Modified seed oil content in soybean

Abstract

Plants producing seeds and seeds comprising increased oil content are provided. Additionally, methods for generating and using plants and seeds having increased oil content are disclosed.

Description

MODIFIED SEED OIL CONTENT IN PLANTSREFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0001] The official copy of the sequence listing is submitted electronically via Patent Center as an XML formatted sequence listing with a file named 210752_SequenceListing created on August 11, 2023, and having a size of 967,885 bytes and is filed concurrently with the specification. The sequence listing comprised in this XML formatted document is part of the specification and is herein incorporated by reference in its entirety.BACKGROUND

[0002] Plant oils are a major product of oil seed crops such as soybean, sunflower, and canola. Oils, such as soybean oil, produced in the US are extracted from seeds and have a major use in food products such as cooking oils, shortenings and margarines. The oils can be refined, bleached and deodorized (RBD) and may be hydrogenated to facilitate use in shortenings.

[0003] Accordingly, there is a need to develop compositions and methods to increase oil (e.g., seed oil) content. This disclosure provides such compositions and methods.SUMMARY

[0004] Provided are plant cells and seeds comprising two or more modifications selected from (i) a modification increasing expression, activity, and / or stability of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression, activity, and / or stability of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression and / or activity of an ABB polypeptide, (vi) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof and comprising an increase in total oil content, as compared to a control plant cell or seed comprising one of the two or more modifications. In certain embodiments, theplant cell or seed is a soybean cell or seed, a Brassica species cell or seed, or a pennycress cell or seed.

[0005] Also provided are plants comprising two or modifications selected from (i) a modification increasing expression, activity, and / or stability of a SWT polypeptide, (ii) a modification increasing expression, activity, and / or stability of a SUT polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vi) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, or any combination thereof and comprising a seed having increased oil content as compared to seeds of a control plant comprising one of the two or more modifications. In certain embodiments, the plant is soybean, a Brassica species, or pennycress.

[0006] Further provided are methods of producing a plant producing seeds having an increased oil content as compared to a control seed comprising introducing into a regenerable plant cell two or more modifications selected from (i) a modification increasing expression, activity, and / or stability of a SWT polypeptide, (ii) a modification increasing expression, activity, and / or stability of a SUT polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vi) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, or any combination thereof, and generating the plant, wherein the plant comprises the two or more modifications and produces a seed having an increased oil content as compared to a control plant comprising one of the two or more modifications.

[0007] Also provided are methods for producing plants having seeds with increased oil content as compared to a control seed comprising crossing a first plant with a second plant, the first and second plant each comprising at least one modification selected from (i) a modification increasing expression, activity, and / or stability of a SWT polypeptide, (ii) a modificationincreasing expression, activity, and / or stability of a SUT polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an AB 13 polypeptide, (vi) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, or any combination thereof, harvesting the seed produced thereby, and generating a progeny plant, wherein the progeny plant comprises the at least one modification of the first plant and the at least one modification present in the second plant.

[0008] Provided are methods producing a plurality of elite high-oil plant lines in a plant production program comprising multiplex genome editing a plurality of elite plant lines to introduce at least two modifications selected from (i) a modification increasing expression, activity, and / or stability of a SWT polypeptide, (ii) a modification increasing expression, activity, and / or stability of a SUT polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vi) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, or any combination thereof into the plurality of plant lines to produce a plurality of directly-edited elite plant lines, and increasing seed of the plurality of directly-edited plant lines of step (a) by growing the directly-edited plant lines of step (a) and harvesting the seed therefrom over one or more generations to produce a plurality of elite high- oil plant lines.

[0009] Also provided are methods of producing an elite high-oil plant line in a plant production program, the method comprising directly editing an elite plant line to introduce at least two modifications selected from the group selected from (i) a modification increasing expression, activity, and / or stability of a SWT polypeptide, (ii) a modification increasing expression, activity, and / or stability of a SUT polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, (iv) a modification increasingexpression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vi) a modification increasing expression, activity, and / or stability of an 0DP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, or any combination thereof to produce an elite high-oil plant line and increasing seed of the elite high-oil plant line over multiple generations to produce commercially relevant quantities of high-oil plant seed.BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0010] The disclosure can be more fully understood from the following detailed description and the accompanying Sequence Listing, which form a part of this application. The sequence descriptions (Table 1A and Table IB) and sequence listing attached hereto comply with the rules governing nucleotide and amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §§1.831-1.835.Table 1A: Sequence Listing Description - Nucleic Acid SequencesTable IB: Sequence Listing Description - Amino Acid SequencesDETAILED DESCRIPTION

[0011] The present disclosure provides plant cells, plants producing seeds, or seeds comprising an increase in the total oil content as compared to a control seed.

[0012] In certain embodiments, the plant cell, plant or seed comprises two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications selected from the group consisting of (i) a modification increasing expression, activity, and / or stability of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression, activity, and / or stability of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an ABI3 polypeptide, (vi) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof. In certain embodiments, the plant cell, plant or seed of the plant comprises at least or at least about a 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7,2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, or 8.0 percentage point increase and less than about 10.0, 9.5, 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, 5.0 or 4.5 percentage point increase in fatty acid or oil content measured on a dry weight basis, or weight at 13% moisture, relative to a control seed.

[0013] As used herein, "percentage point" (pp) difference, change, increase or decrease refers to the arithmetic difference of two percentages, e.g. [transgenic or genetically modified value (%) - control value (%)] = percentage points. For example, a modified seed may contain 20% by weight of a component and the corresponding unmodified control seed may contain 15% by weight of that component. The difference in the component between the control and transgenic seed would be expressed as 5 percentage points.

[0014] In certain embodiments of the compositions and methods described herein, the control plant cell, plant or seed comprises at least one and less than all of the two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications. In certain embodiments, the plant cell, plant, or seed comprises two or more modifications and the control plant cell, plant, or seed comprises one of the modifications. In certain embodiments, the plant cell, plant, or seed comprises three or more modifications and the control plant cell, plant, or seed comprises one or two of the modifications. In certain embodiments, the plant cell, plant, or seed comprises four or more modifications and the control plant cell, plant, or seed comprises one, two, or three of the modifications. In certain embodiments, the plant cell, plant, or seed comprises five or more modifications and the control plant cell, plant, or seed comprises one, two, three, or four of the modifications. In certain embodiments, the plant cell, plant, or seed comprises six or more modifications and the control plant cell, plant, or seed comprises one, two, three, four, or five of the modifications. In certain embodiments, the plant cell, plant, or seed comprises seven or more modifications and the control plant cell, plant, or seed comprises one, two, three, four, five, or six of the modifications. In certain embodiments, the plant cell, plant, or seed comprises eight or more modifications and the control plant cell, plant, or seed comprises one, two, three, four, five, six, or seven of the modifications. In certain embodiments, the plant cell, plant, or seed comprises nine or more modifications and the control plant cell, plant, or seed comprises one, two, three, four, five, six, seven, or eight of the modifications. In certain embodiments, the plant cell, plant, or seed comprises ten or more modifications and the control plant cell, plant, or seed comprises one, two,three, four, five, six, seven, eight, or nine of the modifications. Tn certain embodiments, the control plant cell, plant, or seed comprises one of the two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications. In certain embodiments, the control plant cell, plant, or seed is an unmodified cell, plant or seed (e.g., wild type).

[0015] In certain embodiments, the plant cell, plant, or seed comprises at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more) modifications. In embodiments of the compositions and methods described herein the at least two modifications the modifications can be from the same category, for example, a plant cell, plant, or seed is considered to comprise at least two modifications selected from the group when the cell, plant or seed comprises a modification or modifications increasing expression, activity, and / or stability of two or more SWT polypeptides.

[0016] As used herein, “decrease in expression” “decreased expression” or the like refers to any detectable reduction in expression of a gene and / or the corresponding polypeptide. Similarly, “decrease in activity” “decreased activity” or the like refers to any detectable reduction in the activity (e.g., enzymatic activity) of the encoded polypeptide. Also, as used herein “decrease in stability” “decreased stability” or the like refers to any detectable increase in the turnover rate (e.g., shorter half-life) of the expressed polypeptide. The method by which the expression or activity of a gene or polypeptide described herein is decreased is not particularly limited and can be done using methods known in the art such at RNAi, gene knockdown, gene knockout, or targeted amino acid modification.

[0017] As used herein, “increase in expression” “increased expression” or the like refers to any detectable gain in expression of a gene and / or the corresponding polypeptide. As used herein, “increase in activity” “increased activity” and the like refers to any detectable gain in activity (e.g., enzymatic activity) of the polypeptide. Also, as used herein “increase in stability” “increased stability” or the like refers to any detectable decrease in the turnover rate (e.g., longer half-life) of the expressed polypeptide. The method by which the activity of a polypeptide described herein is increased is not particularly limited and can be done using methods known in the art such as increasing expression of the gene encoding the polypeptide (e.g., transgenic expression, promoter swap, gene modification) or a targeted modification of the gene encoding the polypeptide to, for example, remove a self-regulatory domain.

[0018] In certain embodiments, the plant cell, plant, or seed of the plant comprises modified amounts of fatty acids, such as at least a 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50% increase in oleic acid content, linoleic acid content, or a combination thereof expressed by weight as a proportion of the total fatty acid content as compared to a control seed.

[0019] As used herein, "percent increase" refers to a change or difference expressed as a fraction of the control value, e.g. { [modified / transgenic / test value (%) - control value (%)] / control value (%)} x 100% = percent change., or {[value obtained in a first location (%) - value obtained in second location (%)] / value in the second location (%)}xl00 = percent change.

[0020] In certain embodiments, the seed or the seed of the plant comprises a total seed weight greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0021] In certain embodiments, the seed or the seed of the plant comprises a protein content that is at least the same as, similar to, or increased compared with a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications), or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to the control seed.

[0022] In certain embodiments, the plant has a yield that is greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5%, as compared to the corresponding control plant (e.g., an unmodified plant or a plant comprising one of the two or more modifications). As used herein, “yield” refers to the amount of agricultural production harvested per unit of land and may include reference to bushels per acre or kilograms per hectare of a crop at harvest, as adjusted for grain moisture. Grain moisture is measured in the grain at harvest. The adjusted test weight of grain is determined to be the weight in pounds per bushel or kilogram, adjusted for grain moisture level at harvest.

[0023] Any of the modified plants described herein may be grown in a field in a double cropping system with other plants of the same or different species, such that, for example, two or more crops are harvested per 12-month period.

[0024] As used herein, the term “plant” includes plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plantsor parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. Grain is intended to mean the mature seed produced by commercial growers for purposes other than growing or reproducing the species. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the disclosure, provided that these parts comprise the introduced polynucleotides.

[0025] The plant of the composition and methods described herein is not particularly limited and may be any plant for which increased oil content in the seed is desired. Examples of plant species of interest include, but are not limited to, maize (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum mihaceum), foxtail millet (Setaria italica), finger millet Eleusine coracanaj), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), coconut (Cocos nucifera), olive (Olea europaea), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp), and pennycress (Thlaspi arvense).

[0026] In certain embodiments, plants of the present disclosure are oil-seed plants (e.g., cotton, soybean, safflower, sunflower, Brassica sp, maize, alfalfa, palm, coconut, pennycress, etc.) and / or leguminous plants (e.g., beans and peas; beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea). In certain embodiments, soybean, sunflower, pennycress, and / or Brassica species plants are optimal, and in yet other embodiments soybean plants are optimal.

[0027] As used herein, the term "Brassica species” '' rassica sp” or the like refers to the plants of a genus Brassica, the genus Camelina, and the genus Sinapis, in the mustard family (Brassicaceae). Brassica species include plant species such as Brassica juncea (brown mustard); Brassica carinata Carinata, Ethiopian mustard); Brassica oleracea (cabbage); Brassica nigra (black mustard); Brassica rapa, especially Brassica rapa subsp. oleifera (field mustard), Brassica napus, Camelina sativa, Brassica napus subsp. oleifera (oilseed rape); Sinapis hirta; Sinapis alba, and subspecies, cultivars, varieties and hybrids thereof.

[0028] Camelina Sativa is a member of the Brassicaceae family and is a potential oil crop for renewable fuel production. Camelina Sativa can grow in poor soil and limited rainfall and contains 30-49% oil and 24-31% protein in seeds (Martin Mondor, Alan Javier Hernandez- Alvarez, 2021, Camelina sativa Composition, Attributes, and Applications: A Review. European J of Lipid Science and Technology). In certain embodiments, Camelina sativa is transformed using a floral dip method that is similar to Arabidopsis transformation method (Lee et al 2021, Increasing Monounsaturated Fatty Acid Contents in Hexapioid Camelina sativa Seed Oil by FAD2 Gene Knockout Using CRISPR-Cas9, Front. Plant Sci).

[0029] Penny cress (Thlapsi arvense L., field penny cress) is an oil seed crop belonging to the Brassicaceae family, which is closely related to Arabidopsis. The pennycress plant has an excellent cold tolerance and short life cycle, and could be used a winter cover crop in a two crop system. Pennycress seeds contain 27-39% oil and about 19% protein on dry weight basis (McGinn et al 2019 Molecular tools enabling penny cress (Thlaspi arvense) as a model plant and oilseed cash cover crop. Plant Biotechnol. J. DOI: 10.1111 / pbi.13014). Pennycress has a diploid genome with 7 chromosomes. About 86% of pennycress genes have highly homologous genes in Arabidopsis, allowing for the identification of functional orthologs in pennycress (Dorn et al 2015. A draft genome of field penny cress (Thlaspi arvense) provides tools for the domestication of a new winter biofuel crop. DNA Res. 22, 121-131).

[0030] For example, in certain embodiments, soybean, Brassica species, or penny cress plants are provided that comprise two or more (e g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications selected from the group consisting of: (i) a modification increasing expression, activity, and / or stability of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression, activity, and / or stability of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an ABB polypeptide, (vi) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof, and have increased seed oil content as compared to a control plant (e g., anunmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0031] In certain embodiments, the plants are elite lines. As used herein, “elite line” refers to any line that has resulted from breeding and selection for superior agronomic performance that allows a producer to harvest a product of commercial significance. Numerous elite lines are available and known to those of skill in the art of plant breeding.

[0032] In certain embodiments, the cell, seed, or plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression, activity, and / or stability of a SUT polypeptide.

[0033] In certain embodiments, the cell, seed, or plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification introducing a high oil DGAT variant.

[0034] In certain embodiments, the cell, seed, or plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression, activity, and / or stability of an ODP1 polypeptide.

[0035] In certain embodiments, the cell, seed, or plant comprises a modification increasing expression, activity, and / or stability of a SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0036] In certain embodiments, the cell, seed, or plant comprises a modification increasing expression, activity, and / or stability of an ODP1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0037] In certain embodiments, the cell, seed, or plant comprises a modification introducing a high oil DGAT variant and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0038] In certain embodiments, the cell, seed, or plant comprises a modification introducing a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide.

