Compositions and methods with flavonoids

Abstract

Compositions comprising quercetin and / or quercetin dihydrate and methods particularly useful for preventing hypercoagulation, the methods comprising: administering to a subject in need for treatment for hypercoagulation a composition comprising quercetin and / or quercetin dihydrate; and wherein the composition is administered to the subject orally and in an amount sufficient to overcome or suppress proinflammatory / procoagulant activation of endothelial cells in the subject.

Description

Compositions And Methods With Flavonoids CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to the U.S. provisional application 63 / 535,462 filed August 30, 2023, the entire disclosure of which is herein incorporated by reference in its entirety.INCORPORATION OF ELECTRONIC SEQUENCE LISTING FILE

[0002] The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on August 22, 2024, is named “5781_152733PCT.xml” and is 6,034 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.TECHNICAL FIELD

[0003] This disclosure relates to compositions and methods useful for patients having an increased risk of developing hypercoagulation.BACKGROUND

[0004] Hypercoagulation is a condition in which subject’ s blood coagulates more easily than normal, which may result in formation of a blood clot, leading to life- threatening complications such as stroke, pulmonary embolism, myocardial infraction or a limb ischemia.

[0005] Hypercoagulation may be inherited or acquired. In inherited hypercoagulation, a subject is genetically pre-disposed to hypercoagulation. In acquired hypercoagulation, the condition may develop because of a disease such as for example as cancer or sepsis (acute or chronic), or because a subject is undergoing certain treatment such as for example as anticancer chemotherapy, hormonal contraception or vaccination.

[0006] Various antithrombotic agents are used in order to prevent formation of blood clots in patients who are hypercoagulative, including heparins, DOAC (apixaban), Low Molecular Weight Heparins (tinzaparin, enoxaparin) or Vitamin K antagonists. While these medications have a great benefit for patients at risk of developing blood clots, they also have significant side effects, including the increased risk of bleeding.

[0007] Thus, there remains the need in the field for compositions that can aid hypercoagulative patients.SUMMARY

[0008] In one aspect, this disclosure provides compositions comprising quercetin and / or quercetin dihydrate useful for protecting endothelial cells from procoagulant activation in a subject who is hypercoagulative or has a disease or condition known to cause hypercoagulation, or who undergoes treatment that increases the risk of forming a blood clot.

[0009] In another aspect, this disclosure provides methods for overcoming proinflammatory and procoagulant activation of endothelial cells in a subject. The subjects include human subjects, and in particular human subjects who arehypercoagulative or who may become hypercoagulative because of a condition and / or treatment known to cause hypercoagulation in humans. The methods comprising: administering to the subject a composition comprising quercetin and / or quercetin dihydrate, and one or more excipients; and wherein the composition is administered in an amount sufficient to overcome or suppress proinflammatory / procoagulant activation of endothelial cells in the subject. Preferred embodiments of the method include those, wherein the composition is administered in the amount which is further sufficient for attenuating the procoagulant activity of cancer cells and for blocking at least partially production of thrombin by the cancer cells. Preferably, the composition is administered orally at least once daily at a dosage per one administration in the range from about 100 to about 3000 mg, and more preferably from about 250 to about 3000 mg of quercetin and / or quercetin dihydrate. Most preferably, the composition may be administered up to 3000 mg of quercetin and / or quercetin dihydrate per day.

[0010] Some particularly preferred embodiments of the method include those, wherein the composition is administered at a concentration sufficient to deliver at least 300 micromoles of quercetin dihydrate to the subject’s bloodstream. Some methods may be performed with the composition having bioavailability of at least 10% or higher.

[0011] Suitable compositions for the methods include those wherein the composition comprises solid powder and / or solid granules comprising quercetin and / or quercetin dihydrate, and one or more excipients. Preferably, the composition may be in solid dosage form and the composition may comprise granules containing quercetin and / or quercetin dihydrate and one or more excipients; and wherein the granules are nanoparticles having the size range from about 300 to about 600 nm.

[0012] In certain embodiments of the method, the composition may be dosed from about 200 to about 1000 mg of quercetin and / or quercetin dihydrate per a tablet, soft gel capsule, capsule or sachet.

[0013] In embodiments of the methods, the composition may be administered one or more times daily and the total dosage administered per day may be in the range from about 1000 mg to about 3000 mg of quercetin and / or quercetin dihydrate or from about 2000 mg to about 3000 mg of quercetin and / or quercetin dihydrate.

[0014] Various patients may be treated with the methods according to this disclosure. In particular, the methods may be useful for those patients who are hypercoagulative or may become hypercoagulative because they have a disease or condition and / or they undergo a treatment that may cause hypercoagulation. In particular, the subject may have a cancer, stroke, blood clot(s), autoimmune disease, acute lung infection, viral infection, chronical lung infection, venous thromboembolism (VTE), deep vein thrombosis (DVT) and / or pulmonary embolism (PE), and / or a history of metastatic or non-metastatic cancers, stroke, blood clot(s), autoimmune disease, venous thromboembolism (VTE), deep vein thrombosis (DVT) and / or pulmonary embolism (PE). The cancer may be selected from the group consisting of pancreatic cancers, lung cancers, breast cancers, prostate cancers, colorectal cancers, malignant brain tumors and stomach cancers. In some embodiments, the subject has a cancer and may be undergoing or may be scheduled to receive chemotherapy, and wherein the composition is administered prior to beginning of chemotherapy, preferably at least one week or more prior to the beginning of chemotherapy, during time periods whenchemotherapy is administered and / or after the chemotherapy treatment has been completed.

[0015] In other preferred embodiments, the subject may be undergoing treatment with steroids / steroid derivatives or may have completed receiving a steroid / steroid derivative treatment prior to the administration of the composition.

[0016] In yet another aspect, this disclosure relates to compositions comprising quercetin and / or quercetin dihydrate, and one or more excipients as disclosed in this application. In embodiments, the compositions may include a composition for treating hypercoagulation, the oral composition comprising quercetin and / or quercetin dihydrate, and one or more excipients, wherein the oral composition is formulated in dosages for oral administration, and wherein each dosage comprises 2500 mg or more, e.g. 3000 mg or more, 5000 mg or more of quercetin and / or quercetin dihydrate.

[0017] In yet another aspect, this disclosure relates to methods for preparing the compositions according to this disclosure. The methods may comprise: a) mixing quercetin and / or quercetin dihydrate, one or more hydrophobic stabilizers and a hydrophilic solvent into a mixture; b) milling the mixture into a nanosuspension comprising granules containing quercetin and / or quercetin dihydrate; and c) lyophilizing the granules in the presence of a bulking agent or precipitating the granules from the mixture onto a carrier.

[0018] In yet further embodiment, this disclosure relates to a method of administering a drug to a subject, wherein the drug has a known side effect of forming blood clot, the method comprising:administering to the subject a composition comprising quercetin and / or quercetin dihydrate, and one or more excipients, wherein the composition is administered in an amount sufficient to overcome or suppress proinflammatory / procoagulative activation of endothelial cells in the subject.

[0019] In particularly preferred embodiments of the method, the composition is administered at one or more of the following time periods: i) prior to administration of the drug; ii) during administering the drug; and / or iii) after the administration of the drug has been completed.

[0020] These methods may be performed, wherein the drug is a chemotherapy drug, vaccine, steroid or steroid derivative drug, antibody or a biologic. In some embodiments, the composition may be administered for a period of at least 2 weeks after the administration of the drug has been completed.BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Fig. 1A reports viability studies of BXPC3 cells monitored by a crystal violet assay after 72 h of exposure to enoxaparin, apixaban, tinzaparin or quercetin. Data are shown as % viability compared to an untreated control and are presented as means ± SEM of 3 independent experiments.

[0022] Fig. IB reports viability studies of MCF7 cells monitored by a crystal violet assay after 72 h of exposure to enoxaparin, apixaban, tinzaparin or quercetin. Data are shown as % viability compared to the untreated control and are presented as means ± SEM of 3 independent experiments.

[0023] Fig. 2A reports results of a comparative study of the effect of quercetin, tinzaparin, enoxaparin or apixaban on the procoagulant potential of cancer cells evaluated as the ratio of lag-time prolongation as compared to a control.

[0024] Fig. 2B reports the endogenous thrombin potential in cells treated with quercetin, tinzaparin, enoxaparin or apixaban as compared to a control.

[0025] Fig. 2C reports a thrombin peak reduction by quercetin, tinzaparin, enoxaparin or apixaban as compared to a control.

[0026] Fig. 3 reports the body weight modulation in studies of Example 4.

[0027] Fig. 4 reports the IAV quantification at termination in studies of Experiment 4.

[0028] Fig. 5 reports the platelets activation at termination in studies of Experiment 4.

[0029] Fig. 6 reports the prothrombin time analysis at termination (in s) in studies of Experiment 4.

[0030] Fig. 7 reports the Activated Partial Thromboplastin time analysis at termination (in s) in studies of Experiment 4.

[0031] Fig. 8 reports the peak of thrombin generation at termination (in nM) in studies of Experiment 4.

[0032] Fig. 9 reports the soluble P-selectin analysis at termination in studies of Experiment 4.

[0033] Fig. 10 reports the soluble E-selectin analysis at termination in studies ofExperiment 4.

