Synthetic organelle-based method for recovering target product, DNA construct and expression system

Abstract

A synthetic organelle-based method for recovering a target product, a DNA construct and an expression system. Specifically, the method comprises: constructing a synthetic organelle in a host; collecting a target product using the synthetic organelle; recovering the synthetic organelle containing the target product; and releasing the target product from the synthetic organelle containing the target product to obtain the target product. Provided is a universal method for product recovery and / or purification, which has the advantages of simple steps, low cost, convenient implementation for scale-up and the capability of performing high-throughput parallel treatment.

Description

A target product recovery method, DNA construct and expression system based on synthetic organelles Technical Field

[0001] The present invention relates to a method for recovering a target product based on synthetic organelles, a DNA construct, and an expression system. More specifically, the present invention relates to a method for isolating, recovering, and purifying the target product by constructing the synthetic organelles in a host and controlling the process by which the synthetic organelles collect and release the target product. Background Art

[0002] Currently, the separation, recovery, and purification of various target products require complex process flows. These processes often require customized combinations of various chemical unit operations, such as extraction, chromatography, electrophoresis, centrifugation, and membrane treatment, based on the physical, chemical, and biological properties of the target product. While these processes can efficiently and specifically recover and purify products, they generally suffer from cumbersome steps, long processing times, and expensive equipment and consumables. Furthermore, these processes lack versatility, making high-throughput parallel processing difficult for the separation, recovery, and purification of different products.

[0003] For target products that can be artificially modified, such as recombinant proteins, affinity chromatography can be used for purification by connecting affinity tags. Although such a process flow has a certain degree of versatility, it involves affinity tag removal and secondary purification, so the steps are complicated and there is still a problem of high cost. The affinity tags suitable for different target proteins are not completely consistent, and different chromatography column fillers may need to be used. Since different target proteins have different migration speeds in the mobile phase, the flow rate used in the chromatography process and the time taken for each step will also be significantly different. Therefore, the recombinant protein affinity chromatography purification method based on affinity tags is also difficult to operate in parallel.

[0004] Some target products with special properties can use a simple and low-cost recovery method. For example, if the target product has a high solubility in a specific solvent, the target product can be enriched with the solvent and then separated and recovered. If the target product is a natural organelle in the cell, the cell can be broken and then subjected to gradient density centrifugation to obtain the organelle. Furthermore, if the target product is a molecule in a natural organelle, such as the mitochondrial genome, the organelle can be separated first and then broken to recover the target product. However, the process development of these methods is difficult and it is difficult to reuse them in the recovery and purification of other products.

[0005] CN112575016A discloses a “Construction and Application of Membraneless Organelles in Prokaryotes”, which successfully constructed membraneless compartments in Escherichia coli using recombinant spider silk protein and arthropod elastic protein-like proteins. Spider silk protein or arthropod elastic protein-like proteins were fused with different cargo proteins by DNA recombination technology to achieve intracellular co-localization of target functional proteins, thereby constructing membraneless compartments with biological activity. This method directly expresses fusion proteins. Although it has been successful to a certain extent and can form an enriched phase of cargo proteins in cells, the structure will be dissolved after the host cells are broken. Therefore, the structure lacks the spatial independence properties that organelles should have, resulting in the inability to be separated and recovered. In addition, the design of directly expressing fusion proteins will also result in low activity of the fused cargo proteins and limited specific expression of assembled proteins.

[0006] WO2023015190A1 discloses a method for controlling cellular processes in mammalian cells by synthesizing organelles, which utilizes an arginine / glycine (RGG) protein domain capable of liquid-liquid phase separation (LLPS) to fuse a high-affinity coiled-coil tag to enrich endogenous proteins that are also fused with a coiled-coil tag, thereby controlling the behavior of the cell by isolating or releasing the endogenous protein. This method fuses tags separately on the RGG protein that forms the organelle and the target protein, respectively, to better ensure the correct folding and activity of the target protein. However, since the goal of this method is to control the behavior of mammalian cells, the recruitment and release of the target protein by the synthetic organelle must occur within the mammalian cell. Therefore, this method cannot allow for the experimental steps of isolating and recovering the synthetic organelles from the host cell.