[0039] In certain embodiments, the cell, seed, or plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasingexpression, activity, and / or stability of a SUT polypeptide, and a modification introducing a high oil DGAT variant.

[0040] In certain embodiments, the cell, seed, or plant comprises a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, and a modification increasing expression, activity, and / or stability of an ODP1 polypeptide.

[0041] In certain embodiments, the cell, seed, or plant comprises a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, and a modification increasing expression, activity, and / or stability of a SUT polypeptide.

[0042] In certain embodiments, the cell, seed, or plant comprises a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide.

[0043] The Sugars Will Eventually be Exported Transporters (SWTs) is a group of efflux transporters which play critical roles in sugar efflux, phloem loading, and sugar import into developing seeds. Carbohydrates are translocated from source to seeds through seed coat. SWTs expressed in the seed coat facilitate sucrose efflux from the seed coat to developing seed cotyledons, affecting seed development. In certain embodiments of the compositions and methods described herein the SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39. In certain embodiments, the polynucleotide encoding SWT4 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5, 98, 174 or 250. In certain embodiments, the polynucleotide encoding SWT5 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 6, 99, 175 or 251. In certain embodiments, the polynucleotide encoding SWT16 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%,75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 7, 100, 176 or 252. In certain embodiments, the polynucleotide encoding SWT17 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 8, 101 177 or 253. In certain embodiments, the polynucleotide encoding SWT24 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 9, 102, 178 or 254. In certain embodiments, the polynucleotide encoding SWT39 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10, 103, 179 or 255.

[0044] In certain embodiments of the compositions and methods described herein, the modification increasing expression, activity, or stability of a SWT polypeptide comprises introducing a genetic modification in an endogenous SWT gene sequence. In certain embodiments, the SWT gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 5-10, 98-103, 174-179 and 250-255. In certain embodiments, the genetic modification is in the promoter region, for example, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression, activity, or stability of a SWT polypeptide comprises introducing a SWT polynucleotide operably linked to a heterologous regulatory element (e.g., heterologous promoter). In certain embodiments, the SWT polynucleotide operably linked to a heterologous regulatory element is introduced using genome editing. In certain embodiments, the SWT polynucleotide operably linked to a heterologous regulatory element is introduced using a nucleic acid construct comprising a polynucleotide encoding the SWT polypeptide operably linked to a heterologous regulatory element. In certain embodiments, the SWT polypeptide comprises an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%,87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 60-65, 136-141, 212-217 and 287-292.

[0045] In certain embodiments, the modification increasing expression, activity, or stability of a SUT comprises introducing a genetic modification in the endogenous gene sequence. In certain embodiments, the SUT gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4, 11, 97, 104, 173, 180, 249 or 256. In certain embodiments, the genetic modification is in the promoter region, for example, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression, activity, or stability of SUT comprises introducing a SUT polynucleotide operably linked to a heterologous regulatory element (e g., heterologous promoter). In certain embodiments, the SUT polynucleotide operably linked to a heterologous regulatory element is introduced using genome editing. In certain embodiments, the SUT polynucleotide operably linked to a heterologous regulatory element is introduced using a nucleic acid construct comprising a polynucleotide encoding the SUT polypeptide operably linked to a heterologous regulatory element. In certain embodiments, the SUT polypeptide comprises an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 59, 66, 135, 142, 211, 218, 286 or 293.

[0046] Mother of FT (flowering time) and TFL1 (terminated flowering locus 1) (referred to herein as MFT) polypeptides are members of the phosphatidylethanolamine binding protein (PEBP) family. In certain embodiments, the MFT gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3, 96 172 or 248.

[0047] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 58, 134, 210 or 285 and comprises a modification at a position other than the amino acid corresponding to LI 06 in SEQ ID NO: 58. In certain embodiments, the modified MFT polypeptide comprises a nonleucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 58. In certain embodiments, the modified MFT polypeptide comprises a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 58. In certain embodiments, the modified MFT polypeptide comprises both a non-leucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 58 and a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 58.

[0048] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 58, 134, 210 or 285.

[0049] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockdown of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 58, 134, 210 or 285. In certain embodiments, the cell, seed, or plant comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of MFT, as compared to a control seed.

[0050] As used herein a “gene knockout” is used to refer to gene in which there is no detectable expression of the mRNA or protein encoded by the gene, whereas “gene knockdown” is used to refer to a gene in which there is reduced expression, activity or amount of the mRNA or protein encoded by the gene. As used herein, “decreased expression”, “decreased activity” or “decreased stability” encompasses both gene knockout and gene knockdown.

[0051] In certain embodiments of the compositions and methods described herein, the knockdown of a gene results in activity or amount of protein encoded by the gene that is at least0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% and less than 90%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the activity or amount of the protein in a wild-type control plant or seed.

[0052] In certain embodiments of the compositions and methods described herein, the knockdown of a gene results in expression or amount of mRNA encoded by the gene that is at least 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% and less than 90%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the expression or amount of mRNA in a wild-type control plant or seed.

[0053] As used herein, an MFT network gene refers to a gene in which mRNA expression is increased in the soybean plants comprising an MFT modification resulting in increased protein, such as those described herein (e.g., MFT knockdown, MFT knockout, MFT mutant). Examples of MFT network genes for use in the composition and methods described herein include, but are not limited to, the genes listed in Table 5 below. In certain embodiments, the MFT network gene encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 67-92, 143-168, 219-244 and 294-319. In certain embodiments, the MFT network gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 12-37, 105-130, 181-206 and 247-282.

[0054] In certain embodiments, the modification increasing expression or activity of an MFT network gene comprises introducing a genetic modification in the endogenous gene sequence. In certain embodiments, the genetic modification is in the promoter region, for example, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression or activity of an MFT network gene comprises introducing a nucleic acid construct comprising the MFT network gene operably linked to a heterologous regulatory element (e.g., heterologous promoter).

[0055] In certain embodiments, the modification increasing expression, activity, or stability of a ABB comprises introducing a genetic modification in the endogenous gene sequence. In certainembodiments, the genetic modification is in the promoter region, for example, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression, activity, or stability of ABI3 comprises introducing a nucleic acid construct comprising a polynucleotide encoding the ABI3 polypeptide operably linked to a heterologous regulatory element (e.g., heterologous promoter). In certain embodiments, the polynucleotide encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 76, 89, 152, 165, 228, 241, 303, or 316. In certain embodiments, the ABI3 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 21, 34, 114, 127, 190, 203, 266 or 279.

[0056] In certain embodiments, the modification increasing expression, activity, or stability of a ODP1 comprises introducing a genetic modification in the endogenous gene sequence. In certain embodiments, the genetic modification is in the promoter region, for example, a promoter swap so that the endogenous gene is operably linked to a heterologous promoter. In certain embodiments, the modification increasing expression, activity, or stability of ODP1 comprises introducing a nucleic acid construct comprising a polynucleotide encoding the ODP1 polypeptide operably linked to a heterologous regulatory element (e.g., heterologous promoter). In certain embodiments, the polynucleotide encodes a polypeptide comprising an amino acid sequence that is at least, or at least about, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 74 or 85. In certain embodiments, the ODP1 comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 19, 30, 112, 123, 188, 199, 264 or 275.

[0057] Diacylglycerol acyltransferase (DGAT) catalyzes the last step of oil biosynthesis. In certain embodiments, the DGAT gene of the compositions and methods described herein comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1, 94, 170 or 246.

[0058] The high oil DGAT variant of the compositions and methods may be any high oil DGAT variant described herein or known in the art such as, for example, those described in WO2022246387. In certain embodiments, the high oil DGAT variant comprises an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 54, 132, 208 or 283 and comprises at least one amino acid substation, insertion, deletion, or any combination thereof as compared to SEQ ID NO: 54, 132, 208 or 283, respectively. In certain embodiments, the high oil DGAT variant comprises at least one amino acid substitution. In certain embodiments, the at least one substitution is selected from the group consisting of a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54, a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a nonasparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, or any combination thereof. In certain embodiments, the high oil DGAT variant comprises an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 54, 132, 208 or 283 and comprises a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54. In certain embodiments, the high oil DGAT variant comprises an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 54, 132, 208 or 283 and comprises a serine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54. In certain embodiments, the high oil DGAT variant comprises an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 54, 132, 208 or 283 and comprises a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a non-asparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, and a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54. In certain embodiments, the high oil DGAT variant comprises an amino acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 46 and comprises a serine at the amino acid residue corresponding to position 355 of SEQ IDNO: 54, a serine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, and a serine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54.

[0059] In certain embodiments, the high oil DGAT variant is introduced into an endogenous DGAT gene sequence using genome engineering. In certain embodiments, the high oil DGAT variant is operably linked to a heterologous regulatory element. In certain embodiments, the high oil DGAT variant operably linked to a heterologous regulatory element is introduced using genome editing. In certain embodiments, the high oil DGAT variant operably linked to a heterologous regulatory element is introduced using a nucleic acid construct comprising a polynucleotide encoding the high oil DGAT variant operably linked to the heterologous regulatory element.

[0060] As used herein an “amino acid deletion,” “deletion mutation,” or the like, refers to a mutation in which the indicated amino acid residue is removed from the polypeptide sequence, so that, when aligned to the reference sequence (e.g., SEQ ID NO: 54) the mutated sequence does not have an amino acid corresponding to the indicated position of the reference sequence. An “amino acid insertion,” “insertion mutation,” or the like, refers to a mutation in which at least one amino acid residue is added to the polypeptide sequence, so that, when aligned to the reference sequence (e.g., SEQ ID NO: 54) the mutated sequence contains an additional amino acid corresponding to the indicated position of the reference sequence.

[0061] An “amino acid substitution,” “substitution mutation,” or the like, refers to a modification in which the indicated amino acid residue is replaced with a different amino acid residue, so that, when aligned to the reference sequence (e.g., SEQ ID NO: 54) the mutated sequence does not have the same amino acid at the indicated position. When the amino acid residue is substituted for a residue that has similar properties (e.g., size, charge, and / or hydrophobicity) the substitution is referred to as a conservative amino substitution. Conservative amino acid substitutions are well known in the art. For example, the following six groups contain amino acids that are considered to be conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). Alternatively, when the amino acid residue is substituted for an amino acid that has dissimilar properties the modification is referred to as a radical amino acid substitution.

[0062] The type of amino acid substitution (i.e., conservative or radical) in the high oil DGAT variant polypeptides provided herein is not particularly limited, such that the high oil DGAT variant polypeptides provided herein may contain all conservative amino acid substitutions, all radical amino acid substitutions, or a combination of radical and conservative amino acid substitutions.

[0063] In certain embodiments of the compositions and methods described herein, the high oil DGAT variant polypeptide further comprises a deletion of at least 1 and less than 101 amino acids in the N-terminal region corresponding to the region at positions 1 to 107 of SEQ ID NO: 54. The deletion can represent a sequence encoding a polypeptide of at least or at least about 1, 2, 3, 4, 5, 6, 7, 8 ,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids, and less than or less than about 107, 106, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3 or 2 amino acids. The deletion can occur in a sequence encoding a polypeptide corresponding to SEQ ID NO: 54 at positions corresponding to position 1 to position 107 of SEQ ID NO: 54. The modified polynucleotide may encode a polypeptide having at least 70%, 75%, 80%, 85%, 90%, or 95% identity to positions 102 to 498 of SEQ ID NO: 54. In certain embodiments, the polynucleotide encoding the high oil DGAT variant polypeptide having at least 70%, 75%, 80%, 85%, 90%, or 95% identity to positions 108 to 504 of SEQ ID NO: 54 comprises at least one modification described herein. The deletion can include a deletion corresponding to the N-terminal region of the coding sequence or encoded polypeptide of at least or at least about 1, 2, 3, 4, 5, 6, 7, 8 ,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 49, 49, 50, 51, 52, 53, 55, 55, 56, 57, 58, 59, 60, 65, 70,75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 160, 170, 180, 190,200, 210, 220, 230, 240, 250, 260, 265, 270, 280, 290, or 300 nucleotides and less than or less than about 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 145, 140, 135, 130, 125, 120, 115, 110, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, or 6 nucleotides, for example the deletion can occur in a location corresponding to from position 1 to position 309 of SEQ ID NO: 1.

[0064] In certain embodiments of the high oil DGAT variant polynucleotides described herein, the polynucleotides encodes high oil DGAT variant polypeptides which comprise one or more orall four signature motifs such as APTLCYQ (SEQ ID NO: 320, corresponding to position 274- 280 of SEQ ID NO: 54), FGDREFYXDWWNA (SEQ ID NO: 321; corresponding to position 370-382 of SEQ ID NO: 54), LLYYHD (SEQ ID NO: 322; corresponding to position 490-495 of SEQ ID NO: 54), and FYXDWWN (SEQ ID NO: 325; corresponding to position 375-381 of SEQ ID NO: 54) where X is any amino acid, such as K or Q. Other amino acid motifs in the polypeptides disclosed herein and polynucleotides encoding them include, for example, GFIIEQYINPIVXNSXHPL (SEQ ID NO: 323; corresponding to position 309-327 of SEQ ID NO: 54) and ESPLSSDXIFXQSHAGLXNLCXVVLXAVNXRLIIENLMKYGXLI (SEQ ID NO: 324; corresponding to position 95-138 of SEQ ID NO: 54), wherein X is any amino acid. The polypeptides may include at least 1, 2, 3, 4 or 5 amino acid motifs disclosed herein, and any combination thereof. Such polynucleotides may encode polypeptides having at least about 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% identity to SEQ ID NO: 54, 55 or 56 and comprise one or more of the motifs disclosed herein.

[0065] In certain embodiments, the heterologous regulatory element operably linked to the DGAT variant comprises a heterologous promoter. The heterologous promoter may be any promoter described herein, or known in the art, such as, for example, a constitutive promoter, a seed preferred promoter, or tissue preferred promoter described herein. In certain embodiments, expression of the high oil DGAT variant polypeptide encoded by a high oil DGAT polynucleotide operably linked to the heterologous promoter is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, as compared to expression of a high oil DGAT variant polypeptide encoded by a high oil DGAT polynucleotide operably linked to the native DGAT promoter. In certain embodiments, the heterologous promoter is a seed preferred promoter, such as, for example, a P-conglycinin promoter. In certain embodiments of the compositions and methods described herein, the promoter comprises a nucleic acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 43-45. In certain embodiments, expression of the high oil DGAT variant polypeptide encoded by a high oil DGAT polynucleotide operably linked to a promoter comprising a nucleic acid sequence that is at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 43-45 is increased byat least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, as compared to expression of a high oil DGAT variant polypeptide encoded by a high oil DGAT polynucleotide operably linked to the native DGAT promoter.

[0066] As used herein "operably linked" is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (e.g., a promoter) is a functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, operably linked is intended that the coding regions are in the same reading frame.