[0034] Fig. 11 reports the D-Dimer analysis at termination in studies of Experiment 4.

[0035] Fig. 12 reports the TATc analysis at termination in studies of Experiment 4.DETAILED DESCRIPTION

[0036] In this disclosure, the term “subject” includes a “human subject.” In this disclosure, a “human subject” may be referred interchangeably as a patient.

[0037] In this disclosure the term “about” means plus or minus 5% of a value. For example, about 100 means 100±5 and about 200 means 200±10.

[0038] In this disclosure, the term “treatment” means at least partial improvement at least temporarily, e.g., for a few hours, in at least some of symptoms or at least partial prevention or delay, e.g., by one month, of a further decline. The term “treatment” does not necessarily mean cure and it is not limited only to curative outcomes. The term “treatment” also includes prevention of one or more symptoms, such as for example decreasing thrombin production or preventing a further increase in thrombin production.

[0039] “Hypercoagulation” means a condition in which subject’s blood coagulates more easily than normal. The average time range for blood to clot is 10 to 13 seconds. A number lower than that range means that a person is hypercoagulative. In this disclosure, a subject is said to be at risk of hypercoagulative if he / she has a disease or undergoes a treatment known to increase the risk of blood clot formation.

[0040] This disclosure relates to compositions and treatment methods useful for patients who are hypercoagulative or who are having a disease and / or undergo atreatment known to may cause hypercoagulation. Various conditions, including cancers or autoimmune diseases, diabetes and / or certain medications are known to trigger production of thrombin and / or other proinflammatory / procoagulant factors.

[0041] In response to an exposure to thrombin and procoagulant (clotting) factors and / or other inflammatory stimuli, endothelial cells undergo procoagulant activation that results in changes of endothelial cell morphology, including endothelial cell contraction and formation of gaps in cell-cell junctions. This disclosure reports that, unexpectedly, compositions comprising an effective amount of quercetin, preferably quercetin dihydrate, protect endothelial cells from deleterious effects trigged by procoagulant activation factors.

[0042] In one aspect, this disclosure provides methods for overcoming proinflammatory and procoagulant activation of endothelial cells in a subject, preferably in a human subject, and more preferably, wherein the human subject is hypercoagulative and / or the human subject is having a disease and / or is undergoing a treatment known to may cause hypercoagulation. The method comprises administering to the subject a composition comprising: quercetin and / or quercetin dihydrate and one or more excipients; and wherein the composition is administered to the subject in an amount sufficient to overcome or suppress proinflammatory / procoagulant activation of endothelial cells in the subject.

[0043] Quercetin is a flavonoid with CAS Number 117-39-5, found in many fruits, vegetables, leaves, seeds and grains, having a very low bioavailability, as low as less than 1%. Quercetin can be taken as a food supplement in an amount of 25 to 50 milligrams daily.

[0044] Quercetin dihydrate (CAS number 6151-25-3, molecular formula C15H10O7X2H2O, also known under chemical name of 3,3 ,4',5,7-pentahydroxyflavone dihydrate) is a chemically modified form of quercetin.

[0045] Unexpectedly, this disclosure reports that compositions comprising quercetin and / or quercetin dihydrate in an effective amount, which is preferably from about 100 mg to about 3000 mg of quercetin and / or quercetin dihydrate, and more preferably from about 250 mg to about 3000 mg of quercetin and / or quercetin dihydrate daily, more preferably about 1000 mg to about 3000 mg of quercetin and / or quercetin dihydrate daily, and most preferably from about 1000 mg to about 2000 mg of quercetin and / or quercetin dihydrate daily or from about 2000 mg to about 3000 mg quercetin and / or quercetin dihydrate daily, are effective in protecting endothelial cells from proinflammatory / procoagulant activation. In particular, it has been unexpectedly found that the technical effect of overcoming or suppressing proinflammatory and procoagulant activation of endothelial cells may be achieved by administering to a subject up to 3000 mg of quercetin and / or quercetin dihydrate per day. Preferably, the compositions according to this disclosure may be administered at a concentration sufficient to deliver at least 300 micromoles of quercetin dihydrate to the subject’s bloodstream.

[0046] In the methods according to this disclosure, compositions comprising quercetin and / or quercetin dihydrate, and one or more excipients may be administered either alone or in combination with other drugs. Accordingly, methods of these disclosure include those which comprise, consists essentially of, or consist of administering to a subject the composition according to this disclosure.

[0047] Various routes of administration may be suitable, including oral, parenteral, transcutaneous (transdermal), aerosol or intranasal. Preferably, compositions according to this disclosure may be administered orally. Preferred compositions according to this disclosure comprise an effective amount of quercetin and / or quercetin dihydrate and one or more excipients. In this disclosure, excipients may include, but are not limited to, pharmaceutically acceptable carriers, additives, stabilizers, binders, sweeteners, bulking agents (fillers), preservatives, lubricants, flavoring agents, colorants, coatings, and / or buffering agents, among others. The compositions according to this disclosure may comprise one or more of the following excipients: dextran, water, soybean oil, sugars, lactose, sorbitol, calcium carbonate, starch, sucrose, cellulose and its derivatives (micro crystalline cellulose, hydroxy propyl cellulose, cellulose ethers, cellulose esters, ethylcellulose), gelatin, polyvinyl pyrrolidone (PVP), calcium phosphate, calcium sulfate, calcium stearate, metallic oxides, sugar alcohols, artificial sweeteners, glycols (polyethylene glycol, propylene glycol), mineral hydrocarbons (mineral oils, mineral waxes, petrolatum), oleochemicals (lipids, phospholipids, glycerin, glycerol monostearate, mineral stearates, fatty alcohols), proteins, among others. Excipients may be used in various amounts, for example from about 0.1 to about 99 wt % of the dosage.

[0048] Preferably, compositions according to this disclosure may comprise solid powder and / or solid granules comprising quercetin and / or quercetin dihydrate, and one or more excipients. Some particularly preferred compositions have a bioavailability of at least 10% or higher. Such compositions include those wherein the composition comprises granules containing quercetin and / or quercetin dihydrate and one or moreexcipients. Preferably, the granules may be nanoparticles having the size range from about 300 to about 600 nm.

[0049] For oral administration, the compositions according to this disclosure may be dosed from about 200 to about 1000 mg of quercetin and / or quercetin dihydrate, more preferably from about 250 mg to about 500 mg, per a tablet, soft gel capsule, capsule or sachet. Other dosages and formulations can be also used.

[0050] As is shown in this disclosure by a comparative analysis with reference to Figs. 1A-1B and Figs. 2A-2C, the compositions according to this disclosure effectively prevent procoagulant activation of endothelial cells. The protective effect of the compositions according to this disclosure on endothelial cells maybe used to help patients suffering from inflammation, viral infections, preeclampsia, subfertility or idiopathic venous thrombosis and many other diseases and conditions in which a subject has an increased risk of becoming hypercoagulative.

[0051] A person of skill can test whether a composition overcomes or suppresses pro-inflammatory / procoagulant activation of endothelial cells by measuring generation of platelet-derived thrombin. This can be measured by following protocols provided in practical examples of this disclosure. In particular, platelet-free plasma may be mixed with donor platelet-rich plasma diluted to a platelet concentration of 250,000 platelets per microliter in the presence of 5mM GPRP and 6 mM CaCF and then stimulated with 0.1 U / ml of thrombin. Samples may be incubated for 90 minutes at room temperature with rotation, and thrombin levels may be measured using cleavage of a fluorescent thrombin-specific substrate. Rates of substrate cleavage can be used to calculate theconcentration of thrombin in each sample. As a control, a sample prior to beginning of treatment with the composition can be used.

[0052] The treatment methods and compositions according to this disclosure may be useful to subjects who are hypercoagulative or who are having a disease known to may cause hypercoagulation and / or who are undergoing a treatment known to may cause hypercoagulation.

[0053] In particular, the treatment methods and compositions according to this disclosure may be useful for a human subject who has one or more of the following diseases: a cancer, stroke, blood clot(s), autoimmune disease, acute lung infection, chronical lung infection, venous thromboembolism (VTE), deep vein thrombosis (DVT) and / or pulmonary embolism (PE). The treatment methods and compositions according to this disclosure may be also useful for a human subject who has a family history of cancer, stroke, blood clot(s), autoimmune disease, venous thromboembolism (VTE), deep vein thrombosis (DVT) and / or pulmonary embolism (PE). In particular, the compositions and methods according to this disclosure may be helpful to a human subject who one of the following cancers: pancreatic cancers, lung cancers, breast cancers, prostate cancers, colorectal cancers gastric cancers, malignant brain tumors and stomach cancers.

[0054] The compositions and methods according to this disclosure may be useful for subjects who are undergoing a treatment or are taking a drug known to increase the risk of hypercoagulation. These treatments may include chemotherapy, a surgery or taking a vaccine, among others. The compositions and methods according to thisdisclosure may be useful for subjects taking one or more of the following drugs: a chemotherapy drug, vaccine, steroid or steroid derivative drug, antibody or a biologic.

