Combination immunotherapy and antiviral treatment

Abstract

The present invention relates generally to the combination of immunotherapy and antiviral treatment for the treatment or prevention of HIV. In particular, the methods include in vivo and / or ex vivo enrichment of HIV-specific CD4+ T cells.

Description

COMBINATION IMMUNOTHERAPY AND ANTIVIRAL TREATMENTCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 536,364, filed September 1, 2023. The disclosure of the prior application is incorporated herein by reference in its entirety.FIELD OF THE INVENTION

[0002] The present invention relates generally to the field of immunization and immunotherapy for the treatment and prevention of HIV. In particular, the disclosed methods relate to obtaining and processing leukocytes from HIV+ individuals seeking a functional cure to prepare a cell product suitable for infusion to such HIV+ individuals.BACKGROUND OF THE INVENTION

[0003] Combination antiretroviral therapy (also known as Highly Active Antiretroviral Therapy or HAART) limits HIV-1 replication and slows disease progression, but drug toxi cities and the emergence of drug-resistant viruses are challenges for long-term control in HIV-infected persons. Additionally, traditional antiretroviral therapy, while successful at delaying the onset of AIDS or death, has yet to provide a functional cure. Alternative treatment strategies are needed.

[0004] Intense interest in immunotherapy for HIV infection has been precipitated by emerging data indicating that the immune system has a major, albeit usually insufficient, role in limiting HIV replication. Virus-specific T-helper cells, which are critical to maintenance of cytolytic T cell (CTL) function, likely play a role. Viremia is also influenced by neutralizing antibodies, but they are generally low in magnitude in HIV infection and do not keep up with evolving viral variants in vivo.

[0005] Together these data indicate that increasing the strength and breadth of HIV - specific cellular immune responses may have a clinical benefit through so-called HIV immunotherapy. Some studies have tested vaccines against HIV, but success has been limited to date. Additionally, there has been interest in augmenting HIV immunotherapy by utilizing gene therapy techniques, but as with other immunotherapy approaches, success has been limited.

[0006] Viral vectors can be used to transduce genes into target cells owing to specific virus-host cell interactions and mechanisms for expressing therapeutic gene constructs. As a result, viral vectors have been used as vehicles for the transfer of genes into many different celltypes including whole T cells or other immune cells as well as embryos, fertilized eggs, isolated tissue samples, tissue targets in situ and cultured cells. The ability to introduce and express foreign or altered genes in a cell is useful for therapeutic interventions such as gene therapy, somatic cell reprogramming of induced pluripotent stem cells, and various types of immunotherapy .

[0007] Gene therapy is one of the ripest areas of biomedical research with the potential to create new therapeutics that may involve the use of viral vectors. In view of the wide variety of potential genes available for therapy, an efficient means of delivering these genes is needed to fulfill the promise of gene therapy as a means of treating infectious and non-infectious diseases. Several viral systems including murine retrovirus, adenovirus, parvovirus (adeno- associated virus), coxsackie virus, vaccinia virus, and herpes virus have been proposed as therapeutic gene transfer vectors.

[0008] There are many factors that must be considered when developing viral vectors including tissue tropism, stability of virus preparations, stability and control of expression, genome packaging capacity, construct-dependent vector stability, and whether or not the desired outcome is to have stable gene integration into the host genome. In addition, in vivo application of viral vectors is often limited by host immune responses against viral structural proteins and / or transduced gene products.

[0009] Thus, toxicity and safety are key hurdles that must be overcome for viral vectors to be used in vivo for the treatment of subjects. There are numerous historical examples of gene therapy applications in humans that have met with problems associated with the host immune responses against the gene delivery vehicles or the therapeutic gene products. Viral vectors (e.g, adenovirus) which co-transduce several viral genes together with one or more therapeutic gene(s) are particularly problematic.

[0010] Although lentiviral vectors do not generally induce cytotoxicity and do not elicit strong host immune responses, some lentiviral vectors such as HIV-1, which encode several immunostimulatory gene products, have the potential to cause cytotoxicity and induce strong immune responses in vivo. However, this may not be a concern for lentivirus-derived transducing vectors that do not encode viral genes after transduction. Of course, this may not always be the case, as sometimes the purpose of the vector is to encode a protein that will provoke a clinically useful immune response.

[0011] Another important issue related to the use of lenti viral vectors is that of possible cytopathogenicity upon exposure to some cytotoxic viral proteins. Exposure to certain HIV-1 proteins may induce cell death or functional unresponsiveness in T cells. Likewise, the possibility of generating replication-competent, virulent virus by recombination is often a concern. Accordingly, there remains a need for improved treatments of HIV.SUMMARY OF THE INVENTION

[0012] In one aspect, a method of reducing viral load induced by antiviral treatment interruption in a subject is provided. The method includes measuring the viral load in a subject wherein the subject was previously administered a viral vector comprising at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to the subject. In embodiments the subject was previously administered a course of antiviral treatment. In embodiments, course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof. In embodiments, the subject ceased the course of antiviral treatment for at least about 1 month prior to measuring viral load. In embodiments, the antiviral treatment administered to the subject following measuring viral load is the same as the previous course of antiviral treatment. In embodiments, the viral load is at least about 5,000 viral load copies / ml. In embodiments, In embodiments, the subject was administered the viral vector at least 3 months prior to antiviral treatment interruption. In embodiments, the method further includes ceasing administering the antiviral treatment to the subject, measuring viral load in the subject and administering a course of antiviral treatment. In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5). In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of targeting HIV Vif. In embodiments, the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5. In embodiments, the at least one genetic element includes: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity' with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%. or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) 95% percent identity' with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or atleast 90%, or at least 95% percent identity with SEQ ID NOs: 1, 2 and 3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 6, 7 and 97. In embodiments, the at least one genetic element includes a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO:3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97.

[0013] In embodiments, the viral vector is produced by the method of viral vector is produced by the method comprising contacting isolated PBMC ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral deliver}7system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; and culturing the transduced PBMC for at least 1 day. In embodiments, the isolated PBMC is autologous. In embodiments, the isolated PBMC is heterologous.

[0014] In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. In embodiments, the method further includes negatively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are negatively selected using at least one physical method of selection. In embodiments, the subject is a human. In embodiments the subject, is immunized with a stimulatory7agent prior to isolation of PBMC. In embodiments, the stimulatory7agent includes any agent suitable for stimulating a T cell response in a subject. In embodiments, the stimulatory agent is a peptide or mixture of peptides, and in embodiments includes a gag peptide. In further embodiments, the stimulatory7agent is a vaccine. In embodiments, the vaccine is a HIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the subject is administered a stimulatory7agent prior to isolation of the PBMC.

[0015] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1). In embodiments, the at least one genetic element comprises SEQ ID NO: 1.

[0016] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity withGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTC GTCG (SEQ ID NO: 3). In embodiments, the at least one genetic element includes SEQ ID NO: 2; or SEQ ID NO: 3.

[0017] In another aspect, the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAGCCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31). In embodiments, the microRNA cluster includes SEQ ID NO: 31.

[0018] In one aspect, a method of reducing side effects of antiviral treatment in a subj ect. The method includes administering a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to the subject. In embodiments, the viral vector is produced by contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a stimulatory agent: transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; culturing the transduced PBMC for at least 1 day. In embodiments, the side effects of antiviral therapy includes depression, skin rash, discouragement, feeling sad or empty , irritability, kick of appetite, loss of interest or pleasure, thoughts of killing oneself, tiredness.trouble concentrating, trouble sleeping, diarrhea, nausea, headache, fatigue, stomach discomfort and combinations thereof. In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5). In embodiments, wherein the genetic element further includes a nucleotide sequence encoding a small RNA capable of targeting HIV Vif. In embodiments, the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5. In embodiments, the at least one genetic element includes: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%. or at least 95% percent identity with SEQ ID NOs: 1, 2 and 3; or e) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%, or at least 95% percent identity7with SEQ ID NOs: 6, 7 and 97. In embodiments, the at least one genetic element includes a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO:3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97. In embodiments, the course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof.

[0019] In embodiments, the isolated PBMC is autologous. In embodiments, the isolated PBMC is heterologous.

[0020] In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. In embodiments, the method further includes negatively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are negatively selected using at least one physical method of selection. In embodiments, the subject is a human. In embodiments the subject, is immunized with a stimulatory agent prior to isolation of PBMC. In embodiments, the stimulatory agent includes any agent suitable for stimulating a T cell response in a subject. In embodiments, the stimulatory agent is a peptide or mixture of peptides, and in embodiments includes a gag peptide. In further embodiments, the stimulatory agent is a vaccine. In embodiments, the vaccine is aHIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variantthereof.

[0021] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1). In embodiments, the at least one genetic element comprises SEQ ID NO: 1.

[0022] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity withGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTC GTCG (SEQ ID NO: 3). In embodiments, the at least one genetic element includes SEQ ID NO: 2; or SEQ ID NO: 3.

[0023] In another aspect, the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31). In embodiments, the microRNA cluster includes SEQ ID NO: 31.

[0024] In one aspect, a method of reducing dosage of antiviral treatment in a subject. The method includes administering a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to thesubject. In embodiments, the viral vector is produced by contacting isolated PBMC ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral deliver}’ system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; culturing the transduced PBMC for at least 1 day; infusing the transduced PBMC in the subject; and administering a course of antiviral therapy to the subject. In embodiments, the dose of antiviral therapy is 10 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 125 mg. 150 mg, 175 mg, 200 mg. 225 mg, 250 mg and combinations thereof. In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5). In embodiments, wherein the genetic element further includes a nucleotide sequence encoding a small RNA capable of targeting HIV Vif. In embodiments, the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat. targeting HIV Vif and inhibiting production of CCR5. In embodiments, the at least one genetic element includes: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity’ with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%. or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 1, 2 and 3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 6, 7 and 97. In embodiments, the at least one genetic element includes a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO:3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97. In embodiments, the course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof.

[0025] In embodiments, the isolated PBMC is autologous. In embodiments, the isolated PBMC is heterologous.

[0026] In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. In embodiments, the method further includes negatively selecting HIV-specific CD4+ T cells from the PBMC. In furtherembodiments, the HIV-specific CD4+ T cells are negatively selected using at least one physical method of selection. In embodiments, the subject is a human. In embodiments the subject, is immunized with a stimulatory agent prior to isolation of PBMC. In embodiments, the stimulatoryagent includes any agent suitable for stimulating a T cell response in a subject. In embodiments, the stimulatory agent is a peptide or mixture of peptides, and in embodiments includes a gag peptide. In further embodiments, the stimulatory- agent is a vaccine. In embodiments, the vaccine is a HIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof.

[0027] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1). In embodiments, the at least one genetic element comprises SEQ ID NO: 1.

[0028] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity withGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTC GTCG (SEQ ID NO: 3). In embodiments, the at least one genetic element includes SEQ ID NO: 2; or SEQ ID NO: 3In another aspect, the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31). In embodiments, the microRNA cluster includes SEQ ID NO: 31.

[0029] In one aspect, a method of reducing the frequency of antiviral treatment in a subject. The method includes administering a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to the subject. In embodiments, the viral vector is produced by contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a stimulatory7agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; culturing the transduced PBMC for at least 1 day; infusing the transduced PBMC in the subject; and administering a course of antiviral therapy to the subject. In embodiments, the frequency of antiviral therapy is once a day, twice a day, once a week, twice a week, once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every78 months, once every 9 months, once every710 months, once every711 months or once every 12 months. In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5). In embodiments, wherein the genetic element further includes a nucleotide sequence encoding a small RNA capable of targeting HIV Vif. In embodiments, the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5. In embodiments, the at least one genetic element includes: a) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 1, 2 and 3; or e) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%, or at least 95% percent identity7with SEQ ID NOs: 6, 7 and 97. In embodiments, the at least one genetic element includes a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO:3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97. In embodiments, the course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide. bictegravir, dolutegravir and combinationsthereof.

[0030] In embodiments, the isolated PBMC is autologous. In embodiments, the isolated PBMC is heterologous.

[0031] In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. In embodiments, the method further includes negatively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are negatively selected using at least one physical method of selection. In embodiments, the subject is a human. In embodiments the subject, is immunized with a stimulatory agent prior to isolation of PBMC. In embodiments, the stimulatory agent includes any agent suitable for stimulating a T cell response in a subject. In embodiments, the stimulatory agent is a peptide or mixture of peptides, and in embodiments includes a gag peptide. In further embodiments, the stimulatory agent is a vaccine. In embodiments, the vaccine is a HIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof.

[0032] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1). In embodiments, the at least one genetic element comprises SEQ ID NO: 1.

[0033] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity withGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTC GTCG (SEQ ID NO: 3). In embodiments, the at least one genetic element includes SEQ IDNO: 2; or SEQ ID NO: 3.

[0034] In another aspect, the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31). In embodiments, the microRNA cluster includes SEQ ID NO: 31.

[0035] The foregoing general description and following brief description of the drawings and detailed description are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following brief description of the drawings and detailed description of the invention.BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 depicts a flow diagram of an ex vivo treatment method of the present disclosure.

[0037] Figure 2 depicts CD4+ T cell alteration and prevention of new infection in accordance with the present disclosure.

[0038] Figure 3 depicts an exemplary lentiviral vector system comprised of atherapeutic vector, a helper plasmid, and an envelope plasmid. The therapeutic vector shown here is a preferred therapeutic vector, which is also referred to herein as AGT103, and contains miR30CCR5-miR21 Vif-miRl 85-Tat.

[0039] Figure 4 depicts an exemplary 3-vector lentiviral vector system in a circularized form.

[0040] Figure 5 depicts an exemplary 4-vector lentiviral vector system in a circularized form.

[0041] Figure 6 depicts a further exemplary 3-vector lentiviral vector system in acircularized form.

[0042] Figure 7 depicts exemplary vector sequences. Positive (i.e., genomic) strand sequences of the promoter and miR cluster were developed for inhibiting the spread of CCR5- tropic HIV strains. Sequences that are not underlined comprise the EF-lalpha promoter of transcription that was selected as being a preferable promoter for this miR cluster. Sequences that are underlined show the miR cluster consisting of miR30 CCR5, miR21 Vif, and miR185 Tat (as shown collectively in SEQ ID NO: 33).

[0043] Figure 8 depicts exemplary lentiviral vector constructs according to various aspects of this disclosure.

[0044] Figures 9A-B show knockdown of CCR5 by an experimental vector and corresponding prevention of R5-tropic HIV infection in AGTcl20 cells. Figure 9A shows CCR5 expression in AGTcl20 cells with or without AGT103 lentivirus vector. Figure 9B shows the sensitivity of transduced AGTcl20 cells to infection with a HIV BaL vims stock that was expressing green fluorescent protein (GFP) fused to the Nef gene of HIV.

[0045] Figures 10A-B depict data demonstrating regulation of CCR5 expression by shRNA inhibitor sequences in a lentiviral vector of the present disclosure. Figure 10A Screening data for potential candidates is shown. Figure 10B CCR5 knock-down data following transduction with CCR5 shRNA-1 (SEQ ID NO: 16) is shown.

[0046] Figures 11A-B depict data demonstrating regulation of HIV components by shRNA inhibitor sequences in a lentiviral vector of the present disclosure. Figure 11A Knockdown data for the rev / tat target gene is shown. Figure 11B Knock-down data for the gag target gene is show n.

[0047] Figure 12 depicts data demonstrating that AGT103 reduces expression of Tat protein expression in cells transfected with an HIV expression plasmid, as described herein.

[0048] Figures 13A-B depicts data demonstrating regulation of HIV components by synthetic microRNA sequences in a lentiviral vector of the present disclosure. Figure 13A Tat knock-down data is shown. Figure 13B Vif knock-down data is shown.

[0049] Figure 14 depicts data demonstrating regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector of the present disclosure.

[0050] Figure 15 depicts data demonstrating regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector of the present disclosure containing either a long or short WPRE sequence.

[0051] Figure 16 depicts data demonstrating regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector of the present disclosure with or without a WPRE sequence.

[0052] Figure 17 depicts data demonstrating regulation of CCR5 expression by a CD4 promoter regulating synthetic microRNA sequences in a lentiviral vector of the present disclosure.

[0053] Figure 18 depicts data demonstrating detection of HIV Gag-specific CD4 T cells.

[0054] Figures 19A-E depict data demonstrating HIV-specific CD4 T cell expansion and lentivirus transduction. Figure 19A An exemplary schedule of treatment is shown. Figure 19B IFN-gamma production in CD4-gated T cells is shown, as described herein. Figure 19C IFN-gamma production and GFP expression in CD4-gated T cells is shown, as described herein. Figure 19D Frequency of HIV-specific CD4+ T cells is shown, as described herein. Figure 19E IFN-gamma production from PBMCs post-vaccination and following ex vivo peptide and expansion is shown, as described herein.

[0055] Figures 20A-C depicts data demonstrating a functional assay for a dose response of increasing AGT103-GFP and inhibition of CCR5 expression. Figure 20A Dose response data for increasing amounts of AGT103-GFP is shown. Figure 20B Normally distributed populations in terms of CCR5 expression are shown and a left shift of the population average indicates decreasing CCR5 expression due to AGT103-GFP transduction. Figure 20C Percentage inhibition of CCR5 expression with increasing doses of AGT103-GFP is shown.

[0056] Figures 21A-B depicts data demonstrating AGT103 transduction efficiency for primary human CD4+ T cells. Figure 21A Frequency of transduced cells (GFP -positive) is shown by FACS, as described herein. Figure 21B Number of vector copies per cell is shown, as described herein.

[0057] Figure 22 depicts data demonstrating AGT103 inhibition of HIV replication in primary CD4+ T cells, as described herein.

[0058] Figure 23 depicts data demonstrating AGT103 protection of primary humanCD4+T cells from HIV -induced depletion.

[0059] Figures 24A-D depicts data demonstrating generation of a CD4+ T cell population that is highly enriched for HIV-specific, AGT103-transduced CD4 T cells. Figure 24A shows CD4 and CD8 expression profiles for cell populations, as described herein. Figure 24B shows CD4 and CD8 expression profiles for cell populations, as described herein. Figure 24C shows IFN-gamma and CD4 expression profiles for cell populations, as described herein. Figure 24D shows IFN-gamma and GFP expression profiles for cell populations, as described herein.

[0060] Figure 25 depicts the manufacturing method of AGT103.

[0061] Figures 26A-B depicts data from subjects after restarting antiviral therapy following antiviral treatment interruption. Figure 26A shows HIV viral load, CD4 and CD8 levels from patient 1. Figure 26B shows HIV viral load, CD4 and CD8 levels from patient 1.

[0062] Figures 27A-B depict the persistence of AGT103-T and HIV Gag-specific CD4 and CD8 T cells in circulation in two patients.DETAILED DESCRIPTIONOverview

[0063] Disclosed herein are methods and compositions for treating and / or preventing human immunodeficiency virus (HIV) disease to achieve a functional cure. The methods and compositions include integrating lentivirus, non-integrating lentivirus, and related viral vector technology as described below.

[0064] Disclosed herein are therapeutic viral vectors (e.g.. lentiviral vectors), immunotherapies, and methods for their use for treating HIV infection. In embodiments, methods and compositions for achieving a functional cure for HIV infection are provided. As depicted in Figure 1 herein, the various aspects and embodiments include a first stimulation event, for example a first therapeutic immunization with vaccines intended to produce strong immune responses against HIV in HIV -infected patients, for example with stable suppression of viremia due to daily administration of HAART. In embodiments, the first stimulation event enriches the fraction of HIV-specific CD4 T cells. This is followed by (1) isolating peripheral leukocytes by leukapheresis or purifying PBMC or purifying fractions of PBMC from venous blood, (2) a second stimulating event, for example stimulating CD4 T cells ex vivo with a suitablestimulator^' agent, such as any vaccine or protein, for example, HIV or HIV -related peptides, (3) selecting an enriched cell population based on a biological response to peptide stimulation, (4) performing therapeutic lentivirus transduction, ex vivo T cell culture, and (5) re-infusion back into the original patient.

[0065] The various methods and compositions can be used to prevent new cells, such as CD4+ T cells, from becoming infected with HIV. For example as illustrated in Figure 2, to prevent new cells from becoming infected, CCR5 expression can be targeted to prevent virus attachment. Further, destruction of any residual infecting viral RNA can also be targeted. In respect of the foregoing, and in reference to Figure 2 herein, compositions and methods are provided to stop the HIV viral cycle in cells that have already become infected with HIV. To stop the HIV viral cycle, viral RNA produced by latently -infected cells, such as latently -infected CD4+ T cells, is targeted.

[0066] Previous efforts to achieve a cure for HIV have fallen short due to, among others, the failure to obtain sufficient numbers of HIV-specific CD4 T cells with protective genetic modifications. When this number is below a critical threshold, a functional cure as described herein is not achieved. For example, upon termination of antiretroviral therapy HIV re- emergence generally follows. Thereafter, patients often experience rapid destruction of HIV- specific CD4 T cells, followed by return to progression of disease despite prior genetic therapy. By employing selective enrichment for HIV-specific T cells in accordance with the compositions and methods described herein, a new HIV treatment regimen has been developed including, in various embodiments, a functional cure.Definitions and Interpretation

[0067] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited anddiscussed throughout the present specification unless otherwise indicated. See, e.g. : Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology. Wiley, John & Sons, Inc. (2002); Harlow and Lane, Using Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory7Press, Cold Spring Harbor, N.Y. (1998); and Coligan et al.. Short Protocols in Protein Science. Wiley, John & Sons, Inc. (2003). Any enzymatic reactions or purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry7, synthetic organic chemistry7, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art.

[0068] As used herein, the term “about’' will be understood by persons of ordinary skill in the art and will vary to some extent depending upon the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” will mean up to plus or minus 10% of the particular term.

[0069] As used herein, the terms “administration of’ or “administering” an active agent means providing an active agent of the invention to the subject in need of treatment in a form that can be introduced into that individual's body in a therapeutically useful form and therapeutically effective amount.

[0070] As used herein, the term “AGT103” refers to a particular embodiment of a lentiviral vector that contains a miR30-CCR5 / miR21-Vif / miR185-Tat microRNA cluster sequence, as detailed herein.

[0071] As used herein, the term “AGT103T” refers to a cell that has been transduced with a lentivirus that contains the AGT103 lentiviral vector.

[0072] As used herein, the term “antiviral treatment” and “antiviral therapy” can be used interchangeably and refer to any therapeutic agent used to treat a viral infection. Antiviral treatment includes therapeutic agents specifically for the treatment of HIV. Table 1 below7provides non-limiting list of antiviral treatments for HIV.Table 1Combination HIV Medicines

[0073] As used herein, the term “antiviral treatment interruption” refers to a period of time when antiviral treatment is stopped in a subject before the antiviral treatment is re-started in the subject.

[0074] As used herein, the term “CCR5” refers to C-C chemokine receptor 5. Reference herein to “CCR5delta32” is reference to a mutant genotype in the CCR5 gene.

[0075] As used herein, the term “CD” refers to a particular cluster of differentiation protein. A non-limiting example of this terminology as used herein is CD4 protein expression. Examples of such proteins include but are not limited to CD4.

[0076] As used herein, the term “HAART” refers to Highly Active AntiretroviralTherapy.

[0077] Throughout this specification and claims, the word “comprise,” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. Further, as used herein, the term “includes” means includes without limitation.

[0078] As used herein, the term “engraftment” refers to the ability7for one skilled in the art to determine a quantitative level of sustained engraftment in a subject following infusion of a cellular source (see for e.g. Rosenberg et al., N. Engl. J. Med. 323:570-578 ( 1990)1 Dudley etal., J. Immunother. 24:363-373 (2001); Yee et al., Curr. Opin. Immunol. 13: 141-146 (2001); Rooney et al., Blood 92: 1549-1555 (1998)).

[0079] The terms, “expression,” “expressed,” or “encodes” refer to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. Expression may include splicing of the mRNA in a eukaryotic cell or other forms of post-transcriptional modification or post-translational modification.

[0080] The term “functional cure”, as referenced above, and further defined herein, refers to a state or condition wherein HIV+ individuals who previously required ongoing HIV therapies such as HAART, may survive with low or undetectable virus replication using lower doses, intermittent doses, alternate drug combinations or single agents, or discontinued dosing of such HIV therapies. An individual may be said to have been “functionally cured” while still requiring adjunct therapy to maintain low level virus replication and slow or eliminate disease progression. A possible outcome of a functional cure is the eventual eradication of all or virtually all HIV such that no recurrence is detected within a specified time frame, for example, 1 month, 3 months, 6 months, 1 year, 3 years, and 5 years, and all other time frames as may be defined.

[0081] The term “HIV vaccine” encompasses immunogens plus vehicle plus adjuvant intended to elicit HIV-specific immune responses. The term “HIV vaccine” is within the meaning of the term “stimulatory agent” as described herein. A “HIV vaccine” may include purified or whole inactivated virus particles that may be HIV or recombinant virus vectors capable of expressing HIV proteins, protein fragments or peptides, glycoprotein fragments or glycopeptides, in addition to recombinant bacterial vectors, plasmid DNA or RNA capable of directing cells to producing HIV proteins, glycoproteins or protein fragments able to elicit specific immunity. Alternately, specific methods for immune stimulation including anti- CD3 / CD28 beads, T cell receptor-specific antibodies, mitogens, superantigens, cytokines and other chemical or biological stimuli may be used to activate dendritic, T or B cells for the purposes of enriching HIV-specific CD4 T cells prior to transduction or for in vitro assay of lentivirus-transduced CD4 T cells. Activating substances may be soluble, polymeric assemblies, liposome or endosome-based or linked to beads. Cytokines including interleukin-2, 6, 7, 12, 15, 23 or others may be added to improve cellular responses to stimuli and / or improve the survival of CD4 T cells throughout the culture and transduction intervals. Alternately, and withoutlimiting any of the foregoing, the term “HIV vaccine” encompasses the MVA / HIV62B vaccine and variants thereof. The MVA / HIV62B vaccine is a known highly attenuated double recombinant MVA vaccine. The MVA / HIV62B vaccine was constructed through the insertion of HIV-1 gag-pol and env sequences into the known MVA vector (see for e.g.: Goepfert et al. (2014) J. Infect. Dis. 210(1): 99-110, and see W02006026667, both of which are incorporated herein by reference). The term “HIV vaccine” also includes any one or more vaccines provided in Table 2, below- and in any similar tables contained in the priority documents (all of w hich are incorporated herein in their entirety).Table 2*IAVI is the International AIDS Vaccine Initiative, whose clinical trials database is publicly available at http: / / www.iavi.org / trials-database / trials.** As used herein, the term “Prime” refers to the composition initially used as an immunological inoculant in a given clinical trial as referenced in Table 1 herein.