[0007] Therefore, there is a need for a technology that can isolate, recover and utilize synthetic organelles.

[0008] Summary of the Invention

[0009] In order to solve the above problems, the present invention provides a method for recovering a target product based on synthetic organelles, which constructs a synthetic organelle in a host and uses the synthetic organelle to collect and release the target product, thereby achieving separation, recovery and purification of the target product.

[0010] Specifically, if a synthetic organelle can be constructed in a host for product recovery, and if the target product can enter the synthetic organelle, or if the target product itself is produced in the synthetic organelle, then the synthetic organelle can be used to collect the target product, and then the synthetic organelle can be recovered and / or purified by releasing the target product by finally placing it in an eluent. This forms the present invention.

[0011] The synthetic organelles that can be used in the present invention can be either artificially synthesized membrane-structured organelles or artificially synthesized membraneless organelles. Preferably, the host is a cell system, and the synthetic organelles are membraneless organelles. Membraneless organelles are biomolecular condensates with distinct spatial independence formed by biomacromolecules through phase separation. Synthetic biomacromolecules that can be used to construct membraneless organelles in the present invention include nucleotide sequences that are repeated 10-1000 times continuously, such as triplets CAG, CCUG, GGGAA, GGGGCC, etc.; amino acid sequences that are repeated 3-500 times continuously, such as resilin-like peptides (RLP); intrinsic non-structural regions, such as FUS protein, ParB protein; multimerization of multiple biomacromolecules, such as PTB protein and UCUCU sequence repetitions, artificially designed binary protein two-dimensional structures, and artificially designed binary RNA two-dimensional structures.

[0012] The target product that can be used in the present invention can be any molecule or structure that is intended to be prepared. It can be a sample obtained from the external environment or a product of artificial host biosynthesis. It can be produced in the same host cell as the synthetic organelle or in a different host. Preferably, the biosynthetic pathway of at least one component of the target product is encoded by heterologous DNA, including: small molecules synthesized by heterologous biosynthesis, such as deoxyviolacein; recombinantly expressed polypeptides, proteins, RNA and DNA, such as green fluorescent protein, red fluorescent protein, T4 DNA ligase, 16S rRNA; and multi-component complexes, such as 30S ribosomal subunits, CRISPR-Cas and RNA complexes.

[0013] In one aspect, the present invention provides a method for recovering a target product based on synthesizing organelles, comprising the following steps:

[0014] a. Constructing synthetic organelles in the host,

[0015] b. using the synthetic organelles to collect the target product;

[0016] c. recovering the synthetic organelle containing the target product;

[0017] d. releasing the target product from the synthetic organelle containing the target product, thereby obtaining the target product.

[0018] In one embodiment, the synthetic organelle refers to an artificially designed compartmentalized structure. Preferably, the synthetic organelle refers to a membraneless organelle, which is a biomolecular condensate formed by polypeptides and / or proteins and / or DNA and / or RNA and / or nucleic acid-protein complexes in the host. More preferably, the synthetic organelle is constructed from biomacromolecule components selected from the following groups: a nucleotide sequence repeated 10-1000 times continuously, such as triplets CAG, CCUG, GGGAA, GGGGCC, etc.); an amino acid sequence repeated 3-500 times continuously, such as resilin-like peptides (RLP) repetitions; an intrinsic non-structural region, such as FUS protein, ParB protein; multimerization of multiple biomacromolecules, such as PTB protein and UCUCU sequence repetitions, an artificially designed binary protein two-dimensional structure, and an artificially designed binary RNA two-dimensional structure.

[0019] In one embodiment, the target product is one or more substances with a diameter ranging from 0.1 to 500 nanometers. Preferably, the target product is biosynthesized. More preferably, the biosynthetic pathway of at least one component of the target product is encoded by heterologous DNA, including: small molecules synthesized by heterologous biosynthesis, such as deoxyviolacein; recombinantly expressed polypeptides, proteins, RNA and DNA, such as green fluorescent protein, red fluorescent protein, T4 DNA ligase, 16S rRNA; and multi-component complexes, such as 30S ribosomal subunit, CRISPR-Cas9 / gRNA complex.

