A).

[0081] The present invention provides a fusion protein for regulating the editing of RNA methylation modification, wherein the fusion protein comprises the above-mentioned targeting element and the above-mentioned editing element.

[0082] In certain embodiments, the linker sequence between the targeting element and the editing element is 1-40 amino acids long.

[0083] The present invention provides a polynucleotide encoding the editing system or fusion protein as described above.

[0084] The present invention provides a vector comprising the polynucleotide described above.

[0085] In certain embodiments, the vector is a mammalian expression vector. In some embodiments, the expression vector is selected from one or more of an adeno-associated virus, a retroviral vector, an adenoviral vector, a lentiviral vector, a Sendai virus vector, and a herpes virus vector. In some embodiments, the vector comprises a promoter.

[0086] The present invention provides a cell comprising one or more of the editing system, the fusion protein, the polynucleotide and the vector as described above.

[0087] In certain embodiments, the cell is a prokaryotic cell or a eukaryotic cell.

[0088] In certain embodiments, the cell is a bacterial cell, a plant cell, an insect cell, a human cell, or a mammalian cell.

[0089] The present invention provides a pharmaceutical composition comprising one or more of the editing system, the fusion protein, the polynucleotide, the vector, and the cell as described above, and a pharmaceutically acceptable carrier.

[0090] The present invention provides use of the editing system, the fusion protein, the polynucleotide, the vector, the cell or the composition described above in the preparation of a drug for regulating RNA methylation modification.

[0091] The terms and laboratory procedures used in the present invention in connection with protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology are those widely used in the respective fields. For example, standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are fully described in Sambrook et al., Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, 1989.

[0092] In this specification, a numerical range expressed using "a numerical value A - a numerical value B" means a range including the endpoints A and B.

[0093] The term "element" refers to a series of functional nucleic acid sequences useful for protein expression. The "element" described in the present invention is systematically constructed to form an expression construct. The "element" sequence can be the sequence provided in the present invention, but also includes variants thereof, as long as these variants substantially retain the function of the "element".

[0094] The terms "editing specificity" and "editing preference" are used interchangeably herein and refer to the degree of A-to-I editing at a particular adenosine site in a substrate. In certain embodiments, the adenosine deaminase used herein has a preference for substrates in the order GAC>GAT (">" indicates a greater preference).

[0095] The terms "nucleic acid" and "nucleic acid molecule" refer to compounds comprising a core base and an acidic moiety, such as a polymer of nucleosides, nucleotides or nucleotides. Typically, polymeric nucleic acids, such as nucleic acid molecules comprising three or more nucleotides, are linear molecules in which adjacent nucleotides are interconnected by phosphodiester bonds. In some embodiments, "nucleic acid" refers to a single nucleic acid residue (such as a nucleotide and / or nucleoside). In some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms "oligonucleotide" and "polynucleotide" are used interchangeably to refer to a polymer of nucleotides (such as a string of at least three nucleotides). In some embodiments, "nucleic acid" includes RNA and single-stranded and / or double-stranded DNA. Nucleic acid can be naturally occurring, such as in the context of a genome, transcript, mRNA, tRNA, rRNA, siRNA, snRNA, plasmid, cosmid, chromosome, chromatid or other naturally occurring nucleic acid molecules. On the other hand, nucleic acid molecules can be non-naturally occurring molecules, such as recombinant DNA or RNA, artificial chromosomes, engineered genomes or fragments thereof, or synthetic DNA, RNA, DNA / RNA hybrids or include non-naturally occurring nucleotides or nucleosides. In addition, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, e.g., analogs having backbones other than phosphodiester backbones. Nucleic acids can be purified from natural sources, produced and optionally purified using recombinant expression systems, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can include nucleoside analogs, e.g., analogs having chemically modified bases or sugar and backbone modifications.