[0082] The term “zn vzvo” refers to processes that occur in a living organism. The term “ex vivo” refers to processes that occur outside of a living organism. For example, in vivo treatment refers to treatment that occurs within a patient’s body, while ex vivo treatment is one that occurs outside of a patient’s body, but still uses or accesses or interacts with tissues from that patient. Thereafter, an ex vivo treatment step may include a subsequent in vivo treatment step.

[0083] The term “miRNA” refers to a microRNA, and also may be referred to herein as “miR”. The term “microRNA cluster” refers to at least two microRNAs that are situate on a vector in close proximity to each other and are co-expressed.

[0084] The term “packaging cell line” refers to any cell line that can be used to express a lentiviral particle.

[0085] The term ”PBMC” refers to peripheral blood mononuclear cells.

[0086] The term “percent identity,” in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of ordinary skill in the art) or by visual inspection. Depending on the application, the “percentidentity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared. For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity' for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0087] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA. and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

[0088] One example of an algorithm that is suitable for determining percent sequence identity' and sequence similarity is the BLAST algorithm, which is described in Altschul et al.. J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology' Information website.

[0089] The percent identity' between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at w x .gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40. 50. 60. 70. or 80 and a length weight of 1, 2, 3, 4, 5, or 6. The percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller CABIOS, 4: 11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available at http: / / www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0090] The nucleic acid and protein sequences of the present disclosure can further be used as a “query sequence” to perform a search against public databases to, for example, identify related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to the protein molecules of the invention. To obtain gapped alignments for comparison purposes. Gapped BLAST can be utilized as described in Altschul etal., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http: / / www.ncbi.nlm.nih.gov.

[0091] As used herein, “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and / or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0092] As used herein, a “pharmaceutically acceptable carrier” refers to, and includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The compositions can include a pharmaceutically acceptable salt, e.g., an acid addition salt or a base addition salt (see, e.g., Berge et al. (1977) J Pharm Sci 66: 1-19).

[0093] As used herein, the term “physical method of selection” refers to any physical method that can be used to positively select for a cell type within a larger mixture of cells (e.g., PBMC). A non-limiting example of a physical method of selection is magnetic bead sorting.

[0094] As used herein, the term “SEQ ID NO” is synonymous with the term “Sequence ID No. ”

[0095] As used herein, “small RNA” refers to non-coding RNA that are generally less than about 200 nucleotides or less in length and possess a silencing or interference function. In other embodiments, the small RNA is about 175 nucleotides or less, about 150 nucleotides orless, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less in length. Such RNAs include microRNA (miRNA), small interfering RNA (siRNA), double stranded RNA (dsRNA), and short hairpin RNA (shRNA). "‘Small RNA" of the disclosure should be capable of inhibiting or knocking-down gene expression of a target gene, for example through pathways that result in the destruction of the target gene mRNA.

[0096] As used herein, the term ‘‘stimulatory agent’’ refers to any exogenous agent that can stimulate an immune response, and includes, without limitation, a vaccine, a HIV vaccine, and HIV or HIV-related peptides. A stimulatory7agent can preferably stimulate a T cell response.

[0097] As used herein, the term “subject” includes a human patient but also includes other mammals. The terms “subject,” “individual,” “host,” and “patient” may be used interchangeably herein.

[0098] The term “Tat” refers to the HIV tat gene and its gene product, and variants thereof.

[0099] The term “therapeutically effective amount” refers to a sufficient quantity of the active agents of the present invention, in a suitable composition, and in a suitable dosage form to treat or prevent the symptoms, progression, or onset of the complications seen in patients suffering from a given ailment, injury7, disease, or condition. The therapeutically effective amount will vary depending on the state of the patient's condition or its severity7, and the age, weight, etc., of the subject to be treated. A therapeutically effective amount can vary, depending on any of a number of factors, including, e.g., the route of administration, the condition of the subject, as well as other factors understood by those in the art.

[0100] As used herein, the term “therapeutic vector” is synonymous with a lentiviral vector such as the AGT103 vector.

[0101] The term “treatment” or “treating” generally refers to an intervention in an attempt to alter the natural course of the subject being treated and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects include, but are not limited to, preventing occurrence or recurrence of disease, alleviating symptoms, suppressing, diminishing or inhibiting any direct or indirect pathological consequences of the disease, ameliorating or palliating the disease state, and causing remission or improved prognosis.

[0102] The term “vaccine”, which is used interchangeably with the term “therapeuticvaccine” refers to an exogenous agent that can elicit an immune response in an individual and includes, without limitation, purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, or virus-like particles (VLPs).

[0103] The term “Vif’ refers to the HIV vif gene and its gene product, and variants thereof.Description of Aspects of the Disclosure

[0104] As detailed herein, in one aspect, a method of treating cells infected with HIV is provided. In one aspect, a method of reducing viral load induced by antiviral treatment interruption in a subject is provided. The method includes measuring the viral load in a subject wherein the subject was previously administered a viral vector comprising at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to the subject. In embodiments, the viral vector is produced by the method of viral vector is produced by the method comprising contacting isolated PBMC ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; and culturing the transduced PBMC for at least 1 day. In embodiments, the transduced PBMC are cultured from about 1 to about 35 days. In embodiments, the method further includes infusing the transduced PBMC into a subject. In embodiments, the subject is a human. In embodiments, the stimulatory agent is a peptide or mixture of peptides, and in embodiments includes a gag peptide. In further embodiments, the stimulatory includes a vaccine. In embodiments, the vaccine is a HIV vaccine, and in further embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element includes a small RNA capable of inhibiting production of chemokine receptor CCR5. In embodiments, the at least one genetic element includes at least one small RNA capable of targeting an HIV RNA sequence. In other embodiments, the at least one genetic element includes a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. In embodiments, the HIV RNA sequence includes a HIV Vif sequence, a HIV Tat sequence, or variants thereof. In embodiments, the at least one genetic element includes at least one of a microRNA or a shRNA.In further embodiments, the at least one genetic element comprises a microRNA cluster.

[0105] In embodiments, the isolated PBMC is autologous. In embodiments, the isolated PBMC is heterologous. In embodiments, the subject is HIV+.

[0106] In another aspect, a method is disclosed which includes obtaining peripheral blood; fractionating the blood to obtain a PBMC population; contacting the PBMC population with purified antigen-presenting cells or peptides or proteins representing components of HIV ; culturing the contacted PBMC population for about 1 to about 12 days to expand an antigenspecific population; positively selecting cells that respond to peptide stimulation to produce an enriched cell fraction; transducing the enriched cell fraction ex vivo with a viral delivery system as detailed herein, and culturing the transduced cell fraction for a period of time sufficient to ensure adequate transduction.

[0107] In embodiments, the PBMC population is further purified to produce a purified fraction of PBMC. In embodiments, further purified fractions of PBMC are contacted with peptides or proteins representing components of HIV.

[0108] In another aspect, the at least one genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 1. In embodiments, the at least one genetic element comprises SEQ ID NO: 1.

[0109] In another aspect, the at least one genetic element includes a microRNA having at least 80%. at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 2; or at least 80%, at least81%, at least 82%, at least 83%. at least 84%, at least 85%, at least 86%, at least 87%, at least88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least95% or more percent identity with SEQ ID NO: 3. In embodiments, the at least one genetic element includes SEQ ID NO: 2 or SEQ ID NO: 3.

[0110] In another aspect, the microRNA cluster includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, atleast 95% or more percent identity with SEQ ID NO: 31. In embodiments, the microRNA cluster includes SEQ ID NO: 31.

[0111] In one aspect, a method of reducing side effects of antiviral treatment in a subj ect. The method includes administering a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to the subject. In embodiments, the viral vector is produced by contacting PBMC isolated from the subj ect ex vivo with a therapeutically effective amount of a stimulatory7agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; culturing the transduced PBMC for at least 1 day. In embodiments, the side effects of antiviral therapy includes depression, skin rash, discouragement, feeling sad or empty, irritability, lack of appetite, loss of interest or pleasure, thoughts of killing oneself, tiredness, trouble concentrating, trouble sleeping, diarrhea, nausea, headache, fatigue, stomach discomfort and combinations thereof. In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5). In embodiments, wherein the genetic element further includes a nucleotide sequence encoding a small RNA capable of targeting HIV Vif. In embodiments, the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5. In embodiments, the at least one genetic element includes: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%. or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) 95% percent identity7with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 1, 2 and 3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 6, 7 and 97. In embodiments, the at least one genetic element includes a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO:3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97. In embodiments, the course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir. dolutegravir and combinations thereof.

[0112] The method generally includes obtaining blood leukocytes; removing leukocytes from the subject and purifying peripheral blood mononuclear cells (PBMC) or defined fractions of PBMC. The method further includes contacting the PBMC or purified fraction of PBMC ex vivo with a therapeutically effective amount of a stimulatory agent; positive selection based on response to stimulatory agent to enrich the proportion of antigen-specific T cells; transducing the PBMC or purified fraction of PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC or a purified fraction of PBMC for a period of time sufficient to achieve transduction and growth of the modified cell population. The method may further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells or selecting for antigen-specific cells based on cytokine expression or combinations of selection methods to enrich for the therapeutic fraction of cells. In embodiments, the transduced PBMC or purified fraction of PBMC are cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC or purified fraction of PBMC into a subject. The subject may be a human. The subject maybe HV+. The at least one of the first stimulatory agents may include a peptide or mixture of peptides and may represent one, two. three or more of proteins encoded by the HIV genome. In embodiments, at least one of the first stimulatory agents includes a gag peptide. The at least one of the first stimulatory agents may include a vaccine. In embodiments, the vaccine is a HIV vaccine, and in further embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the first stimulatory agent is a mixture of gag peptides.

[0113] In embodiments, the viral delivery' system includes a lentiviral particle. In embodiments, the at least one genetic element includes a small RNA capable of inhibiting production of chemokine receptor CCR5. In embodiments, the at least one genetic element includes at least one small RNA capable of targeting an HIV RNA sequence. In embodiments, the at least one genetic element includes a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. The HIV RNA sequence may include a HIV Vif sequence, a HIV Tat sequence, or variants thereof. The at least one genetic element may include a rmcroRNA or a shRNA. or a cluster thereof. In embodiments, the at least one genetic element comprises a synthetic microRNA cluster.

[0114] In another aspect, the at least one genetic element includes a microRNA havingat least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 1. In embodiments, the at least one genetic element comprises SEQ ID NO: I.

[0115] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 2; or at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 3. In embodiments, the at least one genetic element includes SEQ ID NO: 2 or SEQ ID NO: 3.

[0116] In another aspect, the microRNA cluster includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 31. In embodiments, the microRNA cluster includes SEQ ID NO: 31.

[0117] In one aspect, a method of reducing dosage of antiviral treatment in a subject. The method includes administering a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to the subj ect. In embodiments, the viral vector is produced by contacting isolated PBMC ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; culturing the transduced PBMC for at least 1 day; infusing the transduced PBMC in the subject; and administering a course of antiviral therapy to the subject. In embodiments, the dose of antiviral therapy is 10 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg and combinations thereof. In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5). In embodiments, wherein the genetic element further includes a nucleotide sequence encoding a small RNA capable of targeting HIV Vif. In embodiments, the nucleotide sequence encodes forat least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5. In embodiments, the at least one genetic element includes: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 1, 2 and 3; or e) a nucleotide sequence having at least 80%. or at least 85%, or at least 90%, or at least 95% percent identity’ with SEQ ID NOs: 6, 7 and 97. In embodiments, the at least one genetic element includes a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO:3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97. In embodiments, the course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide. bictegravir, dolutegravir and combinations thereof.

[0118] In another aspect, the at least one genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity’ with SEQ ID NO: 1. In embodiments, the at least one genetic element comprises SEQ ID NO: 1.

[0119] In another aspect, the at least one genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 2; or at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 3. In embodiments, the at least one genetic element includes SEQ ID NO: 2; or SEQ ID NO: 3.

[0120] In another aspect, the microRNA cluster includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 31. In embodiments, the microRNA cluster includes SEQ ID NO: 31.

[0121] In another aspect, a lentiviral vector system for expressing a lentiviral particle is provided. The system includes a lentiviral vector as described herein; at least one envelope plasmid for expressing an envelope protein preferably optimized for infecting a cell; and at least one helper plasmid for expressing a gene of interest, for example any of gag, pol. and rev genes, wherein when the lentiviral vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell, wherein a lentiviral particle is produced by the packaging cell, wherein the lentiviral particle is capable of modulating a target sequence of interest, for example inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.

[0122] In another aspect, a lentiviral particle capable of infecting a cell is disclosed. The lentiviral particle includes at least one envelope protein preferably optimized for infecting a cell, and a lentiviral vector as described herein. The envelope protein may be optimized for infecting a T cell. In embodiments, the envelope protein is optimized for infecting a CD4+ T cell.

[0123] In another aspect, a modified cell is disclosed. In embodiments, the modified cell is a CD4+ T cell. In embodiments, the CD4+ T cell is infected with a lentiviral particle as described herein. In embodiments, the CD4+ T cell also has been selected to recognize an HIV antigen based on the prior immunization with a stimulatory agent. In a further embodiment, the HIV antigen that is recognized by the CD4+ T cell includes a gag antigen. In a further embodiment, the CD4+ T cell expresses a decreased level of CCR5 following infection with the lentiviral particle.

[0124] In another aspect, a method of selecting a subject for a therapeutic treatment regimen is disclosed. The method generally includes immunizing the subject with an effective amount of a first stimulatory agent; removing leukocytes from the subject and purifying peripheral blood mononuclear cells (PBMC) and determining a first quantifiable measurement associated with at least one factor associated with the PBMC; contacting the PBMC ex vivo with a therapeutically effective amount of a second stimulatory agent, and determining a second measurement associated with the at least one factor associated with the PBMC, whereby when the second quantifiable measurement is different (e.g. higher) than the first quantifiable measurement, the subject is selected for the treatment regimen. The at least one factor may be T cell proliferation or IFN gamma production.

[0125] In one aspect, a method of reducing the frequency of antiviral treatment in asubject. The method includes administering a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat and administering a course of antiviral therapy to the subject. In embodiments, the viral vector is produced by contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery' system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; culturing the transduced PBMC for at least 1 day; infusing the transduced PBMC in the subject; and administering a course of antiviral therapy to the subject. In embodiments, the frequency of antiviral therapy is once a day, twice a day, once a week, twice a week, once a month, once every 2 months, once every73 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months or once every 12 months. In embodiments, the genetic element further includes a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5). In embodiments, wherein the genetic element further includes a nucleotide sequence encoding a small RNA capable of targeting HIV Vif. In embodiments, the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5. In embodiments, the at least one genetic element includes: a) anucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity7with SEQ ID NOs: 1, 2 and 3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity7with SEQ ID NOs: 6, 7 and 97. In embodiments, the at least one genetic element includes a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO:3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97. In embodiments, the course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof.

[0126] In embodiments, the isolated PBMC is autologous. In embodiments, the isolatedPBMC is heterologous.

[0127] In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. In embodiments, the method further includes negatively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are negatively selected using at least one physical method of selection. In embodiments, the subject is a human. In embodiments the subject, is immunized with a stimulatory agent prior to isolation of PBMC. In embodiments, the stimulatory agent includes any agent suitable for stimulating a T cell response in a subject. In embodiments, the stimulatory agent is a peptide or mixture of peptides, and in embodiments includes a gag peptide. In further embodiments, the stimulatory agent is a vaccine. In embodiments, the vaccine is a HIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof.

[0128] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1). In embodiments, the at least one genetic element comprises SEQ ID NO: 1.

[0129] In another aspect, the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity withGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTC GTCG (SEQ ID NO: 3). In embodiments, the at least one genetic element includes SEQ ID NO: 2; or SEQ ID NO: 3.

[0130] In another aspect, the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAGCCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31). In embodiments, the microRNA cluster includes SEQ ID NO: 31.Human Immunodeficiency Virus (HIV)

[0131] Human Immunodeficiency Virus, which is also commonly referred to as “HIV”, is a retrovirus that causes acquired immunodeficiency syndrome (AIDS) in humans. AIDS is a condition in which progressive failure of the immune system allows life-threatening opportunistic infections and cancers to thrive. Without treatment, average survival time after infection with HIV is estimated to be 9 to 11 years, depending upon the HIV subtype and genetics of the host population. Infection with HIV occurs by the transfer of bodily fluids, including but not limited to blood, semen, vaginal fluid, pre-ejaculate, saliva, tears, lymph or cerebro-spinal fluid, or breast milk, or use of contaminated blood or tissue products. HIV may be present in an infected individual as both free virus particles and within infected immune cells.

[0132] HIV infects vital cells in the human immune system such as helper T cells, although tropism can vary among HIV subtypes. Immune cells that may be specifically susceptible to HIV infection include but are not limited to CD4+ T cells, macrophages, and dendritic cells. HIV infection leads to low levels of CD4+ T cells through a number of mechanisms, including but not limited to apoptosis of uninfected bystander cells, direct viral killing of infected cells, and killing of infected CD4+ T cells by CD8 cytotoxic lymphocytes that recognize infected cells. When CD4+ T cell numbers decline below a critical level, cell-mediated immunity is lost, and the body becomes progressively more susceptible to opportunistic infections and cancer.

[0133] Structurally, HIV is distinct from many other retroviruses. The RNA genome consists of at least seven structural landmarks (LTR, TAR, RRE, PE, SLIP. CRS. and INS), and at least nine genes (gag, pol, env, tat, rev, nef, vif, vpr, vpu, and sometimes a tenth tev, which is a fusion of tat, env and rev), encoding 19 proteins. Three of these genes, gag, pol, and env, contain information needed to make the structural proteins for new virus particles.

[0134] HIV replicates primarily in CD4 T cells and causes cellular destruction or dysregulation to reduce host immunity. Because HIV establishes infection as an integrated provirus and may enter a state of latency wherein virus expression in a particular cell decreases below the level for cytopathology affecting that cell or detection by the host immune system, HIV is difficult to treat and has not been eradicated even after prolonged intervals of combination antiretroviral therapy (HAART). In most cases, HIV infection causes fatal disease although survival may be prolonged by HAART.

[0135] A major goal in the fight against HIV is to develop strategies for curing disease. Prolonged HAART has not accomplished this goal, so investigators have turned to alternative procedures. Early efforts to improve host immunity by therapeutic immunization (using a vaccine after infection has occurred) had marginal or no impact. Likewise, treatment intensification had moderate or no impact.

[0136] Some progress has been made using genetic therapy, but positive results are sporadic and found only among rare human beings carry ing defects in one or both alleles of the gene encoding CCR5, which plays a critical role in viral penetration of host cells. However, many investigators are optimistic that genetic therapy holds the best promise for eventually achieving an HIV cure.

[0137] As disclosed herein, the methods and compositions of the invention are able to achieve a functional cure that may or may not include complete eradication of all HIV from the body. As mentioned above, a functional cure is defined as a state or condition wherein HIV+ individuals who previously required HAART, may survive with low or undetectable virus replication and using lower or intermittent doses of HAART, or are potentially able to discontinue HAART altogether. As used herein, a functional cure may still possibly require adjunct therapy to maintain low level virus replication and slow or eliminate disease progression. A possible outcome of a functional cure is the eventual eradication of HIV to prevent all possibility of recurrence.

[0138] The primary obstacles to achieving a functional cure lie in the basic biology of HIV itself. Virus infection deletes CD4 T cells that are critical for nearly all immune functions. Most importantly, HIV infection and depletion of CD4 T cells requires activation of individual cells. Activation is a specific mechanism for individual CD4 T cell clones that recognize pathogens or other molecules, using a rearranged T cell receptor.

[0139] In the case of HIV, infection activates a population of HIV-specific T cells that become infected and are consequently depleted before other T cells that are less specific for the virus, which effectively cripples the immune system's defense against the virus. The capacity for HIV-specific T cell responses is rebuilt during prolonged HAART; however, when HAART is interrupted the rebounding virus infection repeats the process and again deletes the virusspecific cells, resetting the clock on disease progression.

[0140] Clearly, afunctional cure is only possible if enough HIV-specific CD4 T cells are protected to allow for a host’s native immunity to confront and control HIV once HAART is interrupted. In one embodiment, the present invention provides methods and compositions for improving the effectiveness of genetic therapy to provide a functional cure of HIV disease. In another embodiment, the present invention provides methods and compositions for enhancing host immunity against HIV to provide a functional cure. In yet another embodiment, the present invention provides methods and compositions for enriching HIV-specific CD4 T cells in a patient to achieve a functional cure.

[0141] In one embodiment of the invention, treatment results in enriching a subject's HIV-specific CD4 T cells by about 100%. about 200%. about 300%, about 400%, about 500%, about 600%, about 700%, about 800%, about 900%, or about 1000%.Gene Therapy

[0142] Viral vectors are used to deliver genetic constructs to host cells for the purposes of disease therapy or prevention.

[0143] Genetic constructs can include, but are not limited to. functional genes or portions of genes to correct or complement existing defects, DNA sequences encoding regulatory proteins, DNA sequences encoding regulatory RNA molecules including antisense, short homology RNA, long non-coding RNA. small interfering RNA or others, and decoy sequences encoding either RNA or proteins designed to compete for critical cellular factors to alter a disease state. Gene therapy involves delivering these therapeutic genetic constructs to target cells to provide treatment or alleviation of a particular disease.

[0144] There are multiple ongoing efforts to utilize genetic therapy in the treatment of HIV disease, but thus far, the results have been poor. A small number of treatment successes were obtained in rare HIV patients carrying a spontaneous deletion of the CCR5 gene (an alleleknown as CCR5delta32).

[0145] Lentivirus-delivered nucleases or other mechanisms for gene deletion / modification may be used to lower the overall expression of CCR5 and / or help to lower HIV replication. At least one study has reported having success in treating the disease when lentivirus was administered in patients with a genetic background of CCR5delta32. However, this was only one example of success, and many other patients without the CCR5delta32 genotype have not been treated as successfully. Consequently, there is a substantial need to improve the performance of viral genetic therapy against HIV, both in terms of performance for the individual viral vector construct and for improved use of the vector through a strategy for achieving functional HIV cure.

[0146] For example, some existing therapies rely on zinc finger nucleases to delete a portion of CCR5 in an attempt to render cells resistant to HIV infection. However, even after optimal treatment, only 30% of T cells had been modified by the nuclease at all, and of those that w ere modified, only 10% of the total CD4 T cell population had been modified in a way that would prevent HIV infection. In contrast, the disclosed methods result in virtually every cell carrying a lentivirus transgene having a reduction in CCR5 expression below the level needed to allow HIV infection.

[0147] For the purposes of the disclosed methods, gene therapy can include, but is not limited to, affinity -enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1. MxA or MxB proteins. APOBEC complexes. TRIM5-alpha complexes, tetherin (BST2), and similar proteins identified as being capable of reducing HIV replication in mammalian cells.Immunotherapy

[0148] Historically, vaccines have been a go-to weapon against deadly infectious diseases, including smallpox, polio, measles, and yellow fever. Unfortunately, there is no currently approved vaccine for HIV. The HIV virus has unique ways of evading the immune system, and the human body seems incapable of mounting an effective immune response against it. As a result, scientists do not have a clear picture of what is needed to provide protectionagainst HIV.

[0149] However, immunotherapy may provide a solution that was previously unaddressed by conventional vaccine approaches. Immunotherapy, also called biologic therapy, is a type of treatment designed to boost the body’s natural defenses to fight infections or cancer. It uses materials either made by the body or in a laboratory to improve, target, or restore immune system function.

[0150] In some embodiments of the disclosed invention, immunotherapeutic approaches may be used to enrich a population of HIV-specific CD4 T cells for the purpose of increasing the host’s anti-HIV immunity. In some embodiments of the disclosed invention, integrating or non-integrating lenti virus vectors may be used to transduce a host’s immune cells for the purposes of increasing the host’s anti-HIV immunity. In yet another embodiment of the invention, a vaccine comprising HIV proteins including but not limited to a killed particle, a virus-like particle, HIV peptides or peptide fragments, a recombinant viral vector, a recombinant bacterial vector, a purified subunit or plasmid DNA combined with a suitable vehicle and / or biological or chemical adjuvants to increase a host's immune responses may be used to enrich the population of virus-specific T cells or antibodies, and these methods may be further enhanced through the use of HIV-targeted genetic therapy using lentivirus or other viral vector.Methods

[0151] In one aspect, the disclosure provides methods for using viral vectors to achieve a functional cure for HIV disease. The methods generally include immunotherapy to enrich the proportion of HIV-specific CD4 T cells, followed by lentivirus transduction to deliver inhibitors of HIV and CCR5 and CXCR4 as required.

[0152] In one embodiment, the methods include a first stimulation event to enrich a proportion of HIV-specific CD4 T cells. The first stimulation can include administration of one or more of any agent suitable for enriching a patient’s HIV -specific CD4+ T cells including but not limited to a vaccine.