[0020] In one embodiment, step a comprises constructing a DNA construct, and introducing the DNA construct into a host to guide the formation of the synthetic organelle. The host includes a cell-free expression system and a cellular host, preferably a prokaryotic host, more preferably Escherichia coli.

[0021] In one embodiment, step b includes using the synthetic organelle to collect the target product. The collection method can be nonspecific and / or specific binding. The target product can originate from outside the synthetic organelle and / or be produced within the synthetic organelle. This process can be achieved through nonspecific diffusion and adsorption, or through specific intermolecular interactions. Simply configure a receptor domain within the constructed synthetic organelle and attach a corresponding ligand to the target product, so that the synthetic organelle has a receptor and the target product is attached to the ligand. This allows the synthetic organelle to specifically bind the target product while preventing other impurity molecules from entering the synthetic organelle. The target product can be produced within the synthetic organelle, for example, in one embodiment, deoxypurpurogenin is biosynthesized within the synthetic organelle. It can also be collected from the extracellular environment within the synthetic organelle. For example, in one embodiment, MS2 capsid protein is fused to the N-terminus of recombinant green fluorescent protein and MS2 hairpin RNA is fused to the 3' end of the CAG repeat. The synthetic organelle formed by liquid-liquid phase separation can specifically recruit GFP expressed in the cytoplasm. Preferably, the receptor / ligand pair includes: complementary paired nucleic acid molecules; capsid protein and translation operon RNA hairpin of RNA phages such as MS2, PP7, and Qbeta; protein N and B box (boxB) RNA hairpin of DNA phages such as λ, 21, and P22; CRISPR RNA hairpin and Cas6 protein of bacteria such as Pseudomonas aeruginosa; two segments of a split protein, such as split green fluorescent protein, alpha and omega segments of beta-galactosidase, split T7 RNA polymerase; inducible dimerization or multimerization monomers, such as the photoregulated multimeric green fluorescent protein Dronpa. Preferably, if in the host, the rate constant of the target product flowing into the synthetic organelle is higher than that of the outflow, the target product will be enriched in the synthetic organelle, thereby achieving a higher yield of the target product. This property can be achieved by the physicochemical properties of the synthetic organelles and the target product. For example, the various by-products produced in the biosynthetic small molecule deoxypurpurogenin and its biosynthetic pathway are poorly soluble in the aqueous phase and therefore are enriched in the RNA condensates synthesized within the cell. It can also be achieved by high-affinity receptors and ligands.

[0022] In one embodiment, the step c is to recover the synthetic organelle containing the target product from the host. Preferably, step c comprises separation, recovery, and purification of the synthetic organelle, preferably comprising the following steps:

[0023] c1. Collect and lyse the host;

[0024] c2. separating the precipitate containing the synthetic organelles, preferably, the separation method is centrifugation and / or filtration, suction filtration;

[0025] c3. Optionally, wash the precipitate to remove impurities, thereby obtaining a purer synthetic organelle.

[0026] In one embodiment, step d releases the target product from the synthetic organelle containing the target product. Preferably, step d comprises separating, recovering and purifying the target product, preferably comprising the following steps:

[0027] d1. Place the synthetic organelle in an eluent. Due to the permeability of the synthetic organelle to the target product, the target product will spontaneously diffuse into the eluent until equilibrium is reached.