[0055] Accordingly, in another embodiment, this disclosure provides a method of administering a drug to a subject, wherein the drug has a known side effect of forming blood clots, the method comprising: administering to the subject a composition comprising quercetin and / or quercetin dihydrate, and one or more excipients, wherein the composition is administered in an amount sufficient to overcome or suppress pro- inflammatory activation of endothelial cells in the subject. Preferably, the composition may be administered at one or more of the following time periods: i) prior to administration of the drug; ii) during administering the drug; and / or iii) after the administration of the drug has been completed.

[0056] The drugs may include a chemotherapy drug, vaccine, steroid drugs which include steroid derivative drugs, antibody or a biologic, among others.

[0057] In some preferred embodiments, the composition according to this disclosure may be administered to a subject who has a cancer and is undergoing or is scheduled to receive chemotherapy, and wherein the composition is administered prior to beginning of chemotherapy, preferably at least one week or more prior to the beginning of chemotherapy, during time periods when chemotherapy is administered and / or after the chemotherapy treatment has been completed.

[0058] In some preferred embodiments, the composition according to this disclosure may be administered to a subject who is undergoing treatment with steroids / steroid derivatives, such as for example as taking a birth control pill, or whohas completed receiving a steroid / steroid derivative treatment prior to the administration of the composition.

[0059] In yet another aspect, this disclosure relates to methods for producing compositions according to this disclosure. The methods may comprise those in which quercetin hydrate is formulated into nanocrystals. a) mixing quercetin and / or quercetin dihydrate, one or more hydrophobic stabilizers and a hydrophilic solvent into a mixture; b) milling the mixture into a nanosuspension comprising granules containing quercetin and / or quercetin dihydrate; and c) lyophilizing the granules in the presence of a bulking agent or precipitating the granules from the mixture onto a carrier.

[0060] Preferably, the hydrophilic solvent may include water. Preferably, the one or more hydrophobic stabilizers may include a polymer and a surface-active agent. Preferably, the nanosuspension may be milled to obtain granules having the size in the range from about 300 to about 600 nm. Preferably, lactose and micro crystalline cellulose may be used for precipitating the granules from the mixture onto a carrier, but other bulking agents and / or carriers may be also used.

[0061] The invention will now be described in more detail with the following non-limiting examples.Example 1. Materials and Methods for Examples 2 and 3.Cancer cells

[0062] Cancer cells derived from pancreatic cancer (BXPC3) and breast cancer (MCF7) were obtained from American Type Culture Collection (ATCC, Rockville,MD, USA) and studied with respect to their effect on thrombin generation in human normal platelet poor plasma (PPP). Among the above-mentioned cancer cell lines studied at equal cell count, the BXPC3 and MCF7 cells showed the highest and lowest impact on thrombin generation respectively. Since these cell lines stem from cancers with substantially different biological profiles and thrombogenicity, they were evaluated as appropriate to set up an experimental model with high and low procoagulant stimulus. Cells were expanded and cultured as described by our group elsewhere. A volume of 100 pl cell suspension (50 cells / pl) was placed in each well of 96-well plates and cells were incubated for 24 h at 37 °C in a 95% humidified atmosphere with 5% CO2. After 24 h incubation, BXPC3 and MCF7 cells reached 60% of confluence and were assessed according to the experimental protocol.Endothelial cells

[0063] Primary human umbilical vein endothelial cells (HUVEC) were used. HUVEC were cultured in endothelial cell growth media EBM-2 (from Clonetics San Diego, CA, USA) containing 2% fetal bovine serum. Cells of second passage were used for the experiments. Cells were cultured in 25 cm2 culture flasks at 37 °C in a 95% humidified atmosphere with 5% CO2 and were used for experiments at a confluence of 60%. For thrombin generation assessment, the same experimental protocol was used for the HUVEC (50 cells / pl) as for BXPC3 and MCF7 cells.Isolation of cancer cell-derived extracellular vesicles

[0064] Cancer cell-derived extracellular vesicles (CaCe-dEV) were isolated from conditioned media, containing 2% of fetal bovine serum and supplements, from confluent BXPC3, MCF7, by differential centrifugation, as described elsewhere.Briefly, culture supernatants (cell conditioned media) were collected and centrifuged at lOOOxg for 10 min to pellet whole cells and debris. The collected supernatant was recentrifuged at 20000 xg for 1 h at 4 °C to pellet the CaCe-dEV. The clear CaCe-dEV suspension was further centrifuged at 20000 xg for 1 h at 4 °C. The number of EV was measured with flow cytometry and standardized for the mixing experiments. Due to the variability of the EV regarding their dimensions and their activity, and also the limitations of the available assays for the measurement of EV count, the flow cytometry assay warrants an approximate count of EV in each experiment.Normal human plasma

[0065] For thrombin generation experiments, commercially available samples of fresh frozen normal platelet poor plasma (Ref 00539) were purchased from Stago (Genevilliers France).Calibrated automated thrombogram assay

[0066] In each well of the micro-plate, 80 pl of platelet poor plasma (PPP) were mixed with PBS (20 pl). Thrombin generation was initiated by adding 20 pl triggering solution containing CaC12 (16.7mM final concentration) and fluorogenic substrate (Z- Gly-Gly-Arg-AMC, 417 pM final concentration). Thrombin generation was assessed with the Calibrated Automated Thrombogram assay (Thrombinoscope b.v., Diagnostica Stago, Asnieres, France). The following thrombogram parameters were analyzed: the lag-time which is informative of the initiation phase of thrombin generation and is influenced by the tissue factor concentration presented by the studied cells; the endogenous thrombin potential (ETP) which is informative of the total enzymatic work of thrombin during its presence in plasma; and the Peak of thrombin.Cell-based model for thrombin generation

[0067] The studied cell lines (BXPC3, MCF7 or HUVEC) following detachment from the culture flasks, were placed in each well of microtiter plates suitable for thrombin generation assessment where they were incubated for 24 h. Afterwards, 80 pl of normal PPP were added in each well and thrombin generation was assessed as described above. In the control experiments, wells were filled with culture medium without cells and treated in the same way as the experiments. PBS (20 pl) was used in the control experiment. Each experiment was repeated 10 times. No significant difference was found between the two experimental procedures (data not shown). In preliminary experiments, we also verified that the culture medium (solution of RPMI, glutamine, penicillin, streptomycin and bovine fetal serum) did not influence thrombin generation process of normal PPP.Example 2. Experimental Model for Protecting Endothelial Cells from Cancer Induced DamageFirst experimental system

[0068] Day 0: Culture of cells in the presence of quercetin (Q), enoxaparin (E), tinzaparin (T), or apixaban (A) for 3 days

[0069] Day 3:• Isolation of the microvesicles (MV) from the conditioned media• Transfer of cells to ELISA microwells

[0070] Day 4: Assessment of thrombin generation of normal human platelet poor plasma (PPP) in the presence of cells pretreated with Q, E, T or ASecond experimental system

[0071] Day 0: Culture of cells

[0072] Day 1 : addition of Q, E, T, or A in the cultures

[0073] Day 5:• Isolation of the micro-vesicles (MV) from the conditioned media• Transfer of cells to ELISA microwells and assessment of thrombin generation

[0074] The two experimental procedures yielded the same results.Exposure of endothelial cells to CaCe-dMV

[0075] DayO: Culture of HUVEC in the presence of quercetin (Q), enoxaparin (E), tinzaparin (T), or apixaban (A) or saline (control) for 3 days.

[0076] Day 3:• Addition of the CaCe-dMV and culture for 48h

[0077] Transfer of cells to ELISA microwells

[0078] Day 4: Assessment of thrombin generation of normal human platelet poor plasma (PPP) in the presence of cells pretreated with Q, E, T or A.Example 3. Results and Discussion of Studies1. Effect of antithrombotic agents and quercetin and / or quercetin dihydrate on the viability of cancer cells

[0079] Quercetin, preferably quercetin dihydrate, and tinzaparin significantly reduced the viability of cancer cells. The kinetic analysis showed that the maximum effect of the studied pharmacological agents on the viability of cancer cells was manifested upon 72h of exposure. Exposure of cancer cells (BXPC3 or MCF7) toquercetin resulted in a significant reduction of their viability. The decrease of cell viability induced by quercetin was 46% in BXPC3 cells and 57% in MCF7 cells. Concentration response curves showed that the efficacy of quercetin is significant at concentrations equal or higher than 300 pM.

[0080] Exposure of cancer cells to tinzaparin also significantly reduced the viability of the BXPC3 and MCF7 cells. Tinzaparin reduced by 53% the viability of BXPC3 and by 28% that of MCF7. The effect of tinzaparin was similar to that of quercetin, preferably quercetin dihydrate, on BXPC3 cells. Tinzaparin had a less important effect on MCF7 viability as compared to quercetin. Treatment of cancer cells with enoxaparin or apixaban did not significantly affect the viability of BXPC3 or MCF7 cells.

[0081] The studied pharmaceutical agents had no significant effect on the viability of normal endothelial cells (HUVEC). The comparative effect of treatment with quercetin, preferably quercetin dihydrate, enoxaparin, tinzaparin and apixaban on BXPC3 and MCF7 viability is shown in Figs. 1A and IB, respectively.2. Impact of exposure of cancer cells to antithrombotic agents and quercetin and / or quercetin dihydrate on thrombin generation.