[0096] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein and refer to amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0097] The term "fusion protein" refers to a hybrid polypeptide comprising protein domains from at least two different proteins. A protein can be located at the amino-terminal (N-terminal, N-terminal) portion or carboxyl-terminal (C-terminal, C-terminal) protein of the fusion protein, thereby forming an "amino-terminal fusion protein" or a "carboxyl-terminal fusion protein" respectively. Any protein provided herein can be produced by any method known in the art. For example, provided herein is a protein that can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins comprising peptide linkers. Methods for recombinant protein expression and purification are well known, and include those described in: Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.

[0098] The term "Cas protein" refers to CRISPR-associated proteins. Cas proteins and CRISPR sequences together constitute the CRISPR / Cas system. Cas proteins have functional domains related to nucleases and cut target sequences at specific locations by recognizing PAM (protospacer adjacent motif).

[0099] The term "deaminase" or "deaminase domain" refers to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine to hypoxanthine. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenosine or adenine (A) to inosine (I). In some embodiments, the deaminase or deaminase domain is an adenosine deaminase that catalyzes the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, adenosine deaminase catalyzes the hydrolytic deamination of adenosine in deoxyribonucleic acid (DNA).

[0100] The terms "nucleic acid programmable nucleotide binding domain" and "nucleic acid programmable DNA-binding protein (napDNAbp)" refer to proteins that bind to nucleic acids (e.g., DNA or RNA), such as guide polynucleotides (e.g., gRNA), which guide napDNAbp to a specific nucleic acid sequence, for example, by hybridizing with a target nucleic acid sequence. For example, the Cas9 protein can be bound to a guide RNA that guides the Cas9 protein to a specific DNA sequence that is complementary to the guide RNA. In some embodiments, napDNAbp is a Cas9 domain, e.g., a nuclease-active Cas9, a Cas9 nickase (nCas9), or a nuclease-free Cas9 (dCas9). Examples of nucleic acid programmable DNA-binding proteins include, but are not limited to, Cas9 (e.g., dCas9 and nCas9), CasX, CasY, Cpf1, C2c1, C2c2, C2c3, and Argonaute protein (AGO). However, it should be understood that nucleic acid programmable DNA-binding proteins also include nucleic acid programmable proteins that bind RNA. For example, the napDNAbp can be bound to a nucleic acid that guides the napDNAbp to the RNA.Other nucleic acid programmable DNA binding proteins are also within the scope of the present disclosure, although they may not be specifically described in this disclosure.

[0101] The term "guide polynucleotide," "guide RNA," or "gRNA" refers to a polynucleotide that can specifically target a target sequence and can form a complex with a nucleic acid-programmable nucleotide binding domain protein (e.g., Cas9). In one embodiment, the guide polynucleotide is a guide RNA (gRNA). The gRNA can exist as a complex of two or more RNAs or as a single RNA molecule. A gRNA that exists as a single RNA molecule may be referred to as a single guide RNA (sgRNA), but "gRNA" is used interchangeably to refer to a guide RNA that exists as a single molecule or a complex of two or more molecules. Typically, a gRNA that exists as a single RNA species includes two domains: (1) a domain that has homology to the target nucleic acid (e.g., guides the binding of the Cas9 complex to the target nucleic acid); and (2) a domain that binds to the Cas9 protein. In some embodiments, domain (2) corresponds to a sequence called tracrRNA and includes a stem-loop structure. For example, in some embodiments, domain (2) is identical to or homologous to the tracrRNA provided in Jinek et al., Science 337:816-821 (2012). Other examples of gRNAs may be those disclosed in U.S. Provisional Patent Application USSN 61 / 874,682, filed on September 6, 2013, entitled “Switchable Cas9 Nucleases and Uses Thereof” and U.S. Provisional Patent Application USSN 61 / 874,746, filed on September 6, 2013, entitled “Delivery System For Functional Nucleases.” In some embodiments, the gRNA includes two or more of domains (1) and (2) and may be referred to as an “extended gRNA.” The extended gRNA will bind to two or more Cas9 proteins and bind to the target nucleic acid at two or more different regions. The gRNA includes a nucleotide sequence complementary to the target site that mediates binding of the nuclease / RNA complex to the target site, providing sequence specificity for the nuclease:RNA complex.

