Single-domain antibody targeting HBV full-length envelope protein and use thereof

Abstract

Disclosed is a single-domain antibody targeting an HBV full-length envelope protein. The single-domain antibody can bind to the HBV full-length envelope protein with high affinity, and has good specificity, thereby laying a new material foundation for development of an anti-tumor drug targeting the HBV full-length envelope protein. The single-domain antibody can also be used for preparing a bispecific antibody, a chimeric antigen receptor, a chimeric antigen receptor-T cell, an ADC, an RDC, etc.

Description

Single-domain antibody targeting HBV full-length envelope protein and its use Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a single-domain antibody targeting the full-length HBV envelope protein and its use. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the most common, highly malignant cancers worldwide, characterized by rapid progression, poor prognosis, and a 5-year survival rate of less than 5%. Currently, effective treatment options for HCC patients are limited to early-stage disease with a low tumor burden. Clinical treatment for HCC remains primarily surgical resection, chemotherapy, and radiotherapy, but these approaches offer limited benefit, and most patients ultimately die from disease recurrence or metastasis. Several tyrosine kinase inhibitors, such as sorafenib, lenvatinib, and cabozantinib, have been approved for HCC, but clinical observations show poor overall survival improvements in patients with advanced HCC. Immune checkpoint blockade (ICB) therapy is a new treatment for liver cancer. Its efficacy, alone or in combination with kinase inhibitors, has shown different response rates and survival benefits in HCC patients (Kudo M et al. Lenvatinib versus sorafenib in first-line treatment of patients with unresectable hepatocellular carcinoma: arandomised phase 3 non-inferiority trial. Lancet 391, 1163-1173 (2018)). Despite advances in existing treatments, effective and durable systemic treatment options for HCC remain limited.

[0003] China is a high-incidence region for HCC, with approximately 75-80% of HCC patients being induced by hepatitis B virus (HBV) infection. In these HCC patients, virus-specific T cells are often deleted or dysfunctional, resulting in a delay in their immune attack to eliminate cancer cells (Hao XS, et al. Twenty-year trends of primary liver cancer incidence rates in an urban Chinese population. Eur J Cancer Prev 12:273-279 (2003)). This problem can be overcome through TCR-T therapy. More than 90% of HBV-HCCs harbor HBV DNA integration and may express complete or truncated HBV antigens. These are processed and presented by MHC molecules on the surface of HBV-infected hepatocytes or HCC cells, resulting in HBV epitopes that are specifically recognized by T cells. Furthermore, HBV, as a foreign invader, shares little homology with the endogenous human genome. Therefore, the use of T cells engineered with HBV-specific T cell receptors (HBV-TCR T cells) to treat HBV-HCC is promising. Currently, several patients with advanced HBV-HCC have been reported to be safe and potentially effective after receiving HBsAg-specific TCR-redirected T cell immunotherapy (Fanping Meng et al., Immunotherapy of HBV-related advanced hepatocellular carcinoma with short-term HBV-specific TCR expressed Tcells: results of dose escalation, phase I trial. Hepatol Int 15(6), 1402-1412(2021)). Therefore, there is an urgent need for effective drugs for the treatment of HBV infection and HBV-induced liver cancer.

[0004] Single-domain antibodies (sdAbs) are a special type of antibody with a smaller molecular weight. Single-domain antibodies are composed of only two identical heavy chains. Compared with the molecular weight of 150-160kDa of traditional double-chain antibodies, the molecular weight of single-domain antibodies is about 110KD. Single-domain antibodies generally have high specificity, high affinity, low immunogenicity, and good permeability. The antigen-binding region of a single-domain antibody is composed of only one chain, and the variable region (VHH) of a single-domain antibody is only 12-15kDa. Therefore, it is very simple to structurally modify single-domain antibodies. There will be no problem of mismatching of the light and heavy chains of traditional double-linked antibodies, nor will there be a decrease in affinity caused by modification of the single chain of the antigen-binding region. Single-domain antibodies can recognize cell membrane proteins, as well as polypeptides derived from intracellular proteins presented to the cell surface by major histocompatibility antigens.

[0005] Summary of the Invention

[0006] The purpose of the present invention is to provide a specific single-domain antibody targeting the full-length HBV envelope protein and corresponding specific humanized single-domain antibodies, bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells and ADCs targeting the full-length HBV envelope protein.

[0007] The present invention also aims to provide uses of the single-domain antibodies, humanized single-domain antibodies, bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells and ADCs in treating tumors or preparing drugs for treating tumors.

[0008] In a first aspect, the present invention provides a VHH chain of a single-domain antibody targeting the full-length envelope protein of HBV, wherein the VHH chain comprises CDR1, CDR2 and CDR3 as shown in the following table:

[0009] In a preferred embodiment, the amino acid sequence of the HBV full-length envelope protein is shown as GLSPTVWLSV (SEQ ID NO: 36).

[0010] In a preferred embodiment, any one of the above-mentioned amino acid sequences also includes a derivative sequence that is optionally added, deleted, modified and / or substituted by at least one (such as 1-3, preferably 1-2, and more preferably 1) amino acid and can retain high affinity binding to the full-length HBV envelope protein.

[0011] In a preferred embodiment, the VHH chain further comprises framework regions FR1, FR2, FR3 and FR4.

[0012] In a preferred embodiment, the amino acid sequence of the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein is shown in SEQ ID NO: 1 or 5.

[0013] In a second aspect, the present invention provides a heavy chain variable region of an antibody targeting the full-length HBV envelope protein, wherein the heavy chain variable region comprises CDR1, CDR2 and CDR3 as shown in the following table:

[0014] In a preferred embodiment, the amino acid sequence of the heavy chain variable region of the antibody targeting the full-length HBV envelope protein is shown in SEQ ID NO: 1 or 5.

[0015] In a third aspect, the present invention provides a single-domain antibody targeting the full-length envelope protein of HBV, which has the VHH chain described in the first aspect.

[0016] In a fourth aspect, the present invention provides a humanized VHH chain of a single-domain antibody targeting the full-length envelope protein of HBV, wherein the framework regions FR1, FR2, FR3 and FR4 are humanized based on the VHH chain described in the first aspect.

[0017] In a preferred embodiment, the amino acid sequence of the humanized VHH chain is shown in any one of SEQ ID NOs: 24-35; preferably, in any one of SEQ ID NOs: 24-30, 32, 33 and 35.

[0018] In the fifth aspect, the present invention provides an antibody targeting the full-length envelope protein of HBV, which comprises one or more VHH chains of the single-domain antibody targeting the full-length envelope protein of HBV described in the first aspect or the VHH chains of the humanized single-domain antibody targeting the full-length envelope protein of HBV described in the fourth aspect.

[0019] In a preferred embodiment, the antibody targeting the full-length HBV envelope protein includes a monomer, a bivalent antibody, and / or a multivalent antibody.

[0020] In the sixth aspect, the present invention provides a bispecific antibody, comprising a first antibody and a second antibody, wherein the first antibody comprises the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein described in the first aspect, or the heavy chain variable region of the antibody targeting the full-length HBV envelope protein described in the second aspect, or the single-domain antibody targeting the full-length HBV envelope protein described in the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length HBV envelope protein described in the fourth aspect, or the antibody targeting the full-length HBV envelope protein described in the fifth aspect.

[0021] In a preferred embodiment, the second antibody may bind to the same or a different antigen as the first antibody, or bind to a different epitope on the same antigen as the first antibody.

[0022] In a preferred embodiment, the second antibody is a single domain antibody, a single chain antibody or a double chain antibody.

[0023] In a preferred embodiment, the bispecific antibody comprises 2-4 single-domain antibodies targeting the full-length envelope protein of HBV; preferably, it comprises 2 single-domain antibodies targeting the full-length envelope protein of HBV; more preferably, the 2 single-domain antibodies targeting the full-length envelope protein of HBV form a single-domain antibody dimer targeting the full-length envelope protein of HBV.