[0082] The control experiments (contact of cancer cells without any antithrombotic agent or quercetin) showed that: a) both BXPC3 and MCF7 cells significantly enhanced thrombin generation of normal human PPP as compared to the control experiment. This difference is manifested on the lag-time of thrombin generation. In previous studies we haveshown that the impact of BXPC3 and MCF7 cells on the lag -time depends on the concentration of TF expressed by the cells. b) BXPC3 cells showed a more potent procoagulant activity as compared to MCF7 cells. Previous studies from our group showed that BXPC3 cells express significantly higher amount of TF as compared to MCF7 cells. c) BXPC3 cells but not MCF7 yielded a similar lag-time of thrombin generation as compared to that obtained by adding physiologically relevant concentrations of TF (5pM) and procoagulant phospholipids (4 pM) in normal human PPP.

[0083] Exposure of BXPC3 cells to quercetin as compared to the control experiment (BXPC3 control) resulted in: a) significant prolongation of the lag-time (by 1.16-fold); and b) non-significant reduction of the ETP (7.7%) and the Peak of thrombin (10%).

[0084] Exposure of MCF7 cells to quercetin as compared to the control experiment (MCF7 control) resulted in: a) significant prolongation of the lag-time (by 1.6-fold); and b) significant reduction of the ETP (30%) and the Peak of thrombin (41%).

[0085] Exposure of BXPC3 cells to tinzaparin as compared to the control experiment (BXPC3 control) resulted in: a) significant prolongation of the lag -time (by 1.12-fold); and b) non-significant reduction of the ETP (8%) and the Peak of thrombin (10%).

[0086] Exposure of MCF7 cells to tinzaparin as compared to the control experiment (MCF7 control) resulted in: a) significant prolongation of the lag-time (by 1.6-fold); andb) significant reduction of the ETP (20%) and the Peak of thrombin (31%).

[0087] Exposure of BXPC3 cells to enoxaparin as compared to the control experiment (BXPC3 control) had no significant effect on thrombin generation.

[0088] Exposure of MCF7 cells to enoxaparin as compared to the control experiment (MCF7 control) resulted in: a) no significant prolongation of the lag-time (by 1.07-fold); b) significant reduction of the ETP (24%) and the Peak of thrombin (35%).

[0089] Exposure of BXPC3 cells to apixaban as compared to the control experiment (BXPC3 control) resulted in: a) no significant modification of the lag -time; and b) no significant modification of the ETP and the Peak of thrombin.

[0090] Exposure of MCF7 cells to apixaban as compared to the control experiment (MCF7 control) resulted in: a) significant prolongation of the lag -time (by 1.2-fold); and b) significant reduction of the ETP (23%) and the Peak of thrombin (35%).

[0091] Concentration response curves showed that the efficacy of quercetin was significant at concentrations equal or higher than 300 pM. Figs 1A and IB depict the comparison of the effect of quercetin, tinzaparin, enoxaparin and apixaban on the procoagulant potential of cancer cells.

[0092] Data from these experiments are summarized in Table A.Table A. Impact of treatment with quercetin or antithrombotic agents on the potential of cancer cells BXPC3 and MCF7 to trigger thrombin generationLag-time (min)2.33 ± 0.5±2.33 ± 0.2 3.00 ± 0.5* 2.06 ± 0.2 2.06 ± 0.12.1 0.1 *ETP (nM«min) 1882 ± 80 990 ± 0.5 1452 ± 50 1340 ± 50 1336 ± 50 1426 ± 90Peak (nM) 385 ± 20 87 ± 0.5 161 ± 10 144 ± 6* 131 ± 7* 169 ± 6 177 ± 20Lag-time_(min)2.33±0.53047 ± 1 L84 ±1 8 61 ± p13.33 ±12 78 ± 1 114.33 ±ETP (nM«min)1882 ± 80 990 ± 0.5 945 ± 0.5 735 ± 0.5* 717 ± 0.5* 729 ± 7*0.5**Peak (nM) 385 ± 20 87 ± 0.5 73 ± 7 43 ± 5*$50 ± 5* 47 ± 5* 51 ± 5* ata are mean ± sd from 10 different experiments.3. Effect of quercetin and / or quercetin dihydrate and apixaban on endothelial cells exposed to cancer cell derived microparticles

[0093] Exposure of native HUVEC to quercetin or apixaban did not affect their effect on thrombin generation as compared to the control experiment.

[0094] The exposure of HUVEC to BXPC3 CaCe-dEV resulted in a significant decrease of the lag-time of thrombin generation (Fig. 2A) and a significant increase of the Peak of thrombin as compared to non-exposed HUVEC (Fig. 2C).

[0095] The lag-time of thrombin generation induced by HUVEC pre-treated with quercetin and exposed to BXPC3 CaCe-dEV was significantly longer (Fig. 2A) and the Peak of thrombin (Fig. 2C) was significantly lower as compared to those obtained by HUVEC non-treated with quercetin exposed to BXPC3 CaCe-dEV.

[0096] The lag-time of thrombin generation induced by HUVEC pre-treated with apixaban and exposed to BXPC3 CaCe-dEV (Fig. 2A) was similar to that observed in the experiments with HUVEC non-treated with apixaban and exposed to BXPC3 CaCe- dEV. The Peak of thrombin (Fig. 2C) was significantly lower as compared to thatobtained by HUVEC non-treated with quercetin exposed to BXPC3 CaCe-dEV. ThePeak (Fig. 2C) was similar to that obtained by HUVEC pre-treated with quercetin.

[0097] The exposure of HUVEC to MCF7 CaCe-dEVs was not associated with any significant change of thrombin generation as compared to that obtained by nonexposed HUVEC. Pretreatment with either quercetin or apixaban did not significantly modify the effect of HUVEC exposed to MCF7 CaCe-dEV.

[0098] Concentration response curves showed that the efficacy of quercetin is significant at concentrations equal or higher than 300 pM. Results are summarized in Table B below.Table B. Impact of HUVEC ptre-treated with quercetin or apixaban and exposed to BXPC3 or MCF7 CaCe-dMV on thrombin generationData are mean ± sd from 10 different experiments. *p<0.05 vs HUVEC$p<0.05 vs HUVEC / CaCe-dEV4. Discussion