[0028] Preferably, if the rate coefficient of the target product flowing out of the synthetic organelle is higher than that flowing into the eluent, the synthetic organelle can be induced to release the target product faster, thereby achieving a higher yield of the target product. This property can be achieved by using an eluent with a stronger affinity. For example, for deoxypurpurobacterium, the eluent methanol has a higher affinity than the synthetic organelle RNA aggregates. It can also be achieved by changing the affinity of the synthetic organelle, for example, using receptor and ligand pairs that are sensitive to temperature, light signals, pH, etc. More preferably, the connection between the target product and the ligand can be cut off, so that the synthetic organelle loses its specific binding to the target product, thereby allowing the synthetic organelle to efficiently release the target product without a ligand tag, for example, using nickel ions, factor Xa, enterokinase, dithiothreitol (DTT), thrombin or TEV protease to catalyze the breakage of the corresponding fusion hinge (fusion linker) between proteins, using imidazole to induce dCsy4 to cut the 3' end of the PA14 RNA hairpin, using ribozymes or inteins to catalyze self-cleavage, etc.

[0029] d2. Separating the precipitate containing the synthetic organelles to obtain an eluate containing the target product. Preferably, the separation method is centrifugation and / or filtration, or suction filtration;

[0030] d3. Optionally, impurities in the eluate are removed to obtain a target substance with higher purity. Preferably, separation and purification methods are used to remove by-products in the eluate, such as using molecular sieves to remove broken recombinant proteins and using dialysis to remove metal ion contamination.

[0031] On the other hand, the present invention provides a DNA construct comprising a nucleotide sequence 1 defined in the above method for guiding the host to construct the synthetic organelle, and a nucleotide sequence 2 for guiding and regulating the production of the target product. Preferably, the DNA construct is composed of the nucleotide sequences 1 and 2 and a plasmid vector, such as pACYC184, pACYC177, pET28a(+), pET28b(+), pET-5a(+), pET43.1a, pET-37b(+), pCDFDuet-1, pCOLADuet-1, pRSFDuet-1, pETDuet-1, pUC57, pUC19, pBAD, pBluescript II SK(+), pTrcHis C, pTrcHis A, pTrcHis2C, pBV221, pQE-70, pCold III. pRSET-CFP, pRSET-BFP, pGFPuv, pKD46, pKD4, pTYB1, PinPoint Xa-2, pTWIN1, pRSET C, pSB1C3, pSB3C5, pSB4C5, pSB4K5.

[0032] On the other hand, the present invention provides an expression system comprising the above-mentioned DNA construct. Preferably, the expression system refers to a system for simultaneously constructing the synthetic organelles and producing the target product in prokaryotic cells. More preferably, the expression system is an Escherichia coli expression system. Beneficial effects:

[0033] The recovery and purification of the target product of biosynthesis requires a complex process flow, which is generally a combination of multiple unit operations such as extraction, chromatography, electrophoresis, centrifugation, and membrane treatment. These process flows generally have defects such as cumbersome steps, long time, and expensive equipment and consumables. Taking the purification of recombinant proteins as an example, chromatography is usually used, but it has the following disadvantages: 1. The price of chromatography columns and fillers is expensive; 2. The chromatography column has a limited service life, and after each use of the chromatography filler, the chromatography filler must be cleaned before the next use; 3. Different chromatography methods need to be selected according to the different properties of molecules (including ion exchange chromatography, gel chromatography, molecular exclusion chromatography, hydrophobic chromatography and affinity chromatography, etc.). These shortcomings limit the versatility of chromatography and make it difficult to parallelize different process lines on a large scale.

[0034] The method of the present invention is versatile and can be used to recover and purify small molecules or ionic compounds, biomacromolecules, etc.; it is easy to operate, has a simple process, and is easy to scale up; it is low-cost and generally does not require the use of expensive equipment and / or consumables; it is highly standardized and can use basically the same process flow for different products, thereby enabling high-throughput parallel processing. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 shows gel electrophoresis images of the target product, sfGFP, purified using the rCAG-MS2 / tdMCP system. M: Prestained protein marker (GenScript, Catalog M00624); S1: Whole-cell sample induced for expression at 37°C for 12 hours, showing a distinct band of approximately 51 kDa representing sfGFP fused to the tdMCP-SNAC-tag; E1: Product recovered from organelles 24 hours after nickel cleavage of the SNAC-tag, showing a distinct band of approximately 28 kDa representing the target product, sfGFP; E2: Product obtained after 48 hours of cleavage; E3: Product obtained after 72 hours of cleavage.