[0067] As used herein, “heterologous” in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide that is from a species different from the species from which the polynucleotide was derived, or, if from the same / analogous species, one or both are substantially modified from their original form and / or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.

[0068] As used herein “regulatory element” generally refers to a transcriptional regulatory element involved in regulating the transcription of a nucleic acid molecule such as a gene or a target gene. The regulatory element is a nucleic acid and may include a promoter, an enhancer, an intron, expression modulating elements (EMEs), a 5 ’-untranslated region (5’-UTR, also known as a leader sequence), or a 3’-UTR or a combination thereof. A regulatory element may act in "cis" or "trans", and generally it acts in "cis", i.e., it activates expression of genes located on the same nucleic acid molecule, e.g., a chromosome, where the regulatory element is located.

[0069] An “enhancer” element is any nucleic acid molecule that increases transcription of a nucleic acid molecule when functionally linked to a promoter regardless of its relative position. Various enhancers are known in the art including for example, introns with gene expression enhancing properties in plants, the ubiquitin intron (i.e., the maize ubiquitin intron 1 (see, for example, NCBI sequence S94464)), the omega enhancer or the omega prime enhancer (Gallie, et al., (1989) Molecular Biology ofRNA ed. Cech (Liss, New York) 237-256 and Gallie, et al., (1987) Gene 60:217-25), the CaMV 35S enhancer (see, e.g., Benfey, et al., (1990) EMBO J.9: 1685-96) and the enhancers of US Patent Number 7,803,992 may also be used. The above list of transcriptional enhancers is not meant to be limiting. Any appropriate transcriptional enhancer can be used in the embodiments described herein.

[0070] A “repressor” (also sometimes called herein silencer) is defined as any nucleic acid molecule which inhibits the transcription when functionally linked to a promoter regardless of relative position. The term "cis-element" generally refers to transcriptional regulatory element that affects or modulates expression of an operably linked transcribable polynucleotide, where the transcribable polynucleotide is present in the same DNA sequence. A cis-element may function to bind transcription factors, which are trans-acting polypeptides that regulate transcription.

[0071] An “intron” is an intervening sequence in a gene that is transcribed into RNA but is then excised in the process of generating the mature mRNA. The term is also used for the excised RNA sequences. An “exon” is a portion of the sequence of a gene that is transcribed and is found in the mature mRNA derived from the gene but is not necessarily a part of the sequence that encodes the final gene product. The 5' untranslated region (5’UTR) (also known as a translational leader sequence or leader RNA) is the region of an mRNA that is directly upstream from the initiation codon. This region is involved in the regulation of translation of a transcript by differing mechanisms in viruses, prokaryotes and eukaryotes. The “3' non-coding sequences” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.

[0072] As used herein “promoter” refers to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in plant cells. In certain embodiments, the polynucleotides described herein are operably linked to a promoter that drives expression in a plant cell. Any promoter known in the art can be used in the methods of the present disclosure including, but not limited to, constitutive promoters, pathogeninducible promoters, wound-inducible promoters, tissue-preferred promoters, and chemical- regulated promoters. The choice of promoter may depend on the desired timing and location of expression in the transformed plant as well as other factors, which are known to those of skill inthe art. Such constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99 / 43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter; rice actin; ubiquitin; pEMU; MAS; ALS; and the like. Other constitutive promoters include, for example, those disclosed in U.S. Patent Nos.5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611, which are known in the art, and can be contemplated for use in the present disclosure.

[0073] Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter can be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical -inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-la promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (e.g., the glucocorticoid-inducible promoter, and tetracycline-inducible and tetracycline-repressible promoters).

[0074] Tissue-preferred promoters can be utilized to target enhanced expression of the target genes or proteins within a particular plant tissue. Such tissue-preferred promoters include, but are not limited to, leaf-preferred promoters, root-preferred promoters, seed-preferred promoters, and stem-preferred promoters. Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2): 255 -265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol.112(2):525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al. (1993) Plant Mol Biol. 23(6): 1129-1138; Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters can be modified.

[0075] Leaf-specific promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2)255-265; Kwon et al. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994)Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.

[0076] "Seed-preferred" promoters include both "seed-specific" promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as "seedgerminating" promoters (those promoters active during seed germination). Such seed-preferred promoters include, but are not limited to, Ciml (cytokinin-induced message), cZ19Bl (maize 19 kDa zein), milps (myo-inositol- 1 -phosphate synthase), and celA (cellulose synthase) (see WO 00 / 11177, herein incorporated by reference). Gama-zein is a preferred endosperm-specific promoter. Glob-1 is a preferred embryo-specific promoter. For dicots, seed-specific promoters include, but are not limited to, bean -phaseolin, napin, P-conglycinin, soybean lectin, cruciferin, and the like. For monocots, seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO 00 / 12733, where seed-preferred promoters from endl and end2 genes are disclosed; herein incorporated by reference.

[0077] In certain embodiments, the polynucleotides of the present disclosure can involve the use of the intact, native gene, wherein the expression is driven by a cognate 5' upstream promoter sequence(s).

[0078] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockout of an endogenous RS gene, the endogenous RS gene encoding a RS polypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 57, 93, 132, 169, 208, 245 or 283. In certain embodiments, the endogenous RS gene comprises a nucleic acid sequence that is at least, or at least about, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, 46, 95, 131, 171, 207 or 247.

[0079] In certain embodiments of the compositions and methods described herein, the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockdown of an endogenous RS gene, the endogenous RS gene encoding an RSpolypeptide comprising an amino acid sequence that is at least, or at least about, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 57, 93, 132, 169, 208, 245 or 283. In certain embodiments, the cell, seed, or plant comprises at least a 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease in expression of a RS, as compared to a control seed.

[0080] As used herein “encoding,” “encoded,” or the like, with respect to a specified nucleic acid, means comprising the information for translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons. Typically, the amino acid sequence is encoded by the nucleic acid using the “universal” genetic code. However, variants of the universal code, such as is present in some plant, animal and fungal mitochondria, the bacterium Mycoplasma capricolum (Yamao, et al., (1985) Proc. Natl. Acad. Sci. USA 82:2306-9) or the ciliate Macronucleus, may be used when the nucleic acid is expressed using these organisms.

[0081] The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.

[0082] As used herein "percent (%) sequence identity" with respect to a reference sequence (subject) is determined as the percentage of amino acid residues or nucleotides in a candidate sequence (query) that are identical with the respective amino acid residues or nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any amino acid conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The percent identity between the two sequences is a function of the number of identical positions shared bythe sequences (e.g., percent identity of query sequence = number of identical positions between query and subject sequences / total number of positions of query sequence *100).

[0083] Unless otherwise stated, sequence identity / similarity values provided herein refer to the value obtained using the BLAST 2.0 suite of programs using default parameters (Altschul, et al., (1997) Nucleic Acids Res. 25:3389-402).

[0084] In certain embodiments, the modifications described herein are of the endogenous gene (e.g., MFT, DGAT, RS). As used herein “endogenous gene” refers to a gene that is original to a host plant and can be used synonymously with “host genomic DNA,” “pre-existing DNA,” and the like. Moreover, for the purposes herein, an endogenous gene includes coding DNA and genomic DNA within and surrounding the coding DNA, such as for example, the promoter, intron, and terminator sequences.

[0085] Methods to modify or alter endogenous genomic DNA are known in the art. For example, a pre-existing or endogenous sequence in a host plant can be modified or altered in a site-specific fashion using one or more site-specific engineering systems. In certain embodiments, one or more modifications is a targeted genetic modification. In certain embodiments, the endogenous gene may be modified by a CRISPR associated (Cas) endonuclease, a Zn-finger nuclease- mediated system, a meganucl ease-mediated system, an oligonucleobase-mediated system, or any gene modification system known to one of ordinary skill in the art.

[0086] As used herein, a targeted genetic modification refers to the direct manipulation of an organism’s genes. The targeted modification may be introduced using any technique known in the art, such as, for example, plant breeding, genome editing, or single locus conversion.

[0087] As used herein, “polynucleotide” includes reference to a deoxyribopolynucleotide, ribopolynucleotide or analogs thereof that have the essential nature of a natural ribonucleotide in that they hybridize, under stringent hybridization conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and / or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide can be full-length or a subsequence of a structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as theterm is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia, simple and complex cells.

[0088] In certain embodiments, the modifications described herein introduce a polynucleotide into the plant, cell or seed (e.g., SWT, SUT, DGAT). In certain embodiments, the introduced polynucleotide is operably linked to a heterologous regulatory element. Methods to introduce polynucleotides are known in the art. In certain embodiments, the polynucleotides described herein are provided in expression cassettes (e.g., a plasmid, cosmid, virus, autonomously replicating sequence, phage, or linear or circular single-stranded or double-stranded DNA or RNA nucleotide sequence) for expression in the plant, seed, or cell. The cassette can include 5' and 3' regulatory sequences operably linked to a polynucleotide. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and / or recombination sites for insertion of the polynucleotide to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

[0089] The expression cassette can include in the 5'-3 ' direction of transcription, a transcriptional and translational initiation region (e g., a promoter), a polynucleotide described herein, and a transcriptional and translational termination region (e.g., termination region) functional in plants. The regulatory regions (e.g., promoters, transcriptional regulatory regions, and translational termination regions) and / or the polynucleotide may be native / analogous to the host cell or to each other. Alternatively, the regulatory regions and / or the polynucleotide may be heterologous to the host cell or to each other.

[0090] The termination region may be native with the transcriptional initiation region, with the plant host, or may be derived from another source (i.e., foreign or heterologous) than the promoter, the polynucleotide, the plant host, or any combination thereof.

[0091] The expression cassette may additionally contain a 5' leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include viral translational leader sequences.

[0092] Generally, the expression cassette can comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glyphosate, glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the present disclosure.

[0093] In preparing the expression cassette, the various DNA fragments may be manipulated, to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

[0094] The present disclosure further provides a method of generating plants producing seeds with an increased oil or fatty acid content as compared to a control seed comprising introducing into a regenerable plant cell two or more (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more) modifications selected from the group consisting of: (i) a modification increasing expression, activity, and / or stability of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression, activity, and / or stability of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression, activity, and / or stability of an ABB polypeptide, (vi) a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof, and generating the plant, wherein the plant comprises the two or more modifications and produces a seed having an increased oil content as compared to a control plant(e g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0095] The modification increasing the expression, activity, and / or stability of an endogenous SWT polypeptide may be any modification described herein. The modification increasing the expression, activity, and / or stability of an endogenous SUT polypeptide may be any modification described herein. The modification decreasing the expression, activity, and / or stability of an MFT polypeptide may be any modification described herein. The modification increasing the expression or activity of an MFT network gene may be any modification described herein. The modification increasing the expression, activity, and / or stability of an ABB network polypeptide may be any modification described herein. The modification increasing the expression, activity, and / or stability of an ODP1 network polypeptide may be any modification described herein. The modification introducing a high oil DGAT variant may be any modification described herein. The modification decreasing the expression, activity, and / or stability of an RS polypeptide may be any modification described herein.

[0096] In certain embodiments, the method generates plants producing seed comprising at least or at least about a 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2 1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, or 8.0 percentage point increase and less than about 10.0, 9.5, 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, 5.0 or 4.5 percentage point increase in fatty acid or oil content measured on a dry weight basis relative to a control seed, such as, for example, a seed comprising one of the two or more modifications or a seed comprising at least one and less than all of the two or more modifications.

[0097] In certain embodiments, the method generates plants producing seed comprising modified amounts of fatty acids, such as at least a 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50% increase in oleic acid content, linoleic acid content, or a combination thereof expressed by weight as a proportion of the total fatty acid content as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0098] In certain embodiments, the seed or the seed of the plant comprises a protein content that is at least the same as a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or moremodifications), or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to the control seed.

[0099] In certain embodiments, the method generates plants producing seed comprising a total seed weight greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to a control seed (e.g., an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0100] In certain embodiments, the plant has a yield that is greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5%, as compared to the corresponding control plant (an unmodified seed, a seed comprising one of the two or more modifications, or a seed comprising at least one and less than all of the two or more modifications).

[0101] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression, activity, and / or stability of a SUT polypeptide.

[0102] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification introducing a high oil DGAT variant.

[0103] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression, activity, and / or stability of an ODP1 polypeptide.

[0104] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0105] In certain embodiments, the method comprises introducing a modification increasing expression, activity, and / or stability of a SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0106] In certain embodiments, the method comprises introducing a modification increasing expression, activity, and / or stability of an ODP1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0107] In certain embodiments, the method comprises introducing a modification introducing a high oil DGAT variant and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

[0108] In certain embodiments, the method comprises introducing comprises a modification introducing a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide.

[0109] In certain embodiments, the method comprises introducing a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression, activity, and / or stability of a SUT polypeptide, and a modification introducing a high oil DGAT variant.

[0110] In certain embodiments, the method comprises introducing a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, and a modification increasing expression, activity, and / or stability of an ODP1 polypeptide.

[0111] In certain embodiments, the method comprises introducing a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression, activity, and / or stability of an ODP1 polypeptide, and a modification increasing expression, activity, and / or stability of a SUT polypeptide.

[0112] In certain embodiments, the method for introducing one or more of the at least one modification into the regenerable plant cell comprises using genome editing technologies. In certain embodiments, the method comprises editing the endogenous gene or a previously introduced gene. In certain embodiments, the method for introducing one or more of the at least one modification comprises introgressing a modified gene or a high oil QTL into the plant.

[0113] The genome editing technology for use in the methods and compositions described herein is not particularly limited and may be any genome editing technique that allows for the modification or targeted introduction of the desired polynucleotide.

[0114] In certain embodiments the genome editing technique is selected from the group consisting of a polynucleotide-guided endonuclease, CRISPR-Cas endonucleases, base editing deaminases, zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), or an engineered site-specific meganuclease.

[0115] In certain embodiments, the genome modification may be facilitated through the induction of a double-stranded break (DSB) or single-strand break, in a defined position in the genome near the desired alteration. DSBs can be induced using any DSB-inducing agent available, including, but not limited to, TALENs, meganucleases, zinc finger nucleases, Cas9- gRNA systems (based on bacterial CRISPR-Cas systems), guided cpfl endonuclease systems, and the like. In some embodiments, the introduction of a DSB can be combined with the introduction of a polynucleotide modification template.

[0116] In certain embodiments, the method comprises: (a) providing a guide RNA, at least one polynucleotide modification template, and at least one Cas endonuclease to the regenerable plant cell, wherein the at least one Cas endonuclease introduces a double stranded break at an endogenous gene to be modified (e.g., MFT, DGAT, RS) in the plant cell, and wherein the polynucleotide modification template generates a modified gene that encodes any of the modifications described herein; (b) obtaining a plant from the plant cell; and (c) generating a progeny plant.