[0153] Therapeutic vaccines can include one or more HIV protein with protein sequences representing the predominant viral types of the geographic region where treatment is occurring. Therapeutic vaccines will include purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, virus-likeparticles (VLPs), biological or chemical adjuvants including cytokines and / or chemokines, vehicles, and methods for immunization. Vaccinations may be administered according to standard methods known in the art and HIV patients may continue antiretroviral therapy during the interval of immunization and subsequent ex vivo lymphocyte culture including lentivirus transduction.

[0154] In some embodiments, HIV+ patients are immunized with an HIV vaccine, increasing the frequency of HIV-specific CD4 T cells by about 2, about 25, about 250, about 500, about 750, about 1000, about 1250, or about 1500-fold (or any amount in between these values). The vaccine may be any clinically utilized or experimental HIV vaccine, including the disclosed lentiviral, other viral vectors or other bacterial vectors used as vaccine delivery systems. In another embodiment, the vectors encode virus-like particles (VLPs) to induce higher titers of neutralizing antibodies. In another embodiment, the vectors encode peptides or peptide fragments associated with HIV including but not limited to gag, pol, and env, tat, rev, nef, vif, vpr, vpu, and tev, as well as LTR, TAR, RRE. PE. SLIP, CRS, and INS. Alternatively, the HIV vaccine used in the disclosed methods may comprise purified proteins, inactivated viruses, virally vectored proteins, bacterial ly vectored proteins, peptides or peptide fragments, vims-like particles (VLPs), or biological or chemical adjuvants including cytokines and / or chemokines.

[0155] In one embodiment, the methods include ex vivo re-stimulation of CD4 T cells from persons or patients previously immunized by therapeutic vaccination, using purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, biological or chemical adjuvants including cytokines and / or chemokines, vehicles, and methods for restimulation. Ex vivo re-stimulation may be performed using the same vaccine or immune stimulating compound used for in vivo immunization, or it may be performed using a different vaccine or immune stimulating compound than those used for in vivo immunization. Moreover, in some embodiments, the patient does not require prior therapeutic vaccination or re-stimulation of CD4 T cells if the individual has sufficiently high antigen-specific CD4 T cell responses to HIV proteins. In these embodiments, such a patient may only require ex vivo stimulation of CD4 T cells with viral antigens, vaccines or peptides followed by selection for HIV-specific T cells based on the response to stimulation. Enriched cell preparations may include 1%, 5%, 10%, 20%, 30%, 40%, 50% or more of the HIV-specific CD4+ T cells and are used for lentivirus transduction of genes able to protection from HIV-mediated depletion. Stimulation withpolyclonal mitogen plus cytokines increases the number of enriched and transduced T cells until appropriate levels are reached for infusion back into the original patient.

[0156] In embodiments, peripheral blood mononuclear cells (PBMCs) are obtained by leukapheresis and treated ex vivo to obtain about 1x109CD4 T cells of which about 0.1%, about 1%, about 5% or about 10% or about 30% or about 40% or about 50% are both HIV-specific in terms of antigen responses, and HIV-resistant by virtue of earn ing the therapeutic transgene delivered by the disclosed lentivirus vector. Alternatively, about IxlO7, about IxlO8, about IxlO9, about IxlO10, about IxlO11, or about IxlO12CD4 T cells may be isolated for restimulation. Any suitable amount of CD4 T cells are isolated for ex vivo re-stimulation.

[0157] The isolated CD4 T cells can be cultured in appropriate medium throughout restimulation with HIV vaccine antigens, which may include antigens present in the prior therapeutic vaccination. Antiretroviral therapeutic drugs including inhibitors of reverse transcriptase, protease or integrase may be added to prevent virus re-emergence during prolonged ex vivo culture. CD4 T cell re-stimulation is used to enrich the proportion of HIV - specific CD4 T cells in culture. The same procedure may also be used for analytical objectives wherein smaller blood volumes with peripheral blood mononuclear cells obtained by purification, are used to identify HIV-specific T cells and measure the frequency of this subpopulation.

[0158] The PBMC fraction may be enriched for HIV-specific CD4 T cells by contacting the cells with HIV proteins matching or complementary7to the components of the vaccine previously used for in vivo immunization. Ex vivo re-stimulation can increase the relative frequency of HIV-specific CD4 T cells by about 2, about 5. about 10. about 25, about 50, about 75, about 100, about 125, about 150, about 175, or about 200-fold. Further enrichment is obtained by positive selection for cells responding to HIV antigens, vaccines or peptides. Positive selection is accomplished, for example, with the CliniMACS Cytokine Capture System (Miltenyi Biotec Product number 130-028-701, San Diego, CA 92121) or similar manual or automated system including the Miltenyi Prodigy System (Miltenyi Biotec Product number 200- 075-301, San Diego, CA 92121) that is compatible with selecting viable cells based on expression of a cytokine (including but not limited to interferon gamma or tumor necrosis factor alpha) that is captured by a bi-specific reagent and labeled with a magnetic bead antibody to enable positive selection on a magnetic column. Enrichment may also be accomplished bylabeling stimulated cells with antibodies capable of detecting cell surface markers expressed preferentially on activated T cells including CD45RO, MHC Class II and others known in the art. Purification of labeled cells may be by fluorescence activated cell sorting, magnetic bead sorting or other physical methods capable of purifying viable cells based on phenotypic characteristics.

[0159] The methods additionally include combining in vivo therapeutic immunization and ex vivo re-stimulation of CD4 T cells with ex vivo lentiviral transduction and culturing.

[0160] Thus, in one embodiment, the re-stimulated PBMC or fraction of PBMC that has been enriched for HIV-specific CD4 T cells can be positively selected as described above, cultured for 1,2, 3, 4, 5 or up to 12, 20 or 30 days before activating again with a polyclonal mitogen such as Miltenyi GMP TransAct T cell reagent (Miltenyi Biotec Product number 170-076-156, San Diego, CA 92121) or other plant- or fungal based agglutinins or other reagents capable of recognizing cell surface CD3 and CD28 to cross link these molecules and cause polyclonal T cell activation. After polyclonal stimulation cells are transduced with therapeutic anti-HIV lentivirus or other vectors and maintained in culture for a sufficient period of time for such transduction, for example from about 1 to about 21 days, including up to about 35 days. Alternatively, the cells may be cultured for about 1- about 18 days, about 1- about 15 days, about 1- about 12 days, about 1- about 9 days, or about 3- about 7 days. Thus, the transduced cells may be cultured for about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 days. Activation with a polyclonal mitogen may or may not be included in the cell product manufacturing process.

[0161] In further embodiments, once the transduced cells have been cultured for a sufficient period of time, transduced CD4 T cells are infused back into the original patient. Infusion can be performed using various devices and methods known in the art. In some embodiments, infusion may be accompanied by pre-treatment with cyclophosphamide or similar compounds to increase the efficiency of re-engraftment.

[0162] In some embodiments, a CCR5-targeted therapy may be added to a subject’s antiretroviral therapy regimen, which w as continued throughout the treatment process. Examples of CCR5-targeted therapies include but are not limited to Maraviroc (a CCR5 antagonist) orRapamycin (immunosuppressive agent that lowers CCR5). In some embodiments, the antiretroviral therapy may be ceased and the subject can be tested for virus rebound. If no rebound occurs, adjuvant therapy can also be removed and the subject can be tested again for virus rebound.

[0163] In various embodiments, continued virus suppression with reduced or no antiretroviral therapy including HAART, and reduced or no adjuvant therapy for about 26 weeks can be considered a functional cure for HIV. Other definitions of a functional cure are described herein.

[0164] The lentiviral and other vectors used in the disclosed methods may encode at least one, at least two, at least three, at least four, or at least five genes, or at least six genes, or at least seven genes, or at least eight genes, or at least nine genes, or at least ten genes, or at least eleven genes, or at least twelve genes of interest. Given the versatility and therapeutic potential of HIV- targeted gene therapy, a viral vector of the invention may encode genes or nucleic acid sequences that include but are not limited to (i) an antibody directed to an antigen associated with an infectious disease or a toxin produced by the infectious pathogen, (ii) cytokines including interleukins that are required for immune cell growth or function and may be therapeutic for immune dysregulation encountered in HIV and other chronic or acute human viral or bacterial pathogens, (iii) factors that suppress the growth of HIV in vivo including CD8 suppressor factors, (iv) mutations or deletions of chemokine receptor CCR5, mutations or deletions of chemokine receptor CXCR4, or mutations or deletions of chemokine receptor CXCR5, (v) antisense DNA or RNA against specific receptors or peptides associated with HIV or host protein associated with HIV, (vi) small interfering RNA against specific receptors or peptides associated with HIV or host protein associated with HIV, or (vii) a variety' of other therapeutically useful sequences that may be used to treat HIV or AIDS.

[0165] Additional examples of HIV-targeted gene therapy that can be used in the disclosed methods include, but are not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5-alpha complexes, tetherin (BST2), and similar proteins identified as being capable of reducing HIV replication in mammalian cells.

[0166] In some embodiments, a patient may be undergoing HAART concurrently while being treated according to the methods of the invention. In other embodiments, a patient may undergo HAART before or after being treated according to the methods of the invention. In some embodiments, HAART is maintained throughout treatment according to the methods of the invention and the patient may be monitored for HIV viral burden in blood and frequency of lentivirus-transduced CD4 T cells in blood. Preferably, a patient receiving HAART prior to being treated according to the methods of the invention is able to discontinue or reduce HAART following treatment according to the methods of the invention.

[0167] For efficacy purposes, the frequency of transduced. HIV-specific CD4 T cells, which is a novel surrogate marker for gene therapy effects, may be determined, as discussed in more detail herein.Compositions

[0168] In various aspects, the disclosure provides lentiviral vectors capable of delivering genetic constructs to inhibit HIV penetration of susceptible cells. For instance, one mechanism of action in accordance herein is to reduce mRNA levels for CCR5 and / or CXCR4 chemokine receptors for reducing the rates for viral entry into susceptible cells.

[0169] Alternatively, the disclosed lentiviral vectors are capable of inhibiting the formation of HIV -infected cells by reducing the stability of incoming HIV genomic RNA. And in yet another embodiment, the disclosed lentivirus vectors are capable of preventing HIV production from a latently infected cell, wherein the mechanism of action is to cause instability of viral RNA sequences through the action of inhibitory RNA including short-homology, smallinterfering or other regulatory RNA species.

[0170] The therapeutic lentiviruses disclosed generally comprise at least one of two types of genetic cargo. First, the lentiviruses may encode genetic elements that direct expression of small RNA capable of inhibiting the production of chemokine receptors CCR5 and / or CXCR4 that are important for HIV penetration of susceptible cells. The second type of genetic cargo includes constructs capable of expressing small RNA molecules targeting HIV RNA sequences for the purpose of preventing reverse transcription, RNA splicing, RNA translation to produce proteins, or packaging of viral genomic RNA for particle production and spreading infection. An exemplary structure is diagrammed in Figure 3.

[0171] As shown in Figure 3 (top panel), an exemplary construct may comprise numerous sections or components. For example, in one embodiment, an exemplar}7LV construct may comprise the following sections or components:• RSV - a Rous Sarcoma virus long terminal repeat;• 5’LTR - a portion of an HIV long terminal repeat that can be truncated to prevent replication of the vector after chromosomal integration;• Psi - a packaging signal that allows for incorporation of the vector RNA genome into viral particles during packaging;• RRE - a Rev Responsive element can be added to improve expression from the transgene by mobilizing RNA out of the nucleus and into the cytoplasm of cells;• cPPT - a Poly purine tract that facilitates second strand DNA synthesis prior to integration of the transgene into the host cell chromosome;• Promoter - a promoter initiates RNA transcription from the integrated transgene to express micro-RNA clusters (or other genetic elements of the construct), and in some embodiments, the vectors may use an EF-1 promoter;• Anti-CCR5 - a micro RNA targeting messenger RNA for the host cell factor CCR5 to reduce its expression on the cell surface;• Anti-Rev / Tat - a micro RNA targeting HIV genomic or messenger RNA at the junction between HIV Rev and Tat coding regions, which is sometimes designated miRNA Tat or given a similar description in this application:• Anti-Vif - a micro RNA targeting HIV genomic or messenger RNA within the Vif coding region;• WPRE - a woodchuck hepatitis virus post-transcriptional regulatory element is an additional vector component that can be used to facilitate RNA transport of the nucleus; and• deltaU3 3’LTR - a modified version of a HIV 3’ long terminal repeat where a portion of the U3 region has been deleted to improve safety7of the vector.

[0172] One of ordinary skill in the art will recognize that the above components are merely examples, and that such components may be reorganized, substituted with other elements, or otherwise changed, so long as the construct is able to prevent expression of HIV genes and decrease the spread of infection.

[0173] Vectors of the invention may include either or both of the types of genetic cargo discussed above (i.e., genetic elements that direct expression of a gene or small RNAs, such as siRNA. shRNA, or miRNA that can prevent translation or transcription), and the vectors of the invention may also encode additionally useful products for the purpose of treatment or diagnosis of HIV. For instance, in some embodiments, these vectors may also encode green fluorescent protein (GFP) for the purpose of tracking the vectors or antibiotic resistance genes for the purposes of selectively maintaining genetically-modified cells in vivo.

[0174] The combination of genetic elements incorporated into the disclosed vectors is not particularly limited. For example, a vector herein may encode a single small RNA, two small RNAs, three small RNA, four small RNAs, five small RNAs, six small RNAs, seven small RNAs, eight small RNAs, nine small RNAs, or ten small RNAs, or eleven small RNAs, or twelve small RNAs. Such vectors may additionally encode other genetic elements to function in concert with the small RNAs to prevent expression and infection of HIV.

[0175] Those of ordinary skill in the art will understand that the therapeutic lentivirus may substitute alternate sequences for the promoter region, targeting of regulatory RNA, and types of regulatory RNA. Further, the therapeutic lentivirus of the disclosure may comprise changes in the plasmids used for packaging the lentivirus particles; these changes are required to increase levels of production in vitro.Lentiviral Vector System

[0176] A lentiviral virion (particle) in accordance with various aspects and embodiments herein is expressed by a vector system encoding the necessary viral proteins to produce a virion (viral particle). In various embodiments, one vector containing a nucleic acid sequence encoding the lentiviral pol proteins is provided for reverse transcription and integration, operably linked to a promoter. In another embodiment, the pol proteins are expressed by multiple vectors. In other embodiments, vectors containing a nucleic acid sequence encoding the lentiviral Gag proteins for forming a viral capsid, operably linked to a promoter, are provided. In embodiments, this gag nucleic acid sequence is on a separate vector than at least some of the pol nucleic acid sequence. In other embodiments, the gag nucleic acid is on a separate vector from all the pol nucleic acid sequences that encode pol proteins.

[0177] Numerous modifications can be made to the vectors herein, which are used tocreate the particles to further minimize the chance of obtaining wild type revertants. These include, but are not limited to deletions of the U3 region of the LTR, tat deletions and matrix (MA) deletions. In embodiments, the gag, pol and env vector(s) do not contain nucleotides from the lentiviral genome that package lentiviral RNA. referred to as the lentiviral packaging sequence.

[0178] The vector(s) forming the particle preferably do not contain a nucleic acid sequence from the lentiviral genome that expresses an envelope protein. Preferably, a separate vector that contains a nucleic acid sequence encoding an envelope protein operably linked to a promoter is used. This env vector also does not contain a lentiviral packaging sequence. In one embodiment the env nucleic acid sequence encodes a lentiviral envelope protein.

[0179] In another embodiment the envelope protein is not from the lentivirus, but from a different virus. The resultant particle is referred to as a pseudotyped particle. By appropriate selection of envelopes one can "infect" virtually any cell. For example, one can use an env gene that encodes an envelope protein that targets an endocytic compartment such as that of the influenza virus, VSV-G, alpha viruses (Semliki forest virus, Sindbis virus), arenaviruses (lymphocytic choriomeningitis virus), flaviviruses (tick-bome encephalitis virus. Dengue virus, hepatitis C virus, GB virus), rhabdoviruses (vesicular stomatitis virus, rabies virus), paramyxoviruses (mumps or measles) and orthomyxoviruses (influenza virus). Other envelopes that can preferably be used include those from Moloney Leukemia Virus such as MLV-E, MLV- A and GALV. These latter envelopes are particularly preferred where the host cell is a primary cell. Other envelope proteins can be selected depending upon the desired host cell. For example, targeting specific receptors such as a dopamine receptor can be used for brain delivery. Another target can be vascular endothelium. These cells can be targeted using a filovirus envelope. For example, the GP of Ebola, which by post-transcriptional modification become the GP, and GP2 glycoproteins. In another embodiment, one can use different lentiviral capsids with a pseudotyped envelope (for example, FIV or SHIV [U.S. Patent No. 5,654,195]). A SHIV pseudotyped vector can readily be used in animal models such as monkeys.

[0180] Lentiviral vector systems as provided herein typically include at least one helper plasmid comprising at least one of a gag, pol, or rev gene. Each of the gag, pol and rev genes may be provided on individual plasmids, or one or more genes may be provided together on the same plasmid. In one embodiment, the gag, pol. and rev genes are provided on the same plasmid(e.g., Figure 4). In another embodiment, the gag and pol genes are provided on a first plasmid and the rev gene is provided on a second plasmid (e.g., Figure 5). Accordingly, both 3-vector (e.g., Figures 4 and 6) and 4-vector (e.g., Figure 5) systems can be used to produce a lentivirus as described herein. In embodiments, the therapeutic vector, at least one envelope plasmid and at least one helper plasmid are transfected into a packaging cell, for example a packaging cell line. A non-limiting example of a packaging cell line is the 293T / 17 HEK cell line. When the therapeutic vector, the envelope plasmid, and at least one helper plasmid are transfected into the packaging cell line, a lentiviral particle is ultimately produced.

[0181] In another aspect, a lentiviral vector system for expressing a lentiviral particle is disclosed. The system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.

[0182] In another aspect, the lentiviral vector, which is also referred to herein as a therapeutic vector, includes the following elements: hybrid 5’ long terminal repeat (RSV / 5’ LTR) (SEQ ID NOS: 34-35), Psi sequence (RNA packaging site) (SEQ ID NO: 36), RRE (Rev- response element) (SEQ ID NO: 37), cPPT (polypurine tract) (SEQ ID NO: 38), EF-la promoter (SEQ ID NO: 4). miR30CCR5 (SEQ ID NO: 1), miR21Vif (SEQ ID NO: 2). miR185Tat (SEQ ID NO: 3), Woodchuck Post-Transcriptional Regulatory' Element (WPRE) (SEQ ID NOS: 32 or 80), and AU3 3’ LTR (SEQ ID NO: 39). In another aspect, sequence variation, by way' of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.

[0183] In another aspect, a helper plasmid includes the following elements: CAG promoter (SEQ ID NO: 41); HIV component gag (SEQ ID NO: 43); HIV component pol (SEQ ID NO: 44); HIV Int (SEQ ID NO: 45); HIV RRE (SEQ ID NO: 46); and HIV Rev (SEQ ID NO: 47). In another aspect, the helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, and a second and separate plasmid for expressing the rev gene. In another aspect, sequence variation, by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.

[0184] In another aspect, an envelope plasmid includes the following elements: RNA polymerase II promoter (CMV) (SEQ ID NO: 60) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 62). In another aspect, sequence variation, by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.

[0185] In various aspects, the plasmids used for lentiviral packaging are modified by substitution, addition, subtraction or mutation of various elements without loss of vector function. For example, and without limitation, the following elements can replace similar elements in the plasmids that comprise the packaging system: Elongation Factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can replace the CMV or CAG promoter. SV40 poly A and bGH poly A can replace the rabbit beta globin poly A. The HIV sequences in the helper plasmid can be constructed from different HIV strains or clades. The VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD 114), gibbon ape leukemia virus (GALV), Rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A fowl plague virus (FPV), Ross River alphavirus (RRV), murine leukemia virus 10A1 (MLV), or Ebola virus (EboV).

[0186] Various lentiviral packaging systems can be acquired commercially (e.g.. Lenti- vpak packaging kit from OriGene Technologies, Inc., Rockville, MD), and can also be designed as described herein. Moreover, it is within the skill of a person ordinarily skilled in the art to substitute or modify aspects of a lentiviral packaging system to improve any number of relevant factors, including the production efficiency of a lentiviral particle.Bioassays

[0187] In various aspects, the present invention includes bioassays for determining the success of HIV treatment for achieving a functional cure. These assays provide a method for measuring the efficacy of the disclosed methods of immunization and treatment by measuring the frequency of transduced, HIV specific CD4 T cells in a patient. HIV-specific CD4 T cells are recognizable because, among others, they proliferate, change the composition of cell surface markers, induce signaling pathways including phosphorylation, and / or express specific marker proteins that may be cytokines, chemokines, caspases, phosphorylated signaling molecules or other cytoplasmic and / or nuclear components. Specific responding CD4 T cells are recognized for example, using labeled monoclonal antibodies or specific in situ amplification of mRNA sequences, that allow' sorting of HIV-specific cells using flow cytometry' sorting, magnetic beadseparation or other recognized methods for antigen-specific CD4 T cell isolation. The isolated CD4 T cells are tested to determine the frequency of cells carrying integrated therapeutic lentivirus. Single cell testing methods may also be used including microfluidic separation of individual cells that are coupled with mass spectrometry. PCR, ELISA or antibody staining to confirm responsiveness to HIV and presence of integrated therapeutic lentivirus.

[0188] Thus, in various embodiments, following application of a treatment according to the invention (e.g., (a) immunization, (b) ex vivo leukocyte / lymphocyte culture; (c) restimulation with purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, biological or chemical adjuvants including cytokines and / or chemokines, vehicles; and (d) infusion of the enriched, transduced T cells), a patient may be subsequently assayed to determine the efficacy of the treatment. A threshold value of target T cells in the body may be established to measure a functional cure at a determined value, for example, at about IxlO8HIV-specific CD4 T cells bearing genetic modification from therapeutic lentivirus. Alternatively, the threshold value may be about IxlO5, about IxlO6, about IxlO7, about IxlO8, about IxlO9, or about IxlO10CD4 T cells in the body of the patient.

[0189] HIV-specific CD4 T cells bearing genetic modification from therapeutic lentivirus can be determined using any suitable method, such as but not limited to flow cytometry7, cell sorting, FACS analysis, DNA cloning, PCR, RT-PCR or Q-PCR, ELISA, FISH, western blotting, southern blotting, high throughput sequencing, RNA sequencing, oligonucleotide primer extension, or other methods known in the art.

[0190] While methods for defining antigen specific T cells with genetic modifications are known in the art, utilizing such methods to combine identifying HIV-specific T cells with integrated or non-integrated gene therapy constructs as a standard measure for efficacy is a novel concept in the field of HIV treatment, as described variously herein.Doses and Dosage Forms

[0191] The disclosed methods and compositions can be used for treating HIV+ patients during various stages of their disease. Accordingly, dosing regimens may vary based upon the condition of the patient and the method of administration.

[0192] In various embodiments, HIV-specific vaccines for the initial in vivo immunization are administered to a subject in need in varying doses. In general, vaccinesdelivered by intramuscular injection include about 10 pg to about 300 pg. about 25 pg to about 275 jug, about 50 jug to about 250 ig, about 75 jug to about 225, or about 100 jug to about 200 jug of HIV protein, either total virus protein prepared from inactivated virus particles, virus-like particles or purified virus protein from recombinant systems or purified from virus preparations. Recombinant viral or bacterial vectors may be administered by any and all of the routes described. Intramuscular vaccines will include about 1 pg to about 100 pg, about 10 pg to about 90 pg, about 20 pg to about 80 pg, about 30 pg to about 70 pg, about 40 pg to about 60 pg, or about 50 pg of suitable adjuvant molecules and be suspended in oil. saline, buffer or water in volumes of 0. 1 to 5 ml per injection dose, and may be soluble or emulsion preparations. Vaccines delivered orally, rectally, bucally, at genital mucosal or intranasally, including some virally- vectored or bacterially-vectored vaccines, fusion proteins, liposome formulations or similar preparations, may contain higher amounts of virus protein and adjuvant. Dermal, sub-dermal or subcutaneous vaccines utilize protein and adjuvant amounts more similar to oral, rectal or intranasal-delivered vaccines. Depending on responses to the initial immunization, vaccination may be repeated 1-5 times using the same or alternate routes for delivery. Intervals may be of 2- 24 weeks between immunizations. Immune responses to vaccination are measured by testing HIV-specific antibodies in serum, plasma, vaginal secretions, rectal secretions, saliva or bronchoalveolar lavage fluids, using ELISA or similar methodology. Cellular immune responses are tested by in vitro stimulation with vaccine antigens followed by staining for intracellular cytokine accumulation followed by flow cytometry or similar methods including lymphoproliferation, expression of phosphorylated signaling proteins or changes in cell surface activation markers. Upper limits of dosing may be determined based on the individual patient and will depend on toxicity / safety profiles for each individual product or product lot.

[0193] Immunization may occur once, twice, three times, or repeatedly. For instance, an agent for HIV immunization may be administered to a subj ect in need once a week, once every other week, once every three weeks, once a month, every other month, every three months, every six months, every nine months, once a year, every eighteen months, every two years, every 36 months, or every three years.

[0194] Immunization will generally occur at least once before ex vivo expansion and enrichment of CD4 T cells, and immunization may occur once, twice, three times, or more after ex vivo leukocyte / lymphocyte culture / re-stimulation and infusion.

[0195] In one embodiment, HIV vaccines for immunization are administered as a pharmaceutical composition. In one embodiment, the pharmaceutical composition comprising an HIV vaccine is formulated in a wide variety of nasal, pulmonary’, oral, topical, or parenteral dosage forms for clinical application. Each of the dosage forms can comprise various disintegrating agents, surfactants, fillers, thickeners, binders, diluents such as wetting agents or other pharmaceutically acceptable excipients. The pharmaceutical composition comprising an HIV vaccine can also be formulated for injection.