[0024] In the seventh aspect, the present invention provides a fusion protein, which includes the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV described in the first aspect, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV described in the second aspect, the single-domain antibody targeting the full-length envelope protein of HBV described in the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV described in the fourth aspect, or the antibody targeting the full-length envelope protein of HBV described in the fifth aspect, an optional linker sequence and an Fc fragment or half-life extension domain of an immunoglobulin.

[0025] In a preferred embodiment, the immunoglobulin is IgG1, IgG2, IgG3, IgG4; preferably IgG4.

[0026] In the eighth aspect, the present invention provides a nucleic acid molecule, which encodes the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV described in the first aspect, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV described in the second aspect, the single-domain antibody targeting the full-length envelope protein of HBV described in the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV described in the fourth aspect, the antibody targeting the full-length envelope protein of HBV described in the fifth aspect, the bispecific antibody described in the sixth aspect, or the fusion protein described in the seventh aspect.

[0027] In a ninth aspect, the present invention provides an expression vector comprising the nucleic acid molecule described in the eighth aspect.

[0028] In a tenth aspect, the present invention provides a host cell, wherein the host cell comprises the expression vector described in the ninth aspect, or the nucleic acid molecule described in the eighth aspect is integrated into its genome.

[0029] In an eleventh aspect, the present invention provides a method for preparing the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the first aspect, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein of the second aspect, the single-domain antibody targeting the full-length HBV envelope protein of the third aspect, the humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the fourth aspect, the antibody targeting the full-length HBV envelope protein of the fifth aspect, the bispecific antibody of the sixth aspect, or the fusion protein of the seventh aspect, the method comprising the following steps:

[0030] 1) Cultivating the host cell as described in the tenth aspect under suitable conditions to obtain a culture containing the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein, the single-domain antibody targeting the full-length HBV envelope protein, the humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein, the antibody targeting the full-length HBV envelope protein, the bispecific antibody, or the fusion protein; and

[0031] 2) Optionally, the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein, the single-domain antibody targeting the full-length HBV envelope protein, the humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein, the single-domain antibody targeting the full-length HBV envelope protein, the bispecific antibody or the fusion protein is isolated or recovered from the culture.

[0032] In a twelfth aspect, the present invention provides an immunoconjugate comprising:

[0033] 1) the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein as described in the first aspect, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein as described in the second aspect, the single-domain antibody targeting the full-length HBV envelope protein as described in the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length HBV envelope protein as described in the fourth aspect, the antibody targeting the full-length HBV envelope protein as described in the fifth aspect, the bispecific antibody as described in the sixth aspect, or the fusion protein as described in the seventh aspect; and

[0034] 2) A conjugated moiety selected from the group consisting of a detectable label, a drug, a toxin, a cytokine, a radionuclide, or an enzyme.

[0035] In a preferred embodiment, the conjugated moiety is a drug or a toxin.

[0036] In a preferred embodiment, the immunoconjugate is an antibody-drug conjugate (ADC) or a radionuclide drug conjugate (RDC).

[0037] In a preferred embodiment, the conjugated moiety is a detectable label.

[0038] In a preferred embodiment, the conjugate is selected from: fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (such as IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorods, viral particles, liposomes, nanomagnetic particles, prodrug-activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)), chemotherapeutic agents (for example, cisplatin) or any form of nanoparticles, etc.

[0039] In a preferred embodiment, the immunoconjugate contains: a multivalent (e.g., bivalent) VHH chain of a single-domain antibody targeting the full-length HBV envelope protein as described in the first aspect, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein as described in the second aspect, the single-domain antibody targeting the full-length HBV envelope protein as described in the third aspect, the humanized VHH chain of a single-domain antibody targeting the full-length HBV envelope protein as described in the fourth aspect, the antibody targeting the full-length HBV envelope protein as described in the fifth aspect, the bispecific antibody as described in the sixth aspect, or the fusion protein as described in the seventh aspect.

[0040] In a preferred embodiment, the multivalency refers to the presence of multiple repeating portions in the amino acid sequence of the immunoconjugate.

[0041] In a thirteenth aspect, the present invention provides a chimeric antigen receptor, wherein the chimeric antigen receptor comprises the single domain antibody described in the third aspect or is prepared from the single domain antibody described in the third aspect.

[0042] In a preferred embodiment, the amino acid sequence of the chimeric antigen receptor is shown in SEQ ID NO: 22 or 23.

[0043] In a fourteenth aspect, the present invention provides an immune effector cell, wherein the immune effector cell expresses the chimeric antigen receptor according to the thirteenth aspect on its surface.

[0044] In a preferred embodiment, the immune effector cells include but are not limited to T cells or NK cells; preferably T cells.

[0045] In the fifteenth aspect, the present invention provides a pharmaceutical composition comprising a therapeutically or diagnostically effective amount of the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV described in the first aspect, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV described in the second aspect, the single-domain antibody targeting the full-length envelope protein of HBV described in the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV described in the fourth aspect, the antibody targeting the full-length envelope protein of HBV described in the fifth aspect, the bispecific antibody described in the sixth aspect, the fusion protein described in the seventh aspect, the immunoconjugate described in the twelfth aspect or the immune effector cell described in the fourteenth aspect, and optional pharmaceutically acceptable excipients.

[0046] In a preferred embodiment, the pharmaceutical composition is used to treat HBV full-length envelope protein-related diseases; preferably, the HBV full-length envelope protein-related diseases are tumors or hepatitis B virus infection.

[0047] In a preferred embodiment, said tumor is liver cancer; preferably hepatocellular carcinoma.

[0048] In the sixteenth aspect, the present invention provides uses of the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the first aspect, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein of the second aspect, the single-domain antibody targeting the full-length HBV envelope protein of the third aspect, the humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the fourth aspect, the antibody targeting the full-length HBV envelope protein of the fifth aspect, the bispecific antibody of the sixth aspect, the fusion protein of the seventh aspect, the immunoconjugate of the twelfth aspect, the immune effector cell of the fourteenth aspect, or the pharmaceutical composition of the fifteenth aspect, for preparing the following reagents:

[0049] 1) Reagents for detecting the full-length HBV envelope protein;

[0050] 2) Reagents that block the binding of HBV full-length envelope protein to PD-L1;

[0051] 3) Drugs for the treatment of diseases related to HBV full-length envelope protein.

[0052] In a preferred embodiment, the HBV full-length envelope protein-related disease is tumor or hepatitis B virus infection.

[0053] In a preferred embodiment, said tumor is liver cancer; preferably hepatocellular carcinoma.

[0054] In a seventeenth aspect, the present invention provides a kit comprising:

[0055] 1) the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the first aspect, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein of the second aspect, the single-domain antibody targeting the full-length HBV envelope protein of the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length HBV envelope protein of the fourth aspect, the antibody targeting the full-length HBV envelope protein of the fifth aspect, the bispecific antibody of the sixth aspect, the fusion protein of the seventh aspect, the immunoconjugate of the twelfth aspect, the immune effector cell of the fourteenth aspect, or the pharmaceutical composition of the fifteenth aspect;

[0056] 2) container; and

[0057] 3) Optional instruction manual.

[0058] In an eighteenth aspect, the present invention provides a method for detecting the full-length HBV envelope protein in a sample, the method comprising the steps of:

[0059] 1) contacting the sample to be tested with the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein described in the first aspect, the heavy chain variable region of the antibody targeting the full-length HBV envelope protein described in the second aspect, the single-domain antibody targeting the full-length HBV envelope protein described in the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length HBV envelope protein described in the fourth aspect, the antibody targeting the full-length HBV envelope protein described in the fifth aspect, the bispecific antibody described in the sixth aspect, the fusion protein described in the seventh aspect, or the immunoconjugate described in the twelfth aspect;

[0060] 2) Detect whether an antigen-antibody complex is formed. If a complex is formed, it indicates that the HBV full-length envelope protein is present in the sample.