[0117] Double-strand breaks induced by double-strand-break-inducing agents, such as endonucleases that cleave the phosphodiester bond within a polynucleotide chain, can result in the induction of DNA repair mechanisms, including the non-homologous end-joining pathway, and homologous recombination. Endonucleases include a range of different enzymes, including restriction endonucleases (see e.g. Roberts et al., (2003) Nucleic Acids Res 1 :418-20), Roberts et al., (2003) Nucleic Acids Res 31 :1805-12, and Belfort et al., (2002) in Mobile DNA II, pp. 761- 783, Eds. Craigie et al., (ASM Press, Washington, DC)), meganucleases (see e.g., WO 2009 / 114321; Gao et al. (2010) Plant Journal 1 :176-187), TAL effector nucleases or TALENs (see e g., US20110145940, Christian, M., T. Cermak, et al. 2010. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186(2): 757-61 and Boch et al., (2009), Science 326(5959): 1509-12), zinc finger nucleases (see e.g. Kim, Y. G., J. Cha, et al. (1996). "Hybrid restriction enzymes: zinc finger fusions to FokI cleavage”), and CRISPR-Cas endonucleases (see e g. W02007 / 025097 application published March 1, 2007).

[0118] Once a double-strand break is induced in the genome, cellular DNA repair mechanisms are activated to repair the break. There are two DNA repair pathways. One is termed nonhomologous end-joining (NHEJ) pathway (Bleuyard et al., (2006) DNA Repair 5: 1-12) and the other is homology-directed repair (HDR). The structural integrity of chromosomes is typically preserved by NHEJ, but deletions, insertions, or other rearrangements (such as chromosomal translocations) are possible (Siebert and Puchta, 2002, Plant Cell 14: 1121-31; Pacher et al., 2007, Genetics 175:21-9. The HDR pathway is another cellular mechanism to repair double-stranded DNA breaks and includes homologous recombination (HR) and singlestrand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem. 79: 181-211).

[0119] In addition to the double-strand break inducing agents, site-specific base conversions can also be achieved to engineer one or more nucleotide changes to create one or more modifications described herein into the genome. These include for example, a site-specific base edit mediated by an C*G to T*A or an A«T to G*C base editing deaminase enzymes (Gaudelli et al., Programmable base editing of A»T to G*C in genomic DNA without DNA cleavage." Nature (2017); Nishida et al. “Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems.” Science 353 (6305) (2016); Komor et al. “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.” Nature 533 (7603) (2016):420-4.

[0120] In the methods described herein, the endogenous gene may be modified by a CRISPR associated (Cas) endonuclease, a Zn-finger nuclease-mediated system, a meganuclease-mediated system, an oligonucleobase-mediated system, or any gene modification system known to one of ordinary skill in the art.

[0121] In certain embodiments the endogenous gene is modified by a CRISPR associated (Cas) endonuclease.

[0122] Class I Cas endonucleases comprise multisubunit effector complexes (Types I, III, and IV), while Class 2 systems comprise single protein effectors (Types II, V, and VI) (Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13; Haft et al., 2005, Computational Biology, PLoS Comput Biol 1(6): e60; and Koonin et al. 2017, Curr Opinion Microbiology 37:67-78). In Class 2 Type II systems, the Cas endonuclease acts in complex with a guide polynucleotide.

[0123] Accordingly, in certain embodiments of the methods described herein the Cas endonuclease forms a complex with a guide polynucleotide (e.g., guide polynucleotide / Cas endonuclease complex).

[0124] As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonucleases described herein, and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence). The guide polynucleotide may further comprise a chemically modified base, such as, but not limited, to Locked Nucleic Acid (LNA), 5-methyl dC, 2,6-Diaminopurine, 2’-Fluoro A, 2’-Fluoro U, 2'-O-Methyl RNA, Phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5’ to 3’ covalent linkage resulting in circularization.

[0125] In certain embodiments, the Cas endonuclease forms a complex with a guide polynucleotide (e.g., gRNA) that directs the Cas endonuclease to cleave the DNA target to enable target recognition, binding, and cleavage by the Cas endonuclease. The guide polynucleotide (e.g., gRNA) may comprise a Cas endonuclease recognition (CER) domain that interacts with the Cas endonuclease, and a Variable Targeting (VT) domain that hybridizes to a nucleotide sequence in a target DNA. In certain embodiments, the guide polynucleotide (e.g., gRNA) comprises a CRISPR nucleotide (crNucleotide; e.g., crRNA) and a trans-activating CRISPR nucleotide (tracrNucleotide; e.g., tracrRNA) to guide the Cas endonuclease to its DNA target. The guide polynucleotide (e.g., gRNA) comprises a spacer region complementary to one strand of the double strand DNA target and a region that base pairs with the tracrNucleotide (e.g., tracrRNA), forming a nucleotide duplex (e.g. RNA duplex).

[0126] In certain embodiments, the gRNA is a “single guide RNA” (sgRNA) that comprises a synthetic fusion of crRNA and tracrRNA. In many systems, the Cas endonuclease-guide polynucleotide complex recognizes a short nucleotide sequence adjacent to the target sequence (protospacer), called a “protospacer adjacent motif’ (PAM).

[0127] The terms “single guide RNA" and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to atracrRNA (trans-activating CRISPR RNA). The single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR / Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, optionally bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site.

[0128] The nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence. In one embodiment, the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can be at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64,65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides in length. In one embodiment, the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a tetraloop sequence, such as, but not limiting to a GAAA tetraloop sequence.

[0129] The term “variable targeting domain” or “VT domain” is used interchangeably herein and includes a nucleotide sequence that can hybridize (is complementary) to one strand (nucleotide sequence) of a double strand DNA target site. The percent complementation between the first nucleotide sequence domain (VT domain) and the target sequence can be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 63%, 65%, 66%, 67%,68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or100%. The variable targeting domain can be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides. The variable targeting domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.

[0130] The term “Cas endonuclease recognition domain” or “CER domain” (of a guide polynucleotide) is used interchangeably herein and includes a nucleotide sequence that interactswith a Cas endonuclease polypeptide. A CER domain comprises a (trans-acting) tracrNucleotide mate sequence followed by a tracrNucleotide sequence. The CER domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence (see for example US20150059010A1, published 26 February 2015), or any combination thereof.

[0131] A “protospacer adjacent motif’ (PAM) as used herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein. In certain embodiments, the Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not adjacent to, or near, a PAM sequence. In certain embodiments, the PAM precedes the target sequence (e.g., Casl2a). In certain embodiments, the PAM follows the target sequence (e.g., S. pyogenes Cas9). The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

[0132] As used herein, the terms “guide polynucleotide / Cas endonuclease complex”, “guide polynucleotide / Cas endonuclease system”, “ guide polynucleotide / Cas complex”, “guide polynucleotide / Cas system” and “guided Cas system” “polynucleotide-guided endonuclease”, and “PGEN” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease, that are capable of forming a complex, wherein said guide polynucleotide / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site. A guide polynucleotide / Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the known CRISPR systems (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13). In certain embodiments, the guide polynucleotide / Cas endonuclease complex is provided as a ribonucleoprotein (RNP), wherein the Cas endonuclease component is provided as a protein and the guide polynucleotide component is provided as a ribonucleotide.

[0133] Examples of Cas endonucleases for use in the methods described herein include, but are not limited to, Cas9 and Cpfl. Cas9 (formerly referred to as Cas5, Csnl, or Csxl2) is a Class 2 Type II Cas endonuclease (Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1-15).A Cas9-gRNA complex recognizes a 3’ PAM sequence (NGG for the S. pyogenes Cas9) at the target site, permitting the spacer of the guide RNA to invade the double- stranded DNA target, and, if sufficient homology between the spacer and protospacer exists, generate a double-strand break cleavage. Cas9 endonucleases comprise RuvC and HNH domains that together produce double strand breaks, and separately can produce single strand breaks. For the S. pyogenes Cas9 endonuclease, the double-strand break leaves a blunt end. Cpfl is a Clas 2 Type V Cas endonuclease, and comprises nuclease RuvC domain but lacks an HNH domain (Yamane et al., 2016, Cell 165:949-962). Cpfl endonucleases create “sticky” overhang ends.

[0134] Some uses for Cas9-gRNA systems at a genomic target site include, but are not limited to, insertions, deletions, substitutions, or modifications of one or more nucleotides at the target site; modifying or replacing nucleotide sequences of interest (such as a regulatory elements); insertion of polynucleotides of interest; gene knock-out; gene-knock in; modification of splicing sites and / or introducing alternate splicing sites; modifications of nucleotide sequences encoding a protein of interest; amino acid and / or protein fusions; and gene silencing by expressing an inverted repeat into a gene of interest.

[0135] The terms “target site”, “target sequence”, “target site sequence, ’’target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus” and “protospacer”, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, a locus, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick or cleave . The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell. An “artificial target site” or “artificial target sequence” are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a cell. Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a cell but be located in adifferent position (i.e., a non-endogenous or non-native position) in the genome of a cell. An “altered target site”, “altered target sequence”, “modified target site”, “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence. Such “alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i) - (iii).

[0136] A “polynucleotide modification template” is also provided that comprises at least one nucleotide modification when compared to the nucleotide sequence to be edited. A nucleotide modification can be at least one nucleotide substitution, addition, deletion, or chemical alteration. Optionally, the polynucleotide modification template can further comprise homologous nucleotide sequences flanking the at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.

[0137] In certain embodiments of the methods disclosed herein, a polynucleotide of interest is inserted at a target site and provided as part of a “donor DNA” molecule. As used herein, “donor DNA” is a DNA construct that comprises a polynucleotide of interest to be inserted into the target site of a Cas endonuclease. The donor DNA construct further comprises a first and a second region of homology that flank the polynucleotide of interest. The first and second regions of homology of the donor DNA share homology to a first and a second genomic region, respectively, present in or flanking the target site of the cell or organism genome. The donor DNA can be tethered to the guide polynucleotide. Tethered donor DNAs can allow for colocalizing target and donor DNA, useful in genome editing, gene insertion, and targeted genome regulation, and can also be useful in targeting post-mitotic cells where function of endogenous HR machinery is expected to be highly diminished (Mali et al., 2013, Nature Methods Vol. 10: 957-963). The amount of homology or sequence identity shared by a target and a donor polynucleotide can vary and includes total lengths and / or regions.

[0138] The process for editing a genomic sequence at a Cas9-gRNA double-strand-break site with a modification template generally comprises: providing a host cell with a Cas9-gRNA complex that recognizes a target sequence in the genome of the host cell and is able to induce a double-strand-break in the genomic sequence, and at least one polynucleotide modification template comprising at least one nucleotide alteration when compared to the nucleotide sequenceto be edited. The polynucleotide modification template can further comprise nucleotide sequences flanking the at least one nucleotide alteration, in which the flanking sequences are substantially homologous to the chromosomal region flanking the double-strand break. Genome editing using double-strand-break-inducing agents, such as Cas9-gRNA complexes, has been described, for example in US20150082478, WO2015026886, WO2016007347, and W02016025131.

[0139] To facilitate optimal expression and nuclear localization for eukaryotic cells, the gene comprising the Cas endonuclease may be optimized as described in WO2016186953, and then delivered into cells as DNA expression cassettes by methods known in the art. In certain embodiments, the Cas endonuclease is provided as a polypeptide. In certain embodiments, the Cas endonuclease is provided as a polynucleotide encoding a polypeptide. In certain embodiments, the guide RNA is provided as a DNA molecule encoding one or more RNA molecules. In certain embodiments, the guide RNA is provided as RNA or chemically modified RNA. In certain embodiments, the Cas endonuclease protein and guide RNA are provided as a ribonucleoprotein complex (RNP).

[0140] In certain embodiments of the inventive methods described herein the endogenous gene is modified by a zinc-finger-mediated genome editing process. The zinc-finger-mediated genome editing process for editing a chromosomal sequence includes for example: (a) introducing into a cell at least one nucleic acid encoding a zinc finger nuclease that recognizes a target sequence in the chromosomal sequence and is able to cleave a site in the chromosomal sequence, and, optionally, (i) at least one donor polynucleotide that includes a sequence for integration flanked by an upstream sequence and a downstream sequence that exhibit substantial sequence identity with either side of the cleavage site, or (ii) at least one exchange polynucleotide comprising a sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site and which further comprises at least one nucleotide change; and (b) culturing the cell to allow expression of the zinc finger nuclease such that the zinc finger nuclease introduces a double-stranded break into the chromosomal sequence, and wherein the double-stranded break is repaired by (i) a non-homologous end-joining repair process such that an inactivating mutation is introduced into the chromosomal sequence, or (ii) a homology-directed repair process such that the sequence in the donor polynucleotide is integrated into the chromosomal sequence or thesequence in the exchange polynucleotide is exchanged with the portion of the chromosomal sequence.

[0141] A zinc finger nuclease includes a DNA binding domain (i.e., zinc finger) and a cleavage domain (i.e., nuclease). The nucleic acid encoding a zinc finger nuclease may include DNA or RNA. Zinc finger binding domains may be engineered to recognize and bind to any nucleic acid sequence of choice. See, for example, Beerli et al. (2002) Nat. Biotechnol. 20: 135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411- 416; and Doyon et al. (2008) Nat. Biotechnol. 26:702-708; Santiago et al. (2008) Proc. Natl. Acad. Sci. USA 105:5809-5814; Urnov, et al., (2010) Nat Rev Genet. 11(9):636-46; and Shukla, et al., (2009) Nature 459 (7245):437-41. An engineered zinc finger binding domain may have a novel binding specificity compared to a naturally occurring zinc finger protein. As an example, the algorithm of described in U.S. Pat. No. 6,453,242 may be used to design a zinc finger binding domain to target a preselected sequence. Nondegenerate recognition code tables may also be used to design a zinc finger binding domain to target a specific sequence (Sera et al. (2002) Biochemistry 41 :7074-7081). Tools for identifying potential target sites in DNA sequences and designing zinc finger binding domains may be used (Mandell et al. (2006) Nuc. Acid Res. 34:W516-W523; Sander et al. (2007) Nuc. Acid Res. 35:W599-W605).

[0142] An exemplary zinc finger DNA binding domain recognizes and binds a sequence having at least about 80% sequence identity with the desired target sequence. In other embodiments, the sequence identity may be about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0143] A zinc finger nuclease also includes a cleavage domain. The cleavage domain portion of the zinc finger nucleases may be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which a cleavage domain may be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2010-2011 Catalog, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes that cleave DNA are known (e.g., SI Nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease). One or more of these enzymes (or functional fragments thereof) may be used as a source of cleavage domains.

[0144] In certain embodiments of the methods described herein the endogenous gene is modified by using “custom" meganucleases produced to modify plant genomes (see e g., WO2009 / 114321 ; Gao et al. (2010) Plant Journal 1 : 176-187). The term "meganuclease" generally refers to a naturally occurring homing endonuclease that binds double-stranded DNA at a recognition sequence that is greater than 12 base pairs and encompasses the corresponding intron insertion site. Naturally occurring meganucleases can be monomeric (e.g., I-Scel) or dimeric (e.g., I-Crel). The term meganuclease, as used herein, can be used to refer to monomeric meganucleases, dimeric meganucleases, or to the monomers which associate to form a dimeric meganuclease.