[0099] As shown in Figs. 1A and IB, treatment of cancer cells with quercetin, preferably quercetin dihydrate, or tinzaparin resulted in reduced viability of cancer cells.In contrast, enoxaparin and apixaban did not show any significant effect on cancer cell viability. The effect of quercetin and tinzaparin on cell viability is specific for the cancer cells since these agents did not show any significant effect on HUVEC.[000100] Quercetin, preferably quercetin dihydrate, had a significant deleterious effect on the survival of both pancreatic cancer cells (BXPC3) and non-invasive breast cancer cells (MCF7). This was a significant improvement in comparison tinzaparin whose effect was cancer cell-type specific. Enoxaparin and apixaban did not show any significant effect on cancer cell survival at all.[000101] The effect of quercetin, preferably quercetin dihydrate, on cancer cell survival was more potent than that of tinzaparin. The efficacy of quercetin was less influenced by the type of cancer cell as compared to tinzaparin. No class effect of LMWHs on cancer cell survival was found; tinzaparin had a distinct effect as compared to enoxaparin. The specific factor Xa inhibitor apixaban did not affect the survival of cancer cells.[000102] Advantageously, treatment of cancer cells with quercetin, preferably quercetin dihydrate, resulted in the attenuation of their procoagulant potential on thrombin generation of human plasma. Quercetin, preferably quercetin dihydrate, attenuated at the similar degree the procoagulant potency of BXPC3 and MCF7 cells. Pre-treatment of cancer cells with quercetin, preferably quercetin dihydrate, affected mainly the initiation phase of thrombin generation. The impact of quercetin pretreatment on the initiation phase of thrombin generation was not affected by the type of cancer cells since the prolongation of the lag-time was similar in BXPC3 and MCF7 cells.[000103] As reported in Figs. 2A-2C, pretreatment of MCF7 cells with quercetin, preferably quercetin dihydrate, significantly decreased the Peak of thrombin and the ETP.[000104] Most importantly, quercetin, preferably quercetin dihydrate, has a more potent impact than tinzaparin on attenuation of the procoagulant potency of cancer cells. [000105] As shown in Figs. 2A-2C, pretreatment with quercetin, preferably with quercetin dihydrate, could protect endothelial cells from the deleterious effect of the exposure to CaCe-dMVs. In this experiment, thrombin generation was used as marker of acquisition of procoagulant properties by endothelial cells. Pretreatment of endothelial cells with quercetin, preferably quercetin dihydrate, prevented procoagulant transformation of endothelial cells upon exposure to BXPC3 CaCe-dMV. In contrast, pretreatment with apixaban did not prevent the procoagulant transformation of endothelial cells induced by BXPC3 CaCe-dMV.[000106] With certain embodiments being described in detail above, a person of skill would appreciate that this invention also includes embodiments with various obvious modifications as would be easily apparent to a person of skill.Example 4. Evaluation Of The Effects Of Administration Of Quercetin On Coagulation Markers In An Influenza Hemagglutinin 1 And Neuraminidase 1 (H1N1) Model.[000107] The following abbreviations may be used in this Example and elsewhere in this application:APTT - Activated Partial Thromboplastin TimeBSA - Bovin Serum AlbuminBW - Body WeightCD40L - Cluster Differentiation 40 LigandCmax - Maximum ConcentrationDAD - Dead After DosingDMSO - Dimethyl sulfoxideDVT - Deep Vein ThrombosisEHG - Euthanized on Humane GroundsELISA - Enzyme-Linked ImmunoSorbent AssayFELASA - Federation of European Laboratory Animal Science AssociationsFSC - Forward light scatterGLP - Good Laboratory PracticeGP - GlycoproteinH1N1 - Hemagglutinin 1 and Neuraminidase 1HEP - Humane End PointsHEPES - 4-(2-Hydroxyethyl)-l -piperazine ethane sulfonic acidIAV - Influenza A virusI2M - Influenza, Immunity and methabolismIC50 - half-maximal Inhibitory ConcentrationIN - Intra-nasalIP - IntraperitonealIV - IntravenousNA - Not ApplicableNo. - NumberOECD - Organization for Economic Co-operation and DevelopmentPBS - Phosphate Buffer Saline PE - Pulmonary Embolism PFU - Plaque Forming Unit PO - Per osPT - Prothrombin TimeQA - Quality AssuranceROA - Route Of AdministrationRT - Room TemperatureSOP - Standard Operating ProcedureSSC - Side light scatterTATc - Thrombin anti-thrombin complexTGA - Thrombin Generation AssayVTE - Veinous Thromboembolism[000108] The aim of this study was to evaluate the effects of IP administrations of 2 doses of quercetin (10 and 100 mg / kg) on platelets and coagulation factors activation in a mouse model of influenza. An additional group was included to evaluate the effect of PO administration of quercetin at 100 mg / kg.[000109] In this study, Influenza H1N1 in phosphate buffer saline (PBS) were administered intranasally at day 0 to mice except for mice from group IM which received only PBS. From day 1 to day 7, vehicle (Water with DMS0 16.67%) was administered IP for groups IM and 2M. Quercetin at 10 mg / kg and 100 mg / kg was administered IP to mice from groups 3M and 4M, respectively. Additionally, quercetin at 100 mg / kg was administered PO to mice from group 5M. Mortality, morbidity andBody weight (BW) measurements were followed all along the study. Clinical signs were performed 3 times a week. At termination, blood was collected by retro-orbital bleeding thirty minutes after the last administration for all groups except group 5M, which was collected 1 hour after the last oral treatment. Pro-thrombin time (PT) and activated partial thromboplastin time (APTT) were evaluated in whole blood using a specific reader. Platelets activation was also evaluated in whole blood using flow cytometry by assessing Glycoprotein lb (GPIb) as a platelet marker and GPIIb / IIIa. Plasma was collected to evaluate the secretion of soluble P-selectin, E-selectin, D- Dimer, Thrombin anti-thrombin complex (TATc) and soluble CD40 Ligand (CD40L) using ELISA method. Furthermore, thrombin generation was also evaluated using a thrombin generation assay (TGA) kit. Additionally, lungs were collected to evaluate the viral load in the different conditions by RTqPCR.[000110] The following results were reported. Influenza H1N1 infection induced a significant BW loss from day 3 after the infection until termination at day 7. The infection level was confirmed by the significant increase of viral load in the lung at day 7. Additionally, Influenza H1N1 infection induced a significant increase of soluble P- selectin, E-selectin, D-Dimer and TATc concentrations. Treatments with quercetin, whatever the dose or the route of administration, did not impact BW loss or IAV quantification. The intraperitoneal administration of quercetin at 10 and 100 mg / kg did not modulate the prothrombogenic state induced by the influenza infection. Interestingly, when quercetin was administered orally at 100 mg / kg, this treatment successfully inhibited and even almost restored some of these pro-coagulant markers, such as P-selectin, E-selectin, D-Dimer and TATc.[000111] In conclusion, Influenza H1N1 infection induced the activation of coagulation markers which atest of a strong pro-thrombogenic state. Quercetin treatments, whether administered orally or intraperitoneally, were well tolerated. Interestingly, only the oral treatments significantly inhibited some of the coagulation markers. As there was no direct antiviral effect, as assessed by the viral load at day 7 and similar BW loss, the inhibition of these markers seems to be related to an antithrombotic effect. Furthermore, as only the oral treatment demonstrated this reduction of coagulation markers, this suggests that the effect is likely mediated by the metabolization of quercetin in the gastrointestinal tract. Thus, after oral administration, it was observed a non-described pharmacological activity of Quercetin, in decreasing the levels of selectins and D-Dimers which might be useful in prevention of clots formations in immunological disorders. Additionally, a pharmacokinetic study will be required to complete the pharmacokinetic data of quercetin after oral or intraperitoneal treatment.[000112] This study will now be described in more detail with the references to Figs. 3 to 12.[000113] Study variable and endpoints included:Body weight (BW) measurement and mortality / morbidity check (every day); Clinical signs and Humane end points (HEP) (three times a week);PT, APTT in whole blood at termination;Platelet activation using flow cytometry at termination;Concentration of soluble P-selectin, E-selectin, D-Dimer, TATc and CD40L at termination in frozen plasma;Thrombin generation at termination in frozen plasma; andCollection of lungs for Influenza A virus (IAV) quantification at termination.RATIONALE FOR EXPERIMENT DESIGN[000114] Principle of the test. The principle of the test was based on the infection of C57BL / 6J mice with influenza H1N1 virus. During severe Influenza infection, an imbalance between coagulation and fibrinolysis has been observed. Influenza has been demonstrated to prolonged PT and APTT and induce the activation of platelets8,9.[000115] After mice infection, quercetin at 10 and 100 mg / kg was administered IP and quercetin at 100 mg / kg was administered PO once a day to mice until termination (total of 6 administrations per mouse for each group). Clinical parameters (BW, clinical signs) were followed to assess the severity of the infection until termination. At termination, blood was collected and PT, APTT (using qLABS® Q3-Vet analyzer) and platelets activation (using flow cytometry) was evaluated in whole blood. Soluble P- selectin, E-selectin, D-Dimer, TATc and CD40L were evaluated in frozen plasma by ELISA. Thrombin generation was also evaluated in frozen plasma using a TGA kit. These markers enabled us to evaluate the inhibitory effect of quercetin administration on platelets activity and the impact of treatments on viral load.[000116] Justification for the selection of the present model. The C57BL6 / J mouse strain was used. C57BL6 / J mice are adapted to the infection of Influenza A virus. This is the main model used in the I2M laboratory.[000117] Rationale for test group size. The number of groups and the total number of animals is the minimum number of animals per group sufficient to obtain indicative / significant information.[000118] Rationale for model inducer. Mice were infected with the pathogenic murine-adapted H1N1 influenza A virus strain pandemic 2009 (pdm09). A sublethal dose of 10 000 plaque forming units (PFU) of virus was used to induce a severe infection.[000119] Rationale for route of administration. Mice were treated intraperitoneally to reach sufficient concentration of quercetin in blood. Indeed, through oral administration, quercetin exhibits low bioavailability due to gastric bypass. In forthcoming studies, a novel formulation will be devised to enhance resistance and improve oral bioavailability, given our focus on an oral treatment approach in humans. [000120] The H1N1 virus stock solution was diluted in PBS to obtain 10 000 PFU in 50pL. H1N1 was administered intranasally (IN) to mice from groups 2M to 5M (50 pL).[000121] Mice from group IM received PBS in the same way (50pL).[000122] Quercetin supplied as powder was weighted and diluted adequately in DMSO as a stock solution at 30 mg / mL. Then, quercetin was diluted in water to administrate the dose of 10 mg / kg for group 3M and the dose of 100 mg / kg for groups 4M and 5M. For these groups treated with quercetin, the concentration of DMSO was 16.67% which is minimum DMSO concentrations achievable.[000123] Water for injection (supplied as “ready to use”) diluted in DMSO to achieve a 16.67% concentration was the vehicle for treatments of groups IM and 2M.[000124] The modified Tyrode’s Buffer was composed of 10 mM HEPES, 137 mM sodium chloride, 2.8 mM potassium chloride, 1 mM magnesium chloride, 12 mM sodium.[000125] Hydrogen carbonate, 0.4 mM sodium phosphate dibasic, 5.5 mM glucose, 0.35% weight / volume BSA at pH 7.4 and filtered through a 0.22 pM filter.