[0061] In the nineteenth aspect, the present invention provides a method for treating a disease, comprising administering to a subject in need thereof a therapeutically effective amount of the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV described in the first aspect, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV described in the second aspect, the single-domain antibody targeting the full-length envelope protein of HBV described in the third aspect, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV described in the fourth aspect, the antibody targeting the full-length envelope protein of HBV described in the fifth aspect, the bispecific antibody described in the sixth aspect, the fusion protein described in the seventh aspect, the immunoconjugate described in the twelfth aspect, or the immune effector cell described in the fourteenth aspect or the pharmaceutical composition described in the fifteenth aspect.

[0062] In a preferred embodiment, the subject comprises a mammal; preferably a human.

[0063] In a preferred embodiment, the disease is a disease associated with the full-length HBV envelope protein; preferably, the disease associated with the full-length HBV envelope protein is a tumor or hepatitis B virus infection.

[0064] In a preferred embodiment, said tumor is liver cancer; preferably hepatocellular carcinoma.

[0065] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] FIG1 shows that the candidate single domain antibodies of the present invention can bind to antigen proteins with high affinity;

[0067] FIG2 shows that the candidate single-domain antibodies of the present invention can bind to the target protein with high affinity at the cellular level;

[0068] FIG3 shows that the candidate single domain antibody of the present invention can specifically bind to the HBV polypeptide-HLA-A02 complex antigen at the cellular level;

[0069] FIG4 shows the expression of the CAR molecule of the present invention on T cells;

[0070] FIG5 shows the killing effect of the CAR-T cells of the present invention on target cells;

[0071] Figure 6 shows that the CAR-T cells of the present invention can effectively recognize T2 loaded with target peptides, activate and transmit immune signals, and secrete IFN-γ and IL-2 cytokines, among which the HBV-CAR-T-02 molecule has relatively better biological activity;

[0072] FIG7 shows that the humanized single domain antibody of the present invention can bind to protein antigens with higher affinity. DETAILED DESCRIPTION

[0073] The MHC class I molecule HLA-A02 can specifically present the GLSPTVWLSV peptide fragment of the full-length HBV envelope protein, allowing HBV antigens to be presented on the cell surface and recognized by antibodies. The present invention uses the HLA-A02 complex of HBV envelope protein-bound peptides as antigens to screen for specific single-domain antibody molecules. These candidate molecules can be used to develop biopharmaceuticals such as bispecific antibodies, CAR-T cells, or ADCs (antibody drug conjugates). The polypeptide sequences utilized in this invention are common to all HBV envelope proteins.

[0074] Specifically, after extensive and in-depth research, the inventors unexpectedly discovered a class of single-domain antibodies that target the full-length HBV envelope protein. These single-domain antibodies bind to the full-length HBV envelope protein with high affinity and good specificity. The present invention also provides bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells, and ADCs prepared using these single-domain antibodies. This work has led to the present invention.

[0075] Definition of terms

[0076] The terms used herein have the same or similar meanings as those commonly understood by those skilled in the art. For the sake of clarity, some of the terms are defined below.

[0077] Single domain antibodies

[0078] In this article, the terms "single-domain antibody," "single-domain antibody," and "nanoantibody" have the same or similar meanings and refer to a class of antibody molecules that lack the light chain and only have the heavy chain variable region. A single-domain antibody is the smallest antigen-binding unit, that is, the smallest antigen-binding fragment with complete function. Typically, antibodies naturally lacking the light chain and heavy chain constant region 1 (CH1) are first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single-domain antibody (VHH) consisting of only a single heavy chain variable region.

[0079] The single-domain antibody VHH chain targeting the full-length HBV envelope protein of the present invention further comprises framework regions FR1, FR2, FR3 and FR4.

[0080] Based on the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the present invention, the inventors also humanized the VHH chain, thereby obtaining the VHH chain of the humanized single-domain antibody targeting the full-length HBV envelope protein.

[0081] Based on the VHH chain or humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the present invention, the present invention also provides an antibody targeting the full-length HBV envelope protein, comprising one or more VHH chains of the single-domain antibody targeting the full-length HBV envelope protein or the humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein. The present invention also provides a bispecific antibody comprising a first antibody and a second antibody, wherein the first antibody may be the VHH chain or humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the present invention. Those skilled in the art can select the second antibody in the bispecific antibody according to actual needs. For example, the second antibody may bind to the same or a different antigen as the first antibody; if the second antibody binds to the same antigen as the first antibody, it preferably binds to a different epitope. In specific embodiments, the second antibody may be a single-domain antibody, a single-chain antibody, or a double-chain antibody.

[0082] Those skilled in the art can also prepare a fusion protein from the single-domain antibody VHH chain or humanized VHH chain targeting the full-length HBV envelope protein of the present invention, for example, a fusion protein further comprising an Fc fragment or half-life extension domain of an immunoglobulin. The fusion protein thus obtained not only possesses the biological activity of the single-domain antibody VHH chain itself, but also possesses other properties conferred by the Fc fragment of the immunoglobulin, such as extended plasma half-life, reduced immunogenicity, improved stability, and the like. In a specific embodiment, the fusion protein comprises the VHH chain or humanized VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the present invention, an optional linker sequence, and an Fc fragment or half-life extension domain of an immunoglobulin. In a specific embodiment, the immunoglobulin is IgG1, IgG2, IgG3, or IgG4; preferably IgG4.

[0083] The present invention includes not only intact antibodies, but also fragments, derivatives and analogs of the antibodies. As used herein, the terms "fragment," "derivative," and "analog" refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present invention. The polypeptide fragments, derivatives, or analogs of the present invention may be (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) polypeptides having a substituent group in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). Based on the teachings herein, these fragments, derivatives, and analogs are within the scope known to those skilled in the art.

[0084] The antibodies of the present invention refer to polypeptides that have binding activity to the full-length HBV envelope protein and include the above-mentioned CDR regions. The term also includes variant forms of polypeptides that have the same function as the antibodies of the present invention and include the above-mentioned CDR regions. These variant forms include (but are not limited to): deletion, insertion and / or substitution of one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids with similar or similar properties generally does not change the function of the protein. For another example, adding one or more amino acids to the C-terminus and / or N-terminus generally does not change the function of the protein. The term also includes active fragments and active derivatives of the antibodies of the present invention. Variant forms of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibody of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using antiserum against the antibody of the present invention.

[0085] In addition to substantially full-length polypeptides, the present invention also encompasses fragments of the single domain antibodies of the present invention. Typically, such fragments comprise at least about 50 contiguous amino acids of an antibody of the present invention, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids.

[0086] In the present invention, "conservative variants of the antibodies of the present invention" refer to polypeptides in which no more than 10, preferably no more than 8, more preferably no more than 5, and most preferably no more than 3 amino acids are replaced with amino acids having similar or similar properties, compared to the amino acid sequence of the antibodies of the present invention. These conservative variant polypeptides are preferably generated by making amino acid substitutions according to the table below.

[0087] The present invention also provides polynucleotide molecules encoding the above-mentioned antibodies or fragments thereof or fusion proteins thereof. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand. Polynucleotides encoding the mature polypeptides of the present invention include: a coding sequence that encodes only the mature polypeptide; a coding sequence for the mature polypeptide and various additional coding sequences; a coding sequence for the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0088] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide or a polynucleotide further including additional coding and / or non-coding sequences. The present invention also relates to polynucleotides that hybridize with the above-mentioned sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0089] The full-length nucleotide sequence of the antibody of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. A feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is short. Generally, by first synthesizing multiple small fragments and then connecting them, a fragment with a very long sequence can be obtained. In addition, the coding sequence of the heavy chain and the expression tag (such as 6His) can be fused together to form a fusion protein. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombination. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the host cells after proliferation by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in isolated form.

[0090] Currently, DNA sequences encoding proteins of the present invention (or fragments thereof, or derivatives thereof) can be obtained entirely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into protein sequences of the present invention by chemical synthesis.