[0145] Naturally occurring meganucleases have been used to effectively promote site-specific genome modification in plants, yeast, Drosophila, mammalian cells and mice. Engineered meganucleases such as, for example, LIG-34 meganucleases, which recognize and cut a 22 basepair DNA sequence found in the genome of Zea mays (maize) are known (see e g., US 20110113509).

[0146] In certain embodiments of the methods described herein the endogenous gene is modified by using TAL endonucleases (TALEN). TAL (transcription activator-like) effectors from plant pathogenic Xanthomonas are important virulence factors that act as transcriptional activators in the plant cell nucleus, where they directly bind to DNA via a central domain of tandem repeats. A transcription activator-like (TAL) effector-DNA modifying enzymes (TALE or TALEN) are also used to engineer genetic changes. See e.g., US20110145940, Boch et al., (2009), Science 326(5959): 1509-12. Fusions of TAL effectors to the FokI nuclease provide TALENs that bind and cleave DNA at specific locations. Target specificity is determined by developing customized amino acid repeats in the TAL effectors.

[0147] In certain embodiments of the methods described herein the endogenous gene is modified by using base editing, such as an oligonucleobase-mediated system. In addition to the doublestrand break inducing agents, site-specific base conversions can also be achieved to engineer one or more nucleotide changes to create one or more EMEs described herein into the genome. These include for example, a site-specific base edit mediated by a OG to T»A or an A»T to G*C base editing deaminase enzymes (Gaudelli et al., Programmable base editing of A«T to G’C in genomic DNA without DNA cleavage." Nature (2017); Nishida et al. “Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems.” Science 353 (6305) (2016); Komor et al. “Programmable editing of a target base in genomic DNA without doublestranded DNA cleavage.” Nature 533 (7603) (2016):420-4. Catalytically dead dCas9 fused to acytidine deaminase or an adenine deaminase protein becomes a specific base editor that can alter DNA bases without inducing a DNA break. Base editors convert C->T (or G->A on the opposite strand) or an adenine base editor that would convert adenine to inosine, resulting in an A->G change within an editing window specified by the gRNA.

[0148] The present disclosure further provides a method of generating plants producing seeds with an increased oil content as compared to a control seed comprising crossing a first plant comprising at least one modification described herein with a second plant comprising at least one modification described herein, harvesting the seed produced thereby, and generating a progeny plant. In certain embodiments, first plant comprises at least one modification that is not present in the second plant. In certain embodiments, the progeny plant comprises the at least one modification of the first plant and the at least one modification present in the second plant.

[0149] In certain embodiments, the method generates progeny plants producing seed comprising at least or at least about a 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, or 8.0 percentage point increase and less than about 10.0, 9.5, 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, 5.0 or 4.5 percentage point increase in fatty acid or oil content measured on a dry weight basis relative to the first plant, the second plant, or both the first and second plant.

[0150] In certain embodiments, the method generates plants producing seed comprising modified amounts of fatty acids, such as at least a 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50% increase in oleic acid content, linoleic acid content, or a combination thereof expressed by weight as a proportion of the total fatty acid content as compared to the first plant, the second plant, or both the first and second plant.

[0151] In certain embodiments, the method generates plants producing seed comprising a total seed weight greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or 20% as compared to the first plant, the second plant, or both the first and second plant.

[0152] In certain embodiments, the method generates plants having a yield that is greater than or within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, or 5%, as compared to the first plant, the second plant, or both the first and second plant.

[0153] Further provided are methods of plant breeding comprising crossing any of the plants described herein with a second plant to produce a progeny seed comprising at least one modification described herein. In certain embodiments, a plant is produced from the progeny seed.

[0154] In certain embodiments of the methods and compositions described herein, the seeds comprising the two or more modifications can be processed to produce oil. Methods of processing the seeds to produce oil are provided which include one or more steps of dehulling the seeds, crushing the seeds, heating the seeds, such as with steam, extracting the oil, roasting, and extrusion. Processing and oil extraction can be done using solvents or mechanical extraction. In certain embodiments, the oil content of the seeds of the compositions and methods described herein can be increased by at least 5%, 10%, 15% or 20% compared to a comparable cell or seed expressing the polynucleotide without the modification.

[0155] Products formed following processing include, without limitation, soybean oil. Crude or partially degummed oil can be further processed by one or more of degumming, alkali treatment, silica absorption, vacuum bleaching, hydrogenation, interesterification, filtration, deodorization, physical refining, refractionation, and optional blending to produce refined bleached deodorized (RBD) oil.

[0156] The oil can be used in animal feed and in food products for human consumption. Provided are food products and animal feed comprising oils which contain or are derived from the modified polynucleotides and modified polypeptides. The food products and animal feed may comprise nucleotides comprising one or more of the modified alleles disclosed herein and the modified polynucleotides, polypeptides and plant cell disclosed herein.

[0157] Also provided are methods of producing a plurality of elite high-oil plant lines in a plant production program comprising multiplex genome editing a plurality of elite plant lines to introduce at least two modifications described herein into the plurality of plant lines to produce a plurality of directly-edited elite plant n lines, and increasing seed of the plurality of directly- edited plant lines of step (a) by growing the directly-edited plant lines of step (a) and harvesting the seed therefrom over one or more generations (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) to produce a plurality of elite high-oil plant lines. In certain embodiments, the seed is grown and harvested a sufficient number of generations to produce a commercially relevant quantity of seed.

[0158] As used herein, a commercially relevant quantity refers to an amount of seed that is needed for a variety to be sold for commercial use. The amount of seed considered to be a commercially relevant amount is not particularly limited and may vary based upon the phenotypic characteristics of the seed or plant grown therefrom and economic factors. In certain embodiments of the methods described herein, the commercially relevant quantity of seed comprises at least 10, 25, 50, 75, 100, 250, 500, 1000, 10,000, or 100,000 units of the plurality of directly-edited plant lines or the directly-edited elite high-oil plant line. A unit of seed as used herein refers to about 140,000 seeds.

[0159] Further provided are methods for producing an elite high-oil plant line in a plant production program, the method comprising directly editing an elite plant line to introduce at least two modifications described herein to produce an elite high-oil plant line and increasing seed of the elite high-oil plant line over multiple generations to produce commercially relevant quantities of high-oil plant seed.

[0160] In certain embodiments, the seed of the elite high-oil plant line or seed of the elite high- oil plant lines of the methods described herein comprise at least or at least about a 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 10, or 15 and less than 20, 15, 10, 9, 8, 7, 6, or 5 percentage point increase in total oil measured on a dry weight basis, as compared to a control seed, such as, for example, an unmodified seed of an elite line, a seed of an elite line comprising one of the two or more modifications, or a seed of an elite line comprising at least one and less than all of the two or more modifications.

[0161] The following are examples of specific embodiments of some aspects of the invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the invention in any way.EXAMPLE 1

[0162] This example demonstrates transformation and CRISPR editing in soybean.

[0163] For genome engineering applications, the type II CRISPR / Cas system minimally requires the Cas9 protein and a duplexed crRNA / tracrRNA molecule or a synthetically fused crRNA and tracrRNA (guide RNA) molecule for DNA target site recognition and cleavage (Gasiunas et al. (2012) Proc. Natl. Acad. Sci. USA 109: E2579-86, Jinek e / aZ. (2012) Science 337:816-21, Mali et al. (2013) Science 339:823-26, and Cong et al. (2013) Science 339:819-23). Described hereinis a guideRNA / Cas endonuclease system that is based on the type II CRISPR / Cas system and consists of a Cas endonuclease and a guide RNA (or duplexed crRNA and tracrRNA) that together can form a complex that recognizes a genomic target site in a plant and introduces a double- strand -break into said target site.

[0164] To use the guide RNA / Cas endonuclease system in soybean, the Cas9 gene from Streptococcus pyogenes Ml GAS (SF370) was soybean codon optimized per standard techniques known in the art. To facilitate nuclear localization of the Cas9 protein in soybean cells, Simian virus 40 (SV40) monopartite amino terminal nuclear localization signal anA Agrobacterium tumefaciens bipartite VirD2 T-DNA border endonuclease carboxyl terminal nuclear localization signal were incorporated at the amino and carboxyl -termini of the Cas9 open reading frame, respectively. The soybean optimized Cas9 gene was operably linked to a soybean constitutive promoter such as the strong soybean constitutive promoter GM-EF1A2 (US Patent Application Publication 2009 / 0133159) or regulated promoter by standard molecular biological techniques.

[0165] The second component to form a functional guide RNA / Cas endonuclease system for genome engineering applications is a duplex of the crRNA and tracrRNA molecules or a synthetic fusing of the crRNA and tracrRNA molecules, a guide RNA. To confer efficient guide RNA expression (or expression of the duplexed crRNA and tracrRNA) in soybean, the soybean U6 polymerase III promoter and U6 polymerase III terminator were used.

[0166] Plant U6 RNA polymerase III promoters have been cloned and characterized from Arabidopsis and Medicago truncatula (Waibel and Filipowicz, NAR 18:3451-3458 (1990); Li et al., J. Integrat. Plant Biol. 49:222-229 (2007); Kim and Nam, Plant Mol. Biol. Rep. 31 :581-593 (2013); Wang et al., RNA 14:903-913 (2008)). Soybean U6 small nuclear RNA (snRNA) genes were identified herein by searching public soybean variety Williams82 genomic sequence using Arabidopsis U6 gene coding sequence. Approximately 0.5 kb genomic DNA sequence upstream of the first G nucleotide of a U6 gene was selected to be used as a RNA polymerase III promoter, for example, GM-U6-13.1 promoter or GM-U6-9.1 promoter, to express guide RNA to direct Cas9 nuclease to designated genomic site. The guide RNA coding sequence was 76 bp long and comprised a 20 bp variable targeting domain from a chosen soybean genomic target site on the 5’ end and a tract of 4 or more T residues as a transcription terminator on the 3’ end. The first nucleotide of the 20 bp variable targeting domain was a G residue to be used by RNApolymerase TIT for transcription. Other soybean U6 homologous genes promoters were similarly cloned and used for small RNA expression.

[0167] Since the Cas9 endonuclease and the guide RNA need to form a protein / RNA complex to mediate site-specific DNA double strand cleavage, the Cas9 endonuclease and guide RNA must be expressed in same cells. To improve their co-expression and presence, the Cas9 endonuclease and guide RNA expression cassettes were linked into a single DNA construct.

[0168] Ochrobactrum-mediated soybean embryonic axis transformation is done essentially as described in US Patent application US 2018 / 0216123 Al. Mature dry seeds of soybean cultivar 93Y21 are disinfected using chlorine gas and imbibed on semi-solid medium containing 5g / l sucrose and 6 g / 1 agar at room temperature in the dark. After an overnight incubation, the seed is soaked in distilled water for an additional 3-4 hrs at room temperature in the dark. Intact embryonic axis is isolated from cotyledon using a scapel blade in distilled sterile water. The embryonic axis explants are transferred to the deep plate with 15 mL of Ochrobactrum haywardense Hl-8 further containing a helper vector PHP85634 (RV005393) with binary vector RV029968 or RV029969 with suspension at OD600=0.5 in infection medium containing 200 pM acetosy ringone. The plates are sealed with parafilm (“Parafilm M” VWR Cat#52858), then sonicated (Sonicator- VWR model 50T) for 30 seconds. After sonication, embryonic axis explants are transferred to a single layer of autoclaved sterile filter paper (VWR#415 / Catalog # 28320-020). The plates are sealed with Micropore tape (Catalog # 1530-0, 3M, St. Paul, MN)) and incubated under dim light (5-10 pE / m2 / s, cool white fluorescent lamps) for 16 hrs at 21°C for 3 days.

[0169] After co-cultivation, the embryonic axis explants are cultured on shoot induction medium solidified with 0.7% agar in the absence of selection. The base of the explant (i.e., root radical of embryonic axis) is embedded in the medium. Shoot induction is carried out in a Percival Biological Incubator at 26°C with a photoperiod of 18hrs and a light intensity of 40-70 pE / m2 / s. 6 to 7 weeks after transformation, elongated shoots (>l-2 cm) are isolated and transferred to rooting medium containing selection agent. Transgenic plantlets are transferred to soil pots and were grown in the greenhouse.EXAMPLE 2

[0170] This example demonstrates the identification of soybean SWEET (SWT) genes expressed in the seed coat.

[0171] The Sugars Will Eventually be Exported Transporters (SWTs) is a group of efflux transporters which play critical roles in sugar efflux, phloem loading, and sugar import into developing seeds. Carbohydrates are translocated from source to seeds through the seed coat. SWTs expressed in the seed coat facilitate sucrose efflux from seed coat to developing seed cotyledon, affecting seed development and seed protein and oil content. By searching an internal expression database, 6 seed coat preferred SWTs were identified, as shown in Tables 2A-2C. Overexpression of seed coat SWT genes should increase seed oil content and seed size and improve soybean grain value and yield.Table 2A: Seed coat preferred expression of 6 Sweet genes in soybean cotyledonTable 2B: Seed coat preferred expression of 6 Sweet genes in soybean seed coatTable 2C: Seed coat preferred expression of 6 Sweet genes in soybean leafEXAMPLE 3

[0172] This example demonstrates that GmSWT24 and GmSWT39 regulate seed oil biosynthesis.

[0173] GmSWT24 and GmSWT39 are two sweet genes expressed strongly in the seed coat. To determine impact of GmSWT24 or GmSWT39 knockout on seed composition and seed size, one guide RNA, GM-SWT24-CR1 (GGCTCTAAATGGTTCCCACC, SEQ ID NO: 47) was designed to create a frameshift knockout for the SWT24 gene. Similarly, another guide RNA, GM-SWT39-CR1 (GCCATGTAGAGCAAAATGCG, SEQ ID NO: 48), was designed to create a frameshift knockout for the SWT39 gene. The soybean U6 small nuclear RNA promoter, such as the GM-U6-13.1 promoter or the GM-U6-9.1 promoter, was used to express guide RNAs to direct Cas9 nuclease to designated genomic target sites. The construct was transformed into Ochrobactrum haywardense Hl-8 strain for soybean transformation as described in the Example 1. Twenty TO plants were generated, PCR amplicon and NGS sequencing were used to characterize the indels at the GM-SWT24-CR1 target site of the SWT24 gene, or at the GM- SWT39-CR1 target sites of the SWT39 gene. Based on the analytical results, 10 TO plants with frameshift deletions were kept growing to maturity to get to T1 seeds. T1 seeds were planted from 5 editing events, and the same PCR amplicon and NGS sequencing were performed to screen T1 plants with homozygous frameshift alleles to get homozygous T2 seeds for seed composition analyses.