[000126] Animal handling was performed according to guidelines of the Federation of European Laboratory Animal Science Associations (FELASA). Animals were housed in plastic cages (5 mice per cage maximum) with stainless steel top grill facilitating pelleted food and drinking water in plastic bottle; bedding: steam clean paddy husk (Safe) was used and bedding material was changed along with the cage at least once a week.EXPERIMENTAL DESIGN AND CONDITIONS[000127] Humane end points. Three times per week, the personnel observed the animals for any moribund sign. All animals were evaluated and recorded for signs of severe pain and distress using the scoring criteria below (Table 1). No animal was euthanized due to ethical reasons for this study, with a total score for each mouse always below 5 all along the study.Table 1. Humane End Points[000128] Study initiation. The IAV infection was defined in this study as “Day 0” and study termination as “Day 7”.[000129] IAV procedure. All procedures were performed under biosafety cabinet 2. For the viral infection, mice were anesthetized by intraperitoneal injection of 1.25 mg of ketamine plus 0.25 mg of xylazine in 250 pL of phosphate buffered saline (PBS). Then, mice were intranasally infected with 50 pL of PBS containing 10 000 PFU of the H1N1 virus. Animals were infected once on day 0 (group 2M, 3M, 4M and 5M). For group IM (non-infected), 50 pL of PBS were intranasally administered.[000130] Treatment administration. Treatments were administered in mice 24h after IAV infection (Day 1), and then once a day until termination (Day 7). Vehicle (water with DMSO at the same concentration used for test item treatments; i.e 16.67 %) was administered IP to mice (groups IM and 2M). Quercetin with 16.67% of DMSO was administered intraperitoneally at 10 mg / kg (group 3M), 100 mg / kg (group 4M).Quercetin in DMSO 16.67% was also included with an oral administration at 100 mg / kg (group 5M).[000131] Study Design and Timeline. The study was conducted in 2 cycles, to reduce blood conservation and flow cytometry processing to minimize artificial activation of platelets, according to Table 2 for study design and Table 3 for study timeline.Table 2. Study DesignTable 3. Study TimelineTESTS AND EVALUATIONS[000132] Morbidity and mortality observation. Morbidity and mortality were recorded daily during the study.[000133] Body weight. Body weight was recorded before study initiation, and once a day thereafter according to 4P-Pharma’s SOP No. 010 “Weighing Laboratory Animals”.[000134] Study termination. Treatments administration of day 7 was performed sequentially to collect blood for each mouse at the Cmax of Quercetin (around 30 minutes after IP administration or 1 hour after PO administration). Mice were anesthetized by isoflurane for blood collection at termination. To minimize artificial activation of platelets, this study was performed in 2 cycles (reduction of time for blood conservation and flow cytometry processing). Blood was collected by retro-orbital bleeding in citrate tube 0.5 mL. Tubes were fulfilled to respect the ratio 1:9 of sodium citrate and blood to prevent activation of blood platelets. Following blood collection, animals were euthanized and lungs were harvested, weighed and snap frozen in liquid nitrogen for IAV quantification.[000135] Platelets coagulation factors analysis. TP and APTT were measured with qLABS® Q3-Vet using adequate strips. A subcontractor evaluated these parameters on site immediately after blood sampling.[000136] Platelet activation in whole blood and staining procedure for Flow cytometry. Platelets activation was evaluated without any stimulation after blood collection to determine the activation induced by the H1N1 virus. Blood was kept at room temperature (RT) and processed immediately after blood collection. To minimizeartefactual platelet activation, no step of washing or centrifugation was performed. Modified Tyrode’s buffer was used to avoid any interferences with platelets activation and to prevent clotting. Experiments were performed under a biosafety cabinet level 2. [000137] For staining process, blood was diluted 1: 10 in modified Tyrode’s buffer. First, 5pL of each antibody (GPIb and GPIIb / IIIa antibodies) were added in each reaction tube. 40 pL of diluted blood were added to perform the staining in a final volume of 50 pL. Samples were incubated for 15 minutes at room temperature in the dark. Then, 1 mL of PBS (without calcium and magnesium) was added to stop the reaction. Samples were immediately used for flow cytometry analysis on the LSRFortessa machine (BD Biosciences) at the platform of the BioImaging Center of Lille (BICeL).[000138] The platelets were distinguished from other cells based on forward light scatter (FSC) vs. side light scatter (SSC) plot characteristics on a log / log scale (doublet cells were excluded from the analysis by analyzing SSC-H vs SSC-A) and by positive staining with GPIb antibody. Upon stimulation, GPIIb / IIIa undergoes a conformation change which switch from an inactive form (low affinity to fibrinogen) to an active form (high affinity to fibrinogen). The detection of the active form of GPIIb / IIIa (GPIIb / IIIa+ cells) allows the detection of active platelets. The percentages of GPIb+ / GPIIb / IIIa+ platelets were calculated relatively to the total number of platelets (GPIb+ cells) present in each sample.[000139] Additional conditions were used for flow cytometry controls and compensations settings. Unstained cells serve to detect autofluorescence or background staining innate to the cells of interest. Isotype controls serve to determine whetherfluorescence emitted is due to non-specific binding of the fluorescent antibody. Singlecolor controls were used for compensation from spectral overlap between the stains.[000140] Plasma preparation for quantification of soluble markers of platelet activation and thrombin generation. Blood collection tubes (after sampling for platelets activation evaluation) were centrifugated 15 minutes at 1500 g at 4°C for plasma separation. Plasma was harvested and transferred immediately to clean 1.5 mL Eppendorf tubes and stored at -70±10°C for assessment of soluble P-Selectin, E- selectin, D-Dimer, TATc, CD40L and thrombin generation.[000141] Plasma was diluted appropriately to detect soluble P-Selectin, E- selectin, D-Dimer, TATc and CD40L using ELISA kits. Thrombin generation was evaluated using TGA kit. ELISA and TGA kit were performed according to manufacturer instructions.[000142] IAV quantification. Lung samples for RNA extraction were cut in small parts and transferred in CK28 lysis tubes (Precellys) containing 500 pL of RNA Lysis Buffer (from SV total RNA isolation System, Promega). Samples were grinded using Precelyss homogenizer with 3 cycles of agitation at 5,500 rpm during 10 seconds. Samples were put on ice, transferred in Eppendorf tubes and centrifugated at 11,000g for 5 minutes at 4°C. Supernatants were collected in new Eppendorf tubes and kept at -70±10°C until analysis.[000143] RNA extraction was performed according to the manufacturer’s instructions (SV total RNA isolation System, Promega) for RTqPCR analyses and the extracted RNAs were quantified using a Nanodrop. The reverse transcription was performed on 1 pg of RNA in 20 pL final volume per tube. The program used for reversetranscription was 1 hour at 37°C followed by 15 minutes at 70°C, on Mastercycler gradient by Eppendorf. The samples were cooled to 4°C and then frozen at -20°C waiting for qPCR analyses.[000144] qPCR (kit PowerTrack SYBR Green master mix from Applied biosystems) was carried out using specific primer for IAV gene (Forward: AAGAACAATCCTGTCACCTCTGA (SEQ ID NO: 1); Reverse: CAAAGCGTCTACGCTGCAGTCC (SEQ ID NO: 2)) and viral load was evaluated in comparison to HPRT housekeeping gene (Forward: AGGACCTCTCGAAGTGT (SEQ ID NO: 3); Reverse: ATTCAAATCCCTGAAGTACTCAT (SEQ ID NO: 4)). The program was composed of 3 steps of amplification for 40 cycles, on QuantStudio® by Applied Biosystems. The results were analyzed according to the delta delta Ct method. [000145] Statistical analysis. For statistics, a sequential testing strategy reflecting experimental expectations was applied, while retaining the central Mann- Whitney (nonparametric) test. First, the difference between non-infected group (IM) and influenza group (2M) was assessed. If the difference was found significant, the difference between Influenza + Quercetin treatments (group 3M, 4M and 5M) versus Influenza animals (group 2M) was calculated. Results were considered significant when p-value was less than 0.5.RESULTS[000146] Morbidity and mortality observation. During the study, 3 animals died just after dosing. On day 0, animal #1 (from group IM) died just after the intranasal administration. This mouse received only PBS and this event seems to be related to an administration failure which can occur during intranasal administration. Additionally,animals #9 and #17 died on day 3 and 5 after Quercetin administration, respectively. The 2 routes of administration (PO and IP) were involved and may be related to an administration failure as no other animal died after treatments. No specific clinical sign was observed after quercetin PO treatments and only a reduced activity was observed after quercetin IP treatments.[000147] Body weight. Normalized body weight average (BW / BW baseline x 100) was followed during the study to evaluate the severity of the viral infection and to assess a potential toxicity of treatments. Normalized Body weight (BW) results are summarized in Table 4 and Fig. 3 (Mean ± SEM; n=7-8 mice per group ***p<0.001 in comparison to group 2M).[000148] Influenza infection induced a significant and rapid BW loss from day 3 after infection in comparison to non-infected mice whose weight remained stable until the end of the study (85 ± 2% for influenza-infected mice vs 98 ± 3% for non-infected mice, p<0,001 at day 7). Treatments with quercetin, whatever the dose or the route of administration, did not significantly modulate BW loss due to the infection. Furthermore, treatments with quercetin were well tolerated as no exacerbation of BW loss was observed in comparison to group 2M (84 ± 4 % for influenza + quercetin 10 mg / kg IP, 83 ± 3 % for influenza + quercetin 100 mg / kg IP and 83 ± 3 % for influenza + quercetin 100 mg / kg PO vs 85 ± 2 % for influenza-infected mice).Table 4. Summarized averages of normalized BW in %DI 97% 2% 7 97% 2% 8 97% 2% 8 98% 1% 8 98% 1% 8D2 97% 2% 7 95% 3% 8 96% 2% 8 94% 2% 8 96% 2% 8D3 97% 2% 7 86% 4% 8 86% 2% 8 86% 1% 8 86% 2% 8D4 97% 3% 7 86% 4% 8 86% 3% 8 85% 2% 8 86% 1% 7D5 97% 3% 7 88% 3% 8 87% 3% 8 86% 2% 8 88% 1% 7D6 98% 3% 7 88% 3% 8 87% 3% 8 87% 4% 7 87% 2% 7D7 98% 3% 7 85% 2% 8 84% 4% 8 83% 3% 7 83% 3% 7***p<0.001 in comparison to group 2M[000149] The IAV quantification in lungs at termination. Lungs were collected at termination on day 7. RTqPCR was performed on lung homogenates to evaluate the viral load of IAV. Mean IAV quantification results are summarized in Table 5 and Fig.4 (Mean ± SEM; n=7-8 mice per group; *p<0.001 in comparison to group 2M).[000150] The infection with the Influenza A virus significantly increased viral load (13644.40 ± 7621.39 fold increase for Influenza group vs 16.25 ± 28.46 fold increase for non-infected group, p<0,001). Treatments with quercetin, whatever the dose or the route of administration, did not significantly modulate the viral load (17644.16 ±9818.71 fold increase for influenza + quercetin 10 mg / kg IP, 19245.39 ± 10411.41 fold increase for influenza + quercetin 100 mg / kg IP and 14192.31 ± 6285.27 fold increase for influenza + quercetin 100 mg / kg PO vs 13644.80 ± 7621.39 fold increase for influenza-infected mice).Table 5. IAV quantification at termination[000151] Platelets activation (assessed by flow cytometry). After blood collection, blood samples were diluted in Tyrode’s buffer and each sample was stained for 15 minutes and platelets activity was evaluated using flow cytometry. Percentage of mean platelet activations are presented in Table 6 and Fig. 5 (Mean ± SEM; n=6-8 mice per group; *p<0.05 in comparison to group 2M).[000152] The following gating strategy was followed for all samples. First, unstained and single stained samples were analyzed to set up the compensation settings. Then, isotype control antibodies were applied to evaluate both the background level and the specificity of binding of the tested antibodies. Globally, all samples were analyzed as described below:1) all events corresponding to the size and granulometry of platelets were selected using SSC / FSC.2) Singlet cells were selected using SCC-H / SCC-A to remove doublet cells which can occurred when 2 cells or more are analyzed at the same time by the cytometer.3) Platelets were selected as cells expressing GPIb (specific marker of platelets).4) Finally, activated platelets were selected as GpIIb / IIIa positive cells and results are noted in the Q2 window. This antibody recognizes the active of GpIIb / IIIa which characterized activated platelets. The percentage of activated platelets was then analyzed with respect to the administered treatment and the ROA.