[0091] The present invention also relates to vectors comprising the aforementioned appropriate DNA sequences and appropriate promoters or control sequences. These vectors can be used to transform appropriate host cells to express the protein. Host cells can be prokaryotes, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells of Drosophila S2 or Sf9; and animal cells such as CHO, COS7, and 293 cells.

[0092] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0093] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0094] The recombinant polypeptide in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0095] The antibodies of the present invention can be used alone or in combination with a detectable marker (for diagnostic purposes), a therapeutic agent, a PK (protein kinase) modifying moiety, or any combination thereof. Detectable markers for diagnostic purposes include, but are not limited to, fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing a detectable product.

[0096] Therapeutic agents that can be combined or coupled with the antibodies of the present invention include but are not limited to: 1. radionuclides; 2. biological toxins; 3. cytokines, such as IL-2, etc.; 4. gold nanoparticles / nanorods; 5. viral particles; 6. liposomes; 7. nanomagnetic particles; 8. drug-activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 9. therapeutic agents (for example, cisplatin) or any form of nanoparticles, etc.

[0097] Bispecific antibodies

[0098] Bispecific antibodies are recombinant antibodies that have been engineered through protein engineering. Bispecific antibodies can simultaneously target two different antibody binding epitopes, which can be from different antigens or from the same antigen. Many current studies have shown that bispecific antibodies have great therapeutic potential in the treatment of diseases such as tumors, autoimmune diseases, and viral infections. Compared with monoclonal antibodies, the main advantage of bispecific antibodies is that they can mediate the spatial effects of two recognition epitopes and the synergistic effect of dual targeting, producing biological effects that cannot be achieved by the combined use of two antibodies. A more special bispecific antibody is called a T cell engager, which can simultaneously bind to targets and T cells on the surface of tumor cells, activate endogenous T cells, and cause tumor cell lysis, thereby achieving the purpose of treating tumors. T cell engagers have been proven to be used to treat tumors. A bispecific T cell engager targeting CD20 and CD19 has been approved by the FDA for marketing (Nat Rev Clin Oncol. 2020 Jul; 17(7): 418-434.). Because of its complexity, which is different from that of monoclonal antibodies, bispecific antibodies have higher technical barriers and R&D costs.

[0099] immune cells

[0100] In this article, immune cell and immune effector cell have the same meaning, and are the same as those conventionally understood by those skilled in the art. It refers to cells participating in or associated with an immune response, including lymphocytes and phagocytes. In a specific embodiment, the immune cell refers to lymphocytes that can recognize antigens, thereby producing a specific immune response. The lymphocytes are mainly T lymphocytes, B lymphocytes, K lymphocytes and NK lymphocytes. In addition to lymphocytes, the cells participating in the immune response also have plasma cells, granulocytes, mast cells, antigen presenting cells and cells of the mononuclear phagocyte system (such as macrophages).

[0101] Chimeric antigen receptor T cells

[0102] Chimeric antigen receptor T cell therapy is a very promising cellular immunotherapy. CAR-T cells express CAR (Chimeric Antigen Receptor) molecules. The structure of CAR is divided into: antigen binding region, hinge region, transmembrane domain and intracellular signal transduction domain. Current CAR-T cells usually use scFv (Single Chain Fragment Variables) segments derived from the single chain modification of the antigen binding region of monoclonal antibodies as antigen binding regions. However, when performing scFv structural modification, problems such as reduced affinity and changed specificity are prone to occur. At the same time, scFv has a relatively large molecular weight and is prone to forming multimers, which affects the function of CAR (Nat Rev Cancer. 2021 Mar; 21 (3): 145-161.). Therefore, CAR containing an antigen binding region with a novel structure. Using single domain antibodies to construct a CAR structure, the variable region of the single domain antibody can be directly connected to the CAR structure, which is simple and convenient to design.

[0103] Immunoconjugates

[0104] ADC is an antibody that carries a cytotoxic drug and can deliver the cytotoxic drug to tumor cells to achieve specific killing of tumor cells. ADC drugs targeting targets such as HER2, CD30, and Trop2 have shown good clinical efficacy and safety in clinical studies (Nat Rev Clin Oncol. 2021 Jun; 18(6): 327-344.). In recent years, a number of ADC drugs have been approved by the FDA for marketing. However, the targets of current ADC drugs are all cell membrane proteins, and ADC drugs targeting intracellular proteins are one of the hot directions for future development.

[0105] ADC drugs can specifically target target cells and deliver cytotoxic molecules into them, resulting in a specific killing effect. Cytotoxic molecule-induced cell killing can disrupt and improve the suppressive tumor microenvironment, potentially enhancing the efficacy of other therapies such as immunotherapy. The single-domain antibodies of the present invention can be internalized into cells, thus promising the future development of ADC drugs based on the single-domain antibodies of the present invention.

[0106] The present invention also provides an immunoconjugate comprising a VHH chain, a humanized VHH chain, etc., of a single-domain antibody targeting the full-length HBV envelope protein of the present invention, and a coupling moiety. In specific embodiments, the coupling moiety can be a detectable marker, a drug, a toxin, a cytokine, a radionuclide, or an enzyme, thereby achieving diagnostic, detection, or therapeutic purposes.

[0107] In a preferred embodiment, the immunoconjugate is an antibody-drug conjugate (ADC) or a radionuclide drug conjugate (RDC).

[0108] Pharmaceutical composition

[0109] The present invention also provides a composition. Preferably, the composition is a pharmaceutical composition comprising the above-mentioned antibody, active fragment thereof, or fusion protein thereof, and a pharmaceutically acceptable carrier. Typically, these substances can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, although the pH value may vary depending on the properties of the formulated substance and the condition to be treated. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intratumoral, intraperitoneal, intravenous, or topical administration.

[0110] The pharmaceutical composition of the present invention can directly target the full-length HBV envelope protein expressed by tumor cells. Therefore, the pharmaceutical composition of the present invention can be used to treat tumors. In specific embodiments, the tumor is a tumor associated with the full-length HBV envelope protein. In preferred embodiments, the tumor is melanoma, non-small cell lung cancer, ovarian cancer, or breast cancer. Furthermore, the pharmaceutical composition of the present invention can be used in combination with other therapeutic agents.

[0111] The pharmaceutical composition of the present invention contains a safe and effective amount (e.g., 0.001-99 wt%, preferably 0.01-90 wt%, more preferably 0.1-80 wt%) of the above-mentioned single domain antibody of the present invention (or its conjugate) and a pharmaceutically acceptable carrier or excipient. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should be compatible with the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, using physiological saline or an aqueous solution containing glucose and other adjuvants by conventional methods. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions.

[0112] The active ingredient is administered in a therapeutically effective amount, for example, from about 10 μg / kg body weight to about 50 mg / kg body weight per day. When using the pharmaceutical composition, a safe and effective amount of the immunoconjugate is administered to a mammal, wherein the safe and effective amount is generally at least about 10 μg / kg body weight and, in most cases, does not exceed about 50 mg / kg body weight. Preferably, the dose is from about 10 μg / kg body weight to about 10 mg / kg body weight. Of course, the specific dosage will also take into account factors such as the route of administration and the patient's health status, all of which are within the skill of a skilled physician.

[0113] Reagent test kit

[0114] The present invention also provides a kit containing the VHH chain of the single-domain antibody targeting the full-length HBV envelope protein of the present invention, or a humanized VHH chain, antibody, fusion protein, or immunoconjugate. In a specific embodiment, the kit further includes a container, instructions for use, a buffer, and the like.

[0115] Advantages of the present invention:

[0116] 1. The single-domain antibody targeting the full-length HBV envelope protein of the present invention binds to the full-length HBV envelope protein with high affinity;

[0117] 2. The single-domain antibody targeting the full-length HBV envelope protein of the present invention has good specificity;

[0118] 3. The single-domain antibody targeting the full-length HBV envelope protein of the present invention can be further used to prepare bispecific antibodies, chimeric antigen receptors, chimeric antigen receptor-T cells, and ADCs, thereby laying a new material foundation for the development of therapeutic or diagnostic drugs targeting the full-length HBV envelope protein.