[0174] T1 plants from 5 frame shift events grew normally in greenhouse. Seed protein and oil content was determined by FT-NIR in T2 seeds from the T1 homozygous frame shift mutantplants. GmSWT24 and GmSWT39 frame shift knockout plants showed a significant increase in seed protein by ~2 points with 1-2 point reduction in oil content as compared to 93Y21 wild type (Table 3). T2 homozygous mutant seeds were grown out in field in short rows. The T3 seeds harvested from the short rows were used for NIT prediction of seed composition. Consistent with T2 seeds, the T3 seeds showed a similar increase in seed protein content. Sucrose content, total soluble carbohydrate, and short row yield of GmSWT24 or GmSWT39 knockout T3 seeds were not different from 93Y21 wild type seeds (Table 3).Table 3: Seed protein and oil contents of GmSWT24 and SWT39 knockout mutants

[0175] Knockout of GmSWT4, GmSWT5, GmSWT16, GmSWT17 and another sucrose transporter SUT2 (Glyma.l0g217900) is expected to increase seed protein content and reduce seed oil content. Overexpression of GmSWT4, GmSWT5, GmSWT16, GmSWT17, GmSWT24, GmSWT39, and SUT2 is expected to increase seed oil content.EXAMPLE 4

[0176] This example demonstrates MFT expression profiling.

[0177] MFT mutant is a high oil and high protein mutant identified from a gamma-ray mutant population. An MFT knockout line was previously generated by CRISPR editing. To identify downstream genes regulated by MFT, RNAseq analysis was performed on leaf samples, developing seed samples, seed coat and seed cotyledon samples collected from an MFT mutant plant, an MFT Knockout plant, and control wild type plants. Leaf samples were collected from plants at 35 days after pollination. Developing seed samples were collected from MFT mutant and wild type plants at 23, 35, 40 and 47 days after pollination. Developing seed samples were collected from MFT Knockout and control wild type plants at 19, 25, 35, 40, and 47 days after pollination and dissected into seed coat and seed cotyledon for profiling. Total RNA was isolated, and a cDNA library was constructed according to standard protocols. The cDNA library was sequenced using the Illumina platform. Adaptor sequences were trimmed (minlength=35, trimq=20, ktrim=r, qtrim=rl k=23 mink=l 1 hdist= 1 ) and reads aligning to Soybean rRNA genes (“maxindel=l, minid=0.95”) were removed by bbduk v38.90 (Bushnell, 2014). Abundances were calculated on a per-sample basis for the remaining sequence reads using Salmon vl.2.0 with parameters seqBias — validateMappings — numBootstraps 100 -1 SR” to align to a salmon gentrome index (created with parameters “-k 29 -keepDuplicates”) with the Soybean Williams 82.a4.vl reference transcript set amended to include ERCC spike-in sequences followed by summarization to the gene level.

[0178] Gene expression abundances as raw counts were imported into RStudio v. 2021.9.0.351 for downstream QC and differential gene expression analysis. As an initial low expression filtering step, genes that did not have an expression level of at least 10 read counts across any sample were removed from further analysis. A total of 41,346 soybean W82 genes pass this expression threshold. Principle component analysis (PCA) and a gene expression correlationbased hierarchically clustered dendrogram (HCD) were constructed to provide overviews on the quality of the read count data.

[0179] Differentially expressed genes (DEGs) were then identified at each development stage and per each tissue profiled using the DESeq2 method described in Love (2014) by comparing MFT event samples against their corresponding wildtype background samples. No comparisons between development stages or between tissues were performed. Read library size factors wereestimated by the DESeq method, and gene expression values judged to be outliers by DESeq2’s application of Cook’s distance were replaced by the mean of the remaining biological replicate samples for that gene. Criteria for identifying a DEG were an adjusted p-value <0.05 and absolute fold change of >1.25. Principal component analysis and a hierarchical clustering dendrogram were performed on the union of all detected DEGS using the DESeq variance stabilization transform (vst) normalized gene expression values.

[0180] As shown in Table 4, MFT expression was upregulated in the MFT mutant, suggesting that MFT may repress its own expression. In the MFT mutant or MFT knockout, ODPla, ODPlb, LECla and LEClb expression was upregulated greater than 2-fold in developing seeds. ODP1 and LEC1 are well known regulators for fatty acid biosynthesis and oil content in plants. The results suggest that MFT may function as a repressor for ODP1 and LEC1 expression and regulate oil biosynthetic pathway through ODP1 and LEC1.Table 4: Expression of 0DP1 and LEC1 in MFT mutant and MFT KO in developing seeds

[0181] The vst normalized gene expression dataset generated by DESeq2 was used to generate a co-expression network using Weighted Gene Co-expression Network Analysis (WGCNA, Langfelder et al, 2008) package in R. Initially, genes with coefficient of variation less than 10 across normalized gene expression values in all samples were removed prior to network generation. The co-expression network was generated using the blockwiseModules function in the WGCNA package with the following parameter settings: maxBlockSize = 5000, minModuleSize = 30, power = 5, randomSeed = 1234) and subsequently, network interactions that involved the MFT gene were selected for further analysis. Table 5 lists network interactions identified between the MFT gene and a subset of genes of interest for further investigation.Table 5: List of MFT network interactions

[0182] To validate the function of genes identified from MFT network analysis in regulating oil biosynthesis, a knockout variant of both AB 13 genes (Glyma.18G176100 and Glyma.08G357600) was generated by CRISPR SDN1 editing. T2 seed composition was determined by FT-NIR. The homozygous double knockout variant showed a significant reduction in oil and protein and a significant increase in sucrose and soluble carbohydrate, suggesting increasing expression or activity of ABI3 will increase oil and protein and decrease sucrose and soluble carbohydrate in a soybean seed (Table 6).Table 6: Seed composition of ABB double knockout variant

[0183] A knockout variant of both ODP1 genes (Glyma,15G221600 and Glyma.08G227700), was generated by CRISPR SDN1 editing. T2 seed composition was determined by FT-NIR. The homozygous double knockout variant showed a significant reduction in oil and protein and a significant increase in sucrose and soluble carbohydrate, suggesting increasing expression or activity of ODP1 will increase oil and protein and decrease sucrose and soluble carbohydrate in a soybean seed (Table 7).Table 7: Seed composition of 0DP1 double knockout variant

[0184] The function of other genes in Table 5 can also be validated by overexpression or knockout of the gene. For example, knockout of a GA regulated protein (Glyma.08G291900) and / or a bZIP TF (Glyma.l3G317000) is expected to increase seed protein and oil content in stacking with other high oil genes, such as MFT.EXAMPLE 5

[0185] This example demonstrates GmDGATlb variants with three amino acid substitutions increased seed oil in soybean.

[0186] Constructs with the P-conglycinin promoter or oleosin promoter driving expression of the GmDGATlb-3aa variant, which has substitutions C355S, N473S, and I479S, were stably transformed into soybean. The three amino acid substitutions are found within the C-terminus of the protein, with N473S and I479S residing near an acyl-CoA binding site at position Q485. Seed was advanced to the T3 generation and grown along with a GmDGATlb-MOD event containing 14 amino acid substitutions to enhance DGATlb activity expressed with the P- conglycinin promoter, named Soil 111. T3 seed was analyzed by NIT for oil and protein content. As shown in Table 8, three events expressing GmDGATlb-3aa with the P-conglycinin promoter increased oil 3.0 percentage points on average compared to sibling nulls. The oil produced by this variant was similar to the levels measured in GmDGATlb-MOD expressing seeds. Expressing GmDGATlb-3aa with the stronger P-conglycinin promoter resulted in higher oil as compared to expression under the oleosin promoter, which increased oil by 0.69 percentage points on average across five events. These results show that a strong seed specific promoter driving the novel DGATlb variant expression provides high oil in the soybean seed.

[0187] These results also indicate that the three amino acid variant increases oil to levels achieved with GmDGATlb-MOD, which has 14 amino acid substitutions. There were no significant differences in protein content for any of the events.Table 8: Expression of DGATlb C355S, N473S, I479S variant under the P-conglycinin or oleosin promoter* Statistical comparisons for each event were made respective to null segregants by student’s t-test. with asterisks representing significant differences (p < .05)

[0188] Certain events expressing GmDGATlb-3aa under the P-conglycinin promoter had lower 100-seed weight (Table 9). Two GmDGATlb-3aa overexpression events along with corresponding null segregants were advanced to a multiple location field trial. Yield was measured across eight locations and seed composition was determined on a representative selection of six locations by NIT. The yield, protein and oil content of the seeds is shown in Table 10. Differences in fatty acid profile and carbohydrates determined by NIR spectroscopy are shown in Table 11. Changes in total soluble carbohydrates, sugars, stachyose and sucrose are shown in Table 12.Table 9: 100-seed weight of T3 seeds expressing GmDGATlb-3aa with the 0-conglycinin promoter100-seed weight of GmDGATlb-3aa T3 seeds. Statistical comparisons of seeds expressing GmDGATlb-3aa were made respective to null segregants by student’s t-test, with asterisks representing significant differences (p < 0.05), (n > 4)Table 10: Summary of the GmDGATlb-3aa multi-field location trialvalues represent mean ± standard error* Statistical comparisons across all groups were determined by BLUP analysis, with non-overlapping letters representing significant differences (p < .05)Table 1 1 : Fatty acid profile for GmDGATlb-3aa soybeans grown in the multiple location field trial* Indicated values represent mean ± standard error* Statistical comparisons across all groups were determined by BLUP analysis, with non-overlapping letters representing significant differences (p < .05)Table 12: Carbohydrate analysis for GmDGATlb-3aa soybeans grown in the multiple location field trial.Seed composition was detennined from six locations determined by NIT spectroscopy. Indicated values represent mean ± standard error. Statistical comparisons across all groups were determined by BLUP analysis, with non-overlapping letters representing significant differences (p < 0.05).Values are reported on a wt%, at 13% moisture, basis

[0189] Taken together, these results demonstrate that the GmDGATlb-3aa variant can significantly increase oil, while maintaining or slightly increasing protein content across a variety of environmental conditions.EXAMPLE 6

[0190] This example demonstrates CRISPR editing of a high oil gene.

[0191] Beta-cong pro:DGATlb I479S and Beta-cong pro:DGATlb C355S N473S I479S genome edits

[0192] The glym, 17g053300 is the soybean DGATlb gene. The DGATlb I479S and DGATlb C355S N473S I479S genome edits were carried out in a two-step process. The first step was to create a DGATlb dropout line. GM-DGAT1B-CR2 (SEQ ID NO: 50) and GM-DGAT1B- CR6 (SEQ ID NO: 51) were used to generate dropout line (SEQ ID NO: 38). The second step was to reintroduce the DGAT gene with desirable amino acid changes under desirable promoter regulation. For this second step, a new gRNA was designed, GM-DGAT1B-CR26 (SEQ ID NO: 52), to cut the newly created junction in the DGATlb dropout line. A donor DNA containing either the F479S (SEQ ID NO: 39) or C355S N473S I479S (SEQ ID NO: 40) amino acid replacement was used in a templated-based double strand DNA repair process by Agrobacterium transformation. The donor DNA also contained a soybean beta-conglycinin alpha’ subunit promoter (SEQ ID NO: 43) that drives the expression of the DGATlb I479S and DGATlb C355S N473S I479S genes.

[0193] For the DGATlb I479S design, five perfect gene editing TO plants (variants) were identified from 1165 TO plants screened, a perfect Beta-CONG PRO: :DGATlb I479S edit from two of five variants were transmitted to T1 plants. An increase in seed oil content was observed in both T1 and T2 seed composition analyses.

[0194] For the DGATlb C355S N473S I479S design, only 1 perfect gene editing TO plant (variant) was identified from 1253 TO plants screened. An increase in seed oil content was observed in Tl, T2, and T3 seed oil analyses. The data from the T2 seed oil analysis is shown in Table 13.Table 13: Seed composition of T2 seed of DGATlb edits

[0195] Raffinose synthase 2 (RS2) knockout

[0196] Glyma.06gl79200 is the raffinose synthase 2 gene. A gRNA GM-RS2-CR3 (SEQ ID NO: 53) was designed in the exonl of the RS2 gene to create frameshift knockout of the gene. As described in Example 1, CRISPR Cas9 system was used in Agrobacterium transformation process. Seed composition was analyzed in homozygous T2 and T3 seeds. The raffinose level in mature seeds in these RS2 knockout lines decreased to less than 0.1% as compared to WT of 0.75% at 13% moisture basis. In addition, the stachyose level decreased to about 1% as compared to WT of 3.5% at 13% moisture basis.

[0197] Insertion of GM-SUT4 into RS2 for creating SUT4 / RS2 trait stack

[0198] To stack the RS2 knockout with an oil gene, such as sucrose transporter 4 (glyma.02g218600, SEQ ID 4), SUT4, a donor DNA (SEQ ID NO: 41) was designed for a template-based gene insertion of the SUT4 coding sequences under control of soybean annexin promoter (glyma.1 lgl53800, SEQ ID NO: 44). By Agrobacterium-\)ase transformation, the GM-Ann PRO::SUT4 will be inserted in to the GM-RS2-CR3 site by double strand DNA repair process. TO plants will be generated, perfect insertion variants will be identified, seed composition will be analyzed in Tl, T2 and Tn generations. The edited stack is expected to show both high oil and low raffinose / stachyose phenotype.

[0199] Insertion of GM-ODP la into MFT for creating ODP1 / MFT trait stack

[0200] A GM-MFT-CR1 (SEQ ID NO: 49) was designed to create frameshift knockout of the MFT gene (glyma.05g244100). To stack the GM-ODP1A (glyma.15g221600 SEQ ID 30 ) with the MFT knockout, a donor DNA (SEQ ID NO: 42), with the sucrose synthase (SUS2) promoter (glyma.13g 114000, SEQ ID NO: 45) driving the expression of the GM-ODP1 A gene was designed. By Agrobacterhim- asQ transformation, the GM-SUS2 PRO::ODP1A will be inserted in to the GM-MFT-CR1 site by double strand DNA repair process. TO plants will be generated, perfect insertion variants will be identified, seed composition will be analyzed in Tl, T2 and Tn generations. The edited stack is expected to increase oil and protein more than single ODP1 overexpression or MFT knockout.EXAMPLE 7

[0201] This example demonstrates stacking SWT gene knockouts with an MFT gene knockout.

[0202] To determine the effect of SWT gene modification and MFT gene modification, multiplex editing experiments of SWT24 / SWT39 / MFT were conducted. In Mega416, three gRNAs (GM-SWT39-CR1, GM-SWT24-CR1 and GM-MFT-CR1) were used to create frame shift knockout for MFT, SWT24 and SWT39 genes.