[0196] HIV vaccine compositions for the purpose of immunization can be administered using any pharmaceutically acceptable method, such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intracistemally, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, or via a buccal or nasal spray formulation.

[0197] Further, the HIV vaccine compositions can be formulated into any pharmaceutically acceptable dosage form, such as a solid dosage form, tablet, pill, lozenge, capsule, liquid dispersion, gel, aerosol, pulmonary aerosol, nasal aerosol, ointment, cream, semisolid dosage form, and a suspension. Further, the composition may be a controlled release formulation, sustained release formulation, immediate release formulation, or any combination thereof. Further, the composition may be a transdermal delivery' system.

[0198] In another embodiment, the pharmaceutical composition comprising an HIV vaccine is formulated in a solid dosage form for oral administration, and the solid dosage form can be powders, granules, capsules, tablets or pills. In yet another embodiment, the solid dosage form includes one or more excipients such as calcium carbonate, starch, sucrose, lactose, mi crocry stall ine cellulose or gelatin. In addition, the solid dosage form can include, in addition to the excipients, a lubricant such as talc or magnesium stearate. In some embodiments, the oral dosage form is in immediate release or a modified release form. Modified release dosage forms include controlled or extended release, enteric release, and the like. The excipients used in the modified release dosage forms are commonly know n to a person of ordinary skill in the art.

[0199] In a further embodiment, the pharmaceutical composition comprising a HIV vaccine is formulated as a sublingual or buccal dosage form. Such dosage forms comprise sublingual tablets or solution compositions that are administered under the tongue and buccaltablets that are placed between the cheek and gum.

[0200] In yet a further embodiment, the pharmaceutical composition comprising an HIV vaccine is formulated as a nasal dosage form. Such dosage forms of the present invention comprise solution, suspension, and gel compositions for nasal delivery.

[0201] In one embodiment, the pharmaceutical composition is formulated in a liquid dosage form for oral administration, such as suspensions, emulsions or syrups. In other embodiments, the liquid dosage form can include, in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as humectants, sweeteners, aromatics or preservatives. In particular embodiments, the composition comprising HIV vaccine or a pharmaceutically acceptable salt thereof is formulated to be suitable for administration to a pediatric patient.

[0202] In one embodiment, the pharmaceutical composition is formulated in a dosage form for parenteral administration, such as sterile aqueous solutions, suspensions, emulsions, non-aqueous solutions or suppositories. In other embodiments, the non-aqueous solutions or suspensions includes propyleneglycol, polyethyleneglycol, vegetable oils such as olive oil or injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao oil, laurin oil or glycerinated gelatin can be used.

[0203] The dosage of the pharmaceutical composition can vary' depending on the patient's weight, age, gender, administration time and mode, excretion rate, and the severity of disease.

[0204] For the purposes of re-stimulation, lymphocytes. PBMCs, and / or CD4 T cells are generally removed from a patient and isolated for re-stimulation and culturing. The isolated cells may be contacted with the same HIV vaccine or activating agent used for immunization or a different HIV vaccine or activating agent. In one embodiment, the isolated cells are contacted with about 10 ng to 5 pg of an HIV vaccine or activating agent per about 106cells in culture (or any other suitable amount). More specifically, the isolated cells may be contacted with about 50 ng, about 100 ng, about 200 ng, about 300 ng, about 400 ng, about 500 ng, about 600 ng, about 700 ng, about 800 ng, about 900 ng, about 1 pg, about 1.5 pg, about 2 pg, about 2.5 pg, about 3 pg, about 3.5 pg. about 4 pg, about 4.5 pg, or about 5 pg of an HIV vaccine or activating agent per about 106cells in culture.

[0205] Activating agents or vaccines are generally used once for each in vitro cell culture but may be repeated after intervals of about 15 to about 35 days. For example, a repeat dosing could occur at about 15, about 16. about 17, about 18, about 19, about 20. about 21, about 22, about 23. about 24, about 25, about 26, about 27, about 28. about 29. about 30, about 31, about 32, about 33, about 34, or about 35 days.

[0206] For transduction of the enriched, re-stimulated cells, the cells may be transduced with lentiviral vectors or with other known vector systems as disclosed, for example, in Figure 4 or Figure 6. The cells being transduced may be contacted with about 1-1,000 viral genomes (measured by RT-PCR assay of culture fluids containing lentivirus vector) per target cell in culture (or any other suitable amount). Lentivirus transduction may be repeated 1-5 times using the same range of 1-1,000 viral genomes per target cell in culture.Cellular Enrichment

[0207] In various embodiments, cells such as T cells are obtained from an HIV infected patient and cultured. Culturing can occur in multiwell plates in a culture medium comprising conditioned media (“CM”). The levels of supernatant p24gas(“p24”) and viral RNA levels may be assessed by standard means. Those patients whose CM-cultured cells have peak p24 supernatant levels of less than 1 ng / ml may be suitable patients for large-scale T-cell expansion in CM with or without the use of additional anti-viral agents. Additionally, different drugs or drug combinations of interest may be added to different wells and the impact on virus levels in the sample may be assessed by standard means. Those drug combinations providing adequate viral suppression are therapeutically useful combinations. It is within the capacity of a competent technician to determine what constitutes adequate viral suppression in relation to a particular subject. In order to test the effectiveness of drugs of interest in limiting viral expansion, additional factors such as anti-CD3 antibodies may be added to the culture to stimulate viral production. Unlike culture methods for HIV infected cell samples known in the art, CM allows the culture of T cells for periods of over two months, thereby providing an effective system in which to assay long term drug effectiveness.

[0208] This approach allows the inhibition of gene expression driven by the HIV LTR promoter region in a cell population by the culture of cells in a medium comprising the CM. Culture in CM4 likely inhibits HIV LTR driven gene expression by altering one or moreinteractions between transcription mediating proteins and HIV gene expression regulatory elements. Transcription-mediating proteins of interest include host cell encoded proteins such as AP-1, NFkappaB, NF-AT, IRF, LEF-1 and Spl, and the HIV encoded protein Tat. HIV gene expression regulatory elements of interest include binding sites for AP-1, NFkappaB. NF-AT, IRF, LEF-1 and Spl, as well as the transacting responsive element (‘‘TAR’’) which interacts with Tat.

[0209] In a preferred embodiment, the HIV infected cells are obtained from a subject with susceptible transcription mediating protein sequences and susceptible HIV regulator}7element sequences. In a more preferred embodiment, the HIV infected cells are obtained from a subject having wild-type transcription-mediating protein sequences and wild-type HIV regulatory sequences.

[0210] Another method of enriching T Cells utilizes immunoaffinity -based selection. This method includes the simultaneous enrichment or selection of a first and second population of cells, such as a CD4+ and CD8+ cell population. Cells containing primary human T cells are contacted with a first immunoaffinity reagent that specifically binds to CD4 and a second immunoaffinity reagent that specifically binds to CDS in an incubation composition, under conditions whereby the immunoaffinity reagents specifically bind to CD4 and CD8 molecules, respectively, on the surface of cells in the sample. Cells bound to the first and / or the second immunoaffinity reagent are recovered, thereby generating an enriched composition comprising CD4+ cells and CD8+ cells. This approach may include incubation of the composition with a concentration of the first and / or second immunoaffinity reagent that is at a sub-optimal yield concentration. Notably, in some embodiments, transduced cells are a mixed T cell population, and in other embodiments transduced cells are not a mixed T cell population.

[0211] In some embodiments, immunoaffinity -based selection is used where the solid support is a sphere, such as a bead, such as a microbead or nanobead. In other embodiments, the bead can be a magnetic bead. In another embodiment, the antibody contains one or more binding partners capable of forming a reversible bond with a binding reagent immobilized on the solid surface, such as a sphere or chromatography matrix, wherein the antibody is reversibly mobilized to the solid surface. In some embodiments, cells expressing a cell surface marker bound by the antibody on said solid surface are capable of being recovered from the matrix by disruption of the reversible binding between the binding reagent and binding partner. In some embodiments,the binding reagent is streptavidin or is a streptavidin analog or mutant. In some embodiments, immunoaffinity-based selection is used to capture cells specifically responding to HIV proteins, vaccines or peptides based on expression of cytokines in these cells. A bi-specific capture reagent binds to T cells and also captures cytokine released from that cell. The cytokine is preferably interferon gamma but may include tumor necrosis factor alpha or other cytokines known to be produced by T cells. The immobilized cytokine is recognized by a second immune-affinity reagent that is modified by a magnetic bead. Cells with the first capture reagent-cytokine-second immune-affinity reagent and magnetic bead are retained on a magnetic column and are thus purified away from cells that did not express cytokine after HIV protein, vaccine or peptide stimulation and are maintained in a viable state. Removing the matrix from a magnetic field allows release of the labeled cells and capture as a highly enriched population. In some cases, the enriched cells may be cultured for 1-30 days to increase in number before being stimulated with a polyclonal mitogen such as anti-CD3 / anti-CD28 microbeads or similar stimulation reagents that are compatible with lentivirus transduction.

[0212] Stable transduction of primary cells of the hematopoietic system and / or hematopoietic stem cells may be obtained by contacting, in vitro or ex vivo, the surface of the cells with both a lentiviral vector and at least one molecule which binds the cell surface. The cells may be cultured in a ventilated vessel comprising two or more layers under conditions conducive to growth and / or proliferation. In some embodiments, this approach may be used in conjunction with non-CD4+ T cell depletion and / or broad polyclonal expansion.

[0213] In another approach to T cell enrichment, PBMCs are stimulated with a peptide and enriched for cells secreting a cytokine, such as interferon-gamma. This approach generally involves stimulating a mixture of cells containing T cells with antigen, and effecting a separation of antigen-stimulated cells according to the degree to which they are labeled with the product. Antigen stimulation is achieved by exposing the cells to at least one antigen under conditions effective to elicit antigen-specific stimulation of at least one T cell. Labeling with the product is achieved by modifying the surface of the cells to contain at least one capture moiety, culturing the cells under conditions in which the product is secreted, released and specifically bound ("‘captured’7or “entrapped”) to said capture moiety; and labeling the captured product with a label moiety, where the labeled cells are not lysed as part of the labeling procedure or as part of the separation procedure. The capture moiety may incorporate detection of cell surfaceglycoproteins CD3 or CD4 to refine the enrichment step and increase the proportion of antigenspecific T cells in general, of CD4+ T cells in specific.Antiviral Treatment Interruption (ATI)

[0214] In certain embodiments, cell therapy using AGT103 is used in combination with antiviral therapeutic agents for the treatment of HIV. The combination therapy can be used to reduce time to undetectable viral load levels after an antiviral treatment interruption.

[0215] In some embodiments, a subject is administered cells transduced with AGT103 as described in the examples. Following administration of the transduced cells the subject either starts or resumes antiviral treatment. After a first period of time, the subject ceases the antiviral therapy and HIV viral load increases. After a second period of time, the subject resumes antiviral treatment. While, not being bound to any particular theory’, when the viral load increases, CD4+ T cells transduced with AGT103 are exposed to the HIV virus causing an increase in CD8 T cells which then reduce viral load. As detailed in the Examples, it was that in subjects who were administered AGT103 the reduction in viral load to undetectable levels was faster than subjects not administered AGT103.

[0216] In some embodiments, the time period between administration of AGT103 and start of ATI is at least about 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks. 22 weeks, 23 weeks or 24 weeks. In some embodiments, the time period between administration of AGT103 and start of ATI is at least about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, or 24 months.

[0217] In some embodiments, the time period between stopping ani viral treatment and resuming antiviral treatment is at least about 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks or 24 weeks. In some embodiments, the time period between stopping aniviral treatment and resuming antiviral treatment is at least about 1 month, 2 months. 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 1 1 months, 12 months, 13 months, 14 months, 15months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, or 24 months.

[0218] In some embodiments, the antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof. In some embodiments, the antiviral treatment is any therapeutic agent listed in Table 1. In some embodiments, the antiviral treatment before ATI and after ATI is the same.

[0219] In some embodiments the viral load increase at least about 1.000 viral load copies / ml, 2,000 viral load copies / ml, 3,000 viral load copies / ml, 4,000 viral load copies / ml, 5,000 viral load copies / ml, 6,000 viral load copies / ml, 7,000 viral load copies / ml, 8,000 viral load copies / ml, 9,000 viral load copies / ml, 10,000 viral load copies / ml, 15,000 viral load copies / ml, 20,000 viral load copies / ml, 25.000 viral load copies / ml, 30,000 viral load copies / ml, 35,000 viral load copies / ml, 40,000 viral load copies / ml, 45,000 viral load copies / ml, 50,000 viral load copies / ml, 55,000 viral load copies / ml, 60,000 viral load copies / ml, 65,000 viral load copies / ml, 70,000 viral load copies / ml, 75,000 viral load copies / ml, 80,000 viral load copies / ml, 85,000 viral load copies / ml, 90,000 viral load copies / ml, 95,000 viral load copies / ml or 100,000 viral load copies / ml.Reduction of Side Effects of Antiviral Treatment

[0220] In certain embodiments, cell therapy using AGT103 is used in combination with antiviral therapeutic agents for the treatment of HIV. The combination therapy can be used to reduce side effects associated with antiviral treatment.

[0221] In certain embodiments, the side effects of antiviral treatment include depression, skin rash, discouragement, feeling sad or empty, irritability, lack of appetite, loss of interest or pleasure, thoughts of killing oneself, tiredness, trouble concentrating, trouble sleeping, diarrhea, nausea, headache, fatigue and stomach discomfort.

[0222] Reduction of Dosage of Antiviral Treatment

[0223] In certain embodiments, cell therapy using AGT103 is used in combination with antiviral therapeutic agents for the treatment of HIV. The combination therapy can be used to reduce the dosage of antiviral treatment.

[0224] In certain embodiments, the dosage of antiviral treatment is at least about 10 mg, 20 mg. 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg. 60 mg. 70 mg. 80 mg. 90 mg, 100 mg, 125mg, 150 mg, 175 mg, 200 mg, 225 mg, or 250 mg. In certain embodiments, the dosage of antiviral treatment is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40% 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%.

[0225] Reduction of Frequency of Antiviral Treatment

[0226] In certain embodiments, cell therapy using AGT103 is used in combination with antiviral therapeutic agents for the treatment of HIV. The combination therapy can be used to reduce the frequency of antiviral treatment.

[0227] In certain embodiments, the frequency of antiviral treatment is at least about once a day, twice a day, once a week, twice a week, once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every 8 months, once every79 months, once every710 months, once every711 months or once every 12 months.

[0228] The following examples are given to illustrate aspects of the present invention. It should be understood, however, that the invention is not to be limited to the specific conditions or details described in these examples. All printed publications referenced herein are specifically incorporated by reference.ExamplesExample 1: Development of a Lentiviral Vector System

[0229] A lentiviral vector system was developed as summarized in Figure 3 (linear form) and Figure 4 (circularized form). Referring first to the top portion of Figure 3, a representative therapeutic vector has been designed and produced with the following elements being from left to right: hybrid 5’ longterminal repeat (RSV / 5?LTR) (SEQ ID NOS: 34-35), Psi sequence (RNA packaging site) (SEQ ID NO: 36), RRE (Rev-response element) (SEQ ID NO: 37), cPPT (polypurine tract) (SEQ ID NO: 38), EF-la promoter (SEQ ID NO: 4), miR30CCR5 (SEQ ID NO: 1), miR21Vif (SEQ ID NO: 2), miR185Tat (SEQ ID NO: 3), Woodchuck Post- Transcriptional Regulatory Element (WPRE) (SEQ ID NOS: 32 or 80), and AU3 3’ LTR (SEQ ID NO: 39). The therapeutic vector detailed in Figure 3 is also referred to herein as AGT103.

[0230] Referring next to the middle portion of Figure 3, a helper plasmid has been designed and produced with the following elements being from left to right: CAG promoter (SEQ ID NO: 41); HIV component gag (SEQ ID NO: 43); HIV component pol (SEQ ID NO:44); HIV Int (SEQ ID NO: 45); HIV RRE (SEQ ID NO: 46); and HIV Rev (SEQ ID NO: 47).

[0231] Referring next to the lower portion of Figure 3, an envelope plasmid has been designed and produced with the following elements being from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 60) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 62).

[0232] Lentiviral particles were produced in 293T / 17 HEK cells (purchased from American Type Culture Collection, Manassas, VA) following transfection with the therapeutic vector, the envelope plasmid, and the helper plasmid (as shown in Figure 3). The transfection of 293T / 17 HEK cells, which produced functional viral particles, employed the reagent Poly(ethylenimine) (PEI) to increase the efficiency of plasmid DNA uptake. The plasmids and DNA were initially added separately in culture medium without serum in a ratio of 3: 1 (mass ratio of PEI to DNA). After 2-3 days, cell medium was collected and lentiviral particles were purified by high-speed centrifugation and / or filtration followed by anion-exchange chromatography. The concentration of lentiviral particles can be expressed in terms of transducing units / ml (TU / ml). The determination of TU was accomplished by measuring HIV p24 levels in culture fluids (p24 protein is incorporated into lentiviral particles), measuring the number of viral DNA copies per cell by quantitative PCR, or by infecting cells and using light (if the vectors encode luciferase or fluorescent protein markers).

[0233] As mentioned above, a 3-vector system (i.e., a 2-vector lentiviral packaging system) was designed for the production of lentiviral particles. A schematic of the 3-vector system is shown in Figure 4. The schematic of Figure 4 is a circularized version of the linear system previously described in Figure 3. Briefly, and with reference to Figure 4, the top-most vector is a helper plasmid, which, in this case, includes Rev. The vector appearing in the middle of Figure 4 is the envelope plasmid. The bottom-most vector is the previously described therapeutic vector.

[0234] Referring more specifically to Figure 4, the Helper plus Rev plasmid includes a CAG enhancer (SEQ ID NO: 40); a CAG promoter (SEQ ID NO: 41); a chicken beta actin intron (SEQ ID NO: 42); a HIV gag (SEQ ID NO: 43); a HIV Pol (SEQ ID NO: 44); a HIV Int (SEQ ID NO: 45); a HIV RRE (SEQ ID NO: 46); a HIV Rev (SEQ ID NO: 47); and a rabbit beta globin poly A (SEQ ID NO: 48).

[0235] The Envelope plasmid includes a CMV promoter (SEQ ID NO: 60); a beta globin intron (SEQ ID NO: 61); a VSV-G (SEQ ID NO: 62); and a rabbit beta globin poly A (SEQ ID NO: 63).

[0236] In an alternate vector system, and with respect to Figure 6, the vector sequences are provided herein as SEQ ID NOs: 105-107.

[0237] Synthesis of a 2-vector lentiviral packaging system including Helper (plus Rev) and Envelope plasmids.

[0238] Materials and Methods:

[0239] Construction of the helper plasmid: The helper plasmid was constructed by initialPCR amplification of a DNA fragment from the pNL4-3 HIV plasmid (NIH Aids Reagent Program) containing Gag, Pol, and Integrase genes. Primers were designed to amplify the fragment with EcoRI and Notl restriction sites which could be used to insert at the same sites in the pCDNA3 plasmid (Invitrogen). The forward primer was (5’-TAAGCAGAATTC ATGAATTTGCCAGGAAGAT-3 ) (SEQ ID NO: 81) and reverse primer was (5'- CCATACAATGAATGGACACTAGGCGGCCGCACGAAT-3 ) (SEQ ID NO: 82). The sequence for the Gag, Pol, Integrase fragment was as follows:GAATTCATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGA GGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGCGGACATA AAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAA TCTGTTGACTCAGATTGGCTGCACTTTAAATTTTCCCATTAGTCCTATTGAGACTGT ACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTG ACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAA GGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCAT AAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAAT AAGAGAACTCAAGATTTCTGGGAAGTTCAATTAGGAATACCACATCCTGCAGGGT TAAAACAGAAAAAATCAGTAACAGTACTGGATGTGGGCGATGCATATTTTTCAGT TCCCTTAGATAAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACA ATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGG ATCACCAGCAATATTCCAGTGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAA CAAAATCCAGACATAGTCATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTG AGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTT GGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCC AGAAAAGGACAGCTGGACTGTCAATGACATACAGAAATTAGTGGGAAAATTGAAT TGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAGGCAATTATGTAAACTTCTTA GGGGAACCAAAGCACTAACAGAAGTAGTACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGGGAGATTCTAAAAGAACCGGTACATGGAGTGTATTATGA CCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGAC ATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGA ATGAAGGGTGCCCACACTAATGATGTGAAACAATTAACAGAGGCAGTACAAAAA ATAGCCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAATTACCCA TACAAAAGGAAACATGGGAAGCATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAGTTATGGTACCAGTTA GAGAAAGAACCCATAATAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCCAATAGGGAAACTAAATTAGGAAAAGCAGGATATGTAACTGACAGAGGAAGACAAAAAG TTGTCCCCCTAACGGACACAACAAATCAGAAGACTGAGTTACAAGCAATTCATCT AGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTGACAGACTCACAATATGCATTGGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAGTCAAA TAATAGAGCAGTTAATAAAAAAGGAAAAAGTCTACCTGGCATGGGTACCAGCACA CAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTGGTCAGTGCTGGAATCAG GAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGAAGAACATGAGAAATAT CACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTACCACCTGTAGTAGCAA AAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGCCCAGGAATATGGCAGCTAGATTGTACACATTTAGAAGGA AAAGTTATCTTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTAA TTCCAGCAGAGACAGGGCAAGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAGTACATACAGACAATGGCAGCAATTTCACCAGTACTACA GTTAAGGC CGC CTGTTGGTGGGC GGGGATC AAGC AGGAATTTGGC ATTCC CTAC A ATCCCCAAAGTCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTAT AGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGT ATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAGTTTG GAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGA TAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATCAGGGATTAT GGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAA (SEQ ID NO: 83)

[0240] Next, a DNA fragment containing the Rev, RRE, and rabbit beta globin poly A sequence with Xbal and Xmal flanking restriction sites was synthesized by MWG Operon. The DNA fragment was then inserted into the plasmid at the Xbal and Xmal restriction sites The DNA sequence was as follows:TCTAGAATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTC AGACTCATCAAGCTTCTCTATCAAAGCAACCCACCTCCCAATCCCGAGGGGACCC GACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATC CATTCGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGT GCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTAC AATATTGGAGTCAGGAGCTAAAGAATAGAGGAGCTTTGTTCCTTGGGTTCTTGGG AGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAG ACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAA GAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTAGATCTTTTTCCC TCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTA ATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTGGTT TAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGAACAAAGGTGGCTATAA AGAGGTCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAA AGCCTTGACTTGAGGTTAGATTTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTCTCCTGA CTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGAAGATCCCTCGACCTGCAGCCC AAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCA CAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCC ATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAG CTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCT AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTT CACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAA TGTATCTTATCAGCGGCCGCCCCGGG (SEQ ID NO: 84)

[0241] Finally, the CMV promoter of pCDNA3.1 was replaced with the CAG enhancer / promoter plus a chicken beta actin intron sequence. A DNA fragment containing the CAG enhancer / promoter / intron sequence with Mlul and EcoRI flanking restriction sites was synthesized by MWG Operon. The DNA fragment was then inserted into the plasmid at the Mlul and EcoRI restriction sites. The DNA sequence was as follows:ACGCGTTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATA TGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAAC GACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGG GACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAG T AC ATC AAGTGT ATC AT ATGC C A AGT AC GC C C CCT ATTGAC GTC AATGAC GGTA AA TGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCA GTACATCTACGTATTAGTCATCGCTATTACCATGGGTCGAGGTGAGCCCCACGTTC TGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTT TTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCG GGGC GGGGC GGGGC GAGGGGC GGGGC GGGGCGAGGC GGAGAGGTGC GGCGGC A GCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGC GGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGTTGCCTTC GCCCCGTGCCCCGCTCCGCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCG CGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAG CGCTTGGTTTAATGACGGCTCGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTAAAGG GCTCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTG TGTGTGCGTGGGGAGCGCCGCGTGCGGCCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCGTGTGCGCGAGGGGAGCGCGGCC GGGGGCGGTGCCCCGCGGTGCGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGC GGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGGCGGTCGGGCTGTGGGGCTCCGTGCGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCG GCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGG GGAGGGGCGCGGCGGCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGC AGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCA AATCTGGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCG GGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGC GTCGCCGCGCCGCCGTCCCCTTCTCCATCTCCAGCCTCGGGGCTGCCGCAGGGGGA CGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACC GGCGGGAATTC (SEQ ID NO: 85)

[0242] Construction of the VSV-G Envelope plasmid:

[0243] The vesicular stomatitis Indiana virus glycoprotein (VSV-G) sequence was synthesized by MWG Operon with flanking EcoRI restriction sites. The DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the EcoRI restriction site and the correct orientation was determined by sequencing using a CMV specific primer. The DNA sequence was as follows:GAATTCATGAAGTGCCTTTTGTACTTAGCCTTTTTATTCATTGGGGTGAATTGCAAG TTCACCATAGTTTTTCCACACAACCAAAAAGGAAACTGGAAAAATGTTCCTTCTAA TTACCATTATTGCCCGTCAAGCTCAGATTTAAATTGGCATAATGACTTAATAGGCA CAGCCTTACAAGTCAAAATGCCCAAGAGTCACAAGGCTATTCAAGCAGACGGTTG GATGTGTCATGCTTCCAAATGGGTCACTACTTGTGATTTCCGCTGGTATGGACCGA AGTATATAACACATTCCATCCGATCCTTCACTCCATCTGTAGAACAATGCAAGGAA AGCATTGAACAAACGAAACAAGGAACTTGGCTGAATCCAGGCTTCCCTCCTCAAA GTTGTGGATATGCAACTGTGACGGATGCCGAAGCAGTGATTGTCCAGGTGACTCCT CACCATGTGCTGGTTGATGAATACACAGGAGAATGGGTTGATTCACAGTTCATCA ACGGAAAATGCAGCAATTACATATGCCCCACTGTCCATAACTCTACAACCTGGCAT TCTGACTATAAGGTCAAAGGGCTATGTGATTCTAACCTCATTTCCATGGACATCAC CTTCTTCTCAGAGGACGGAGAGCTATCATCCCTGGGAAAGGAGGGCACAGGGTTC AGAAGTAACTACTTTGCTTATGAAACTGGAGGCAAGGCCTGCAAAATGCAATACT GCAAGCATTGGGGAGTCAGACTCCCATCAGGTGTCTGGTTCGAGATGGCTGATAA GGATCTCTTTGCTGCAGCCAGATTCCCTGAATGCCCAGAAGGGTCAAGTATCTCTG CTCCATCTCAGACCTCAGTGGATGTAAGTCTAATTCAGGACGTTGAGAGGATCTTGGATTATTCCCTCTGCCAAGAAACCTGGAGCAAAATCAGAGCGGGTCTTCCAATCTC TCCAGTGGATCTCAGCTATCTTGCTCCTAAAAACCCAGGAACCGGTCCTGCTTTCA CCATAATCAATGGTACCCTAAAATACTTTGAGACCAGATACATCAGAGTCGATATT GCTGCTCCAATCCTCTCAAGAATGGTCGGAATGATCAGTGGAACTACCACAGAAA GGGAACTGTGGGATGACTGGGCACCATATGAAGACGTGGAAATTGGACCCAATGG AGTTCTGAGGACCAGTTCAGGATATAAGTTTCCTTTATACATGATTGGACATGGTA TGTTGGACTCCGATCTTCATCTTAGCTCAAAGGCTCAGGTGTTCGAACATCCTCAC ATTCAAGACGCTGCTTCGCAACTTCCTGATGATGAGAGTTTATTTTTTGGTGATACT GGGCTATCCAAAAATCCAATCGAGCTTGTAGAAGGTTGGTTCAGTAGTTGGAAAA GCTCTATTGCCTCTTTTTTCTTTATCATAGGGTTAATCATTGGACTATTCTTGGTTCT CCGAGTTGGTATCCATCTTTGCATTAAATTAAAGCACACCAAGAAAAGACAGATTT ATACAGACATAGAGATGAGAATTC (SEQ ID NO: 86)

[0244] A 4-vector system (i.e., a 3-vector lentiviral packaging system) has also been designed and produced using the methods and materials described herein. A schematic of the 4- vector system is shown in Figure 5. Briefly, and with reference to Figure 5, the top-most vector is a helper plasmid, which, in this case, does not include Rev. The vector second from the top is a separate Rev plasmid. The vector second from the bottom is the envelope plasmid. The bottommost vector is the previously described therapeutic vector.