[0119] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0120] Example 1: Acquisition of single domain antibody sequences

[0121] The present invention selects two adult healthy alpacas (Alpaca) as experimental animals for immunization. The alpacas are immunized using a recombinant protein of pMHC (peptide-Major histocompatibility complex) carrying the target polypeptide as an antigen. The present invention performs 4-5 immunizations in total. During the immunization process, peripheral blood of the alpacas is collected at different time points, and the post-immunization titer is detected using the ELISA method. After the immunization cycle, peripheral blood of the alpacas is collected to obtain PBMCs cells, mRNA is extracted and reverse transcribed, and cDNA of the PBMCs cells is obtained. The cDNA is amplified using specific primers to obtain a PCR product with a single-domain antibody gene fragment. The PCR product and the yeast library vector are then introduced into yeast competent cells using an electroporator to prepare a yeast display library.

[0122] The yeast library is then screened using pMHC recombinant proteins carrying the target peptide or T2 cells loaded with the target peptide. The present invention uses pMHC recombinant proteins carrying the target peptide as positive antigens and pMHC recombinant proteins carrying negative peptides as negative antigens. After three rounds of positive and negative screening, single domain antibody clones that specifically bind to the positive antigen but not to the negative antigen are obtained.

[0123] The single-domain antibody clones were subjected to Sanger sequencing to obtain the full-length gene sequences of the single-domain antibodies. Two different single-domain antibody clones were obtained in the present invention, designated LL-HP001 and LL-HP002. The full-length amino acid sequences and CDR region amino acid sequences of the single-domain antibodies of the present invention are shown in Table 1, and the nucleic acid sequences are shown in Table 2.

[0124] Table 1. Amino acid sequences of candidate single domain antibodies

[0125] Table 2. Candidate single domain antibody nucleic acid sequence list

[0126] Example 2: Expression and purification of single domain antibodies

[0127] The two candidate single-domain antibodies of the present invention were expressed and purified using conventional monoclonal antibody expression and purification methods. First, a single-domain antibody expression vector was constructed using molecular cloning technology. After the vector was successfully constructed, the single-domain antibody was expressed using the transient transfection method of the HEK293 suspension cell line. Basic steps: The single-domain antibody gene was cloned into the expression vector pCDNA4 (Invitrogen, Cat V86220). Different single-domain antibodies were expressed using the transient transfection method of HEK293 suspension cells. After expression, the supernatant was collected and the single-domain antibody of the present invention was purified using a conventional monoclonal antibody purification method.

[0128] After purification, the protein concentration and total protein content of the different antibodies were determined using UV spectrophotometry. The expression level of each single-domain antibody was then calculated based on the expression volume. The sample solution absorbance (A280) was measured at 280 nm using a NanoDrop 1000. The protein concentration was calculated using the formula C (mg / mL) = A280 / ε (ε = 1.482 mL / mg·cm-1). The purity of the different antibodies was also assessed using conventional gel electrophoresis (SDS-PAGE). The basic steps were as follows: Samples were separated by electrophoresis using an Invitrogen electrophoresis tank and an SDS-PAGE gradient gel. The sample was diluted to approximately 1 mg / mL, and appropriate amounts of reducing agent, loading buffer, and purified water were added. After mixing, the sample was heated at 70°C for approximately 10 minutes. A sample load of 2 to 10 μg was applied, and the electrophoresis voltage was approximately 200 V for approximately 35 minutes. The gel was then stained and destained. After destaining, the gel was photographed using a conventional gel imaging system, and the purity of the main band was analyzed and calculated. The purity of the different antibodies was then evaluated using size-exclusion high-performance liquid chromatography (SEC-HPLC). The basic steps were as follows: the sample was diluted to approximately 1.0 mg / mL and eluted using a TSKgel G3000SWXL column at 25°C with a mobile phase of 100 mM phosphate buffer, 100 mM sodium sulfate, pH 7.0 ± 0.2, and an injection volume of 20 to 50 μL. The column was eluted isocratically for 20 minutes at a flow rate of 1.0 mL / min. Detection was performed at a wavelength of 280 nm, and the monomer content was determined using peak area normalization.

[0129] The expression levels and purity information for two different single-domain antibodies of the present invention are shown in Table 3. The expression levels of the single-domain antibodies of the present invention were 890 and 826 mg / L, respectively. This demonstrates that the single-domain antibodies of the present invention have high expression levels. The purity of most of the single-domain antibodies of the present invention by reducing SDS-PAGE and SEC-HPLC was above 95%. These results demonstrate that the two single-domain structures of the present invention have good expression levels and high purity.

[0130] Table 3. Expression level and purity test results of single domain antibodies

[0131] Example 3: Detection of the binding ability of single domain antibodies to targets

[0132] This example uses ELISA and flow cytometry to detect the binding ability of candidate single-domain antibodies to target antigens at both the protein and cell levels. The specific steps are as follows:

[0133] 3.1 Protein level binding capacity detection

[0134] 1) Dilute streptavidin SA protein to 0.3 μg / mL with PBS and add 100 μL / well to a 96-well transparent ELISA plate. Seal the plate with sealing film and incubate at 37°C for 1 hour.

[0135] 2) Discard the protein and wash the plate three times with 200 μL PBST solution (PBS containing 0.05% Tween 20);

[0136] 3) Add 100 μL / well of blocking solution (PBS solution containing 2% BSA), seal the plate with sealing film, and incubate at 37°C for 1 hour;

[0137] 4) Repeat the plate washing step 2);

[0138] 5) The biotin-labeled pMHC protein complex loaded with HBV envelope peptide was diluted to 2 μg / ml with blocking solution. 100 μL of diluent was added to each well. The plate was sealed with a sealing film and incubated at 37°C for 1 hour.

[0139] 6) Repeat the plate washing step 2);

[0140] 7) Dilute the candidate single-domain antibody to 12 different concentrations with blocking solution, with the highest concentration being 0.3 μg / mL. 3-fold serial dilutions were added to each well. 100 μL of dilution solution was added to each well. The plate was sealed with sealing film and incubated at 37°C for 1 hour.

[0141] 8) Repeat the plate washing step 2);

[0142] 9) Dilute SA-HRP with blocking solution at a ratio of 1:1000, add 100 μL to each well, seal the plate with sealing film, and incubate at 37°C for 30 minutes;

[0143] 10) Repeat the plate washing step 2);

[0144] 11) Add 100 μL of TMB reaction solution to each well, seal the plate with a sealing film, and incubate on a microplate shaker for 10 minutes. Then, add 100 μL of 2N H2SO4 solution to terminate the reaction. Read the absorbance at 450 nm using a microplate reader.

[0145] The results are shown in Figure 1. The EC50 values ​​of LL-PR001 and LL-PR002 single domain antibodies binding to the antigen protein were 0.00252 and 0.00226 μg / mL, respectively. The results show that both single domain antibodies screened by the present invention can bind to the protein antigen with high affinity.

[0146] 3.2 Cell-level binding ability detection

[0147] 1) Take an appropriate amount of T2 cells (cell bank of Shanghai Institute of Biochemistry and Cell Biology) and adjust the cell density to 2×10 6 / ml, dispensed into 96-well U-bottom plates, 50 μL per well (about 1E5 cells);

[0148] 2) Peptide loading: Prepare a peptide at a concentration of 60 μM in 1640 medium. Add 50 μL / well of the peptide dilution to the plate and mix thoroughly with the cells. Incubate at 37°C for 2 hours to allow the peptide to load onto the T2 cells. Resuspend the cells in 200 μL of 1640 medium, centrifuge at 400 g for 5 minutes, and remove the supernatant.

[0149] 3) Antibody incubation: Adjust the starting concentration of the original antibody to 1 μg / mL using antibody diluent (PBS + 0.5% FBS), dilute 4-fold, and set up 10 concentration gradients. Add 100 μL of the diluted antibody to the previously loaded cells, mix thoroughly by pipetting, and incubate at 4°C in the dark for 60 min.