[0203] The soybean U6 small nuclear RNA promoter, such as the GM-U6-13.1 promoter, the GM-U6-9.1 promoter, or the GM-U6-16.2 promoter was used to express different guide RNAs to direct Cas9 nuclease to designated genomic target sites. The construct was transformed into LBA4404-Thy- agrobacterial strain for soybean transformation as described in the Example 1. Twenty TO plants were generated, PCR amplicon and NGS sequencing were used to characterize the indels at the target sites of all those genes. Based on the analytical results, 10 TO plants with frameshift deletions were kept growing to maturity to get to T1 seeds. T1 seeds were planted from 5 editing events per experiment, the same PCR amplicon and NGS sequencing were performed to screen T1 plants with homozygous frameshift alleles in T1 plants to get homozygous T2 seeds for seed composition analyses. In the Mega416 T1 plant analyses, T1 plants with all the genotype combinations were kept, such as triple homozygous KO, SWT39 / MFT double KO or SWT24 / MFT double KO T1 plants from frame shift events grew normally in the greenhouse. Seed protein and oil content were determined by FT-NIR in T2 seeds from T1 homozygous frame shift mutant plants. MFT / SWT24 and MFT / SWT39 stacks show a significant increase in protein without a further reduction in seed weight compared to single MFT or SWT24 or SWT39 knockout. SWT24 / SWT39 stack shows an increase in seed protein by 12.4 percentage points but also significantly reduces seed oil and seed weight compared to single SWT24 or SWT39 knockout. In the triple stack, MFT increases seed oil by 2.8 percentage points and alleviates seed weight loss compared to SWT24 / SWT39 double stack (Table 14).Table 14: Seed composition and seed weight in Sweet / MFT stack T2 seeds

[0204] Other genes in MFT pathway have been identified as shown in Example 4. A stack of one or more SWT genes with one or more MFT pathway genes is expected to increase seed protein and oil content.

[0205] In soybean, seed protein content can show an inverse relationship with seed oil content. Increasing both protein and oil in soybean is desirable as both are valuable components. SWT24 / MFT, SWT39 / MFT and SWT24 / SWT39 / MFT stacks increase protein and oil by ~4 percentage points, an improvement over SWT39 or SWT24 alone (Table 14)EXAMPLE 8

[0206] This example demonstrates the generation of high oil gene stacks.

[0207] As shown in the previous examples, multiple high oil edited variants, mutants, or transgenic events were identified (Table 15). Stacks of high oil genes can be generated by crossing plants containing different high oil gene modifications. A two-gene stack can be identified in F2 population by genotyping both genes. For example, Beta-cong pro:DGATlb 3AA transgenic event or edited variant can be crossed to MFT high oil mutant to generate DGATlb3AA / MFT stack. DGATlb 3AA / MFT stack is expected to show more oil increase compared to single DGATlb3AA or MFT mutant. Using the high oil genes in Table 15, numerous stacks to further increase seed oil content can be created. Examples of high oil stacks are shown in Table 16.Table 15: List of high oil genesTable 16: Examples of high oil stacks

[0208] To increase seed oil content by stacking, a 5 gene stacking construct (SUS:GmODPla- Leg+BC:GmDGATlb3AA+Ann:SUT4+Kti:MFT / RS2 RNAi) was built and transformed to elite soybean. In this construct, ODP1, DGATlb3AA and SUT4 were overexpressed by strong seed specific promoters while MFT and RS2 were silenced by RNAi. Transgenic events weregenerated and will be analyzed for seed composition. About a 40% increase or more in oil content in seeds of the 5 gene stack is expected.EXAMPLE 9

[0209] This example demonstrates generation of high oil gene stacks with increased seed oil content.

[0210] As shown in the previous examples, multiple high-oil edited variants, mutants, or transgenic events were identified (Table 15). Stacks of high oil genes can be generated by crossing plants containing different high oil gene modifications (Table 16). A two-gene stack can be identified in F2 population by genotyping for both genes.

[0211] Stacks were generated by crossing a RS2 frameshift knock-out edited variant with the MFT high oil mutant to generate RS2 / MFT stack. The F2 population were genotyped to identify double, single and wild type (WT) segregants. F3 seeds from plants grown in both greenhouse and field conditions were analyzed for seed composition. In addition, a set of two- gene and WT plants from the population were grown out for an additional generation in short rows and were analyzed for seed composition.

[0212] Seed protein and oil content in F3 seed from the greenhouse (Table 17) and in the field (Table 18) was determined by FT-NIR and by NIT in the following F4 generation (Table 19). The RS2 / MFT two-gene stack showed increased seed oil content when compared to WT as well as the single RS2 edit or MFT mutant, and when compared to WT or single segregants from the population. Seed protein levels in the stack are comparable to that of RS2 single, MFT single and WT controls. In addition, the RS2 / MFT stack shows a reduction in total carbohydrates when compared to WT and WT segregants from the population.Table 17: Seed composition in RS2 / MFT stack F3 seed from greenhouseTable 18: Seed composition in RS2 / MFT stack F3 seed from fieldTable 19: Seed composition and seed weight in RS2 / MFT stack F4 seed from fieldEXAMPLE 10

[0213] This example demonstrates the generation of high oil gene stacks with increased seed oil content.

[0214] As shown in the previous examples, multiple high oil edited variants, mutants, or transgenic events were identified (Table 15). Stacks of high oil genes can be generated by crossing plants containing different high oil gene modifications (Table 16). A two-gene stack can be identified in F2 population by genotyping for both genes.

[0215] Stacks were generated by crossing a DGATlb3AA transgenic variant with the MFT high oil mutant to generate a DGAT / MFT stack. The F2 population were genotyped to identify double, single and WT segregants. F3 seeds from plants grown in both greenhouse and field conditions were analyzed for seed composition. In addition, a set of two-gene and WT plants from the population were grown out for an additional generation in short rows and were analyzed for seed composition.

[0216] Seed protein and oil content in F3 seed from the greenhouse (Table 20) and the field (Table 21) was determined by FT-NIR and by NIT in the following F4 generation (Table 22).The DGAT / MFT two gene stack showed increased seed oil content when compared to WT as well as single DGAT transgenic event or MFT mutant, and when compared to WT or single segregants from the population. Seed protein levels in the stack are comparable to that of DGAT single, MFT single and WT controls. In addition, the DGAT / MFT stack shows a reduction in total carbohydrates when compared to WT and WT segregants from the population.Table 20: Seed composition in DGAT / MFT stack F3 seed from greenhouseTable 21 : Seed composition in DGAT / MFT stack F3 seed from fieldTable 22: Seed composition in DGAT / MFT stack F4 seed from fieldEXAMPLE 11

[0217] This example demonstrates the modification of high oil genes to increase oil in Camelina Sativa

[0218] High oil gene constructs described in Example 8, either as a single gene or gene stack constructs can be transformed into Camelina Sativa to increase seed oil and protein content. Examples of orthologs of MFT and SWT in Camelina Sativa are shown in Table 1 A. CRISPR editing of Camelina Sativa can be used to knockout MFT or RS2 to increase oil in Camelina Sativa. Overexpression of DGAT, SWT, ODP1, SUT2, or SUT4 is also expected to increase oil in Camelina Sativa. A stack of 2 or more high oil genes listed in Table 15 is expected to further increase oil. Increased seed oil and protein content will increase crop value for fuel and feed applications.EXAMPLE 12

[0219] This example demonstrates the modification of high oil genes to increase oil in Thlapsi arvense (penny cress).

[0220] Orthologs of MFT, DGAT, and SWT in penny cress have been identified as shown in Table 1 A. Pennycress is transformed using an Agrobacterium-me,<X\&t.QA floral dip method, similar to the Arabidopsis floral dip transformation method. Alternatively, CRISPR editing of pennycress is carried out (McGinn et al 2019 Molecular tools enabling pennycress (Thlaspi arvense) as a model plant and oilseed cash cover crop. Plant Biotechnol. J.DOI: 10.1111 / pbi.13014). Either a soybean DGAT gene or a pennycress DGAT gene is overexpressed using a strong seed specific promoter to increase seed oil content in pennycress. Additionally, a CRISPR knockout of the MFT or RS2 gene in pennycress is carried out to increase seed oil and protein content. A stack of DGAT, MFT and SWT is created by genetic crossing or by multiplex CRISPR editing. Increased seed oil and protein content is expected and will improve crop value for pennycress as a winter cover crop.EXAMPLE 13

[0221] This example demonstrates the modification of high oil genes to increase oil in Brassica napus (canola).

[0222] The orthologs of high oil genes were identified in canola by sequence Blast to gene sequences disclosed herein. CRISPR-Cas gene editing system was used to edit high oil genes in an elite Brassica napus inbred line. Epicotyl explants of the elite canola inbred were transformed with Agrobacterium tumefasciens carrying a CR1SPR-Cas9 Ti plasmid for plant transformation as described in Chu et al. (2020, Frontiers in Plant Science, Vol. 11, Article 579524). Regenerated plantlets were screened using a NGS sequencing assay to obtain the knockout variants identified herein. Plants identified as positive TO knockout plants were selfpollinated to produce Tl seed. Tl seed was planted in growth chamber and seedlings were genotyped with the same NGS sequencing assay to identify double homozygous plants as well as wildtype (WT) segregants. Seed composition can be determined by NIR spectroscopy. Modification of single high oil gene, or stack of high oil genes, such as MFT, DGAT or SWT, is expected to increase seed oil and protein content, which will further increase canola crop value.

[0223] All publications and patent applications in this specification are indicative of the level of ordinary skill in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated by reference.

[0224] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless mentioned otherwise, the techniques employed or contemplated herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not limiting.

[0225] Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of theappended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0226] Units, prefixes and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5’ to 3’ orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

Claims

We claim:

1. A plant cell comprising two or more modifications selected from the group consisting of: (i) a modification increasing expression and / or activity of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression and / or activity of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression and / or activity of an ABI3 polypeptide, (vi) a modification increasing expression and / or activity of an 0DP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof and comprising an increase in total oil content, as compared to a control plant cell comprising one of the two or more modifications.

2. The plant cell of claim 1, wherein the plant cell comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression and / or activity of a SUT polypeptide.

3. The plant cell of claim 1, wherein the plant cell comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

4. The plant cell of claim 1, wherein the plant cell comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression and / or activity of an 0DP1 polypeptide.

5. The plant cell of claim 1, wherein the plant cell comprises a modification increasing expression and / or activity of a SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

6. The plant cell of claim 1, wherein the plant cell comprises a modification increasing expression and / or activity of an 0DP1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

7. The plant cell of claim 1, wherein the plant cell comprises a modification introducing a high oil DGAT variant and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

8. The plant cell of claim 1, wherein the plant cell comprises a modification introducing a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide.

9. The plant cell of claim 1, wherein the plant cell comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression and / or activity of a SUT polypeptide, and a modification introducing a high oil DGAT variant.

10. The plant cell of claim 1, wherein the plant cell comprises a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, and a modification increasing expression and / or activity of an ODP1 polypeptide.

11. The plant cell of claim 1, wherein the plant cell comprises a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression and / or activity of an ODP1 polypeptide, and a modification increasing expression and / or activity of a SUT polypeptide.

12. The plant cell of any one of claims 1-4 and 8-11, wherein the endogenous RS polypeptide is selected from the group consisting of RS2, RS4, or a combination thereof.

13. The plant cell of claim 12, wherein the endogenous RS polypeptide is RS2.

14. The plant cell of any one of claims 1 and 5, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof.

15. The plant cell of any one of claims 1 and 5, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or any combination thereof.

16. The plant cell of any one of claims 1, 9, and 1 1, wherein the SUT polypeptide is selected from the group consisting of SUT2, SUT4, or a combination thereof.

17. The plant cell of claim 16, wherein the SUT polypeptide is SUT4.

18. The plant cell of any one of claims 1, 5 and 14-15, wherein modification increasing expression and / or activity of a SWT polypeptide comprises expressing in the plant cell a polynucleotide encoding a SWT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 60-65, 136-141, 212-217 and 287-292 operably linked to a heterologous regulatory element.

19. The plant cell of claim 18, wherein the heterologous regulatory element is a promoter.

20. The plant cell of any one of claims 1-2, 9, and 11, wherein modification increasing expression and / or activity of a SUT polypeptide comprises expressing in the plant cell a polynucleotide encoding a SUT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59, 66, 135, 142, 211, 218, 286 or 293 operably linked to a heterologous regulatory element.

21. The plant cell of claim 20, wherein the heterologous regulatory element is a promoter.

22. The plant cell of any one of claims 1-2, 5-8, and 10-11, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is at least 80% identical to any one of SEQ ID NO: 58, 134, 210 and 285 and comprises a modification at a position other than the amino acid corresponding to LI 06 in SEQ ID NO: 58.

23. The plant cell of claim 22, wherein the modified MFT polypeptide comprises a non-leucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 58 or a nonthreonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 58, or a combination thereof.

24. The plant cell of any one of claims 1-2, 5-8, and 10-11, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFTpolypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58, 134, 210 or 285.

25. The plant cell of any one of claims 1, 4, 6, 10, and 11, wherein modification increasing expression and / or activity of a ODP1 polypeptide comprises expressing in the plant cell a polynucleotide encoding a ODP1 polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 74, 85, 150, 161, 226, 237, 301 or 312 operably linked to a heterologous regulatory element.

26. The plant cell of claim 25, wherein the heterologous regulatory element is a promoter.

27. The plant cell of any one of claims 1, 3, and 7-11 , wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises at least one amino acid substitution as compared to SEQ ID NO: 54.

28. The plant cell of claim 27, wherein the at least one amino acid substitution is selected from the group consisting of a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54, a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a non-asparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, or any combination thereof.

29. The plant cell of claim 27 or 28, wherein the wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54.

30. The plant cell of claim 27 or 28, wherein the wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a non-asparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, and a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54.

31. The plant cell of any one of claims 1, 3, 7-11, and 27-30, wherein the modification introducing the high oil DGAT variant comprises expressing in the plant cell a polynucleotide encoding a high oil DGAT variant comprising an amino acid sequence that isat least 90% identical to SEQ ID NO: 55 or 56 operably linked to a heterologous regulatory element.

32. The plant cell of claim 31, wherein the heterologous regulatory element is a promoter.

33. The plant cell of claim 32, wherein the promoter comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 43-45.

34. The plant cell of any one of claims 1-4 and 8-13 wherein the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockout of an endogenous RS gene, the RS gene encoding a RS protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57, 93, 133, 169, 209, 245 or 284.

35. The plant cell of any one of claims 1-4 and 8-13 wherein the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockdown of an endogenous RS gene, the RS gene encoding a RS protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57, 93, 133, 169, 209, 245 or 284.

36. The plant cell of any one of claims 1-35, wherein the plant cell is a soybean cell, a Brassica species cell, or a penny cress cell.

37. A plant comprising the plant cell of any one of claims 1-36.

38. The plant of claim 37, wherein the plant seed comprises at least a 2 percentage point increase in total oil content as compared to a control seed.

39. The plant of claim 37 or 38, wherein the plant is soybean, a Brassica species, or pennycress.

40. A seed comprising the plant cell of any one of claims 1-36, wherein the seed has increased oil content as compared to a seed comprising one of the two or more modifications.