[0102] According to the present invention, the three-letter and one-letter codes for amino acids are as described in J. biol. chem, 243, p3558 (1968).

[0103] According to the present invention, amino acid "addition" refers to the addition of amino acids to the C-terminus or N-terminus of an amino acid sequence. According to the present invention, amino acid "deletion" refers to the deletion of one, two, or three or more amino acids from an amino acid sequence. According to the present invention, amino acid "insertion" refers to the insertion of amino acid residues at appropriate positions in an amino acid sequence. The inserted amino acid residues may be all or partly adjacent to each other, or none of the inserted amino acids may be adjacent to each other.

[0104] According to the present invention, amino acid "substitution" refers to the replacement of a certain amino acid residue at a certain position in the amino acid sequence by another amino acid residue; wherein, the "substitution" can be a conservative amino acid substitution.

[0105] According to the present invention, "conservative modification", "conservative substitution" or "conservative replacement" refers to the replacement of an amino acid in a protein with another amino acid having similar characteristics (e.g., charge, side chain size, hydrophobicity / hydrophilicity, main chain conformation and rigidity, etc.), so that changes can be made frequently without changing the biological activity of the protein. It is known to those skilled in the art that, in general, single amino acid replacements in non-essential regions of a polypeptide do not substantially change the biological activity (see Watson et al. (1987), Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224, (4th edition)). In addition, replacements of amino acids with similar structure or function are unlikely to destroy biological activity. Exemplary conservative replacements are set forth in the table below, "Exemplary amino acid conservative replacements".

[0106] As used interchangeably herein, the terms "coding sequence" or "protein coding sequence" refer to a polynucleotide segment that encodes a protein. This region or sequence has a start codon near the 5' end and a stop codon near the 3' end. A coding sequence may also be referred to as an open reading frame.

[0107] The terms "complementary" or "hybridize" are used to refer to "polynucleotides" and "oligonucleotides" (which are interchangeable terms referring to nucleotide sequences) with respect to the base pairing rules. For example, the sequence "CAGT" is complementary to the sequence "GTCA". Complementarity can be "partial" or "complete". "Partial" complementarity refers to a mismatch between one or more nucleic acid bases according to the base pairing rules, and "complete" or "complete" complementarity between nucleic acids refers to a match between each nucleic acid base and another base under the base pairing rules. The degree of complementarity between nucleic acid chains has an important influence on the efficiency and strength of hybridization between nucleic acid chains. This is particularly important in amplification reactions and detection methods that rely on binding between nucleic acids.

[0108] The terms "nucleic acid sequence" and "nucleotide sequence" refer to oligonucleotides or polynucleotides and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that can be single-stranded or double-stranded, and represent the sense or antisense strand.

[0109] The terms "sequence identity" and "percentage identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by aligning the nucleotide or amino acid sequences of the polynucleotides or polypeptides and scoring the number of positions containing the same nucleotide or amino acid residue in the aligned polynucleotides or polypeptides, and comparing it with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. A polynucleotide may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or missing nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or two polynucleotides). A polypeptide may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or missing amino acids (i.e., amino acid insertions or amino acid deletions in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide and multiplying by 100. Exemplary, two or more sequences or subsequences have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% nucleotide "sequence identity" or "percent identity" when compared and aligned for maximum correspondence using a sequence comparison algorithm or as measured by visual inspection. In certain embodiments, the sequences are substantially identical over the entire length of either or both of the compared biopolymers (e.g., polynucleotides).

[0110] The term "vector" refers to a means for introducing a nucleic acid sequence into a cell to produce a transformed cell. Vectors include plasmids, transposons, phages, viruses, liposomes, and episomes. An "expression vector" is a nucleic acid sequence that contains a nucleotide sequence to be expressed in a recipient cell. An expression vector may include additional nucleic acid sequences to facilitate and / or promote expression of the introduced sequence, such as initiation, termination, enhancer, promoter, and secretion sequences.