[0245] Referring, in part, to Figure 5, the Helper plasmid includes a CAG enhancer (SEQ ID NO: 49); a CAG promoter (SEQ ID NO: 50); a chicken beta actin intron (SEQ ID NO: 51); a HIV gag (SEQ ID NO: 52); a HIV Pol (SEQ ID NO: 53); a HIV Int (SEQ ID NO: 54); a HIV RRE (SEQ ID NO: 55); and a rabbit beta globin poly A (SEQ ID NO: 56).

[0246] The Rev plasmid includes a RSV promoter (SEQ ID NO: 57); a HIV Rev (SEQ ID NO: 58); and a rabbit beta globin poly A (SEQ ID NO: 59).

[0247] The Envelope plasmid includes a CMV promoter (SEQ ID NO: 60); a beta globin intron (SEQ ID NO: 61); a VSV-G (SEQ ID NO: 62); and a rabbit beta globin poly A (SEQ ID NO: 63).

[0248] Synthesis of a 3-vector lentiviral packaging system including Helper, Rev. and Envelope plasmids.

[0249] Materials and Methods:

[0250] Construction of the Helper plasmid without Rev:

[0251] The Helper plasmid without Rev was constructed by inserting a DNA fragment containing the RRE and rabbit beta globin poly A sequence. This sequence was synthesized by MWG Operon with flanking Xbal and Xmal restriction sites. The RRE / rabbit poly A beta globin sequence was then inserted into the Helper plasmid at the Xbal and Xmal restriction sites. The DNA sequence is as follows:TCTAGAAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGC GCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGC AGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACT CACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATAC CTAAAGGATCAACAGCTCCTAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACAT CATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTG CAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCA AATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCAT ATGCTGGCTGCCATGAACAAAGGTGGCTATAAAGAGGTCATCAGTATATGAAACA GCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATTTT TTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACAT GTTTTACTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCT CTTCTCTTATGAAGATCCCTCGACCTGCAGCCCAAGCTTGGCGTAATCATGGTCAT AGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCC GGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAA TTGCGTTGC GCTC ACTGC CC GCTTTC C AGTC GGGAAACCTGTC GTGCC AGC GGATC CGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCC CTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATT TATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAG GCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTAACTTGTTTATTGCAGCTTATA ATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCA CTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCACCCGGG (SEQ ID NO: 87)

[0252] Construction of the Rev plasmid:

[0253] The RSV promoter and HIV Rev sequence was synthesized as a single DNAfragment by MWG Operon with flanking Mfel and Xbal restriction sites. The DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the Mfel and Xbal restriction sites in which the CMV promoter is replaced with the RSV promoter. The DNA sequence was as follows:CAATTGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTT AGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGT AGTTTCGCTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACACTTGTAGT CTTGC AAC ATGGTAAC GATGAGTTAGC AAC ATGC CTTAC AAGGAGAGAAAAAGC A CCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGG CAACAGACAGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAGA TAATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCCATTTGACCATTCACCAC ATTGGTGTGCACCTCCAAGCTCGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAG ACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCC CCTCGAAGCTAGCGATTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGAC GAAGAACTCCTCAAGGCAGTCAGACTCATCAAGTTTCTCTATCAAAGCAACCCAC CTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGA GAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTAGCACTTATCT GGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTC TTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCA AATATTGGTGGAATCTCCTACAATATTGGAGTCAGGAGCTAAAGAATAGTCTAGA (SEQ ID NO: 88)

[0254] The plasmids for the 2-vector and 3-vector packaging systems could be modified with similar elements and the intron sequences could potentially be removed without loss of vector function. For example, the following elements could replace similar elements in the 2- vector and 3-vector packaging system:

[0255] Promoters: Elongation Factor-1 (EF-1) (SEQ ID NO: 64), phosphoglycerate kinase (PGK) (SEQ ID NO: 65), and ubiquitin C (UbC) (SEQ ID NO: 66) can replace the CMV (SEQ ID NO: 60) or CAG promoter (SEQ ID NO: 100). These sequences can also be further varied by addition, substitution, deletion or mutation.

[0256] Poly A sequences: SV40 poly A (SEQ ID NO: 67) and bGH poly A (SEQ ID NO: 68) can replace the rabbit beta globin poly A (SEQ ID NO: 48). These sequences can alsobe further varied by addition, substitution, deletion or mutation.

[0257] HIV Gag, Pol, and Integrase sequences: The HIV sequences in the Helper plasmid can be constructed from different HIV strains or clades. For example, HIV Gag (SEQ ID NO: 69); HIV Pol (SEQ ID NO: 70); and HIV Int (SEQ ID NO: 71) from the Bal strain can be interchanged with the gag, pol, and int sequences contained in the helper / helper plus Rev plasmids as outlined herein. These sequences can also be further varied by addition, substitution, deletion or mutation.

[0258] Envelope: The VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114) (SEQ ID NO: 72), gibbon ape leukemia virus (GALV) (SEQ ID NO: 73), Rabies (FUG) (SEQ ID NO: 74), lymphocytic choriomeningitis virus (LCMV) (SEQ ID NO: 75), influenza A fowl plague vims (FPV) (SEQ ID NO: 76), Ross River alphavirus (RRV) (SEQ ID NO: 77), murine leukemia virus 10A1 (MLV) (SEQ ID NO: 78), or Ebola vims (EboV) (SEQ ID NO: 79). Sequences for these envelopes are identified in the sequence portion herein. Further, these sequences can also be further varied by addition, substitution, deletion or mutation.

[0259] In summary7, the 3-vector versus 4-vector systems can be compared and contrasted, in part, as follows. The 3-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, Integrase, and Rev / Tat; 2. Envelope plasmid: VSV-G / FUG envelope; and 3. Therapeutic vector: RSV 5’LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3’delta LTR. The 4-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, and Integrase; 2. Rev plasmid: Rev; 3. Envelope plasmid: VSV-G / FUG envelope; and 4. Therapeutic vector: RSV 5’LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3’delta LTR. Sequences corresponding with the above elements are identified in the sequence listings portion herein.Example 2: Development of an Anti-HIV Lentivirus Vector

[0260] The purpose of this example was to develop an anti -HIV lentivims vector.

[0261] Inhibitory RNA Designs. The sequence of Homo sapiens chemokine C-C motif receptor 5 (CCR5) (GC03P046377) mRNA was used to search for potential siRNA or shRNA candidates to knockdown CCR5 levels in human cells. Potential RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from theBroad Institute or the BLOCK-iT RNAi Designer from Thermo Scientific. Individual selected shRNA sequences were inserted into lenti viral vectors immediately 3’ to a RNA polymerase III promoter such as Hl, U6, or 7SK to regulate shRNA expression. These lentivirus-shRNA constructs were used to transduce cells and measure the change in specific mRNA levels. The shRNA most potent for reducing mRNA levels were embedded individually within a microRNA backbone to allow for expression by either the CMV or EF-1 alpha RNA polymerase II promoters. The microRNA backbone was selected from mirbase.org. RNA sequences were also synthesized as synthetic siRNA oligonucleotides and introduced directly into cells without using a lentiviral vector.

[0262] The genomic sequence of Bal strain of human immunodeficiency virus type 1 (HIV-1 85US_ BaL, accession number AY713409) was used to search for potential siRNA or shRNA candidates to knockdown HIV replication levels in human cells. Based on sequence homologj' and experience, the search focused on regions of the Tat and Vif genes of HIV although an individual of skill in the art will understand that use of these regions is non-limiting and other potential targets might be selected. Importantly, highly conserved regions of gag or pol genes could not be targeted by shRNA because these same sequences were present in the packaging system complementation plasmids needed for vector manufacturing. As with the CCR5 (NM 000579.3, NM 001100168.1 -specific) RNAs, potential HIV-specific RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Gene-E Software Suite hosted by the Broad Institute (broadinstitute.org / mai / public) or the BLOCK-iT RNAi Designer from Thermo Scientific (madesigner. thermofisher. com / maiexpress / setOption. do? designOption=shma&pid=67126273 60706061801). Individual selected shRNA sequences were inserted into lentiviral vectors immediately 3’ to a RNA polymerase III promoter such as Hl, U6, or 7SK to regulate shRNA expression. These lentivirus-shRNA constructs were used to transduce cells and measure the change in specific mRNA levels. The shRNA most potent for reducing mRNA levels were embedded individually w ithin a microRNA backbone to allow for expression by either the CMV or EF-lalpha RNA polymerase II promoters.

[0263] Vector Constructions. For CCR5, Tat or Vif shRNA, oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by Eurofins MWG Operon, LLC. Overlapping sense and antisense oligonucleotide sequences were mixed and annealedduring cooling from 70 degrees Celsius to room temperature. The lenti viral vector was digested with the restriction enzy mes BamHI and EcoRI for one hour at 37 degrees Celsius. The digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Invitrogen. The DNA concentrations were determined and vector to oligo (3: 1 ratio) were mixed, allowed to anneal, and ligated. The ligation reaction was performed with T4 DNA ligase for 30 minutes at room temperature. 2.5 microliters of the ligation mix were added to 25 microliters of STBL3 competent bacterial cells. Transformation was achieved after heat-shock at 42 degrees Celsius. Bacterial cells were spread on agar plates containing ampicillin and drug-resistant colonies (indicating the presence of ampicillin- resistance plasmids) were recovered, purified and expanded in LB broth. To check for insertion of the oligo sequences, plasmid DNA were extracted from harvested bacteria cultures with the Invitrogen DNA mini prep kit. Insertion of the shRNA sequence in the lentiviral vector was verified by DNA sequencing using a specific primer for the promoter used to regulate shRNA expression. Exemplary' vector sequences that were determined to restrict HIV replication can be found in Figure 7. For example, the shRNA sequences with the highest activity' against CCR5, Tat or Vif gene expression were then assembled into a microRNA (miR) cluster under control of the EF-lalpha promoter. The promoter and miR sequences are depicted in Figure 7.

[0264] Further, and using standard molecular biology techniques (e.g., Sambrook; Molecular Cloning: A Laboratory Manual, 4thEd.) as well as the techniques described herein, a series of lentiviral vectors have been developed as depicted in Figure 8 herein.

[0265] Vector 1 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a Hl element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24-Y); a posttranscriptional regulatory7element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0266] Vector 2 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a Hl element (SEQ ID NO: 101); a shRev / Tat (SEQ ID NO: 10); a Hl element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0267] Vector 3 was developed and contains, from left to right: a long terminal repeat(LTR) portion (SEQ ID NO: 35); a Hl element (SEQ ID NO: 101): a shGag (SEQ ID NO: 12);a Hl element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24); a posttranscriptional regulatory' element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0268] Vector 4 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a 7SK element (SEQ ID NO: 103); a shRev / Tat (SEQ ID NO: 10); a Hl element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0269] Vector 5 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0270] Vector 6 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR155Tat (SEQ ID NO: 104); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0271] Vector 7 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0272] Vector 8 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); and a long terminal repeat portion (SEQ ID NO: 102).

[0273] Vector 9 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a CD4 element (SEQ ID NO: 30); miR30CCR5 (SEQ ID NO: 1); miR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a posttranscriptional regulatoryelement of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).Development of Vectors

[0274] It should be noted that not all vectors developed for these experiments necessarily worked as might be predicted. More specifically, a lentivirus vector against HIV might include three main components: 1) inhibitory RNA to reduce the level of HIV binding proteins (receptors) on the target cell surface to block initial virus attachment and penetration; 2) overexpression of the HIV TAR sequence that will sequester viral Tat protein and decrease its ability to transactivate viral gene expression; and 3) inhibitory RNA that attack important and conserved sequences within the HIV genome.

[0275] With respect to the first point above, a key cell surface HIV binding protein is the chemokine receptor CCR5. HIV particles attach to susceptible T cells by binding to the CD4 and CCR5 cell surface proteins. Because CD4 is an essential glycoprotein on the cell surface that is important for the immunological function of T cells, this was not chosen as a target to manipulate its expression levels. However, people bom homozygous for null mutations in the CCR5 gene and completely lacking receptor expression, live normal lives save for enhanced susceptibility' to a few infectious diseases and the possibility of developing rare autoimmunity. Thus, modulating CCR5 was determined to be a relatively safe approach and was a primary target in the development of anti-HIV lentivirus vectors.

[0276] With respect to the second point above, the viral TAR sequence is a highly structured region of HIV genomic RNA that binds tightly to viral Tat protein. The Tat: TAR complex is important for efficient generation of viral RNA. Over-expression of the TAR region was envisioned as a decoy molecule that would sequester Tat protein and decrease the levels of viral RNA. However, TAR proved toxic to most mammalian cells including cells used for manufacturing lentivirus particles. Further, TAR was inefficient for inhibiting viral gene expression in other laboratories and has been discarded as a viable component in HIV gene therapy.

[0277] In various embodiments, viral gene sequences have been identified that meet 3 criteria: i) Sequences that are reasonably conserved across a range of HIV isolates representative of the epidemic in a geographic region of interest; ii) reduction in RNA levels due to the activityof an inhibitor^' RNA in a viral vector will reduce the corresponding protein levels by an amount sufficient to meaningfully reduce HIV replication; and iii) the viral gene sequence(s) targeted by inhibitory RNA are not present in the genes required for packaging and assembling viral vector particles during manufacturing. In various embodiments, a sequence at the junction of HIV Tat and Rev genes and a second sequence within the HIV Vif gene have been targeted by inhibitory RNA. The Tat / Rev targeting has an additional benefit of reducing HIV envelope glycoprotein expression because this region overlaps with the envelope gene in the HIV genome.

[0278] Various methods for vector development and testing relies first on identifying suitable targets (as described herein) followed by constructing plasmid DNAs expressing individual or multiple inhibitory RNA species for testing in cell models, and finally constructing lentivirus vectors containing inhibitory RNA with proven anti-HIV function. The lentivirus vectors are tested for toxicity, yield during in vitro production, and effectiveness against HIV in terms of reducing CCR5 expression levels or lowering viral gene products to inhibit virus replication.

[0279] Table 2 below demonstrates progression through multiple versions of inhibitory constructs until arriving at a clinical candidate. Initially, shRNA (short homology RNA) molecules were designed and expressed from plasmid DNA constructs.

[0280] Plasmids 1-4, as detailed in Table 3 below, tested shRNA sequences against Gag, Pol and RT genes of HIV. While each shRNA was active for suppressing viral protein expression in a cell model, there were two important problems that prevented further development. First, the sequences were targeted to a laboratory isolate of HIV that was not representative of Clade B HIV strains currently circulating in North America and Europe. Second, these shRNA targeted critical components in the lentivirus vector packaging system and would severely reduce vector yield during manufacturing. Plasmid 5, as detailed in Table 3, was selected to target CCR5 and provided a lead candidate sequence. Plasmids 6, 7, 8, 9, 10, and 11, as detailed in Table 3, incorporated the TAR sequence and it was found they produced unacceptable toxicity for mammalian cells including cells used for lentivirus vector manufacturing. Plasmid 2, as detailed in Table 2, identified a lead shRNA sequence capable of reducing Tat RNA expression. Plasmid 12, as detailed in Table 3, demonstrated the effectiveness of shCCR5 expressed as a microRNA (miR) in a lentiviral vector and confirmed it should be in the final product. Plasmid 13, as detailed in Table 3, demonstrated the effectiveness of a shVif expressed as a microRNA (miR)in a lentiviral vector and confirmed it should be in the final product. Plasmid 14, as detailed in Table 3, demonstrated the effectiveness of shTat expressed as a microRNA (miR) in a lentiviral vector and confirmed it should be in the final product. Plasmid 15, as detailed in Table 3, contained the miR CCR5, miR Tat and miR Vif in the form of a miR cluster expressed from a single promoter. These miR do not target critical components in the lentivirus vector packaging system and proved to have negligible toxicity for mammalian cells. The miRs within the cluster were equally effective to individual miR that were tested previously, and the overall impact was a substantial reduction in replication of a CCR5-tropic HIV BaL strain.Table 3: Development of HIV Vectors

[0281] Functional Assays. Individual lentivirus vectors containing CCR5, Tat or Vif shRNA sequences and, for experimental purposes, expressing green fluorescent protein (GFP) under control of the CMV Immediate Early Promoter, and designated AGT 103 / C MV-GFP were tested for their ability to knockdown CCR5, Tat or Vif expression. Mammalian cells were transduced with lentiviral particles either in the presence or absence of polybrene. Cells were collected after 2-4 days; protein and RNA were analyzed for CCR5, Tat or Vif expression. Protein levels were tested by Western blot assay or by labeling cells with specific fluorescent antibodies (CCR5 assay), followed by analytical flow cytometry comparing modified and unmodified cell fluorescence using either the CCR5-specific or isotype control antibodies.

[0282] Starting Testing of Lentivirus. T cell culture medium was made using RPMI 1640 supplemented with 10% FBS and 1% penicillin-streptomycin. Cytokine stocks of IL-2 10,000 units / ml, IL-12 Ipg / ml, IL-7 Ipg / ml, IL-15 Ipg / ml were also prepared in advance.

[0283] Prior to transduction with the lentivirus, an infectious viral titer was determined and used to calculate the amount of virus to add for the proper multiplicity of infection (MOI).

[0284] Day 0-12: Antigen-specific enrichment. On day 0, cryopreserved PBMC were thawed, washed with 10 ml 37°C medium at 1200 rpm for 10 minutes and resuspended at a concentration of 2xl06 / ml in 37 C medium. The cells were cultured at 0.5 ml / well in a 24-well plate at 37 C in 5% CO2. To define the optimal stimulation conditions, cells were stimulated with combinations of reagents as listed in Table 4 below:Table 4

[0285] Final concentrations: IL-2=20 units / ml, IL-12=10 ng / ml, IL-7=10 ng / ml, IL- 15=10 ng / ml, peptides=5 pg / ml individual peptide, MVA MOI=1.

[0286] On days 4 and 8, 0.5 ml fresh medium and cytokine at listed concentrations (all concentrations indicate the final concentration in the culture) were added to the stimulated cells.

[0287] Day 12-24: non-specific expansion and lentivirus transduction. On day 12, the stimulated cells were removed from the plate by pipetting and resuspended in fresh T cell culture medium at a concentration of lxl06 / ml. The resuspended cells were transferred to T25 culture flasks and stimulated with DYNABEADS® Human T-Activator CD3 / CD28 following the manufacturer’s instruction plus cytokine as listed above; flasks were incubated in the vertical position.

[0288] On day 14, AGT103 / CMV-GFP was added at MOI 20 and cultures were returned to the incubator for 2 days. At this time, cells were recovered by pipetting, collected by centrifugation at 1300 rpm for 10 minutes, resuspended in the same volume of fresh medium, and centrifuged again to form a loose cell pellet. That cell pellet was resuspended in fresh medium with the same cytokines used in previous steps, with cells at 0.5x106viable cells per ml.

[0289] From days 14 to 23, the number of the cells was evaluated every 2 days and the cells were diluted to 0.5 x 106 / ml with fresh media. Cytokines were added every time.

[0290] On day 24, the cells were collected and the beads were removed from the cells. To remove the beads, cells were transferred to a suitable tube that was placed in the sorting magnet for 2 minutes. Supernatant containing the cells was transferred to a new tube. Cells were then cultured for 1 day in fresh medium at lxl06 / ml. Assays were performed to determine the frequencies of antigen-specific T cells and lentivirus transduced cells.

[0291] To prevent possible viral outgrowth, amprenavir (0.5 ng / ml) was added to the cultures on the first day of stimulation and every other day during the culture.

[0292] Examine antigen-specific T cells by intracellular cytokine staining for IFN- gamma. Cultured cells after peptide stimulation or after lentivirus transduction at 1x106cells / ml were stimulated with medium alone (negative control), Gag peptides (5pg / ml individual peptide), or PHA (5pg / ml, positive control). After 4 hours, BD GolgiPlug™ (1 : 1000, BD Biosciences) was added to block Golgi transport. After 8 hours, cells were washed and stained with extracellular (CD3, CD4 or CD8; BD Biosciences) and intracellular (IFN- gamma; BDBiosciences) antibodies with BD Cytofix / Cy toperm™ kit following the manufacturer’s instruction. Samples were analyzed on a BD FACSCalibur™ Flow Cytometer. Control samples labeled with appropriate isotype-matched antibodies were included in each experiment. Data were analyzed using Flowjo software.

[0293] Lentivirus transduction rate was determined by the frequency of GFP+ cells. The transduced antigen-specific T cells are determined by the frequency of CD3+CD4+GFP+IFN gamma + cells; tests for CD3+CD8+GFP+IFN gamma + cells are included as a control.

[0294] These results indicate that CD4 T cells, the target T cell population, can be transduced with lentiviruses that are designed to specifically knock down the expression of HIV - specific proteins, thus producing an expandable population of T cells that are immune to the virus. This example serves as a proof of concept indicating that the disclosed lentiviral constructs can be used in combination with vaccination to produce a functional cure in HIV patients.Example 4: CCR5 Knockdown with Experimental Vectors

[0295] AGTcl20 is a Hela cell line that stably expresses large amounts of CD4 and CCR5. AGTcl20 was transduced with or without LV-CMV-mCherry (the red fluorescent protein mCherry expressed under control of the CMV Immediate Early Promoter) or AGT103 / CMV-mCherry. Gene expression of the mCherry fluorescent protein was controlled by a CMV (cytomegalovirus immediate early promoter) expression cassette. The LV-CMV- mCherry vector lacked a microRNA cluster, while AGT103 / CMV-mCherry expressed therapeutic miRNA against CCR5, Vif, and Tat.

[0296] As shown in Figure 9A, transduction efficiency was >90%. After 7 days, cells were collected and stained with fluorescent monoclonal antibody against CCR5 and subjected to analytical flow cytometry. Isotype controls are shown in gray on these histograms plotting Mean Fluorescence Intensity of CCR5 APC (x axis) versus cell number normalized to mode (y axis). After staining for cell surface CCR5, cells treated with no lentivirus or control lentivirus (expressing only the mCherry marker) showed no changes in CCR5 density while AGT103 (right section) reduced CCR5 staining intensity to nearly the levels of isotype control. After 7 days, cells were infected with or without R5-tropic HIV reporter virus Bal-GFP. 3 days later, cells were collected and analyzed by flow cytometry. More than 90% of cells were transduced.AGT103-CMV / CMVmCherry reduced CCR5 expression in transduced AGTcl20 cells and blocked R5-tropic HIV infection compared with cells treated with the Control vector.

[0297] Figure 9B shows the relative insensitivity of transfected AGTcl20 cells to infection with HIV. As above, the lentivirus vectors express mCherry protein and a transduced cell that was also infected with HIV (expressing GFP) would appear as a double positive cell in the upper right quadrant of the false color flow cytometry dot plots. In the absence of HIV (upper panels), there were no GFP+ cells under any condition. After HIV infection (lower panels), 56% of cells were infected in the absence of lentivirus transduction and 53.6% of cells became infected in AGTcl20 cells transduced with the LV-CMV -mCherry. When cells were transduced with the therapeutic AGT 103 / CMV -mCherry vector, only 0.83% of cells appeared in the double positive quadrant indicating they were transduced and infected.