[0150] 4) Antibody washing: Add 200 μL of antibody diluent to the incubated antibody-cell mixture, centrifuge at 400 g for 5 min, discard the supernatant, resuspend the cells in 200 μL of antibody diluent, and repeat the washing process.

[0151] 5) Secondary antibody incubation: Dilute the fluorescent secondary antibody APC anti-human IgG Fc (BD Biosciences) at 1:200 in antibody diluent, take 100 μL and add it to the cell pellet after discarding the supernatant. After pipetting to mix, incubate at 4°C in the dark for 30 min.

[0152] 6) Secondary antibody washing: Add 200 μL of antibody diluent to the incubated antibody-cell mixture, centrifuge at 400 g for 5 min, discard the supernatant, resuspend the cells in 200 μL of antibody diluent, and repeat the washing process.

[0153] 7) Detection on flow cytometer: Add 100 μL of antibody diluent to each tube to resuspend the cells. Transfer the cell suspension to a flow cytometer and detect the positive labeling rate using a flow cytometer.

[0154] 8) Analyze the data using FlowJo software to obtain the mean fluorescence intensity (MFI). Fit the dose-effect nonlinear curve based on the MFI value and antibody concentration to calculate the EC 50 The antigen affinity activity of the candidate antibody molecule is evaluated.

[0155] The results are shown in Figure 2. LL-PR001 and LL-PR002 single domain antibodies bind to EC of antigen protein at the cellular level. 50 The values ​​were 0.0128 and 0.0161 μg / mL, respectively. The results showed that the two single-domain antibodies screened by the present invention were both able to bind to antigens at the cellular level and had high affinity.

[0156] Example 4: Using T2 cell model to detect the specificity of single domain antibodies for target recognition

[0157] 1) Take T2 cells grown to the logarithmic phase and resuspend them in complete culture medium to 2×10 6 / mL;

[0158] 2) Dilute the target peptide and LL-OTP peptide to 60 μM using culture medium. Mix the peptide dilution with the cell suspension at a 1:1 volume ratio and incubate at 37°C for 1-2 hours to allow the peptide to load onto the T2 cell surface.

[0159] 3) After incubation, the excess peptide was washed with culture medium, the cells were collected by centrifugation, and the cells were resuspended in buffer (PBS solution containing 2% FBS) to 2×10 6 / mL, and the peptide-loaded T2 cells were seeded into a 96-well U-bottom cell culture plate at 50 μL / well;

[0160] 4) Dilute the candidate antibody molecules with buffer to 10 μg / mL, 2 μg / mL, 0.4 μg / mL, and 0.08 μg / mL, respectively. Add 50 μL / well of the antibody dilution to the well plate, mix thoroughly with the cells, and incubate at 4°C for 1 hour.

[0161] 5) Centrifuge at 300g for 5 minutes, remove the antibody diluent, and wash the cells once with 200 μL buffer;

[0162] 6) Dilute the fluorescent secondary antibody APC anti-human IgG Fc (purchased from Biolegend, Cat. No. 366906) in buffer at a ratio of 1:200, add 100 μL / well of the antibody dilution to the well plate, resuspend the cells and mix well, and incubate at 4°C for 30 min;

[0163] 7) Centrifuge at 300 g for 5 min, remove the antibody diluent, and wash the cells once with 200 μL buffer;

[0164] 8) Resuspend the cells in 100 μL of buffer and measure the fluorescence binding intensity in the APC channel using flow cytometry;

[0165] 9) Analyze the data using FlowJo software to obtain the mean fluorescence intensity (MFI) and evaluate the nonspecific binding level of the candidate antibody molecules to the off-target peptides.

[0166] Table 3. Potential off-target peptide sequences used in the present invention

[0167] The present invention tested the off-target effects of two single-domain antibodies. Figure 3 shows the statistical MFI values ​​after data collection, demonstrating the off-target analysis results of the two single-domain antibodies. As shown in Figure 3, the single-domain antibody molecules screened by the present invention have good specificity and are suitable for further development.

[0168] The above results indicate that the single-domain antibodies screened in the present invention can recognize the HBV envelope polypeptide presented by HLA-A02 with high affinity and specificity. In the future, they have the potential to be developed into bispecific antibodies (T cell engagers, etc.) as well as ADCs and RDCs for the treatment of HBV infection or HBV-related cancers, which is of great value.

[0169] Example 5: Design of CAR Sequence Molecules Targeting the Full-Length HBV Envelope Protein and Construction of Lentiviral Vectors

[0170] 5.1 Design of CAR gene sequence targeting the full-length HBV envelope protein

[0171] The CAR targeting the full-length HBV envelope protein comprises a single-domain antibody sequence against the full-length human HBV envelope protein, a CD8 hinge region and a transmembrane domain, a 4-1BB co-stimulatory signaling region, and a CD3zeta signaling domain, which are connected in series. The present invention selected two single-domain antibody sequences and designed two CAR structures. The two different CAR molecules were named: HBV-CAR-01 and HBV-CAR-02, and the amino acid sequences corresponding to different CARs are shown in Table 4. The two CAR gene sequences targeting the full-length HBV envelope protein designed by the present invention were synthesized and subcloned into the pUC57 vector (Suzhou Jinweizhi Biotechnology Co., Ltd.).

[0172] Table 4. Amino acid sequence of CAR targeting the full-length HBV envelope protein

[0173] 5.2 Construction of CAR Lentiviral Vector

[0174] Primers were designed to amplify two different CAR molecules from the pUC57 vector using PCR. The forward and reverse primers were designed to carry homology arms to the lentiviral vector at their 5' ends. The amplified PCR products were analyzed by agarose gel electrophoresis and then purified (Nanjing Novozymes Biotech Co., Ltd., Cat. No. DC301) to obtain DNA fragments. The DNA fragments, recovered by restriction digestion, were cloned into the lentiviral vector via homologous recombination. The lentiviral vector was digested and purified using the restriction endonucleases BamHI (NEB: R3136V) and SalI (NEB: R3138V). This method yielded two different recombinant plasmids: p-lenti-HBV-CAR-01 and p-lenti-HBV-CAR-02. The two lentiviral vectors were sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification. The sequencing primers were: Lenti-seqF: TTGAG TTTGGATCTTGGTTC (SEQ ID NO: 37), Lenti-seqR: CAGCAACCAGGATTTATACA (SEQ ID NO: 38). Sanger sequencing verified that both lentiviral vector plasmids were constructed correctly.

[0175] Example 6: Preparation and functional evaluation of CAR-T cells targeting the full-length HBV envelope protein

[0176] 6.1 Preparation of Lentivirus

[0177] The correct lentiviral plasmids verified by sequencing were transformed into Escherichia coli stbl3 (purchased from Yisheng Biotechnology Co., Ltd.) on the second day. Single clones were picked from the transformed plates and placed in 2 ml liquid LB culture tubes. The culture medium already contained kanamycin (50 ug / ml) and was cultured on a shaker at 37°C and 220 rpm for 8 hours. 1 ml of the activated bacterial solution was inoculated into 250 ml of liquid LB culture medium containing kanamycin and cultured on a shaker at 37°C and 220 rpm for 12-16 hours. Plasmids were extracted using the NucleoBond Xtra Midi Plus (MN, Cat. No. 740412.50) large extraction kit according to the experimental procedure provided by the kit. After plasmid extraction, the plasmid concentration was determined using Nanodrop (Thermo Fisher Scientific) and verified by Sanger sequencing. The supercoiled plasmid content was also detected by DNA agarose gel.