[0111] As used herein, the terms "individual" and "subject" are used interchangeably and refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the individual is a human.

[0112] The methods disclosed herein can be performed in vitro, ex vivo, or in vivo, or the products can exist in an in vitro, ex vivo, or in vivo form. The term "in vitro" refers to experiments using materials, biological substances, cells and / or tissues under laboratory conditions or in culture medium; while the term "in vivo" refers to experiments and procedures using intact multicellular organisms. In some embodiments, the methods performed in vivo can be performed on non-human animals. "Ex vivo" refers to an event that exists or occurs outside an organism, such as outside a human or animal, such as an event that can exist or occur on a tissue (e.g., a whole organ) or cell taken from an organism.

[0113] The term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., a lubricant, talc, magnesium, calcium or zinc stearate, or stearic acid), or solvent encapsulating material, involved in delivering or transporting a compound from one part of the body (e.g., a delivery site) to another part (e.g., an organ, tissue, or part of the body). A pharmaceutically acceptable carrier is "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the tissues of the subject (e.g., physiologically compatible, sterile, physiological pH, etc.). Some examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, and treacle oil. oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) pH buffered solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as peptides and amino acids; (23) serum components, such as serum albumin, high-density lipoprotein (HDL), and low-density lipoprotein (LDL); (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances used in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweeteners, flavoring agents, fragrances, preservatives, and antioxidants may also be present in the formulation.Terms such as "excipient," "pharmaceutically acceptable carrier," and the like are used interchangeably herein.

[0114] The terms "treatment", "processing" refer to a clinical intervention intended to reverse, alleviate a disease or disorder or one or more symptoms thereof, delay the onset of a disease or disorder or one or more symptoms thereof, or suppress the progression of a disease or disorder or one or more symptoms thereof as described herein. As used herein, the terms "treatment", "processing" refer to a clinical intervention intended to reverse, alleviate a disease or disorder or one or more symptoms thereof, delay the onset of a disease or disorder or one or more symptoms thereof, or suppress the progression of a disease or disorder or one or more symptoms thereof as described herein. In some embodiments, treatment can be administered after one or more symptoms have been formed and / or after the disease has been diagnosed. In other embodiments, treatment can be administered in the absence of symptoms, for example, for preventing or delaying the onset of symptoms or suppressing the onset or progression of a disease. For example, treatment can be administered to susceptible individuals before the onset of symptoms (for example, in view of the history of symptoms and / or in view of genetic or other susceptibility factors). Treatment can also be continued after the symptoms subside, for example to prevent or delay their recurrence.

[0115] Example 1 Construction of Cas13X protein with redox switch

[0116] In this embodiment, the targeting element is an inactivated Cas13X, a wild-type inactivated Cas13X (Uniprot ID: A0A660UUL5), and its amino acid sequence is shown in SEQ ID No: 1. Amino acids 1-185 are the HEPN1 domain, amino acids 198-260 (Helical-1-1), 325-386 (Helical-1-2), and 517-608 (Helical-1-3) together constitute the Helical-1 domain, amino acids 386-517 are the Helical-2 domain, amino acids 616-775 are the HEPN2 domain, and amino acids 186-197 and 609-615 are the inter-domain linkers between the domains. According to the structural study and RNA recognition mechanism of Cas13X.1 (Nakagawa R. et al., Mol. Cell 2022, 82, 3178-3192), the targeting element used in this embodiment comprises the amino acid sequence 198-614 of wild-type Cas13X.1 (hereinafter referred to as "miniCas13x", whose amino acid sequence is shown in SEQ ID No: 2), and N326C, R532K and E588C mutations are introduced therein (whose amino acid sequence is shown in SEQ ID No: 3). Cys326-Lys532 and Lys329-Cys588 are cross-linked through an oxidation reaction to obtain an oxidized targeting element (hereinafter referred to as "oxCas13x", whose three-dimensional structure is shown in Figure 1, A); the cross-links between Cys326-Lys532 and Lys329-Cys588 are untied through a reduction reaction to obtain a reduced targeting element (hereinafter referred to as "reCas13x", whose three-dimensional structure is shown in Figure 1, B).