[000153] Surprisingly, the infection with the Influenza A virus significantly decreased platelet activation (6.80 ± 5.18 % for Influenza group vs 15.11 ± 3.92 % fornon-infected group, p<0,05). This decrease was not expected and may be related to the time of blood processing for flow cytometry. However, treatments with quercetin, whatever the dose or the route of administration, did not significantly modulate platelet activation (5.59 ± 4.22 % for influenza + quercetin 10 mg / kg IP, 8.79 ± 7.85 % for influenza ± quercetin for influenza-infected mice).Table 6. Platelets activation percentage at termination[000154] Platelets coagulation factors analysis. Prothrombin time and activated partial thromboplastin time were evaluated in blood at termination. Mean results are presented in Table 7 and in Fig. 6 (Mean ± SEM; n=7-8 mice per group) and Fig. 7 (Mean ± SEM; n=7-8 mice per group) for prothrombin time and activated partial thromboplastin time, respectively.[000155] The infection with the Influenza A virus did not significantly modulate PT (16.85 ± 0.95 s for Influenza group vs 17.09 ± 0.58 s for non-infected group) nor APTT (110.03 ± 2.53 s for Influenza group vs 107.84 ± 6.13 s for non-infected group). Treatments with quercetin, whatever the dose or the route of administration, did not significantly modulate PT (17.56 ± 1.06 s for influenza ± quercetin 10 mg / kg IP, 17.73 ± 1.22 s for influenza ± quercetin 100 mg / kg IP and 18.20 ± 0.42 s for influenza ±quercetin 100 mg / kg PO vs 16.85 ± 0.95 s for influenza-infected mice) nor APTT (109.75 ± 3.56 s for influenza + quercetin 10 mg / kg IP, 109.44 ± 2.13 s for influenza + quercetin 100 mg / kg IP and 110.61 ± 2.32 s for influenza + quercetin 100 mg / kg vs 110.03 ± 2.53 s for influenza-infected mice).Table 7. Platelet coagulations factors analysis at termination (PT and APTT in s)[000156] Evaluation of soluble markers of platelets activation in plasma. Soluble markers of platelets activation were evaluated in plasma. Among all the tested markers, only CD40L was not detected in any of the samples (under the limit of detection of 0.14 ng / mL as specified by the manufacturer).[000157] Evaluation of thrombin generation in plasma. Thrombin generation was evaluated in plasma using the Thrombin Generation Assay (TGA). The TGA is a “global assay” that provides a picture of the hemostasis balance though a continuous and simultaneous measurement of thrombin formation and inhibition. According to manufacturer recommendation, lag phase time (min), Thrombin peak concentration (nM) and time (min), velocity index and Area Under Curve (AUC) were calculated using a dedicated computer software from the manufacturer.Lag time: expressed in minutes, describes the time from starting the reaction until thrombin is first generated. It corresponds to the timepoint when the fibrin clot is formed (=clotting time) in standard clotting tests.- Time to peak: expressed in minutes, corresponds to the time until the maximum amount of thrombin is formed.- Peak Thrombin: correlates to the maximum thrombin generation. It is expressed in nanomolar.- Velocity index: the velocity index is indicative of the slope of thrombin generation between the lag - time and the time to peak and corresponds to the first derivative of this part of the curve.- The endogenous thrombin potential corresponds to the AUG.[000158] Mean results of thrombin generation peak are presented in Table 8 and in Fig. 8 (Mean ± SEM; n=7-8 mice per group).[000159] The infection with the Influenza A virus tended to increase the thrombin generation peak; however, this effect was not significant (411.08 ± 41.97 nM for Influenza group vs 328.48 ± 91.81 nM for non-infected group). Treatments with quercetin, whatever the dose or the route of administration, did not significantly modulate thrombin generation peak (409.27 ± 57.53 nM for influenza + quercetin 10 mg / kg IP, 433.44 ± 59.44 nM for influenza + quercetin 100 mg / kg IP and 441.05 ± 37.87 nM for influenza + quercetin 100 mg / kg PO vs 411.08 ± 41.97 nM for influenza- infected mice).[000160] Evaluation of soluble P- selectin in plasma. Soluble P-selectin concentration was evaluated in plasma at termination on day 7. Mean P-selectin results are summarized in Table 9 and Fig. 9 (Mean ± SEM; n=7-8 mice per group).[000161] The infection with the Influenza A virus significantly increased P-selectin concentration (215712.50 ± 30356.00 pg / mL for Influenza group vs 63310.00 ± 22974.39 pg / mL for non-infected group, p<0,0001). Treatments with quercetin administered intraperitoneally did not significantly modulate P-selectin concentration (199550.00 ± 42364.99 pg / mL for influenza + quercetin 10 mg / kg IP and 217892.86 ± 51647.24 pg / mL for influenza + quercetin 100 mg / kg IP). Interestingly, quercetin administered orally significantly inhibited the P-selectin concentration (1635457.14 ± 24934.13 pg / mL for influenza + quercetin 100 mg / kg PO vs 215712.50 ± 30356.00 pg / mL for influenza-infected mice, p<0.05).Table 9- Soluble P-selectin analysis at termination[000162] Evaluation of soluble E-selectin in plasma. Soluble E-selectin concentration was evaluated in plasma at termination on day 7. Mean E-selectin results are summarized in Table 10 and Fig. 10 (Mean ± SEM; n=7-8 mice per group; *** p< 0.001 in comparison to group 2M).[000163] The infection with the Influenza A virus significantly increased E-selectin concentration (11920.13 ± 1563.35 pg / mL for Influenza group vs 5753.86 ± 726.49 pg / mL for non-infected group, p<0,001). Treatments with quercetin administered intraperitoneally did not significantly modulate E-selectin concentration (11104.13 ± 1776.06 pg / mL for influenza + quercetin 10 mg / kg IP and 12705.14 ± 1952.87 pg / mL for influenza + quercetin 100 mg / kg IP). Interestingly, quercetin administered orally tended to inhibit the E-selectin concentration; however, this effect was not significant (9418.57 ± 1770.75 pg / mL for influenza + quercetin 100 mg / kg PO vs 11920.13 ± 1563.35 pg / mL for influenza-infected mice, p=0.072).Table 10- Soluble E-selectin analysis at termination5M - Influenza + 9418.57 (*) 1770.75 7Quercetin 100 mg / kg PO*** p< 0.001 in comparison to group 2M[000164] Evaluation of D-Dimer in plasma. D-Dimer concentration was evaluated in plasma at termination on day 7. Mean D-Dimer results are summarized in Table 11 and Fig. 11.[000165] The infection with the Influenza A virus significantly increased D-Dimer concentration (823.73 ± 390.12 ng / mL for Influenza group vs 453.63 ± 115.28 ng / mL for non-infected group, p<0,01). Treatments with quercetin administered intraperitoneally tended to decrease D-Dimer concentration; however, this effect was not significant (549.38 ± 285.91 ng / mL for influenza + quercetin 10 mg / kg IP and 536.06 ± 199.37 ng / mL for influenza + quercetin 100 mg / kg IP). Interestingly, quercetin administered orally significantly inhibited and even restored the D-Dimer concentration (394.02 ± 142.81 ng / mL for influenza + quercetin 100 mg / kg PO vs 823.73 ± 390.12 ng / mL for influenza-infected mice, p<0.01).Table 11. D-Dimer analysis at termination =[000166] Evaluation of Thrombin-antithrombin complex (TATc). TATc concentration was evaluated in plasma at termination on day 7. Mean TATc results aresummarized in Table 12 and Fig. 12 (Mean ± SEM; n=7-8 mice per group). The infection with the Influenza A virus significantly increased TATc concentration (8386.13 ± 2972.08 pg / mL for Influenza group vs 5481.43 ± 1147.96 pg / mL for noninfected group, p<0,05). Treatments with quercetin administered intraperitoneally did not decrease TATc concentration (7818.14 ± 2853.32 pg / mL for influenza + quercetin 10 mg / kg IP and 10802.14 ± 9963.25 pg / mL for influenza + quercetin 100 mg / kg IP). Interestingly, quercetin administered orally significantly inhibited and nearly restored the TATc concentration (5787.57 ± 1550.78 pg / mL for influenza + quercetin 100 mg / kg PO vs 8386.13 ± 2972.08 pg / mL for influenza-infected mice, p<0.05).CONCLUSION[000167] Infection with Influenza H1N1 virus induced a significant BW loss from day 3 after the infection until termination at day 7. The infection level was confirmed by the significant increase of viral load in the lung at day 7. Influenza H1N1 infection induced a significant increase of soluble P-selectin, E-selectin, D-Dimer and TATc concentrations.[000168] P-selectin and E-selectin are expressed on cell surface of platelets and endothelial cells when activated. Soluble forms of these proteins are also excreted and reflect thrombosis and inflammation state. TATc is a specific marker of coagulation activation while D-Dimer is a degradation product of fibrin and a circulating marker of enhanced coagulation and fibrinolysis. These results confirm the prothrombogenic state induced by Influenza H1N1 infection. However, coagulation factors (PT and APTT), platelets activation as well as thrombin generation were not significantly modulated by the influenza H1N1 infection. Maybe the timing after the infection is less appropriate for PT and APPT, as these markers have been demonstrated to be significantly increased only on day 4 after infection in another preclinical model (ferrets), with restoration observed by day 712. Concerning thrombin generation, measured using TGA, this marker maybe more appropriate for measuring thrombosis in chronic conditions and is less relevant for acute conditions.[000169] Regarding platelet activation, it appears that troubleshooting occurred during platelets processing. Unexpectedly, influenza infection inhibited platelets activation. However, there was no modulation of platelets activation in the other group, which was equivalent to the influenza group. It’s possible that the processing time for platelets from the non-infected group induced artefactual platelets activation, as mice from this group were proceed separately upon termination, prior to the other groups.[000170] Treatments with quercetin administered intraperitoneally and orally were well tolerated and only a slight decrease of mice activity was observed right after intraperitoneal treatments. Quercetin treatments, whatever the dose or the route of administration, did not impact the course of the infection, as there was no modulationof the body weight loss nor viral load observed. These results indicate that quercetin, when administered at the tested doses, had no direct antiviral effect.[000171] Treatments with quercetin intraperitoneally did not modulate the prothrombogenic state induced by the influenza infection and this regardless of the dose. None of the parameters increased by the influenza infection were modulated by quercetin intraperitoneal treatments. On the contrary and interestingly, when quercetin was administered orally at 100 mg / kg, this treatment successfully inhibited and even almost restored some of these pro-coagulant markers, such as P-selectin, E-selectin, D-Dimer and TATc. As there was no direct antiviral effect, the inhibition of these markers seems to be related to an anti-thrombotic effect.[000172] Interestingly, only the oral treatment had an effect, while the intraperitoneal treatment did not. Therefore, the observed effect is likely mediated by the metabolization of quercetin in the gastrointestinal tract when it is administered orally.[000173] During immunological disorders (Infections, auto immune diseases, cancers) there is an increase in selectins levels, which have been found as predictive markers of VTE particularly in cancer patients. After oral administration, we observed a non-described pharmacological activity of Quercetin, in decreasing the levels of selectins and D-Dimers which should be useful in prevention of clots formations in these populations.[000174] It has been found that quercetin has no activity on usual coagulation parameters (PT, APTT) and therefore, it could be safely, with no risk or minimized risk of bleeding, administered to patients in order to prevent or decrease hypercoagulability.