[0178] After the frozen 293T cells (purchased from the cell bank of the Chinese Academy of Sciences) were taken out of liquid nitrogen, they were thawed in a 37°C water bath and the tube mouth was wiped with 75% alcohol. They were transferred to a 15ml centrifuge tube to which 10ml of preheated DMEM complete medium (90% DMEM + 10% FBS + 1% penicillin / streptomycin) had been added. Gently blow it evenly, centrifuge it at 400g for 4 minutes, and then the supernatant was discarded. Then 10ml of DMEM complete medium was added, and after gently blowing it evenly, it was inoculated into a T25 or T75 culture flask and cultured in a cell culture incubator at 37°C containing 5% CO2. The next day, when the cell density reached more than 80%, the cells were passaged and continued to be cultured. 293T cells cultured for more than 3 generations can be used to package lentivirus. The specific steps are as follows:

[0179] 1) On the first day, 293T cells were inoculated at a rate of approximately 1.0 × 10 7 Cells were inoculated into T175 flasks (40 mL culture medium) and cultured until the cell density reached 90% on the second day for transfection.

[0180] 2) The next day, plasmid transfection: Before transfection, replace the culture medium with DMEM supplemented with 10% FBS but without the anti-antibody. Prepare the plasmid complex by adding the following plasmids to 1.5 ml of Opti-MEM (Thermo Fisher Scientific; 31985-070) and mixing thoroughly: 18 μg of psPAX2 plasmid (Addgene; Catalog No. 12260), 9 μg of pMD2.G plasmid (Addgene; Catalog No. 12259), and 18 μg of lentiviral vector plasmid. The lentiviral plasmids are p-lenti-HBV-CAR-01 and p-lenti-HBV-CAR-02. Next, prepare the transfection reagent complex: at a plasmid to PEI mass ratio of 1:3, add 67.5 μL (2 mg / mL) of PEI (Polysciences: 24765) to 1.5 mL of Opti-MEM, mix thoroughly, and let stand at room temperature for 5 minutes. Then, add the transfection reagent complex dropwise to the plasmid complex, mix thoroughly, and let stand for 20 minutes. Finally, slowly drip the transfection complex into the 293T cell culture flask, gently mix, and continue culturing in a 37°C cell culture incubator with 5% CO2.

[0181] 3) On the fourth day, virus collection: 48 hours after transfection, the culture supernatant was collected and centrifuged at 2000 rpm for 10 minutes to remove cell debris. Use a 0.45 μM filter membrane (Millex-HV, product number SLHVR33RB) to filter the supernatant, and transfer the filtrate to a dedicated centrifuge tube for balancing. Use an ultracentrifuge at 25000 rpm for 2 hours. After discarding the supernatant, resuspend the lentivirus in 1 ml of X-VIVO-15 culture medium, and store the lentivirus in a -80°C ultra-low temperature refrigerator. According to this process, prepare lentivirus containing HBV-CAR-01 and HBV-CAR-02 respectively.

[0182] 6.2 Preparation of CAR-T cells and detection of CAR molecule expression

[0183] Prepared lentivirus containing HBV-CAR-01 and HBV-CAR-02 were used to infect primary human T cells to prepare CAR-T cells carrying different CAR genes. The CAR-T cells carrying the two CAR genes were named: HBV-CAR-T-01 and HBV-CAR-T-02, respectively. Untransfected T cells were used as negative controls and named NTD. The specific steps are as follows:

[0184] 1) CD3+ T cells from healthy human peripheral blood (Miaoshun (Shanghai) Biotechnology Co., Ltd.) were resuspended in T cell culture medium containing 300 IU / mL IL-2 to a density of 1×10 6 / mL, add T cell activator CD3 / CD28 magnetic beads (ACRO Biosystems, catalog number: MBS-C001) at a ratio of 1:1 between cells and magnetic beads, mix thoroughly, and then seed the cells in a 6-well plate for culture;

[0185] 2) After 24 hours of T cell activation, the T cells were counted and seeded into a new 24-well plate at a concentration of 500 μl per well, 5 × 10 5 Cells were inoculated into cells / well. After inoculation, 100 μL of lentiviral solution carrying different CAR genes was added to infect T cells. T cells without virus solution were used as negative control NTD. The cells were placed in the incubator for further culture.

[0186] 3) 48 hours after lentiviral infection, cells were aspirated from the culture wells, the magnetic beads were removed by magnetic adsorption using a magnetic stand, and the cells were collected by centrifugation and resuspended in fresh T cell culture medium.

[0187] 4) Simultaneously, 100 μL of the cell suspension containing lentivirus and the negative control were taken, the cells were collected by centrifugation, and the cells were resuspended in 100 μL FACS buffer. APC-labeled pMHC protein complex tetramer was added to each tube of cells, mixed well, and incubated at 4°C in the dark for 30 minutes.

[0188] 5) Wash the cells twice with PBS, resuspend the cells in 100 μL FACS buffer, and detect the expression efficiency of the two CARs on T cells by flow cytometry.

[0189] The results showed that both CAR molecules described in the present invention were successfully expressed on T cells, with relatively consistent expression efficiencies ranging from 30-65% ( FIG. 4 ).

[0190] 6.3 Detection of CAR-T Cell Killing Ability

[0191] This experiment used two HBV target-expressing cell lines as target cells: HepG2.2.15 and PLC / PRF5. HepG2 cells were used as negative cells, and the two CAR-T cells prepared in Example 6 were co-cultured with the target cells to detect the killing effect and evaluate the biological functions of different CAR-T cells. The specific steps are as follows:

[0192] 1) Use lentiviral vector expressing GFP luciferase (GenBank: AAR29591.1) to transfect different target cells to obtain luciferase-labeled cell lines: HepG2.2.15-GFP-luc, PLC / PRF5, and HepG2-GFP-luc;

[0193] 2) HepG2.2.15-GFP-luc, PLC / PRF5 and HepG2-GFP-luc cells were cultured at a cell concentration of 1×10 5 / mL, 50 μL / well was inoculated into a 96-well flat-bottom opaque cell culture plate and temporarily incubated at 37°C;

[0194] 3) Adjust the positive ratio of the two CAR-T cells to 30% using NTD. Set three effector-target ratios of 15:1, 5:1, and 1:1. Inoculate the two different CAR-T cells and control T cell NTDs into the target cells at 50 μL / well and co-culture. After thorough mixing, place the cells in a 37°C incubator and incubate overnight.

[0195] 4) Remove the opaque 96-well flat-bottom plate after co-culture and add 100 μL of an equal volume of D-luciferin substrate (Thermo Fisher Scientific: 88293) to the wells, mix well, and react in the dark for 10 minutes. Detect fluorescence intensity using a microplate reader in chemiluminescence mode. Since luciferase is only expressed in target cells, the remaining luciferase activity in the well is directly related to the number of live target cells. Add culture medium to the target cells to obtain maximum luciferase activity as a control. By subtracting the live cell fluorescence signal value, the target cell apoptosis ratio is calculated, which is the killing effect of CAR-T cells on target cells. The results are shown in Figure 5.

[0196] The results showed that both CAR molecules described in the present invention could mediate T cell killing of cells positive for both targets, but had no killing effect on negative cells, among which PLC / PRF5 cells had the strongest killing effect.

[0197] 6.4 Detection of CAR-T Cell Cytokine Secretion

[0198] To further evaluate the level of target cell-specific activation of the CAR-T cells of the present invention and the release of cytokines, the two CAR-T cells prepared in Example 6 were co-cultured with target cells at a 1:1 effector-target ratio for 24 hours, and the levels of IFN-γ and IL-2 cytokines secreted by T cells in the culture supernatant were measured. The specific steps are as follows:

[0199] 1) Take target cells HepG2.2.15, PLC / PRF5 and HepG2 and resuspend them in complete culture medium to 1×10 6 / mL, the cell suspension was inoculated into a 96-well U-bottom deep-well plate at 100 μL / well;

[0200] 2) After counting the NTD of the two CAR-T cells and the control T cells, the effector-target ratio was 1:1, i.e., the cell concentration was 1×10 6 / mL, 100 μL / well was added to different target cells for co-culture.

[0201] 3) After co-culturing the cells overnight, 50 μL of the culture supernatant was collected and transferred to a new U-bottom 96-well plate. ELISA kits (Thermo Fisher Scientific; Cat. No. 88-7316) were used to detect the secretion of IFN-γ and IL-2 cytokines in T cells. Plate preparation and supernatant cytokine detection were performed according to the instructions provided by the kit.