[0117] Table 1

[0118] Example 2 Steady-state kinetics of oxCas13x and reCas13x

[0119] In this example, oxCas13x and reCas13x were constructed according to the methods described above, and their amino acid sequences are shown in SEQ ID No: 3.

[0120] The nucleotide sequence of the editing substrate is shown in SEQ ID No: 4:

[0121] The nucleotide sequence of the guide element crRNA is shown in SEQ ID No: 5:

[0122] The nucleotide sequence of the trans substrate is shown in SEQ ID No: 6:

[0123] oxCas13x and reCas13x were mixed with crRNA at a molar ratio of 2:1, and buffer A (20mM 4-hydroxyethylpiperazineethanesulfonic acid, 50mM KCl, 100μg / mL BSA, 0.01% polyethylene glycol nonylphenyl ether, 5% glycerol, pH 6.8) was added and incubated at room temperature for 15 minutes to form nucleic acid binding protein RNP (Ribonucleoprotein). The nucleic acid binding protein RNP was mixed with the editing substrate RNA, and buffer B (20mM 4-hydroxyethylpiperazineethanesulfonic acid, 50mM KCl, 5.0mM MgCl2, 100μg / mL BSA, 0.01% polyethylene glycol nonylphenyl ether, 5% glycerol, pH 6.8) was added and incubated at room temperature for 15 minutes. After that, different concentrations of Alexa488 and biotin-modified trans substrates were added and EDTA sodium salt was added at the designated time points to quench the reaction. In the control group, Cas13x protein did not mix with crRNA to form RNP. After the reaction is completed, unreacted trans substrate is captured using magnetic beads, and the concentration of the editing product is determined by converting the fluorescence value to a molar concentration using a standard curve.

[0124] The steady-state kinetic results are shown in Figure 2. The catalytic constant K of the reduced targeting element reCas13x is cat and Michaelis constant K M The ratios of their catalytic constants and Michaelis constants (K cat / K M ) is about 19.8 times that of the oxidized targeting element oxCas13x. This shows that the reduced targeting element reCas13x has strong editing ability, while the oxidized targeting element oxCas13x has very weak editing ability. However, adding the reducing agent dithiothreitol (DTT) to the oxidized targeting element oxCas13x system can restore its editing activity.

[0125] Example 3 Construction of ADAR2 catalytic domain with redox switch

[0126] In this embodiment, the editing element is the catalytic domain of human ADAR2D (Uniprot ID: P78563-6, SEQ ID No: 7) (amino acids 316-674, hereinafter referred to as wild-type ADAR2-DD, whose amino acid sequence is shown in SEQ ID No: 8). Its E488Q mutant (ADAR2-DD-E488Q, whose amino acid sequence is shown in SEQ ID No: 9) was synthesized based on the structural studies of adenine deaminase ADAR2 and its RNA recognition mechanism (Macbeth MR, et al., Science 2005, 309, 1534-1539; Matthews MM, et al. Nat. Struct. Mol. Biol. 2016, 23, 426-433; Katrekar D. et al., Nat. Methods 2019, 16, 239-242; Doherty EE, et al. al.J.Am.Chem.Soc.2021,143,6865-6867), mutations such as D362R, D419K, E488K and N496F were introduced into the editing element used in this embodiment to improve its editing efficiency for the motif "RRACH" (wherein R represents guanine or adenine, A represents adenine, and H represents adenine, cytosine or uracil), and mutations such as D469C, R477K and N597C were also added to form a redox switch (whose amino acid sequence is shown in SEQ ID No: 10). Through oxidation reaction, Lys376-Cys597 and Cys469-Lys477 are cross-linked to obtain an oxidized editing element (hereinafter referred to as "oxADAR2-DD", whose three-dimensional structure is shown in Figure 3, A); through reduction reaction, the cross-links between Lys376-Cys597 and Cys469-Lys477 are released to obtain a reduced editing element (hereinafter referred to as "reADAR2-DD", whose three-dimensional structure is shown in Figure 3, B).