[0298] Dividing 53.62 (proportion of double positive cells with control vector) by 0.83 (the proportion of double positive cells with the therapeutic vector) show s that AGT103 provided greater than 65-fold protection against HIV in this experimental system.Example 5: Regulation of CCR5 Expression by shRNA Inhibitor Sequences in a Lentiviral Vector

[0299] Inhibitory RNA Design. The sequence of Homo sapiens chemokine receptor CCR5 (CCR5, NC 000003.12) was used to search for potential siRNA or shRNA candidates to knockdown CCR5 levels in human cells. Potential RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-IT RNA iDesigner from Thermo Scientific. A shRNA sequence may be inserted into a plasmid immediately after a RNA polymerase III promoter such as Hl, U6, or 7SK to regulate shRNA expression. The shRNA sequence may also be inserted into a lentiviral vector using similar promoters or embedded within a microRNA backbone to allow7for expression by an RNA polymerase II promoter such as CMV or EF-1 alpha. The RNA sequence may also be synthesized as a siRNA oligonucleotide and utilized independently of a plasmid or lentiviral vector.

[0300] Plasmid Construction. For CCR5 shRNA, oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by MWG Operon. Oligonucleotide sequences were annealed by incubating at 70°C then cooled to room temperature. Annealedoligonucleotides were digested with the restriction enzymes BamHI and EcoRI for one hour at 37°C, then the enzymes were inactivated at 70°C for 20 minutes. In parallel, plasmid DNA was digested with the restriction enzymes BamHI and EcoRI for one hour at 37°C. The digested plasmid DNA was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Invitrogen. The DNA concentration was determined and the plasma to oligonucleotide sequence was ligated in the ratio 3: 1 insert to vector. The ligation reaction was done with T4 DNA ligase for 30 minutes at room temperature. 2.5 pL of the ligation mix were added to 25 pL of STBL3 competent bacterial cells. Transformation required heat shock at 42°C. Bacterial cells were spread on agar plates containing ampicillin and colonies were expanded in L broth. To check for insertion of the oligo sequences, plasmid DNA was extracted from harvested bacterial cultures using the Invitrogen DNA Miniprep kit and tested by restriction enzyme digestion. Insertion of the shRNA sequence into the plasmid was verified by DNA sequencing using a primer specific for the promoter used to regulate shRNA expression.

[0301] Functional Assay for CCR5 mRNA Reduction'. The assay for inhibition of CCR5 expression required co-transfection of two plasmids. The first plasmid contains one of five different shRNA sequences directed against CCR5 mRNA. The second plasmid contains the cDNA sequence for human CCR5 gene. Plasmids were co-transfected into 293T cells. After 48 hours, cells were lysed and RNA was extracted using the RNeasy kit from Qiagen. cDNA was synthesized from RNA using a Super Script Kit from Invitrogen. The samples were then analyzed by quantitative RT-PCR using an Applied Biosystems Step One PCR machine. CCR5 expression was detected with SYBR Green from Invitrogen using the forward primer (5’- AGGAATTGATGGCGAGAAGG-3’) (SEQ ID NO: 93) and reverse primer (5 - CCCC AAAGAAGGTC AAGGTAATC A-3’) (SEQ ID NO: 94) with standard conditions for polymerase chain reaction analysis. The samples were normalized to the mRNA for beta actin gene expression using the forward primer (5’-AGCGCGGCTACAGCTTCA-3’) (SEQ ID NO: 95) and reverse primer (5’-GGCGACGTAGCACAGCTTCT-3’) (SEQ ID NO: 96) with standard conditions for polymerase chain reaction analysis. The relative expression of CCR5 mRNA w as determined by its Ct value normalized to the level of actin messenger RNA for each sample. The results are shown in Figure 10.

[0302] As shown in Figure 10A, CCR5 knock-down was tested in 293T cells by cotransfection of the CCR5 shRNA construct and a CCR5-expressing plasmid. Control sampleswere transfected with a scrambled shRNA sequence that did not target any human gene and the CCR5-expressing plasmid. After 60 hours post-transfection, samples were harvested and CCR5 mRNA levels were measured by quantitative PCR. Further, as shown in Figure 10B, CCR5 knock-down after transduction with lentivirus expressing CCR5 shRNA-1 (SEQ ID NO: 16).Example 6: Regulation of HIV Components by shRNA Inhibitor Sequences in a Lentiviral Vector

[0303] Inhibitory RNA Design.

[0304] The sequences of HIV type 1 Rev / Tat (5 ’- GCGGAGACAGCGACGAAGAGC- 3 ) (SEQ ID NO: 9) and Gag (5 -GAAGAAATGATGACAGCAT-3 ) (SEQ ID NO: 11) were used to design:Rev / Tat:(5’GCGGAGACAGCGACGAAGAGCTTCAAGAGAGCTCTTCGTCGCTGTCTCCGCTTT TT-3’) (SEQ ID NO: 10) andGag:(5 GAAGAAATGATGACAGC ATTTCAAGAGAATGCTGTCATCATTTCTTCTTTTT-3' ) (SEQ ID NO: 12) shRNA that were synthesized and cloned into plasmids as described above.

[0305] Plasmid Construction. The Rev / Tat or Gag target sequences were inserted into the 3’UTR (untranslated region) of the firefly luciferase gene used commonly as a reporter of gene expression in cells or tissues. Additionally, one plasmid was constructed to express the Rev / Tat shRNA and a second plasmid was constructed to express the Gag shRNA. Plasmid constructions were as described above.

[0306] Functional assay for shRNA targeting of Rev / Tat or Gag mRNA'. Using plasmid co-transfection we tested whether a shRNA plasmid was capable of degrading luciferase messenger RNA and decreasing the intensity of light emission in co-transfected cells. A shRNA control (scrambled sequence) was used to establish the maximum yield of light from luciferase transfected cells. When the luciferase construct containing a Rev / Tat target sequence inserted into the 3’-UTR (untranslated region of the mRNA) was co-transfected with the Rev / Tat shRNA sequence there was nearly a 90% reduction in light emission indicating strong function of the shRNA sequence. A similar result was obtained when a luciferase construct containing a Gag target sequence in the 3’-UTR was co-transfected with the Gag shRNA sequence. These resultsindicate potent activity of the shRNA sequences.

[0307] As shown in Figure 11 A, knock-down of the Rev / Tat target gene was measured by a reduction of luciferase activity, which was fused with the target rnRNA sequence in the 3’UTR, by transient transfection in 293T cells. As shown in Figure 11B, knock-down of the Gag target gene sequence fused with the luciferase gene. The results are displayed as the mean ± SD of three independent transfection experiments, each in triplicate.Example 7: AGT103 decreases expression of Tat and Vif

[0308] Cells were transfected with exemplary vector AGT103 / CMV-GFP. AGT103 and other exemplary vectors are defined in Table 3 below. Table 3

[0309] A T lymphoblastoid cell line (CEM; CCRF-CEM; American Type CultureCollection Catalogue number CCL119) was transduced with AGT103 / CMV-GFP. 48 hours later the cells were transfected with an HIV expression plasmid encoding the entire viral sequence. After 24 hours, RNA was extracted from cells and tested for levels of intact Tat sequences using reverse transcriptase polymerase chain reaction. Relative expression levels for intact Tat RNA were reduced from approximately 850 in the presence of control lentivirus vector, to approximately 200 in the presence of AGT103 / CMV-GFP for a total reduction of > 4 fold, as shown in Figure 12.Example 8: Regulation of HIV Components by Synthetic MicroRNA Sequences in a Lentiviral Vector

[0310] Inhibitory RNA Design. The sequence of HIV-1 Tat and Vif genes were used to search for potential siRNA or shRNA candidates to knockdown Tat or Vif levels in human cells. Potential RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-IT RNA iDesigner from Thermo Scientific. The selected shRNA sequences most potent for Tat or Vif knockdown were embedded within a microRNA backbone to allow for expression by an RNA polymerase II promoter such as CMV or EF-I alpha. The RNA sequence may also be synthesized as a siRNA oligonucleotide and used independently of a plasmid or lentiviral vector.

[0311] Plasmid Construction. The Tat target sequence (5’- TCCGCTTCTTCCTGCCATAG-3’) (SEQ ID NO: 7) was incorporated into the miR185 backbone to create a Tat miRNA (5‘-GGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGGT CCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTCG TCG-3’) (SEQ ID NO: 3) that was inserted into a lentivirus vector and expressed under control of the EF-1 alpha promoter. Similarly, the Vif target sequence (5’- GGGATGTGTACTTCTGAACTT-3’) (SEQ ID NO: 6) was incorporated into the miR21 backbone to create a Vif miRNA (5’-CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA-3’) (SEQ ID NO: 2) that was inserted into a lentivirus vector and expressed under control of the EF-1 alpha promoter. The resulting Vif / Tat miRNA-expressing lentivirus vectors were produced in 293T cells using a lentiviral vector packaging system. The Vif and Tat miRNA wereembedded into a microRNA cluster consisting of miR CCR5, miR Vif, and miR Tat all expressed under control of the EF-1 promoter.

[0312] Functional assay for miR185Tat inhibition of Tat mRNA accumulation. A lentivirus vector expressing miR185 Tat (LV-EFl-miR-CCR5-Vif-Tat) was used at a multiplicity’ of infection equal to 5 for transducing 293T cells. 24 hours after transduction the cells were transfected with a plasmid expressing HIV strain NL4-3 (pNL4-3) using Lipofectamine2000 under standard conditions. 24 hours later RNA was extracted and levels of Tat messenger RNA were tested by RT-PCR using Tat-specific primers and compared to actin mRNA levels for a control.

[0313] Functional assay for miR21 Vif inhibition of Vif protein accumulation. A lentivirus vector expressing miR21 Vif (LV-EFl-miR-CCR5-Vif-Tat) was used at a multiplicity of infection equal to 5 for transducing 293T cells. 24 hours after transduction, the cells were transfected with a plasmid expressing HIV strain NL4-3 (pNL4-3) using Lipofectamine2000. 24 hours later cells were lysed and total soluble protein was tested to measure the content of Vif protein. Cell lysates were separated by SDS-PAGE according to established techniques. The separated proteins were transferred to nylon membranes and probed with a Vif-specific monoclonal antibody or actin control antibody.

[0314] As shown in Figure 13A, Tat knock-down was tested in 293T cells transduced with either a control lentiviral vector or a lentiviral vector expressing either synthetic miR185 Tat or miR155 Tat microRNA. After 24 hours, the HIV vector pNL4-3 was transfected with Lipofectamine2000 for 24 hours and then RNA was extracted for qPCR analysis with primers for Tat. As shown in Figure 13B, Vif knock-down was tested in 293T cells transduced with either a control lentiviral vector or a lentiviral vector expressing a synthetic miR21 Vif microRNA. After 24 hours, the HIV vector pNL4-3 was transfected with Lipofectamine2000 for 24 hours and then protein was extracted for immunoblot analysis with an antibody for HIV Vif.Example 9: Regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector

[0315] CEM-CCR5 cells were transduced with a lentiviral vector containing a synthetic miR30 sequence for CCR5 (AGT103: TGTAAACTGAGCTTGCTCTA (SEQ ID NO: 97),AGT103-R5-1: TGTAAACTGAGCTTGCTCGC (SEQ ID NO: 98), or AGT103-R5-2: CATAGATTGGACTTGACAC (SEQ ID NO: 99). After 6 days, CCR5 expression was determined by FACS analysis with an APC-conjugated CCR5 antibody and quantified by mean fluorescence intensity (MFI). CCR5 levels were expressed as % CCR5 with LV-Control set at 100%. The target sequence of AGT103 and AGT103-R5-1 is in the same region as CCR5 target sequence #5. The target sequence of AGT103-R5-2 is the same as CCR5 target sequence #1. AGT103 (2% of total CCR5) is most effective at reducing CCR5 levels as compared with AGT103-R5-1 (39% of total CCR5) and AGT103-R5-2 which does not reduce CCR5 levels. The data is demonstrated in Figure 14 herein.Example 10: Regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector containing either a long or short WPRE sequence.

[0316] Vector Construction. Lenti virus vectors often require an RNA regulatory element for optimal expression of therapeutic genes or genetic constructs. A common choice is to use the Woodchuck hepatitis virus post transcriptional regulatory element (WPRE). We compared AGT103 that contains a full-length WPRE:(5’AATCAACCTCTGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATG TTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTG CTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTA TGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTG ACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACT TTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGC TGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGA AATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGA CGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCC TGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGG ATCTCCCTTTGGGCCGCCTCCCCGCCT-3’) (SEQ ID NO: 32) with a modified AGT103 vector containing a shortened WPRE element(5’AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGATATTCTTAACTAT GTTGCTCCTTTTACGCTGTGTGGATATGCTGCTTTAATGCCTCTGTATCATGCTATT GCTTCCCGTACGGCTTTCGTTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCCGTCAACGTGGCGTGGTGTGCTCTGTGTTTGCT GACGCAACCCCCACTGGCTGGGGCATTGCCACCACCTGTCAACTCCTTTCTGGGAC TTTCGCTTTCCCCCTCCCGATCGCCACGGCAGAACTCATCGCCGCCTGCCTTGCCC GCTGCTGGAC AGGGGCTAGGTTGCTGGGC ACTGATAATTCCGTGGTGTTGTC-3 ' ) (SEQ ID NO: 80).

[0317] Functional assay for modulating cell surface CCR5 expression as a function of long versus short WPRE element in the vector sequence. AGT103 containing long or short WPRE elements were used for transducing CEM-CCR5 T cells a multiplicity of infection equal to 5. Six days after transduction cells were collected and stained with a monoclonal antibody capable of detecting cell surface CCR5 protein. The antibody was conjugated to a fluorescent marker and the intensity of staining is directly proportional to the level of CCR5 on the cell surface. A control lentivirus had no effect on cell surface CCR5 levels resulting in a single population with a mean fluorescence intensity of 73.6 units. The conventional AGT103 with a long WPRE element reduced CCR5 expression to a mean fluorescence intensity level of 11 units. AGT103 modified to incorporate a short WPRE element resulted in a single population of cells with mean fluorescence intensity of 13 units. Accordingly, substituting a short WPRE element had little or no effect on the capacity for AGT103 to reduce cell surface CCR5 expression.

[0318] As shown in Figure 14, CEM-CCR5 cells were transduced with AGT103 containing either a long or short WPRE sequence. After 6 days, CCR5 expression was determined by FACS analysis with an APC-conjugated CCR5 antibody and quantified as mean fluorescence intensity (MFI). CCR5 levels were expressed as % CCR5 with LV-Control set at 100%. The reduction in CCR5 levels was similar for AGT103 with either the short (5.5% of total CCR5) or long (2.3% of total CCR5) WPRE sequence.Example 11: Regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector with or without a WPRE sequence

[0319] Vector construction. In order to test whether WPRE was required for AGT103 down regulation of CCR5 expression we constructed a modified vector without WPRE element sequences.

[0320] Functional assay for modulating cell surface CCR5 expression as a function of including or not including a long WPRE element in the AGT103 vector. In order to test whetherWPRE was required for AGT103 modulation of CCR5 expression levels we transduced CEM- CCR5 T cells with AGT103 or a modified vector lacking WPRE using a multiplicity of infection equal to 5. Six days after transduction cells were collected and stained with a monoclonal antibody capable of recognizing cell surface CCR5 protein. The monoclonal antibody was directly conjugated to a fluorescent marker and the intensity of staining is directly proportional to the number of CCR5 molecules per cell surface. A lentivirus control vector had no effect on cell surface CCR5 levels resulting in a uniform population with mean fluorescence intensity of 164. The lentivirus vector (AGT103 with a long WPRE and also expressing GFP marker protein), AGT103 lacking GFP but containing a long WPRE element, or AGT103 lacking both GFP and WPRE all were similarly effective for modulating cell surface CCR5 expression. After removing GFP, AGT103 with or without WPRE elements were indistinguishable in terms of their capacity for modulating cell surface CCR5 expression.

[0321] CEM-CCR5 cells were transduced with AGT103 with or without GFP and WPRE. After 6 days, CCR5 expression was determined by FACS analysis with an APC- conjugated CCR5 antibody and quantified as mean fluorescence intensity (MFI). CCR5 levels were expressed as % CCR5 with LV-Control set at 100%. The reduction in CCR5 levels was similar for AGT103 with (0% of total CCR5) or without (0% of total CCR5) the WPRE sequence. This data is demonstrated in Figure 16.Example 12: Regulation of CCR5 expression by a CD4 promoter regulating synthetic microRNA sequences in a lentiviral vector.

[0322] Vector Construction. A modified version of AGT103 was constructed to lest the effect of substituting alternate promoters for expressing the microRNA cluster that suppresses CCR5, Vif and Tat gene expression. In place of the normal EF-1 promoter we substituted the T cell-specific promoter for CD4 glycoprotein expression using the sequence:(5’TGTTGGGGTTCAAATTTGAGCCCCAGCTGTTAGCCCTCTGCAAAGAAAAAAAAA AAAAAAAAAGAACAAAGGGCCTAGATTTCCCTTCTGAGCCCCACCCTAAGATGAA GCCTCTTCTTTCAAGGGAGTGGGGTTGGGGTGGAGGCGGATCCTGTCAGCTTTGCT CTCTCTGTGGCTGGCAGTTTCTCCAAAGGGTAACAGGTGTCAGCTGGCTGAGCCTA GGCTGAACCCTGAGACATGCTACCTCTGTCTTCTCATGGCTGGAGGCAGCCTTTGT AAGTCACAGAAAGTAGCTGAGGGGCTCTGGAAAAAAGACAGCCAGGGTGGAGGTAGATTGGTCTTTGACTCCTGATTTAAGCCTGATTCTGCTTAACTTTTTCCCTTGACTTTGGCATTTTCACTTTGACATGTTCCCTGAGAGCCTGGGGGGTGGGGAACCCAGCT CCAGCTGGTGACGTTTGGGGCCGGCCCAGGCCTAGGGTGTGGAGGAGCCTTGCCA TCGGGCTTCCTGTCTCTCTTCATTTAAGCACGACTCTGCAGA-3 ) (SEQ ID NO: 30).

[0323] Functional assay comparing EF-1 and CD4 gene promoters in terms of potency for reducing cell surface CCR5 protein expression. AGT103 modified by substituting the CD4 gene promoter for the normal EF-1 promoter was used for transducing CEM-CCR5 T cells. Six days after transduction cells were collected and stained with a monoclonal antibody capable of recognizing cell surface CCR5 protein. The monoclonal antibody was conjugated to a fluorescent marker and staining intensity is directly proportional to the level of cell surface CCR5 protein. A control lentivirus transduction resulted in a population of CEM-CCR5 T cells that were stained with a CCR5-specific monoclonal antibody and produced a mean fluorescence intensity of 81.7 units. The modified AGT103 using a CD4 gene promoter in place of the EF-1 promoter for expressing microRNA showed a broad distribution of staining with a mean fluorescence intensity roughly equal to 17.3 units. Based on this result, the EF-1 promoter is at least similar and likely superior to the CD4 gene promoter for microRNA expression. Depending on the desired target cell population, the EF-1 promoter is universally active in all cell types and the CD4 promoter is only active in T-lymphocytes.

[0324] CEM-CCR5 cells were transduced with a lentiviral vector containing a CD4 promoter regulating a synthetic microRNA sequence for CCR5, Vift and Tat (AGT103). After 6 days, CCR5 expression was determined by FACS analysis with an APC-conj ugated CCR5 antibody and quantified as mean fluorescence intensity (MFI). CCR5 levels were expressed as % CCR5 with LV-Control set at 100%. In cells transduced with LV-CD4-AGT103, CCR5 levels were 11% of total CCR5. This is comparable to that observed for LV-AGT103 which contains the EFl promoter. This data is demonstrated in Figure 17.Example 13: Detecting HIV Gag-Specific CD4 T Cells

[0325] Cells and reagents. Viable frozen peripheral blood mononuclear cells (PBMC) were obtained from a vaccine company. Data were obtained with a representative specimen from an HIV+ individual who was enrolled into an early stage clinical trial (TRIAL REGISTRATION: clinicaltnals.gov NCT01378156) testing a candidate HIV therapeutic vaccine. Two specimens were obtained for the “Before vaccination” and “After vaccination”studies. Cell culture products, supplements and cytokines were from commercial suppliers. Cells were tested for responses to recombinant Modified Vaccinia Ankara 62B from Geovax Corporation as described in Thompson etal. (2016). "DNA / MVA Vaccination ofHIV-1 Infected Participants with Viral Suppression on Antiretroviral Therapy, followed by Treatment Interruption: Elicitation of Immune Responses without Control of Re-Emergent Virus." PLoS One 11(10): e0163164. Synthetic peptides representing the entire HIV-1 Gag polyprotein were obtained from GeoVax the HIV (GAG) Ultra peptide sets were obtained from JPT Peptide Technologies GmbH (www.jpt.com), Berlin, Germany. HIV (GAG) Ultra contains 150 peptides each being 15 amino acids in length and overlapping by 11 amino acids. They were chemically synthesized then purified and analyzed by liquid chromatography - mass spectrometry. Collectively these peptides represent major immunogenic regions of the HIV Gag polyprotein and are designed for average coverage of 57.8% among known HIV strains. Peptide sequences are based on the HIV sequence database from the Los Alamos National Laboratory (http: / / www.hiv.lanl.gov / content / sequence / NEWALIGN / align.html). Peptides are provided as dried trifluoroacetate salts, 25 micrograms per peptide, and are dissolved in approximately 40 microliters of DMSO then diluted with PBS to final concentration. Monoclonal antibodies for detecting CD4 and cytoplasmic IFN-gamma were obtained from commercial sources and intracellular staining was done with the BD Pharmingen Intracellular Staining Kit for interferongamma. Peptides were resuspended in DMSO and we include a DMSO only control condition.

[0326] Functional assay for detecting HIV-specific CD4+ T cells. Frozen PBMC were thawed, washed and resuspended in RPMI medium containing 10% fetal bovine serum, supplements and cytokines. Cultured PBMC collected before or after vaccination were treated with DMSO control, MV A GeoVax (multiplicity of infection equal to 1 plaque forming unit per cell), Peptides GeoVax (1 microgram / ml) or HIV (GAG) Ultra peptide mixture (1 microgram / ml) for 20 hours in the presence of Golgi Stop reagent. Cells were collected, washed, fixed, permeabilized and stained with monoclonal antibodies specific for cell surface CD4 or intracellular interferon-gamma. Stained cells were analyzed with a FACSCalibur analytical flow cytometer and data were gated on the CD4+ T cell subset. Cells highlighted within boxed regions are double-positive and designated HIV-specific CD4 T cells on the basis of interferon-gamma expression after MV A or peptide stimulation. Numbers within the boxed regions show the percentage of total CD4 that were identified as HIV-specific. We did not detect strong responsesto DMSO or MV A. Peptides from GeoVax elicited fewer responding cells compared to HIV (GAG) Ultra peptide mixture from JPT but differences were small and not significant.

[0327] As shown in Figure 18, PBMCs from a HIV-positive patient before or after vaccination w ere stimulated with DMSO (control), recombinant MVA expressing HIV Gag from GeoVax (MVA GeoVax). Gag peptide from GeoVax (Pep GeoVax, also referred to herein as Gag peptide pool 1) or Gag peptides from JPT (HIV (GAG) Ultra, also referred to herein as Gag peptide pool 2) for 20 hours. IFNg production w as detected by intracellular staining and flow cytometry' using standard protocols. Flow cytometry' data were gated on CD4 T cells. Numbers captured in boxes are the percentage of total CD4 T cells designated ‘“HIV-specific” on the basis of cytokine response to antigen-specific stimulation.Example 14: HIV-specific CD4 T cell expansion and lentivirus transduction

[0328] Designing and testing methods for enriching PBMC to increase the proportion of HIV-specific CD4 T cells and transducing these cells yvith AGT103 to produce the cellular product AGT103T.

[0329] The protocol yvas designed for ex vivo culture of PBMC (peripheral blood mononuclear cells) from HIV-positive patients who had received a therapeutic HIV vaccine. In this example, the therapeutic vaccine consisted of three doses of plasmid DNA expressing HIV Gag, Pol and Env genes followed by two doses of MVA 62-B (modified vaccinia Ankara number 62-B) expressing the same HIV Gag, Pol, and Env genes. The protocol is not specific for a vaccine product and only requires a sufficient level of HIV-specific CD4+ T cells after immunization. Venous blood yvas collected and PBMC were purified by Ficoll-Paque densitygradient centrifugation. Alternately, PBMC or defined cellular tractions can be prepared by positive or negative selection methods using antibody cocktails and fluorescence activated or magnetic bead sorting. The purified PBMC are washed and cultured in standard medium containing supplements, antibiotics and fetal bovine serum. To these cultures, apool of synthetic peptides was added representing possible T cell epitopes yvithin the HIV Gag polyprotein. Cultures are supplemented by adding cytokines interleukin-2 and interleukin- 12 that were selected after testing combinations of interleukin-2 and interleukin- 12, interleukin 2 and interleukin-7, interleukin 2 and interleukin-15. Peptide stimulation is folloyved by a culture interval of approximately 12 days. During the 12 days culture, fresh medium and fresh cytokine supplements were added approximately once every four days.

[0330] The peptide stimulation interval is designed to increase the frequency of HIV- specific CD4 T cells in the PBMC culture. These HIV-specific CD4 T cells were activated by prior therapeutic immunization and can be re-stimulated and caused to proliferate by synthetic peptide exposure. Our goal is to achieve greater than or equal to 1% of total CD4 T cells being HIV-specific by end of the peptide stimulation culture period.