[0202] 4) Graphpad Prism software was used for data analysis, dose-dependent curve fitting, and EC calculation. 50 value.

[0203] The results are shown in Figure 6. The results show that all candidate CAR-T cells can effectively recognize target cells, activate and transmit immune signals, and secrete IFN-γ and IL-2 cytokines. Among them, the HBV-CAR-T-02 molecule has relatively better biological activity. Based on the above results, the CAR sequence of the present invention has good affinity activity and biological function, suggesting that the CAR molecule of the present invention has the value of further development and application.

[0204] Example 7: Humanization of single domain antibodies

[0205] The present invention humanizes the single-domain antibody candidate molecule LL-PR002. The basic steps are:

[0206] 1) The sequence of the single-domain antibody candidate molecule LL-PR002 was entered into the IMGT database for antibody sequence alignment. Based on the database sequence alignment results, IGHV3-23*04 was selected as the parent vector for the humanization of LL-PR002.

[0207] 2) The CDR region of the LL-PR002 single-domain antibody was transplanted into IGHV3-23*04.

[0208] 3) Refer to the existing technical literature to perform back mutation on the transplanted humanized antibody to ensure the affinity of the humanized antibody.

[0209] By the above method, 12 candidate humanized single-domain antibodies were designed using LL-PR002 as the humanized parent. The antibody sequences are shown in Table 5.

[0210] Table 5. Sequences of humanized single-domain antibodies designed based on LL-PR002 humanized parent

[0211] Example 8: Expression of humanized single domain antibody molecules

[0212] The amino acid sequence of the humanized single-domain antibody molecule was first codon-optimized to obtain a nucleotide sequence. The full-length gene for the humanized antibody molecule was then constructed into a single-domain antibody expression vector via gene synthesis. Following successful vector construction, the single-domain antibody was expressed using transient transfection of HEK293 suspension cells. The specific steps are described in Example 2.

[0213] The expression levels and purities of different humanized single-domain antibodies are shown in Table 6. After expression of the humanized single-domain antibodies of the present invention using a transient expression system, the expression levels of the molecules ranged from 650-850 mg / L, demonstrating that the humanized single-domain antibodies of the present invention have high expression levels. Furthermore, the purities of most humanized single-domain antibodies measured by reducing SDS-PAGE and SEC-HPLC were above 95%. These results demonstrate that the humanized single-domain antibodies of the present invention have good expression levels and high purity.

[0214] Table 6. Expression level and purity detection of humanized single domain antibodies

[0215] Example 9: Detection of the binding ability of humanized single-domain antibody molecules to targets

[0216] In this example, the binding ability of the humanized single-domain antibody molecule to the target antigen was detected by ELISA, thereby determining the affinity of the humanized molecule. For specific experimental steps, please refer to Example 3 3.1. The results showed that the candidate humanized single-domain antibodies obtained after the humanization of the LL-PR002 molecule were able to bind to the protein antigen and had a high affinity (the results are shown in Figure 7), which can be applied to the subsequent research and development of biopharmaceutical projects such as bispecific antibodies, CAR-T, ADC and RDC.

[0217] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A VHH chain of a single-domain antibody targeting the full-length envelope protein of HBV, wherein the VHH chain comprises CDR1, CDR2 and CDR3 as shown in the following table:

2. A heavy chain variable region of an antibody targeting the full-length envelope protein of HBV, wherein the heavy chain variable region comprises CDR1, CDR2 and CDR3 as shown in the following table 3. A single-domain antibody targeting the full-length envelope protein of HBV, comprising the VHH chain of claim 1.

4. A humanized VHH chain of a single-domain antibody targeting the full-length envelope protein of HBV, wherein the framework regions FR1, FR2, FR3 and FR4 are humanized based on the VHH chain described in claim 1.

5. An antibody targeting the full-length envelope protein of HBV, comprising one or more VHH chains of the single-domain antibody targeting the full-length envelope protein of HBV as described in claim 1 or the VHH chains of the humanized single-domain antibody targeting the full-length envelope protein of HBV as described in claim 4.

6. A bispecific antibody, comprising a first antibody and a second antibody, wherein the first antibody comprises the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, or the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, or the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, or the antibody targeting the full-length envelope protein of HBV according to claim 5.

7. A fusion protein, comprising the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, or the antibody targeting the full-length envelope protein of HBV according to claim 5, an optional linker sequence and an Fc fragment of an immunoglobulin or a half-life extension domain.

8. A nucleic acid molecule, which encodes the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6, or the fusion protein according to claim 7.

9. An expression vector comprising the nucleic acid molecule of claim 8.

10. A host cell, comprising the expression vector according to claim 9, or the nucleic acid molecule according to claim 8 integrated into its genome.

11. A method for preparing the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the humanized VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6, or the fusion protein according to claim 7, the method comprising the following steps: 1) Cultivating the host cell as described in claim 10 under suitable conditions to obtain a culture containing the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV, the single-domain antibody targeting the full-length envelope protein of HBV, the humanized VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV, the antibody targeting the full-length envelope protein of HBV, the bispecific antibody or the fusion protein; as well as 2) Optionally, the VHH chain of the single domain antibody targeting the full-length envelope protein of HBV, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV, the single domain antibody targeting the full-length envelope protein of HBV, the humanized VHH chain of the single domain antibody targeting the full-length envelope protein of HBV, the single domain antibody targeting the full-length envelope protein of HBV, the bispecific antibody or the fusion protein is isolated or recovered from the culture.

12. An immunoconjugate, comprising: 1) the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6 or the fusion protein according to claim 7; and 2) A conjugated moiety selected from the group consisting of a detectable label, a drug, a toxin, a cytokine, a radionuclide, or an enzyme.

13. A chimeric antigen receptor, comprising the single domain antibody according to claim 3 or prepared by the single domain antibody according to claim 3.

14. An immune effector cell, which expresses the chimeric antigen receptor of claim 13 on its surface.

15. A pharmaceutical composition comprising a therapeutically or diagnostically effective amount of the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the humanized VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6, the fusion protein according to claim 7, the immunoconjugate according to claim 12 or the immune effector cell according to claim 14, and optional pharmaceutically acceptable excipients.

16. Use of the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the humanized VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6, the fusion protein according to claim 7, the immunoconjugate according to claim 12, the immune effector cell according to claim 14 or the pharmaceutical composition according to claim 15 for preparing the following reagents: 1) Reagents for detecting the full-length HBV envelope protein; 2) Reagents that block the binding of HBV full-length envelope protein to PD-L1; 3) Drugs for treating diseases related to HBV full-length envelope protein.

17. A kit, comprising: 1) the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the VHH chain of the humanized single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6, the fusion protein according to claim 7, the immunoconjugate according to claim 12, the immune effector cell according to claim 14, or the pharmaceutical composition according to claim 15; 2) container; and 3) Optional instruction manual.

18. A method for detecting HBV full-length envelope protein in a sample, the method comprising the steps of: 1) contacting the sample to be tested with the VHH chain of the single domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single domain antibody targeting the full-length envelope protein of HBV according to claim 3, the VHH chain of the humanized single domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6, the fusion protein according to claim 7 or the immunoconjugate according to claim 12; 2) Detect whether an antigen-antibody complex is formed. If a complex is formed, it indicates that the full-length HBV envelope protein is present in the sample.

19. A method for treating a disease, the method comprising administering to a subject in need thereof a therapeutically effective amount of the VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 1, the heavy chain variable region of the antibody targeting the full-length envelope protein of HBV according to claim 2, the single-domain antibody targeting the full-length envelope protein of HBV according to claim 3, the humanized VHH chain of the single-domain antibody targeting the full-length envelope protein of HBV according to claim 4, the antibody targeting the full-length envelope protein of HBV according to claim 5, the bispecific antibody according to claim 6, the fusion protein according to claim 7, the immunoconjugate according to claim 12, the immune effector cell according to claim 14, or the pharmaceutical composition according to claim 15.

Images