[0127] Table 2

[0128] Example 4 In vitro editing efficiency of oxADAR2-DD and reADAR2-DD

[0129] In this example, oxADAR2-DD and reADAR2-DD were constructed according to the methods described above, and their amino acid sequences are shown in SEQ ID No: 10. The nucleotide sequences of the target gene GAPDH ADAR-recruiting RNA (adRNA) and primers are as follows:

[0130] SEQ ID No:11:GGTGCCAGCAGTTGGTGG(adRNA)

[0131] SEQ ID No:12:TGGGTGTGAACCATGAGAAGTAT(Forward primer)

[0132] SEQ ID No:13:TGGCATGGACTGTGGTCATG(Reverse primer)

[0133] The nucleotide sequences of the target gene RAB7A adRNA and primers are as follows:

[0134] SEQ ID No:14:TCCAACCACCACAAGTTTTAT(adRNA)

[0135] SEQ ID No:15:AGGCCTGTAAGGTGGAGGG(Forward primer)

[0136] SEQ ID No:16:TGAAATAACGGCAATTTATCCATTGCACATAC(Reverse primer)

[0137] In this example, the editing efficiency of oxADAR2-DD and reADAR2-DD was detected by an in vitro RNA editing experiment of HEK293T. HEK293T cells were evenly plated in a 48-well plate, 500ng ADAR2-DD plasmid, 500ng adRNA plasmid and 1μL transfection reagent Lipofectamine 3000 (Thermo Fisher) were added, and transfection was performed at a confluence of about 30%. After 48 hours, the cells were harvested and RNA was extracted. 500ng RNA was reverse transcribed into cDNA, and 1μL cDNA was amplified by PCR for about 20bp around the primer site. The PCR product was purified and subjected to Sanger sequencing. The RNA editing efficiency was calculated as follows:

[0138] RNA editing efficiency = guanine peak height / (adenine peak height + guanine peak height)

[0139] As shown in the experimental results in Figure 4, the wild-type ADAR2-DD has no preference for GAC (target gene is RAB7A) and GAU (target gene is GAPDH) editing sites. Compared with the GAU site, the GAC site is a high-incidence site for RNA m6A methylation modification. Although ADAR2-DD-E488Q has a certain preference for the GAC site, its editing efficiency at the GAC site is 1.75 times that of the GAU site, but its editing efficiency for the GAU site is also very high, which will cause serious interference in the editing of RNA m6A methylation modification. The reduced editing element reADAR2-DD exhibits excellent RNA editing ability at the GAC editing site, which is 4 times that of the wild-type ADAR2-DD and 2.29 times that of ADAR2-DD-E488Q, and the GAU site editing ability of the reduced editing element reADAR2-DD is very weak, only 40% of that of the wild-type ADAR2-DD. This suggests that the RNA editing ability of the reduced editing element reADAR2-DD is biased, with its editing ability at the GAC site being 12 times higher than that at the GAU site. The oxidized editing element oxADAR2-DD has almost no editing ability at the GAC and GAU editing sites, but after adding the reducing agent dithiothreitol (DTT), its editing ability at the GAC site is restored.