Claims

ClaimsWe claim:

1. A method for overcoming proinflammatory and procoagulant activation of endothelial cells in a subject in need of treatment for hypercoagulation, the method comprising: administering to the subject a composition comprising quercetin and / or quercetin dihydrate, and one or more excipients; and wherein the composition is administered in an amount sufficient to overcome or suppress proinflammatory / procoagulant activation of endothelial cells in the subject.

2. The method of claim 1, wherein the composition is administered in the amount which is further sufficient for attenuating the procoagulant activity of cancer cells and for blocking at least partially production of thrombin by the cancer cells.

3. The method of claim 1, wherein the composition is administered orally at least once daily at a dosage per one administration in the range from about 100 to about 3000 mg of quercetin and / or quercetin dihydrate.

4. The method of claim 1, wherein the composition is administered up to 3000 mg of quercetin and / or quercetin dihydrate per day.

5. The method of claim 1, wherein the composition is administered at a concentration sufficient to deliver at least 300 micromoles of quercetin dihydrate to the subject’s bloodstream.

6. The method of claim 1, wherein bioavailability of the composition is at least 10% or higher.

7. The method of claim 1, wherein the composition comprises solid powder and / or solid granules comprising quercetin and / or quercetin dihydrate, and one or more excipients.

8. The method of claim 1, wherein the composition is in solid dosage form and the composition comprises granules containing quercetin and / or quercetin dihydrate, and one or more excipients; and wherein the granules are nanoparticles having the size range from about 300 to about 600 nm.

9. The method of claim 1, wherein the composition has been dosed from about 200 to about 1000 mg of quercetin and / or quercetin dihydrate per a tablet, soft gel capsule, capsule or sachet.

10. The method of claim 1, wherein the composition is administered one or more times daily and the total dosage administered per day is in the range from about 1000 mg to about 3000 mg of quercetin and / or quercetin dihydrate or from about 2000 mg to about 3000 mg of quercetin and / or quercetin dihydrate.

11. The method of claim 1, wherein the subject has a cancer, stroke, blood clot(s), autoimmune disease, acute lung infection, viral infection, chronical lung infection, venous thromboembolism (VTE), deep vein thrombosis (DVT) and / or pulmonary embolism (PE), and / or a family history of cancer, stroke, blood clot(s), autoimmune disease, venous thromboembolism (VTE), deep vein thrombosis (DVT) and / or pulmonary embolism (PE).

12. The method of claim 11, wherein the cancer is selected from the group consisting of pancreatic cancers, lung cancers, breast cancers, prostate cancers, colorectal cancers, gastric cancers, malignant brain tumors and stomach cancers.

13. The method of claim 11, wherein the subject has a cancer and is undergoing or is scheduled to receive chemotherapy, and wherein the composition is administered prior to beginning of chemotherapy, preferably at least one week or more prior to the beginning of chemotherapy, during time periods when chemotherapy is administered and / or after the chemotherapy treatment has been completed.

14. The method of claim 1, wherein the subject is undergoing treatment with steroids / steroid derivatives or has completed receiving a steroid / steroid derivative treatment within one or more day prior to the administration of the composition.

15. The method of claim 1, wherein the composition is prepared by the method comprising: a) mixing quercetin and / or quercetin dihydrate, one or more hydrophobic stabilizers and a hydrophilic solvent into a mixture; b) milling the mixture into a nanosuspension comprising granules containing quercetin and / or quercetin dihydrate; and c) lyophilizing the granules in the presence of a bulking agent or precipitating the granules from the mixture onto a carrier.

16. A method of administering a drug to a subject, wherein the drug has a known side effect of forming blood clots, the method comprising:administering to the subject a composition comprising quercetin and / or quercetin dihydrate, and one or more excipients, wherein the composition is administered in an amount sufficient to overcome or suppress pro- inflammatory activation of endothelial cells in the subject.

17. The method of claim 16, wherein the composition is administered at one or more of the following time periods: i) prior to administration of the drug; ii) during administering the drug; and / or iii) after the administration of the drug has been completed.

18. The method of claim 16, wherein the drug is a chemotherapy drug, vaccine, steroid / steroid derivative drugs, antibody or biologies.

19. A composition for treating hypercoagulation, the oral composition comprising quercetin and / or quercetin dihydrate, and one or more excipients, wherein the oral composition is formulated in dosages for oral administration, and wherein each dosage comprises 2500 mg or more of quercetin and / or quercetin dihydrate.

Images