41. The seed of claim 40, wherein the seed is a soybean, a Brassica species seed, or a pennycress seed.

42. A plant, the plant comprising two or more modifications selected from the group consisting of: (i) a modification increasing expression and / or activity of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression and / or activity of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasingexpression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression and / or activity of an ABI3 polypeptide, (vi) a modification increasing expression and / or activity of an 0DP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof and comprising a seed having increased oil content as compared to seeds of a control plant comprising one of the two or more modifications.

43. The plant of claim 42, wherein the plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

44. The plant of claim 42, wherein the plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification introducing a high oil DGAT variant.

45. The plant of claim 42, wherein the plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression and / or activity of an 0DP1 polypeptide.

46. The plant of claim 42, wherein the plant comprises a modification increasing expression and / or activity of a SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

47. The plant of claim 42, wherein the plant comprises a modification increasing expression and / or activity of an 0DP1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

48. The plant of claim 42, wherein the plant comprises a modification introducing a high oil DGAT variant and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

49. The plant of claim 42, wherein the plant comprises a modification introducing a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of anendogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide.

50. The plant of claim 42, wherein the plant comprises a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression and / or activity of a SUT polypeptide, and a modification introducing a high oil DGAT variant.

51. The plant of claim 42, wherein the plant comprises a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, and a modification increasing expression and / or activity of an ODP1 polypeptide.

52. The plant of claim 42, wherein the plant comprises a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression and / or activity of an ODP1 polypeptide, and a modification increasing expression and / or activity of a SUT polypeptide.

53. The plant of any one of claims 42-45 and 49-52, wherein the endogenous RS polypeptide is selected from the group consisting of RS2, RS4, or a combination thereof.

54. The plant of claim 53, wherein the endogenous RS polypeptide is RS2.

55. The plant of any one of claims 42 and 46, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof.

56. The plant of any one of claims 42 and 46, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or any combination thereof.

57. The plant of any one of claims 42, 50, and 52, wherein the SUT polypeptide is selected from the group consisting of SUT2, SUT4, or a combination thereof.

58. The plant of claim 57, wherein the SUT polypeptide is SUT4.

59. The plant of any one of claims 42, 46, 55, and 56, wherein modification increasing expression and / or activity of a SWT polypeptide comprises expressing in the plant a polynucleotide encoding a SWT polypeptide comprising an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 60-65, 136-141, 212-217 and 287-292 operably linked to a heterologous regulatory element.

60. The plant of claim 59, wherein the heterologous regulatory element is a promoter.

61. The plant of any one of claims 42, 50, 52, 57, and 58, wherein modification increasing expression and / or activity of a SUT polypeptide comprises expressing in the plant a polynucleotide encoding a SUT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59, 66, 135, 142, 211, 218, 286 or 293 operably linked to a heterologous regulatory element.

62. The plant of claim 61, wherein the heterologous regulatory element is a promoter.

63. The plant of any one of claims 42-43, 46-49, and 51-52, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is at least 80% identical to any one of SEQ ID NO: 58, 134, 210 and 285 and comprises a modification at a position other than the amino acid corresponding to LI 06 in SEQ ID NO: 58.

64. The plant of claim 63, wherein the modified MFT polypeptide comprises a non-leucine at the amino acid residue corresponding to position LI 40 of SEQ ID NO: 58 or a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 58, or a combination thereof.

65. The plant of any one of claims 42-43, 46-49, and 51-52, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58, 134, 210 or 285.

66. The plant of any one of claims 42, 45, 47, and 1 -52, wherein modification increasing expression and / or activity of a 0DP1 polypeptide comprises expressing in the plant a polynucleotide encoding a 0DP1 polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 74, 85, 150, 161, 226, 237, 301 or 312 operably linked to a heterologous regulatory element.

67. The plant of claim 66, wherein the heterologous regulatory element is a promoter.

68. The plant of any one of claims 42, 44, and 48-52, wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises at least one amino acid substitution as compared to SEQ ID NO: 54.

69. The plant of claim 68, wherein the amino acid substitution comprises a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54, a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a non-asparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, or any combination thereof.

70. The plant of claim 68 and 69, wherein the wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54.

71. The plant of claim 68 and 69, wherein the wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a non-asparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, and a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54.

72. The plant of any one of claims 42, 44, 48-52 and 68-71, wherein the modification introducing the high oil DGAT variant comprises expressing in the plant a polynucleotide encoding a high oil DGAT variant comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 55 or 56 operably linked to a heterologous regulatory element.

73. The plant of claim 72, wherein the heterologous regulatory element is a promoter.

74. The plant of claim 73, wherein the promoter comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 43-45.

75. The plant of any one of claims 42-45 and 49-54, wherein the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockout of an endogenous RS gene, the RS gene encoding a RS protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57, 93, 133, 169, 209, 245 or 284.

76. The plant of any one of claims 42-45 and 49-54, wherein the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockdown of an endogenous RS gene, the RS gene encoding a RS protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57, 93, 133, 169, 209, 245 or 284.

77. The plant of any one of claims 42-76, wherein the seeds of the plant comprise at least a 2 percentage point increase in total oil content as compared to the control seed.

78. The plant of any one of claims 42-77, wherein the plant is soybean, a Brassica species, or pennycress.

79. A method of plant breeding the method comprising crossing the plant of any one of claims 42-78 with a second plant to produce progeny seed.

80. A method of producing a plant producing seeds having an increased oil content as compared to a control seed, the method comprising: a. introducing into a regenerable plant cell two or more modifications selected from the group consisting of: (i) a modification increasing expression and / or activity of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression and / or activity of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression and / or activity of an ABB polypeptide, (vi) a modification increasing expression and / or activity of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression,activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof; and b. generating the plant, wherein the plant comprises the two or more modifications and produces a seed having an increased oil content as compared to a control plant comprising one of the two or more modifications.

81. The method of claim 80, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

82. The method of claim 80, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification introducing a high oil DGAT variant.

83. The method of claim 80, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide and a modification increasing expression and / or activity of an ODP1 polypeptide.

84. The method of claim 80, wherein the two or more modifications comprise a modification increasing expression and / or activity of a SWT polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

85. The method of claim 80, wherein the two or more modifications comprise a modification increasing expression and / or activity of an ODP1 polypeptide and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

86. The method of claim 80, wherein the two or more modifications comprise a modification introducing a high oil DGAT variant and a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide.

87. The method of claim 80, wherein the two or more modifications comprise a modification introducing a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, and a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide.

88. The method of claim 80, wherein the two or more modifications comprise a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression and / or activity of a SUT polypeptide, and a modification introducing a high oil DGAT variant.

89. The method of claim 80, wherein the two or more modifications comprise a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, and a modification increasing expression and / or activity of an ODP1 polypeptide.

90. The method of claim 80, wherein the two or more modifications comprise a high oil DGAT variant, a modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide, a modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide, a modification increasing expression and / or activity of an ODP1 polypeptide, and a modification increasing expression and / or activity of a SUT polypeptide.

91. The method of any one of claims 80-83 and 87-90, wherein the endogenous RS polypeptide is selected from the group consisting of RS2, RS4, or a combination thereof.

92. The method of claim 91, wherein the endogenous RS polypeptide is RS2.

93. The method of any one of claims 80 and 84, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT4, SWT5, SWT16, SWT17, SWT24, SWT39, or any combination thereof.

94. The method of any one of claims 80 and 84, wherein the endogenous SWT polypeptide is selected from the group consisting of SWT24, SWT39, or any combination thereof.

95. The method of any one of claims 80, 88, and 90, wherein the SUT polypeptide is selected from the group consisting of SUT2, SUT4, or a combination thereof.

96. The method of claim 95, wherein the SUT polypeptide is SUT4.

97. The method of any one of claims 80, 84, and 93-94, wherein modification increasing expression and / or activity of a SWT polypeptide comprises expressing in the plant cell a polynucleotide encoding a SWT polypeptide comprising an amino acid sequence that is atleast 90% identical to any one of SEQ ID NOs: 60-65, 136-141, 212-217 and 287-292 operably linked to a heterologous regulatory element.

98. The method of claim 97, wherein the heterologous regulatory element is a promoter.

99. The method of any one of claims 80, 88, 90, and 95-96, wherein modification increasing expression and / or activity of a SUT polypeptide comprises expressing in the plant cell a polynucleotide encoding a SUT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 59, 66, 135, 142, 211, 218, 286 or 293 operably linked to a heterologous regulatory element.

100. The method of claim 99, wherein the heterologous regulatory element is a promoter.

101. The method of any one of claims 80-81, 84-87, and 89-90, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a modification introducing a polymorphism in an endogenous MFT gene to encode a modified MFT polypeptide, the modified MFT polypeptide comprising an amino acid sequence that is at least 80% identical to any one of SEQ ID NO: 58, 134, 210 and 285 and comprises a modification at a position other than the amino acid corresponding to LI 06 in SEQ ID NO: 58.

102. The method of any one of claims 80-81, 84-87, and 89-90, wherein the modified MFT polypeptide comprises a non-leucine at the amino acid residue corresponding to position L140 of SEQ ID NO: 58 or a non-threonine at the amino acid residue corresponding to position T82 of SEQ ID NO: 58, or a combination thereof.

103. The method of any one of claims 80-81, 84-87, and 89-90, wherein the modification decreasing expression, activity, and / or stability of an endogenous MFT polypeptide comprises a knockout of an endogenous MFT gene, the endogenous MFT gene encoding a MFT polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 58, 134, 210 or 285.

104. The method of any one of claims 80, 83, 85, and 89-90, wherein modification increasing expression and / or activity of a ODP1 polypeptide comprises expressing in the plant cell a polynucleotide encoding a ODP1 polypeptide comprising an amino acid sequence that is atleast 90% identical to SEQ ID NO: 74, 85, 150, 161, 226, 237, 301 or 312 operably linked to a heterologous regulatory element.

105. The method of claim 104, wherein the heterologous regulatory element is a promoter.

106. The method of any one of claims 80, 81, and 87-90, wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises at least one amino acid substitution as compared to SEQ ID NO: 54.

107. The method of claim 106, wherein the at least one amino acid substitution is selected from the group consisting of a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54, a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a non-asparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, or any combination thereof.

108. The method of claim 107, wherein the wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54.

109. The method of claim 107, wherein the wherein the high oil DGAT variant comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 54, 132, 208, or 283 and comprises a non-cysteine at the amino acid residue corresponding to position 355 of SEQ ID NO: 54, a non-asparagine at the amino acid residue corresponding to position 473 of SEQ ID NO: 54, and a non-isoleucine at the amino acid residue corresponding to position 1479 of SEQ ID NO: 54.

110. The method of any one of claims 80, 81, 87-90, and 106-109, wherein the modification introducing the high oil DGAT variant comprises expressing in the plant cell a polynucleotide encoding a high oil DGAT variant comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 55 or 56 operably linked to a heterologous regulatory element.

111. The method of claim 110, wherein the heterologous regulatory element is a promoter.

112. The method of claim 111, wherein the promoter comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 43-45.

113. The method of any one of claims 80-83 and 87-92, wherein the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockout of an endogenous RS gene, the RS gene encoding a RS protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57, 93, 133, 169, 209, 245 or 284.

114. The method of any one of claims 80-83 and 87-92, wherein the modification decreasing expression, activity, and / or stability of an endogenous RS polypeptide comprises a knockdown of an endogenous RS gene, the RS gene encoding a RS protein comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 57, 93, 133, 169, 209, 245 or 284.

115. The method of any one of claims 80-114, wherein seed comprises at least 2 percentage point increase in total oil content as compared to the control seed.

116. The method of any one of claims 80-115, wherein one or more of the at least two modifications is introduced using an enzyme selected from the group consisting of a polynucleotide-guided endonuclease, CRISPR-Cas endonucleases, base editing deaminases, a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), and engineered site-specific meganucleases.

117. The method of any one of claims 80-116, wherein one or more of the at least two modifications is introduced using a DNA construct.

118. The method of any one of claims 80-117, wherein the plant is soybean, a Brassica species, or pennycress.

119. A method for producing plants having seeds with increased oil content as compared to a control seed, the method comprising: a. crossing a first plant with a second plant, the first and second plant each comprising at least one modification selected from the group consisting of: (i) a modification increasing expression and / or activity of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression and / or activity of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of anMFT network gene, (v) a modification increasing expression and / or activity of an ABI3 polypeptide, (vi) a modification increasing expression and / or activity of an 0DP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof; b. harvesting the seed produced thereby; and c. generating a progeny plant, wherein the progeny plant comprises the at least one modification of the first plant and the at least one modification present in the second plant.

120. The method of claim 119, wherein a seed of the progeny plant comprises at least 2 percentage point increase in total oil content as compared to the control seed.

121. The method of claim 119 or 120, wherein the plant is soybean, a Brassica species, or pennycress.

122. A method of producing a plurality of elite high-oil plant lines in a plant production program, the method comprising a. multiplex genome editing a plurality of elite plant lines to introduce at least two modifications selected from the group consisting of (i) a modification increasing expression and / or activity of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression and / or activity of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression and / or activity of an AB 13 polypeptide, (vi) a modification increasing expression and / or activity of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof into the plurality of plant lines to produce a plurality of directly-edited elite plant lines,b. increasing seed of the plurality of directly-edited plant lines of step (a) by growing the directly-edited plant lines of step (a) and harvesting the seed therefrom over one or more generations to produce a plurality of elite high-oil plant lines.

123. The method of claim 122, wherein the seed of the plurality of directly-edited plant lines is increased to produce a commercially relevant quantity.

124. The method of claim 123, wherein commercially relevant quantity comprises at least 50 units of the plurality of directly-edited plant lines.

125. The method of any one of claims 122-124, wherein the plant is soybean, a Brassica species, or pennycress.

126. A method of producing an elite high-oil plant line in a plant production program, the method comprising directly editing an elite plant line to introduce at least two modifications selected from the group selected from the group consisting of: (i) a modification increasing expression and / or activity of a Sugars Will Eventually be Exported Transporter (SWT) polypeptide, (ii) a modification increasing expression and / or activity of a sucrose transporter (SUT) polypeptide, (iii) a modification decreasing expression, activity, and / or stability of an endogenous Mother of Flowering Time (MFT) polypeptide, (iv) a modification increasing expression and / or activity of an MFT network gene, (v) a modification increasing expression and / or activity of an ABB polypeptide, (vi) a modification increasing expression and / or activity of an ODP1 polypeptide, (vii) a modification introducing a high oil DGAT variant, (viii) a modification decreasing expression, activity, and / or stability of an endogenous raffinose synthase (RS) polypeptide, or any combination thereof to produce an elite high-oil plant line and increasing seed of the elite high-oil plant line over multiple generations to produce commercially relevant quantities of high-oil plant seed.

127. The method of claim 126, wherein commercially relevant quantity comprises at least 50 units of the high-oil plant seed.

128. The method of any one of claims 126-127, wherein the plant is soybean, a Brassica species, or pennycress.

Images