[0331] On approximately day 12 of culture cells are washed to remove residual materials then stimulated with synthetic beads decorated with antibodies against CD4 T cell surface proteins CD3 and CD28. This well-established method for polyclonal stimulation of T cells will reactivate the cells and make them more susceptible for AGT103 lenti virus transduction. The lentivirus transduction is performed on approximately day 13 of culture and uses a multiplicity of infection between 1 and 5. After transduction cells are washed to remove residual lentivirus vector and cultured in media containing interleukin-2 and interleukin- 12 with fresh medium and cytokines added approximately once every four days until approximately day 24 of culture.

[0332] Throughout the culture interval the antiretroviral drug Saquinavir is added at a concentration of approximately 100 nM to suppress any possible outgrowth of HIV.

[0333] On approximately day 24 of culture cells are harvested, washed, a sample is set aside for potency and release assay, then the remaining cells are suspended in cryopreservation medium before freezing in single aliquots of approximately 1 xlO10cells per dose that will contain approximately 1 *108HIV-specific CD4 T cells that are transduced with AGT103.

[0334] Potency of the cell product (AGT103T) is tested in one of two alternate potency assays. Potency assay 1 tests for the average number of genome copies (integrated AGT103 vector sequences) per CD4 T cell. The minimum potency is approximately 0.5 genome copies per CD4 T cell in order to release the product. The assay is performed by positive selection of CD3 positive / CD4 positive T cells using magnetic bead labeled monoclonal antibodies, extracting total cellular DNA and using a quantitative PCR reaction to detect sequences unique to the AGT103 vector. Potency assay 2 tests for the average number of genome copies of integrated AGT103 within the subpopulation of HIV-specific CD4 T cells. This essay is accomplished by first stimulating the PBMC w ith the pool of synthetic peptides representing HIV Gag protein. Cells are then stained with a specific antibody reagent capable of binding to the CD4 T cell and also capturing secreted interferon-gamma cytokine. The CD4 positive / interferon-gamma positive cells are captured by magnetic bead selection, total cellularDNA is prepared, and the number of genome copies of AGT103 per cell is determined with a quantitative PCR reaction. Release criterion based on potency using Assay 2 require that greater than or equal to 0.5 genome copies per HIV-specific CD4 T-cell are present in the AGT103 cell product.

[0335] Functional test for enriching and transducing HIV-specific CD4 T cells from PBMC of HIV-positive patients that received a therapeutic HIV vaccine. The impact of therapeutic vaccination on the frequency of HIV-specific CD4 T cells was tested by a peptide stimulation assay (Figure 19, Panel B). Before vaccination the frequency of HIV-specific CD4 T cells was 0.036% in this representative individual. After vaccination, the frequency of HIV- specific CD4 T cells was increased approximately 2-fold to the value of 0.076%. Responding cells (HIV-specific) identified by accumulation of cytoplasmic interferon-gamma, were only detected after specific peptide stimulation.

[0336] We also tested whether peptide stimulation to enrich for HIV-specific CD4 T cells follow ed by AGT103 transduction w ould reach our goal of generating approximately 1% of total CD4 T cells in culture that were both HIV-specific and transduced by AGT103. In this case, we used an experimental version of AGT103 that expresses green fluorescence protein (see GFP). In Figure 19, Panel C the post-vaccination culture after peptide stimulation (HIV (GAG) Ultra) and AGT103 transduction demonstrated that 1.11% of total CD4 T cells w ere both HIV- specific (based on expressing interferon-gamma in response to peptide stimulation) and AGT103 transduced (based on expression of GFP).

[0337] Several patients from a therapeutic HIV vaccine study were tested to assess the range of responses to peptide stimulation and to begin defining eligibility criteria for entering a gene therapy arm in a future human clinical trial. Figure 19 Panel D show the frequency of HIV - specific CD4 T cells in 4 vaccine trial participants comparing their pre-and post-vaccination specimens. In three cases the post-vaccination specimens show a value of HIV-specific CD4 T cells that was greater than or equal to 0.076% of total CD4 T cells. The ability to reach this value w as not predicted by the pre-vaccination specimens as patient 001-004 and patient 001-006 both started with pre-vaccination values of 0.02% HIV-specific CD4 T cells but one reached an eventual post-vaccination value of 0.12% HIV-specific CD4 T cells while the other individual fail to increase this value after vaccination. The same three patients that responded well to vaccine, in terms of increasing the frequency of HIV-specific CD4 T cells, also showedsubstantial enrichment of HIV-specific CD4 T cells after peptide stimulation and culture. In the three cases shown in Figure 19 Panel E, peptide stimulation and subsequent culture generated samples where 2.07%. 0.72% or 1.54% respectively of total CD4 T cells were HIV-specific. These values indicate that a maj ority of individuals responding to a therapeutic HIV vaccine will have a sufficiently large ex vivo response to peptide stimulation in order to enable our goal of achieving approximately 1% of total CD4 T cells that are HIV-specific and transduced with AGT103 in the final cell product.

[0338] As shown in Figure 19, Panel A describes the schedule of treatment. Panel B demonstrates that PBMCs were stimulated with Gag peptide or DMSO control for 20 hours. IFN gamma production was detected by intracellular staining by FACS. CD4+T cells were gated for analysis. Panel C demonstrates CD4+T cells were expanded and transduced with AGT103-GFP using the method as shown in Panel A. Expanded CD4+T cells were rested in fresh medium without any cytokine for 2 days and re-stimulated with Gag peptide or DMSO control for 20 hours. IFN gamma production and GFP expression was detected by FACS. CD4+T cells were gated for analysis. Panel D demonstrates frequency of HIV-specific CD4+T cells (IFN gamma positive, pre- and post- vaccination) were detected from 4 patients. Panel E demonstrates Postvaccination PBMCs from 4 patients were expanded and HIV-specific CD4+T cells were examined.Example 15: Dose Response

[0339] Vector Construction. A modified version of AGT103 was constructed to test the dose response for increasing AGT103 and its effects on cell surface CCR5 levels. The AGT103 was modified to include a green fluorescent protein (GFP) expression cassette under control of the CMV promoter. Transduced cells expression the miR30CCR5 miR21Vif miR185Tat micro RNA cluster and emit green light due to expressing GFP.

[0340] Functional assay for dose response of increasing AGT103-GFP and inhibition ofCCR5 expression. CEM-CCR5 T cells were transduced with AGT103-GFP using multiplicity of infection per cell from 0 to 5. Transduced cells w ere stained with a fluorescently conjugated (APC) monoclonal antibody specific for cell surface CCR5. The intensity of staining is proportional to the number of CCR5 molecules per cell surface. The intensity of green fluorescence is proportional to the number of integrated AGT103-GFP copies per cell.

[0341] As shown in Figure 20, Panel A demonstrates the dose response for increasing AGT103-GFP and its effects on cell surface CCR5 expression. At multiplicity of infection equal to 0.4 only 1.04% of cells are both green (indicating transduction) and showing significantly reduced CCR5 expression. At multiplicity of infection equal to 1 the number of CCR51ow, GFP+ cells increases to 68. 1% / At multiplicity of infection equal to 5 the number of CCR51ow, GFP+ cells increased to 95.7%. These data are presented in histogram form in Figure 20, Panel B that shows a normally distribution population in terms of CCR5 staining, moving toward lower mean fluorescence intensity with increasing doses of AGT103-GFP. The potency of AGT103-GFP is presented in graphical form in Figure 20, Panel C showing the percentage inhibition of CCR5 expression with increasing doses of AGT103-GFP. At multiplicity of infection equal to 5, there was greater than 99% reduction in CCR5 expression levels.Example 16: AGT103 efficiently transduces primary human CD4+T cells

[0342] Transducing primary CD4 T cells with AGT103 lentivirus vector. A modified AGT103 vector containing the green fluorescence protein marker (GFP) was used at multiplicities of infection between 0.2 and 5 for transducing purified, primary human CD4 T cells.

[0343] Functional assay for transduction efficiency ofAGT103 in primary human CD4T cells. CD4 T cells were isolated from human PBMC (HIV -negative donor) using magnetic bead labeled antibodies and standard procedures. The purified CD4 T cells were stimulated ex vivo with CD3 / CD28 beads and cultured in media containing interleukin-2 for 1 day before AGT103 transduction. The relationship between lentivirus vector dose (the multiplicity of infection) and transduction efficiency is demonstrated in Figure 21, Panel A showing that multiplicity of infection equal to 0.2 resulted in 9.27% of CD4 positive T cells being transduced by AGT103 and that value was increased to 63. 1% of CD4 positive T cells being transduced by AGT103 with a multiplicity of infection equal to 5. In addition to achieving efficient transduction of primary CD4 positive T cells it is also necessary to quantify the number of genome copies per cell. In Figure 21, Panel B total cellular DNA from primary human CD4 T cells transduced at several multiplicities of infection were tested by quantitative PCR to determine the number of genome copies per cell. In a multiplicity of infection equal to 0.2 we measured 0.096 genome copies per cell that was in good agreement with 9.27% GFP positive CD4 T cells in panel A. Multiplicity of infection equal to 1 generated 0.691 genome copies per cell and multiplicity ofinfection equal to 5 generated 1.245 genome copies per cell.

[0344] As shown in Figure 21, CD4+T cells isolated from PBMC were stimulated with CD3 / CD28 beads plus IL-2 for 1 day and transduced with AGT103 at various concentrations. After 2 days, beads were removed and CD4+T cells were collected. As shown in Panel A, frequency of transduced cells (GFP positive) were detected by FACS. As shown in Panel B, the number of vector copies per cell w as determined by qPCR. At a multiplicity of infection (MOI) of 5, 63% of CD4+T cells w ere transduced with an average of 1 vector copy per cell.Example 17: AGT103 inhibits HIV replication in primary CD4+T cells

[0345] Protecting primary human CD4 positive T cells from HIV infection by transducing cells with AGT103. Therapeutic lentivirus AGT103 was used for transducing primary' human CD4 positive T cells at multiplicities of infection between 0.2 and 5 per cell. The transduced cells were then challenged with a CXCR4-tropic HIV strain NL4.3 that does not require cell surface CCR5 for penetration. This assay tests the potency of microRNA against Vif and Tat genes of HIV in terms of preventing productive infection in primary CD4 positive T cells, but uses an indirect method to detect the amount of HIV released from infected, primary human CD4 T cells.

[0346] Functional assay for AGT103 protection against CXCR4-tropic HIV infection of primary human CD4 positive T cells. CD4 T cells were isolated from human PBMC (HIVnegative donor) using magnetic bead labeled antibodies and standard procedures. The purified CD4 T cells were stimulated ex vivo with CD3 / CD28 beads and cultured in media containing interleukin-2 for 1 day before AGT103 transduction using multiplicities of infection between 0.2 and 5. Two days after transduction the CD4 positive T cell cultures were challenged with HIV strain NL4.3 that was engineered to express the green fluorescent protein (GFP). The transduced and HIV-exposed primary CD4 T cell cultures were maintained for 7 days before collecting cell- free culture fluids containing HIV. The cell-free culture fluids were used to infect a highly permissive T cell line C8166 for 2 days. The proportion of HIV-infected C8166 cells was determined by flow cytometry detecting GFP fluorescence. With a mock lentivirus infection, the dose of 0. 1 multiplicity of infection for NL4.3 HIV resulted in an amount of HIV being released into culture fluids that was capable of establishing productive infection in 15.4% of C8166 T cells. With the dose 0.2 multiplicity of infection for AGT103. this value for HIV infection of C8166 cells is reduced to 5.3% and multiplicity of infection equal to 1 for AGT103 resulted inonly 3.19% of C8166 T cells being infected by HIV. C8166 infection was reduced further to 0.62% after AGT103 transduction using a multiplicity7of infection equal to 5. There is a clear dose response relationship between the amount of AGT103 used for transduction and the amount of HIV released into the culture medium.

[0347] As shown in Figure 22, CD4+T cells isolated from PBMC were stimulated with CD3 / CD28 beads plus IL-2 for 1 day and transduced with AGT103 at various concentrations (MOI). After 2 days, beads were removed and CD4+T cells were infected with 0.1 MOI of HIV NL4.3-GFP. 24 hours later, cells were washed 3 times with PBS and cultured with IL-2 (30U / ml) for 7 days. At the end of the culture, supernatant was collected to infect the HIV permissive cell line C8166 for 2 days. HIV-infected C8166 cells (GFP positive) were detected by FACS. There was a reduction in viable HIV with an increase in the multiplicity of infection of AGT103 as observed by less infection of C8166 cells MOI 0.2=65.6%, MOI 1= 79.3%, and MOI 5=96%).Example 18: AGT103 protects primary human CD4+T cells from HIV-induced depletion

[0348] AGT103 transduction of primary human CD4 T cells to protect against HIV- mediated cytopathology and cell depletion. PBMC were obtained from healthy, HIV -negative donors and stimulated with CD3 / CD28 beads then cultured for 1 day in medium containing interleukin-2 before AGT103 transduction using multiplicities of infection between 0.2 and 5.

[0349] Functional assay for AGT103 protection of primary human CD4 T cells againstHIV-mediated cytopatholog ’. AGT103-transduced primary human CD4 T cells were infected with HIV NL 4.3 strain (CXCR4-tropic) that does not require CCR5 for cellular entry. When using the CXCR4-tropic NL 4.3, only the effect of Vif and Tat microRNA on HIV replication is being tested. The dose of HIV NL 4.3 was 0.1 multiplicity of infection. One day after HIV infection, cells were washed to remove residual virus and cultured in medium plus interleukin- 2. Cells were collected every three days during a 14-day culture then stained with a monoclonal antibody that was specific for CD4 and directly conjugated to a fluorescent marker to allow measurement of the proportion of CD4 positive T cells in PBMC. Untreated CD4 T cells or CD4 T cells transduced with the control lentivirus vector were highly susceptible to HIV challenge and the proportion of CD4 positive T cells in PBMC fell below 10% by day 14 culture. In contrast, there was a dose-dependent effect of AGT103 on preventing cell depletion by HIV challenge. With a AGT103 dose of 0.2 multiplicity of infection more than 20% of PBMC were CD4 T cells by day 14 of culture and this value increased to more than 50% of PBMC beingCD4 positive T cells by day 14 of culture with a AGT103 dose of multiplicity of infection equal to 5. Again, there is a clear dose response effect of AGT103 on HIV cytopathogenicity in human PBMC.

[0350] As shown in Figure 23, PBMCs were stimulated w ith CD3 / CD28 beads plus IL- 2 for 1 day and transduced with AGT103 at various concentrations (MOI). After 2 days, beads w ere removed and cells were infected with 0.1 MOI of HIV NL4.3. 24 hours later, cells were washed 3 times with PBS and cultured with IL-2 (30U / ml). Cells were collected every 3 days and the frequency of CD4+T cells w ere analyzed by FACS. After 14 days of exposure to HIV, there was an 87% reduction in CD4+T cells transduced with LV-Control, a 60% reduction with AGT103 MOI 0.2. a 37% reduction with AGT103 MOI 1, and a 17% reduction with AGT103 MOI 5.Example 19: Generating a Population of CD4+ T cells enriched for HIV-Specificity and transduced with AGT103 / CMV-GFP

[0351] Therapeutic vaccination against HIV had minimal effect on the distribution of CD4+, CD8+ and CD4+ / CD8+ T cells. As shown in Figure 24A, the CD4 T cell population is shown in the upper left quadrant of the analytical flow cytometry dot plots, and changes from 52% to 57% of total T cells after the vaccination series. These are representative data.

[0352] Peripheral blood mononuclear cells from a participant in an HIV therapeutic vaccine trial were cultured for 12 days in medium + / - interleukin-2 / interleukin-12 or + / - interleukin-7 / interleukin-15. Some cultures were stimulated with overlapping peptides representing the entire p55 Gag protein of HIV-1 (HIV (GAG) Ultra peptide mixture) as a source of epitope peptides for T cell stimulation. These peptides are 10-20 amino acids in length and overlap by 20-50% of their length to represent the entire Gag precursor protein (p55) from HIV- 1 BaL strain. The composition and sequence of individual peptides can be adjusted to compensate for regional variations in the predominant circulating HIV sequences or when detailed sequence information is available for an individual patient receiving this therapy. At culture end, cells w ere recovered and stained with anti-CD4 or anti-CD8 monoclonal antibodies and the CD3+ population was gated and displayed here. The HIV (GAG) Ultra peptide mixture stimulation for either pre- or post-vaccination samples was similar to the medium control indicating that HIV (GAG) Ultra peptide mixture was not toxic to cells and was not acting as a polyclonal mitogen. The results of this analysis can be found in Figure 24B.

[0353] HIV (GAG) Ultra peptide mixture and interleukin-2 / interleukin-12 provided for optimal expansion of antigen-specific CD4 T cells. As shown in the upper panels of Figure 24C, there was an increase in cytokine (interferon-gamma) secreting cells in post-vaccination specimens exposed to HIV (GAG) Ultra peptide mixture. In the pre-vaccination sample, cytokine secreting cells increased from 0.43 to 0.69% as a result of exposure to antigenic peptides. In contrast, the post-vaccination samples show ed an increase of cytokine secreting cells from 0.62 to 1.76% of total CD4 T cells as a result of peptide stimulation. These data demonstrate the strong impact of vaccination on the CD4 T cell responses to HIV antigen.

[0354] Finally, AGT103 / CMV-GFP transduction of antigen-expanded CD4 T cells produced HIV-specific and HIV-resistant helper CD4 T cells that are needed for infusion into patients as part of a functional cure for HIV (in accordance with other various aspects and embodiments, AGT103 alone is used; for example, clinical embodiments may not include the CMV-GFP segment). The upper panels of Figure 24D show the results of analyzing the CD4+ T cell population in culture. The x axis of Figure 24D shows Green Fluorescent Protein (GFP) emission indicating that individual cells were transduced with the AGT103 / CMV-GFP. As shown in Figure 24D, in the post-vaccination samples 1.11 % of total CD4 T cells that were both cytokine secreting was recovered, indicating that the cells are responding specifically to HIV antigen, and transduced with AGT 103 / CMV-GFP. This is the target cell population and the clinical product intended for infusion and functional cure of HIV. With the efficiency of cell expansion during the antigen stimulation and subsequent polyclonal expansion phases of ex vivo culture, 4x108antigen-specific, lenti virus transduced CD4 T cells can be produced. This exceeds the target for cell production by 4-fold and will allow achievement of a count of antigen-specific and HIV-resistant CD4 T cells of approximately 40 cells / microliter of blood or around 5.7% of total circulating CD4 T cells.

[0355] Table 5 below shows the results of the ex vivo production of HIV -specific and HIV -resistant CD4 T cells using the disclosed vectors and methods.Example 20: Clinical Study for Treatment of HIV

[0356] AGT103T is agenetically modified autologous PBMC containing > 5 x 107HIV- specific CD4 T cells that are also transduced with AGT103 lentivirus vector.

[0357] A Phase I clinical trial will test the safety and feasibility of infusing ex vivo modified autologous CD4 T cells (AGT103T) in adult research participants with confirmed HIV infection, CD4+ T-cell counts >600 cells per mm3of blood and stable virus suppression below 200 copies per ml of plasma while on HAART. All study participants will continue receiving their standard antiretroviral medications through the Phase I clinical trial. Up to 40 study participants receive two doses by intramuscular injection 8 weeks apart, of recombinant modified vaccinia Ankara (rMVA) expressing HIV Gag, Pol and Env proteins. Seven to 10 days after the second immunization a blood sample is collected for in vitro testing to measure the frequency of CD4+ T-cells that respond to stimulation with a pool of overlapping, synthetic peptides representing the HIV-1 Gag polyprotein. Subjects in the upper half of vaccine responders, based on measuring the frequency of Gag-specific CD4 T cells are enrolled in the gene therapy arm and subjects in the lower half of responders do not continue in the study. We anticipate that the cut-off for higher responders is a HIV-specific CD4+ T cell frequency > 0.065% of total CD4 T cells. Subjects enrolled into the gene therapy arm of our trial undergo leukapheresis followed by purification of PBMC (using Ficoll density gradient centrifugation or negative selection with antibodies) that are cultured ex vivo and stimulated with HIV Gag peptides plus interleukin-2 and interleukin- 12 for 12 days, then stimulated again with beads decorated with CD3 / CD28 bispecific antibody. The antiretroviral drug Saquinavir is included at 100 nM to prevent emergence of autologous HIV during ex vivo culture. One day after CD3 / CD28 stimulation cells are transduced with AGT103 at multiplicity7of infection between 1 and 10. The transduced cells are cultured for an additional 7-14 days during which time they expand by polyclonal proliferation. The culture period is ended by harvesting and washing cells, setting aside aliquots for potency and safety release assays, and resuspending the remaining cells in cry opreservationmedium. A single dose is < IxlO10autologous PBMC. The potency assay measures the frequency of CD4 T cells that respond to peptide stimulation by expressing interferon-gamma. Other release criteria include the product must include > 0.5 x 107HIV-specific CD4 T cells that are also transduced with AGT103. Another release criterion is that the number of AGT103 genome copies per cell must not exceed 3. Five days before infusion with AGT103T subjects receive one dose of busulfuram (or Cytoxan) conditioning regimen followed by infusion of < 1 xlO10PBMC containing genetically modified CD4 T cells.

[0358] A Phase II study will evaluate efficacy of AGT103T cell therapy. Phase II study participants include individuals enrolled previously in our Phase I study who were judged to have successful and stable engraftment of genetically modified, autologous, HIV-specific CD4 T cells and clinical responses defined as positive changes in parameters monitored as described in efficacy assessments (1.3.). Study participants will be asked to add Maraviroc to their existing regimen of antiretroviral medication. Maraviroc is a CCR5 antagonist that will enhance the effectiveness of genetic therapy directed at reducing CCR5 levels. Once the Maraviroc regimen is in place subjects will be asked to discontinue the previous antiretroviral drug regimen and only maintain Maraviroc monotherapy for 28 days or until plasma viral RNA levels exceed 10,000 per ml on 2 sequential weekly blood draws. Persistently high viremia requires participants to return to their original antiretroviral drug regimen with or without Maraviroc according to recommendations of their HIV care physician.

[0359] If participants remain HIV suppressed (below 2,000 vRNA copies per ml of plasma) for >28 days on Maraviroc monotherapy, they will be asked to gradually reduce Maraviroc dosing over a period of 4 weeks followed by intensive monitoring for an additional 28 days. Subjects who maintained HIV suppression with Maraviroc monotherapy are considered to have a functional cure. Subjects who maintain HIV suppression even after Maraviroc withdrawal also have a functional cure. Monthly monitoring for 6 months followed by less intensive monitoring will establish the durability of functional cure.Patient SelectionInclusion Criteria:• Aged between 18 and 60 years.• Documented HIV infection prior to study entry.• Must be willing to comply with study -mandated evaluations; including not changingtheir antiretroviral regimen (unless medically indicated) during the study period.• CD4+ T-cell count >500 cell per millimeter cubed (cells / mm3)• CD4+ T-cell nadir of >400 cells / mm3• HIV viral load <1,000 copies per milliliter (mL)Exclusion Criteria:• Any viral hepatitis• Acute HIV infection• HIV viral load >1,000 copies / mL• Active or recent (prior 6 months) AIDS defining complication• Any change in HIV medications within 12 weeks of entering the study• Cancer or malignancy that has not been in remission for at least 5 years with the exception of successfully treated basal cell carcinoma of the skin• Current diagnosis of NYHA grade 3 or 4 congestive heart failure or uncontrolled angina or arrhythmias• History7of bleeding problems• Use of chronic steroids in past 30 days• Pregnant or breast feeding• Active drug or alcohol abuse• Serious illness in past 30 days• Currently participating in another clinical trial or any prior gene therapySafety assessments• Acute infusion reaction• Post-infusion safety' follow-upEfficacy assessments - Phase I• Number and frequency of modified CD4 T cells.• Durability of modified CD4 T cells.• In vitro response to Gag peptide restimulation (ICS assay) as a measure of memory' T cell function.• Polyfunctional anti-HIV CD8 T cell responses compare to pre- and post-vaccination time points.• Frequency of CD4 T cells making doubly spliced HIV mRNA after in vitro stimulation.Efficacy assessments - Phase II• Number and frequency of genetically modified CD4 T cells.• Maintenance of viral suppression (< 2,000 vRNA copies per ml but 2 consecutive weekly draws not exceeding 5x104vRNA copies per ml are permitted) with Maraviroc monotherapy.• Continued virus suppression during and after Maraviroc withdrawal.• Stable CD4 T cell count.

[0360] AGT103T consists of up to 1 x 1010genetically modified, autologous CD4+ T cells containing > 5 x 10 HIV-specific CD4 T cells that are also transduced with AGT103 lentivirus vector. A Phase I clinical trial will test the safety and feasibility of infusing ex vivo modified autologous CD4 T cells (AGT103T) in adult research participants with confirmed HIV infection, CD4+ T-cell counts >600 cells per mm3of blood and stable virus suppression below 200 copies per ml of plasma while on HAART. Up to 40 study participants receive two doses by intramuscular injection 8 weeks apart, of recombinant modified vaccinia Ankara (rMVA) expressing HIV Gag, Pol and Env proteins. Seven to 10 days after the second immunization a blood sample is collected for in vitro testing to measure the frequency of CD4+ T-cells that respond to stimulation with a pool of overlapping, synthetic peptides representing the HIV-1 Gag polyprotein. Subjects in the upper half of vaccine responders, based on measuring the frequency of Gag-specific CD4 T cells are enrolled in the gene therapy arm and subjects in the lower half of responders do not continue in the study. We anticipate that the cut-off for higher responders is a HIV-specific CD4+ T cell frequency > 0.065% of total CD4 T cells. Subjects enrolled into the gene therapy arm of our trial undergo leukapheresis and the CD4+ T cells are enriched by negative selection. The enriched CD4 subset is admixed with 10% the number of cells from the CD4-negative subset to provide a source and antigen-presenting cells. The enriched CD4 T cells are stimulated with HIV Gag peptides plus interleukin-2 and interleukin- 12 for 12 days, then stimulated again with beads decorated with CD3 / CD28 bispecific antibody. The antiretroviral drug Saquinavir is included at 100 nM to prevent emergence of autologous HIV during ex vivo culture. One day after CD3 / CD28 stimulation cells are transduced with AGT103 at multiplicity of infection between 1 and 10. The transduced cells are cultured for an additional 7-14 days during which time they expand by polyclonal proliferation. The culture period is ended by harvesting and washing cells, setting aside aliquots for potency and safety release assays, and resuspending the remaining cells in cry opreservation medium. A single doseis < IxlO10autologous cells enriched for the CD4+ T cell subset. The potency assay measures the frequency of CD4 T cells that respond to peptide stimulation by expressing interferongamma. Other release criteria include that the product must include > 0.5 x 107HIV-specific CD4 T cells that are also transduced with AGT103. Another release criterion is that the number of AGT103 genome copies per cell must not exceed 3. Five days before infusion with AGT103T subjects receive one dose of busulfuram (or Cytoxan) conditioning regimen followed by infusion of < 1 xlO10enriched and genetically modified CD4 T cell.