[0140] Example 5 Construction and expression of Cas13x-ADAR2-DD fusion protein with redox switch

[0141] In the present embodiment, the fusion protein consists of three parts: a targeting element, an editing element, and a linker. Wherein the targeting element is selected from the aforementioned Cas13x protein with a redox switch of the present invention (its amino acid sequence is shown in SEQ ID No: 3), the editing element is selected from the aforementioned ADAR2-DD with a redox switch of the present invention (its amino acid sequence is shown in SEQ ID No: 10), and the amino acid sequence of the linker is shown in SEQ ID No: 17. The amino acid sequence of the above-mentioned Cas13x-ADAR2-DD fusion protein with a redox switch is shown in SEQ ID No: 18.

[0142] The expression method of the above-mentioned Cas13x-ADAR2-DD fusion protein with a redox switch is as follows: the gene sequence of the aforementioned fusion protein (as shown in SEQ ID No: 18) is cloned into the pDUAL-HFF1 vector to obtain a recombinant pDUAL-HFF1-Cas13x-ADAR2-DD plasmid, and the aforementioned pDUAL-HFF1-Cas13x-ADAR2-DD plasmid is cut with NotI enzyme, and the linear pDUAL-HFF1-Cas13x-ADAR2-DD fragment is transformed into fission yeast after reacting at 37 ° C for 30 minutes. YES medium (30 mg / mL glucose, 50 μg / mL adenine, uracil, L-histidine, L-leucine and L-lysine) is added and cultured to the middle logarithmic growth phase, and the Cas13x-ADAR2-DD fusion protein with a redox switch is obtained after transformation by lithium acetate / PEG / heat shock method.

[0143] Table 3

[0144] Example 6 Application of Cas13x-ADAR2-DD Fusion Protein with Redox Switch to Regulate RNA Methylation Modification

[0145] In this example, nucleotide position 2577 of the MALAT1 gene was selected as the editing target. HeLa cells and HCerEpiC cells were transfected with the Cas13x-ADAR2-DD fusion protein containing a redox switch and MALAT1 crRNA (whose nucleotide sequence is shown in SEQ ID No: 20). DTT was added 24 hours later, and the cells were harvested and RNA extracted after 24 hours of culture. 10 μg of RNA was taken and added with a fragmentation reagent (Thermo Fisher Cat. AM8740) and reacted at 70°C for 10 minutes to break the mRNA into 100-150 nt fragments. The RNA fragments were precipitated and recovered by ethanol method. The magnetic beads containing protein A and protein G were washed several times with buffer C (150 nM NaCl, 10 mM Tris-HCl, pH 7.5). 5 μg of m6A antibody (Sigma-Aldrich Cat. MABE1006) was added and incubated at 4°C for 2 hours. After washing with buffer C, the magnetic beads were resuspended and RNA fragments were added. The beads were rotated at 4°C overnight. The RNA fragments enriched on the magnetic beads were eluted, reverse transcribed into cDNA, and then detected by qPCR. The primer sequences are shown in SEQ ID No: 21 and SEQ ID No: 22.

[0146] SEQ ID No:20: GCTACTATATTTAAGGCCTTCCAAATTCTT(MALAT1 crRNA)

[0147] SEQ ID No:21:CGTAACGGAAGTAATTCAAG(Forward primer)

[0148] SEQ ID No:22:GTCAATTAATGCTAGTCCTC(Reverse primer)

[0149] The experimental results are shown in Figure 5. In the cancer cell line HeLa, the Cas13x-ADAR2-DD fusion protein with a redox switch had no RNA editing ability and no significant regulation of m6A methylation at nucleotide 2577 of MALAT1 in the absence of DTT, indicating that the fusion protein was in an oxidized state and lacked RNA editing ability. When the reducing agent DTT was added, m6A methylation at nucleotide 2577 of MALAT1 was significantly downregulated, indicating that the fusion protein was in a reduced state and its RNA editing ability was activated. In normal cells (HCerEpiC), the fusion protein significantly downregulated m6A methylation at nucleotide 2577 of MALAT1, regardless of whether DTT was added, indicating that the fusion protein was always in a reduced state in normal cells. These experimental results demonstrate that the Cas13x-ADAR2-DD fusion protein with a redox switch can specifically regulate RNA m6A methylation in cancer cell lines.