[0036] Figure 2 shows the relative quantitative analysis results of sfGFP purified using the rCAG-MS2 / tdMCP system, using green fluorescence activity identification. The bar graph on the left shows the purification efficiency of each step. Lysis and separation refers to step c, the purification step in which whole cells are lysed and the organelles are precipitated to recover the target product; induced elution refers to step d, the step in which an inducer is added to the organelles to elute the target molecule. The right graph shows the activity ratio of the target product relative to the total protein in different samples. Error bars are calculated from the standard deviation of three replicate experiments.

[0037] Figure 3 shows gel electrophoresis images of the target product, T4 DNA ligase protein, purified using the rCAG-MS2 / tdMCP system. Lane 1: Uninduced whole cells; Lane 2: Whole cells induced at 37°C for 5 hours; Lane 3: S1: Supernatant from the first cell lysate after induction at 37°C for 5 hours; Lane 4: P1: Precipitate from the first cell lysate after induction at 37°C for 5 hours; Lane 5: S2: Supernatant from the second cell lysate after induction at 37°C for 5 hours; Lane 6: P2: Precipitate from the second cell lysate after induction at 37°C for 5 hours; Lane 7: W1: Supernatant from the buffer after washing the precipitate; Lane 8: W2: Supernatant from the buffer after washing the precipitate; Lane 9: F1: Supernatant from the cleavage product; Lane 10: C3: Residual precipitate after cleavage; Lane M1: Prestained protein marker (GenScript, Catalog M00624).

[0038] Figure 4 shows the relative quantitative analysis results of the target product, mKate2, purified using the RLP-GFP11 / GFP(1-10) system, using red fluorescence activity analysis. The bar graph on the left shows the purification efficiency of each step. Lysis and separation refers to step c, where whole cells are lysed and the organelle-enriched molecule is precipitated; and induced elution refers to step d, where an inducer is added to the organelles to elute the target molecule. The right graph shows the activity ratio of the target product relative to the total protein in different samples. Error bars are calculated from the standard deviation of three replicate experiments.

[0039] Figure 5 shows an agarose gel electrophoresis image of the system using protein B and protein A-dCsy4 to construct a synthetic organelle, with the PA14 CRISPR RNA hairpin as a ligand, to purify a 30S ribosomal subunit composed of heterologously expressed 16S rRNA and endogenous ribosomal proteins. The supernatant after lysis is a diffuse band of RNA released after whole-cell lysis, with a very weak signal; the precipitate before elution is the organelle precipitate after lysis, containing only a small amount of free protein A-dCsy4 containing RNA and the target product complex; the supernatant after elution is the target product released after the addition of imidazole to induce dCsy4 to cleave the PA14 CRISPR RNA. The arrow on the right indicates the molecular size before and after cleavage.

[0040] Figure 6 shows thin-layer chromatography images of synthetic organelles constructed using rCAG-BoxB or rCAG-MS2, demonstrating the nonspecific recovery of the target product, deoxypurpurogenin. In the sample on the left, the target product was biosynthesized outside the organelle using rCAG-BoxB; in the sample on the right, the target product was biosynthesized inside the organelle using rCAG-MS2. Arrows on the right indicate the eluted target product and byproduct impurities. DETAILED DESCRIPTION

[0041] The present invention is described in more detail below.

[0042] 1. Synthetic organelles

[0043] Cells typically possess complex spatial organization, one form of which is called compartmentalization. These compartmentalized structures, often called organelles, are to cells what organs are to individuals.

[0044] Organelles are either individually enclosed in their own lipid bilayers, called membrane-bound organelles, such as mitochondria and chloroplasts; or they are spatially independent functional units without a lipid bilayer around them, called membraneless organelles, which are also compartments observable under an optical microscope. In 2009, Hyman and Brangwynne discovered and revealed that membraneless organelles are formed by phase separation of biological macromolecules within the cell (1.CP Brangwynne et al., Germline P granules are liquid droplets that localize by controlled dissolution / condensation. Science 324, 1729-1732 (2009)).