[0361] A Phase II study will evaluate efficacy of AGT103T cell therapy. Phase II study participants include individuals enrolled previously in our Phase I study who were judged to have successful and stable engraftment of genetically modified, autologous, HIV-specific CD4 T cells and clinical responses defined as positive changes in parameters monitored as described in efficacy assessments (1.3.). Study participants will be asked to add Maraviroc to their existing regimen of antiretroviral medication. Maraviroc is a CCR5 antagonist that will enhance the effectiveness of genetic therapy directed at reducing CCR5 levels. Once the Maraviroc regimen is in place subjects will be asked to discontinue the previous antiretroviral drug regimen and only maintain Maraviroc monotherapy for 28 days or until plasma viral RNA levels exceed 10,000 per ml on 2 sequential weekly blood draws. Persistently high viremia requires participants to return to their original antiretroviral drug regimen with or without Maraviroc according to recommendations of their HIV care physician.

[0362] If participants remain HIV suppressed (below 2,000 vRNA copies per ml of plasma) for >28 days on Maraviroc monotherapy, they will be asked to gradually reduce Maraviroc dosing over a period of 4 weeks followed by intensive monitoring for an additional 28 days. Subjects who maintained HIV suppression with Maraviroc monotherapy are considered to have a functional cure. Subjects who maintain HIV suppression even after Maraviroc withdrawal also have a functional cure. Monthly monitoring for 6 months followed by less intensive monitoring will establish the durability of functional cure.Example 21: GMP-grade manufacture of AGT103-T by CliniMACS Prodigy and G-Rex

[0363] The semi-automated TCT system was performed on the Clini-MACS Prodigy using the TS520 tubing set and the TCT process. Unless noted elsew here, reagents and materials were obtained from Miltenyi Biotec (Bergisch Gladbach, Germany). An overview of the general procedure is depicted in Figure ZZ. In brief, apheresis materials from HIV+ donors wereprocessed on a CliniMACS Prodigy device by running an internally developed customized application (CAP): A001_Apheresis_Separation, with a TS520 tubing set. The program executes a Ficoll (GE Healthcare) separation to reduce red blood cells (RBCs) and granulocytes. After Ficoll, the cells were sampled and analyzed for cell count, viability, and phenotype. Dry cell pellet samples were retained for additional testing. The remaining post-Ficoll cells were returned to the same CliniMACS Prodigy device for activation, transduction, and cultivation. The T Cell Transduction process program was executed on the same CliniMACS Prodigy device with the same TS520 tubing set. according to the TCT User Manual, with cultivation of the target population as the major goal. On day 0, the post-Ficoll cells were resuspended in 100 mL of culture media and brought into the CentriCult Unit (CCU) of the TS520 tubing set before incubation with PepMix HIV-1 (GAG) Ultra (1 mg / mL; JPT, Berlin, Germany) for R16 h at 37° C in static culture. Culture media were TexMACS GMP medium with 3% human AB serum (Valley Medical), 12.5 ng / mL IL-7. 12.5 ng / mL IL-15, and 100 nM saquinavir (Sigma, Burlington, MA,). A sample of the culture media was analyzed for baseline metabolite levels. On day 1, after a 16-hr incubation, the TCT process was stopped, and the culture was sampled and analyzed for cell count, viability, phenotype, and intracellular IFN-y peptide stimulation prior to CD8 / CD19 / CD56 cell depletion. Culture supernatant was assessed for metabolite levels. A CD8 / CD19 / CD56 depletion was performed using another internally developed CAP program: A001_Depletion. Post-depletion, the cells were resuspended in 70 mL of culture media and placed in static culture. On day 2, the seeded cells were sampled and analyzed for cell count, viability, and phenotype. Culture supernatant was assessed for metabolite levels. The remaining seeded cells were transduced with the AGT103-ER lentiviral vector (Lentigen. Gaithersburg, MD, USA) at a MOI of 5 in approximately 100 mL of culture media. On day 3, a feed of 100 mL was added to suspend the cells in 200 mL of culture media. On day 5, the seeded cells were sampled and analyzed for cell count, viability, and phenotype. Dry cell pellet samples were retained for additional testing. Culture supernatant was assessed for metabolite levels. The remaining seeded cells were harvested and distributed into G-Rex culture devices at the equivalent seeding density of 1 x 106 cells / cm2 in GRex 500M-CS (Wilson Wolf, St. Paul, MN, USA). On day 12, the G-Rex 500M-CS was harvested and analyzed for cell count, viability, and phenotype. Peptide pulse and intracellular IFN-y staining were performed to measure HIV- specific CD4 T-cells. Dry cell pellet samples were retained for additional testing. Culture supernatant was assessed for metabolites, cytokine levels, P24, and mycoplasma. The cells wereformulated in cry opreservation media. Samples were harvested for sterility and endotoxin, and remaining cells cryopreserved in anticipation of patient infusion.Example 22: the antiviral activity of AGT103-T in HIV infected adults in the absence of antiretroviral therapy (ART)

[0364] This example shows the antiviral activity of AGT103T, an autologous donor lymphocyte product enriched for Gag-specific CD4 T cells, in HIV infected adults in the absence of ART and assesses the AGT103T effect and role in HIV curative strategies. The impact of AGT103T on host capacity to suppress HIV replication in the absence of ART was assessed. Testing occurred in a multi-center, safety, and efficacy study in participants with HIV who received AGT103T in the Phase 1 parent clinical study. Enrolled Subjects stopped their antiretroviral therapy and were monitored closely for the recurrence of HIV viremia and concomitant decrease in their CD4 lymphocyte numbers. The study consisted of two antiviral treatment interruptions (ATI). During the first ATI, the patient was followed according to the schedule of assessments. When the first ATI phase was terminated, the patient was placed on ART and followed monthly until viral load fell below 50 copies per mL and CD4 counts were within 10% of baseline measurement. The second ATI was initiated once criteria were met. The patient was followed biweekly until ART restarted. Post-second ART restart, patients were followed biweekly until viremia was undetectable or a maximum of 3 months after ART restart to document suppression of HIV viral load and to assess CD4 recovery. The time to reach undetectable viral load was assessed to determine if prior infusion of AGT103-T delayed the return of viremia.Patient One

[0365] Table 6 below illustrates that AGT103T reduced the viral load in an HIV infected patient when compared to historical data from diagnosis. Patient number one had an extremely high viral load at the time of diagnosis which was above the level of quantitation and reached viral control below the limit of detection after three hundred eighty -four days. This patient was infused with 4.6 xlO8AGT103T transduced cells (prepared as described in Example 21) in August of 2021 and then ceased taking ART drugs (ODEFSEY® three-way combination of emtricitabine, rilpivirine, and tenofovir alafenamide) in September of 2022. In December of 2022 the patient resumed medication and the viral load at that time was 69,200 copies per mL which represents over 140-fold reduction in viral load, requiring one hundred seventeen days toreach levels below detection. In May of 2023 the patient resumed medication after the second treatment interruption and the viral load at that time was 24,300 copies per mL which represents over 400-fold reduction in viral load from the initial diagnosis which required only sixty -six days to reach levels at the limit of detection. Table 6: Patient 02 Days to < 20 copies / mL after resuming antiretroviral therapy.Patient Two

[0366] Tables 7, 8 and 9 further illustrate AGT103-T reduces the viral load in HIV infected patients. Patient 2 (Table 7) was infused with 1.69 x 109AGT103T transduced cells (prepared as described in Example 21) in February of 2022 and then ceased taking ART drugs (BIKTARVY® three-way combination of bictegravir, emtricitabine & tenofovir alafenamide) for the first time in July of 2022. In August of 2022 resumed medication and the viral load at that time was 570,000 copies per mL, requiring only fifty-three days to control viraemia below the limit of detection. Per protocol, the patient again withdrew from taking antiviral medication for a second ATI, resulting in a viral load of only 14,600 copies per mL in March of 2023 which represents about a 40-fold reduction in viral load requiring only twenty-six days to reach levels below detection. Table 7: Patient 02 Days to < 20 copies / mL after resuming antiretroviral therapy.Patient Three

[0367] Patient 3 (Table 8) was infused with 6.2 xlO8AGT103T transduced cells (prepared as described in Example 21) in November of 2021 and then ceased taking ART drugs (TIVICAY® and DESCOVY®, and two-way combination emtricitabine and tenofovir alafenamide, respectively) for the first time in July of 2022. In August of 2022 resumed medication and the viral load at that time was 404,000 copies per mL, requiring only seventyeight days to control viraemia below the limit of detection. Per protocol, the patient again withdrew from taking antiviral medication for a second ATI, resulting in a viral load of only 16,100 copies per mL in March of 2023 which represents about a 25-fold reduction in viral load requiring only thi rty days to reach levels below detection.Table 8: Patient 03 Days to < 20 copies / mL after resuming antiretroviral therapy.Patient Four

[0368] Patient 4 (Table 9) was infused with 1.92 x 108AGT103T transduced cells(prepared as described in Example 21) in May of 2021 and then ceased taking ART drugs (TIVICAY® and DESCOVY®, dolutegravir and two-way combination emtricitabine and tenofovir alafenamide, respectively) for the first time in September of 2022. In November of 2022 resumed medication and the viral load at that time was 20,900 copies per mL, requiring only eighty-eight days to control viraemia below the limit of detection. Per protocol, the patient again withdrew from taking antiviral medication for a second ATI, resulting in a viral load of only 5,650 copies per mL in July of 2023 which represents about a 37-fold reduction in viral load requiring only fifteen days to reach levels below detection.Table 9: Patient 04 Days to < 20 copies / mL after resuming antiretroviral therapy.Increased Gag-specific immune response after ATI

[0369] To investigate if the immune responses observed were functional against HIV, HIV-specific immune response was determined by measuring the Gag-specific CD4 and CD8 T cells by ICS assay. Overall, Gag-specific T cells demonstrated a similar trend as observed for the total CD4 and CD8 T cells. An increase in Gag-specific CD8 T cells with the rise in viremia was observed during both ATIs (Figure 27). The magnitude of the CD8 T cell response to Gag peptide was higher during the first ATI (1.1-13-fold) than the second (1.5-5.3-fold). Gagspecific CD4 T cells demonstrated higher stability and durability than the total CD4 T cells at the onset and during the presence of viremia. After the first ATI, following the event of “autovaccination,’' 3 out of 4 subjects demonstrated an increase in Gag specific CD4 T cell response during the second ATI, although a similar increase in the Gag-specific CD8 response was not generated. Overall, the data indicates that two ATIs helped in increasing the HIV specific CD4 response that led to the CTL response that in-tum coincided with reduced viral load.Persistence of AGT103-T in Circulation

[0370] To determine if AGT103-T cells could have contributed to the viral suppression observed during the second ATI, the presence of AGT103-modified cells in patient’s circulation was investigated by tw o independent methods. These methods detected different sequences of the lentiviral vector. First, a qPCR-based approach was used to ascertain the VCN in an enriched CD4 T cell population by identifying cells containing a unique sequence, the WPRE. present in our lentivirus within the modified cells, normalized to the housekeeping gene, RPL32. The persisting levels of the modified cells w ere found to be correlated with the dose and the time since the infusion. A significant proportion of circulating CD4 T cells was detected in the two high dose patients at the beginning of the ATI, that were comparable to the number of Gagspecific CD4 cells, suggesting a possibility that a significant proportion of Gag-specific cells could be AGT103-modified. Conversely, AGT103+ cells constituted a lower proportion of circulating CD4 T cells in other participants which can be attributed to their low dose of infusion and alonger duration of 246-490 days post-infusion. A decline in AGT103-T cells occurred with the rise in viremia, which appeared to partially restore upon the resumption of ART, in allparticipants (Figure 27). This suggests the possibility of migration of AGT103-T cells out of the circulation into the site of viral replication during viral rebound and back into circulation during ART. These results were confirmed using the amplicon-sequencing approach and observed a similar pattern of AGT103-T persistence. Since the silencing approach utilizes naturally occurring miR30, we amplified and sequenced miR30 from the DNA obtained from the CD4 T cells and obtained the ratio of modified to unmodified (native) miR30 sequences, that was then used to determine the AGT103+ cells. We also performed the VCN assay on the non-target cells obtained in the flow through (FT) while enriching the CD4 T cells. The absence of WPRE signal from the FT in all the patients suggests that only CD4 T cells were transduced with AGT103 lentiviral vector during drug product manufacture This data suggests that enriching a target population of cells can increase the sensitivity of the downstream qPCR-based assays in clinical samples, which is particularly important for detecting very low persisting levels of CAR-T or other transduced cells in circulation that do not express extracellular surface markers. Taken together, the in vivo persistence of AGT103-T cells 2 years after infusion, surpassing the median lifespan of CD4 T cells, and their fluctuating levels in the presence of viremia indicates their long-term engraftment in the patients that is responsive to the viral rebound and immunological signals. Furthermore, the viral suppression and amplified immune response observed in all study participants indicate the contribution of our therapeutic product to the immunological enhancement of our study participants; however, a direct correlation cannot be established.Summary

[0371] In four of four patients, the time to reach undetectable or below the limit of detection viral load occurred sooner after the second ATI than during the first ATI. Additionally, in all four patients the viral load at the time of second ATI was twenty-five to four hundred-fold lower than the outset of the first ATI. This diminution of time and viral load supports the hypothesis that AGT103-T is a therapeutic cell product capable of reconstituting patients’ immune capacity to a level sufficient for effective HIV suppression, even during viral rebound.Methods

[0372] All methods are detailed in Jain et al. (Frontiers in Medicine (2024); doi.org / 10.3389 / fmed.2024.1342476) (incorporated herein by reference)Intracellular Cvtokine Staining (ICS) Assay for Detecting HIV-Specific CD4 and CD8 T cells.

[0373] The ICS assay was performed as described previously (12). Briefly, PBMCs were isolated from whole blood using Ficoll Plaque and Sepmate Separation tubes per manufacturer’s instructions. These PBMCs were then cryopreserved in RPMI containing 10% human AB serum and 7% DMSO until ready for analysis. Cryopreserved PBMC vials were viably thawed, and cells were cultured for 18-22 h in RPMI +5% hABS. The following day, cells were counted and resuspended in fresh RPMI +5% hABS and stimulated with 1 pg / mL pooled overlapping peptides spanning HIV Gag, in the presence of GolgiPlug for 4 h at 37°C and 5% CO2. Medium containing 0.4% DMSO (peptide resuspension media) served as a negative control, and CEF / CPI Class I / II- restricted peptides were used as positive controls for responses to common antigens. After stimulation, cells were collected and washed in Dulbecco’s phosphate-buffered saline and stained with Fixable Viability7Stain 450 (BD Biosciences) to exclude dead cells. Subsequently, cells were washed in FACS staining buffer, blocked in TruStain Fc blocking solution and then stained with anti CD3-PerCP, CD4-FITC. and CD8-PE antibodies, followed by fixation using 4% paraformaldehyde (EMS). Fixed cells were permeabilized in IX perm / w ash buffer followed by intracellular staining with IFNy-APC antibody. After washing with perm / wash buffer, cells were stored in FACS staining buffer until ready for analysis using aFACSLyric flow cytometer. Data was analyzed using Flowjo software. Results were expressed as HIV Gag-specific CD4+ and CD8+ T cell count per mL of blood.Detection of AGT103-Modified T Cells by q-PCR Based Vector Copy Number (VCN) Assay

[0374] Whole blood was collected during visits in K2 EDTA tubes, which were then processed by Ficoll separation to isolate PBMC. One vial with 10 million frozen PBMCs was then thawed, and the cell viability was determined. These cells were then used to isolate an enriched CD4 T cell population using REALease® CD4 MicroBead Kit according to manufacturer’s instructions. Total DNA was extracted from CD4 T cell pellets (approximately 0.2 to 1 million cells) using DNeasy DNA extraction kit to determine transgene copy number by TaqMan quantitative polymerase chain reaction (qPCR), targeting woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence, a common feature of lentiviral vectors including AGT103. Copy number was calculated by normalizing the copies of WPRE detected with a single-copy housekeeping gene, RPL32. The following primer and probe sequences were used to amplify and detect the respective gene sequences. WPRE FP: 5’- GCTATGTGGATACGCTGCTTTA-3', WPRE RP: 5’-AGAGACAGCAACCAGGATTTATAC-3', WPRE probe 5'- / 56-FAM / TCATGCTAT / ZEN / TGCTTCCCGTATGGCT / 3IABkFQ / -3', RPL32 FP: 5’- CAAGGAAAGACGAGCTGTAGG-3', RPL32 RP:5’-GGGCAGTTGCATCTTCATATTC-3', RPL32 probe 5'- / 5HEX / AGCTGCAGG / ZEN / CAGAAATTCTGGTAGT / 3IABkFQ / -3'. Given that the V CN per transduced cell in all the drug products infused into these patients was less than one, the lentiviral copies per cell were converted into the number of AGT103-T cells. Using the CD4 T cell count obtained from LabCorp, the lentiviral copies per cell or the number of AGT103-T cells were then expressed as either a proportion of circulating CD4 T cells or per mL of blood.Modified miRNA-CCR5 Detection by Amplicon Sequencing

[0375] To detect the presence of modified miRNA targeting CCR5. we employed the Illumina Miseq platform and the 2x KAPA HiFi HotStart ReadyMix (Roche) kit for amplicon sequencing, performed at Psomagen, Rockville, MD. The process was followed according to the manufacturer’s instructions. In brief, total DNA was extracted from purified CD4 T cell pellets, consisting of approximately 0.2 to 1 million cells. The extracted DNA underwent a meticulous assessment for both quality and quantity using DNA electrophoresis and fluorometric measurements. Subsequently, PCR amplification step was conducted to amplify the miR30 sequences flanking the site of insertion of shRNACCR5 in our LVV using the following primers: AdapmiRNA3 OF TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGGTATATTGCTGTTGACAGTG AGCGACTGTA and > AdapmiRNA30RGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGCCCCTTGAAGTCCGAGGCA GTAG. The PCR reactions adhered to cycling conditions that had been rigorously optimized for the amplification of these sequences. The resulting amplicon libraries underwent further evaluation for quality and quantity using TapeStation D5000 Screen Tape and DNA QC- Picogreen assays. For the sequencing step, we performed paired-end sequencing on the Illumina Miseq platform, generating 151 base pair reads. The sequencing process followed Illumina’s standard protocols, ensuring data integrity, and minimizing bias. The sequence data generated from the Illumina platform were then subjected to comprehensive processing and analysis using specialized bioinformatics tools. We employed bioinformatic pipelines to identify and quantify the presence of human endogenous miR30 (GRCh38 chr6: 71403551-71403621) and modifiedmiR30 targeting CCR5 within the samples. Given that full miR30 is present as a single copy gene in the genome, the ratio of modified miR30 to native miR30 was used to determine the proportion of AGT103-containing cells among the circulating CD4 T cellsSequences

[0376] The following sequences are referred to herein:

[0377] While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention.

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A method of reducing viral load induced by antiviral treatment interruption in a subject comprising: a) measuring viral load in the subject, wherein the subject has been previously administered a viral vector comprising at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; and b) administering a course of antiviral treatment to the subject, thereby reducing viral load induced by antiviral treatment.

2. The method of claim 1, wherein the subject was previously on a course of antiviral treatment.

3. The method of claim 2, wherein the course of antiviral treatment comprises emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof.

4. The method of claim 2, wherein the subject ceased the course of antiviral treatment for at least about 1 month prior to measuring viral load.

5. The method of claim 2, wherein the antiviral treatment after measuring viral load is the same as the previous course of antiviral treatment.

6. The method of claim 1, wherein the viral load is at least about 5,000 viral load copies / ml.

7. The method of claim 1 wherein the subject was administered the viral vector at least 3 months prior to antiviral treatment interruption.

8. The method of claim 1, further comprising ceasing administering the antiviral treatment to the subject.

9. The method of claim 8, wherein the ceased the course of antiviral treatment for at least about 1 month.

10. The method of claim 9, further comprising measuring viral load in the subject.

11. The method of claim 10, wherein the viral load is at least about 5,000 viral load copies / ml.

12. The method of claim 11, further comprising administering a course of antiviral therapy.

13. The method of claim 1. wherein the genetic element further comprises a nucleotidesequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5).

14. The method of claim 1. wherein the genetic element further comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Vif.

15. The method of claim 1, wherein the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5.

16. The method of claim 1, wherein the at least one genetic element comprises: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%. or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 1, 2 and NO:3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 6, 7 and 97.

17. The method of claim 1, wherein the wherein the at least one genetic element comprises: a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO: 3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs:

6. 7 and 97.

18. A method of reducing side effects of antiviral treatment in a subject comprising:(a) contacting the PBMC ex vivo with a therapeutically effective amount of a second stimulatory agent;(b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat;(c) culturing the transduced PBMC for at least 1 day;(d) infusing the transduced PBMC in the subject; and(e) administering a course of antiviral therapy to the subject, thereby reducing side effects of antiviral treatment.

19. The method of claim 18, wherein the side effects of antiviral therapy comprised depression, skin rash, discouragement, feeling sad or empty, irritability, lack of appetite, loss of interest or pleasure, thoughts of killing oneself, tiredness, trouble concentrating, trouble sleeping, diarrhea, nausea, headache, fatigue, stomach discomfort and combinations thereof.

20. The method of claim 18, wherein the genetic element further comprises a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5).

21. The method of claim 18, wherein the genetic element further comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Vif.

22. The method of claim 18, wherein the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5.

23. The method of claim 18, wherein the at least one genetic element comprises: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%. or at least 90%, or atleast 95% percent identity with SEQ ID NOs: 1, 2 and NO:3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 6, 7 and 97.

24. The method of claim 23, wherein the wherein the at least one genetic element comprises: a) SEQ ID NO: 31: b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO: 3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97.

25. The method of claim 18, wherein the course of antiviral treatment is emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof.

26. A method of reducing dosage of an antiviral treatment in a subject comprising: a) administer a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; and b) administering a course of antiviral treatment to the subject. thereby reducing the dosage of the antiviral therapy.

27. The method of claim 26, wherein the viral vector is produced by the method comprising:(a) contacting isolated PBMC ex vivo with a therapeutically effective amount of a stimulatory agent;(b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; and(c) culturing the transduced PBMC for at least 1 day.

28. The method of claim 26, wherein the dosage of the antiviral therapy comprises 10 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg.125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg and combinations thereof.

29. The method of claim 26, wherein the genetic element further comprises a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5).

30. The method of claim 26, wherein the genetic element further comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Vif.

31. The method of claim 26, wherein the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat. targeting HIV Vif and inhibiting production of CCR5.

32. The method of claim 26, wherein the at least one genetic element comprises: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31; b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 1, 2 and NO:3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs:

6. 7 and 97.

33. The method of claim 32, wherein the wherein the at least one genetic element comprises: a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO: 3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97.

34. The method of claim 26, wherein the course of antiviral treatment comprises emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinationsthereof.

35. A method of reducing frequency of antiviral treatment in a subject comprising: a) administer a viral vector comprising at least one genetic element to the subject, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; and b) administering a course of antiviral treatment to the subject. thereby reducing the frequency of antiviral treatment.

36. The method of claim 35, wherein the viral vector is produced by the method comprising:(a) contacting isolated PBMC ex vivo with a therapeutically effective amount of a stimulatory agent;(b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Tat; and(c) culturing the transduced PBMC for at least 1 day.

37. The method of claim 35, wherein the frequency of antiviral therapy comprises once a day, twice a day. once a week, twice a week, once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every' 8 months, once every 9 months, once every710 months, once every711 months or once every712 months.

38. The method of claim 36, wherein the genetic element further comprises a nucleotide sequence encoding a small RNA capable of inhibiting the production of chemokine receptor 5 (CCR5).

39. The method of claim 36, wherein the genetic element further comprises a nucleotide sequence encoding a small RNA capable of targeting HIV Vif.

40. The method of claim 36, wherein the nucleotide sequence encodes for at least one small RNA that is capable of targeting HIV Tat, targeting HIV Vif and inhibiting production of CCR5.

41. The method of claim 36. wherein the at least one genetic element comprises: a) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 31;b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 1 and SEQ ID NO:3; c) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 2 and SEQ ID NO:3; d) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs:

1. 2 and NO:3; or e) a nucleotide sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NOs: 6, 7 and 97.

42. The method of claim 41, wherein the wherein the at least one genetic element comprises: a) SEQ ID NO: 31; b) SEQ ID NO: 1 and SEQ ID NO:3; c) SEQ ID NO: 2 and SEQ ID NO: 3; d) SEQ ID NOs: 1, 2 and 3; or e) SEQ ID NOs: 6, 7 and 97.

43. The method of claim 36, wherein the course of antiviral treatment comprises emtricitabine, rilpivirine, tenofovir alafenamide, bictegravir, dolutegravir and combinations thereof.

Images