[0150] It should be understood that the above embodiments are exemplary and are not intended to encompass all possible implementations of the claims. Various modifications and variations may be made to the above embodiments without departing from the scope of this disclosure. Similarly, the various technical features of the above embodiments may be arbitrarily combined to form additional embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments merely illustrate several implementations of the present invention and do not limit the scope of protection of the patent of this invention.

Claims

1. An editing system for regulating RNA methylation modification, characterized in that: The editing system includes a targeting element and an editing element; The targeting element comprises an inactivated Cas13 protein; and the editing element comprises the catalytic domain of adenine deaminase ADAR2.

2. The editing system according to claim 1, characterized in that: The inactivated Cas13 protein is selected from the full length or partial sequence of the wild type or mutant of inactivated Cas13a, inactivated Cas13b, inactivated Cas13c, inactivated Cas13d, inactivated Cas13f, inactivated Cas13X and inactivated Cas13Y; Preferably, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild type or mutant of inactivated Cas13a, inactivated Cas13b and inactivated Cas13X; Preferably, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild type or mutant of the inactivated Cas13X; Preferably, the inactivated Cas13 protein is selected from the full-length or partial sequence of the wild type or mutant of inactivated Cas13X.1; Preferably, the inactivated Cas13 protein comprises one or more of the following sequences: 1) the amino acid sequence shown in SEQ ID NO: 2; II) an amino acid sequence that is at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID NO: 2, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 2; III) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 2, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 2; or, IV) a nucleic acid that is partially complementary or completely complementary to any one of I) to III); Preferably, the inactivated Cas13 protein comprises the amino acid sequence shown in SEQ ID NO:

3.

3. The editing system according to claim 1 or 2, characterized in that: The catalytic domain of the adenine deaminase ADAR2 has a specific catalytic function for the RNA methylation motif "RRACH", wherein R represents guanine or adenine, and H represents adenine, cytosine or uracil; Preferably, the catalytic domain of the adenine deaminase ADAR2 comprises one or more of the following sequences: a) the amino acid sequence shown in SEQ ID NO: 8; b) an amino acid sequence that is at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID NO: 8, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 8; c) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 8, and which retains the activity of the amino acid sequence shown in SEQ ID NO: 8; or d) a nucleic acid that is partially complementary or completely complementary to any one of a) to c); Preferably, the catalytic domain of the adenine deaminase ADAR2 comprises the amino acid sequence shown in SEQ ID NO:

10.

4. The editing system according to any one of claims 1 to 3, characterized in that: The editing system further includes a guide element; Preferably, the guide element comprises a crRNA or a gRNA targeting a target sequence; Preferably, the length of the crRNA or gRNA is 19-120bp.

5. The editing system according to any one of claims 1 to 4, characterized in that: The RNA methylation modification is selected from 5-methylcytosine (m5C), N1-methyladenine (m1A), N6-methyladenine (m6A), pseudouracil and 5-hydroxymethylcytosine (hm5C); Preferred is N1-methyladenine (m1A) and N6-methyladenine (m6A).

6. A polynucleotide, characterized in that Encode an editing system as claimed in any one of claims 1-5.

7. A carrier, characterized in that Comprising the polynucleotide as claimed in claim 6.

8. A cell, characterized in that Comprising one or more of the editing system according to any one of claims 1 to 5, the polynucleotide according to claim 6, and the vector according to claim 7.

9. A pharmaceutical composition, characterized in that Comprising one or more of the editing system according to any one of claims 1 to 5, the polynucleotide according to claim 6, the vector according to claim 7, and the cell according to claim 8, and a pharmaceutically acceptable carrier.

10. Use of the editing system according to any one of claims 1 to 5, the polynucleotide according to claim 6, the vector according to claim 7, the cell according to claim 8 or the composition according to claim 9 in the preparation of a drug for regulating RNA methylation modification.

Images