[0045] Synthetic organelles are an innovative bioengineering concept, also known as "organelle-like structures," "artificial organelles," or "artificial organelles." Synthetic organelles aim to design and construct tiny functional units similar to natural organelles, designed to achieve compartmentalization within cells (or in vitro environments) and to control biosynthesis, metabolic pathways, or other biological processes. The construction of synthetic organelles involves introducing exogenous DNA constructs into host cells. These exogenous DNA, including exogenous coding genes, noncoding DNA, and regulatory elements, is used to guide cell-free expression systems or host cells to synthesize specific peptides, proteins, DNA, RNA, enzymes, or other biomolecules. Some of these molecules contribute to the construction of the synthetic organelle structure, while others carry out the synthetic organelle's intended functions, such as biocatalysis, receptor recognition, and protein sorting. Synthetic organelles can be formed through the self-assembly of heteropolymers of proteins, DNA, and RNA, or by modifying the cell's membrane structure. Since the phase separation mechanism of membraneless organelles was revealed, the construction of synthetic organelles can also be formed by the aggregation of biological macromolecules that can undergo phase separation.

[0046] The present invention provides methods for recovering target products using synthetic organelles. Synthetic organelles can be constructed primarily from polypeptides and / or proteins and / or DNA and / or RNA and / or nucleic acid-protein complexes. For example, after intracellular transcription, the repeating triplet of RNA (CAG)n spontaneously aggregates through liquid-liquid phase separation to form RNA condensates / droplets. Synthetic organelles can also contain other substances depending on the characteristics of the target product. For example, the P9 and P12 proteins expressed by φ6 bacteriophage can recruit lipid molecules to form membrane structures.

[0047] The biomacromolecule components for constructing synthetic membraneless organelles are selected from the following groups: nucleotide sequences repeated 10-1000 times continuously, such as triplets CAG, CCUG, GGGAA, GGGGCC, etc.; amino acid sequences repeated 3-500 times continuously, such as resilin-like peptides (RLP) repeats; intrinsic non-structural regions, such as FUS protein, ParB protein; multimerization of multiple biomacromolecules, such as PTB protein and UCUCU sequence repeats, artificially designed binary protein two-dimensional structures, and artificially designed binary RNA two-dimensional structures.

[0048] Of course, the synthetic organelles of the present invention can also be constructed from polypeptides and / or proteins and / or DNA and / or RNA and / or nucleic acid-protein complexes of other sequences, for example:

[0049] RNA:

[0050] o Repeating triplet RNAs, such as (CAG)n, (GGU)n, (AUG)n, (CGG)n, (GUU)n, (CGU)n, (AUU)n, (ACG)n, (AAU)n, (AUC)n, (CCG)n, (AGC)n, (AGU)n, (ACU)n, where n is 10-1000;

[0051] ○ Repeating quadruplex RNA, such as (CCUG)n, where n is 10 to 1000;

[0052] ○ Repeating pentamido RNA, such as (GGGAA)n, where n is 10-1000;

[0053] Repeating hexanucleotides, such as GGGGCC (rGGGGCC), i.e., (GGGGCC)n, (AGGGCC)n, (GGAGCC)n, (GGGGAC)n, (AGGACC)n, where n is 10-1000;

[0054] ○ Mono-synthetic RNA scaffold, for example (underlined and bolded "XX--XX" represent sites where functional aptamers or ribozymes can be inserted):

[0055] ○ Binary synthetic RNA scaffold, for example (underlined and bolded "XX--XX" represent sites where functional aptamers or ribozymes can be inserted): d2-1 with d2-2GGGTAGTTGTTATGGATTCCTGATTTATGGGXX--XXCCACTAGT;

[0056] DNA:

[0057] ○ ssDNA sequence identical to the above RNA sequence;

[0058] ○ ssDNA capable of forming nanopolymers, such as the following four ssDNA nanopolymers (the underlined "XX--XX" represents the site where a functional nucleic acid aptamer or ribozyme can be inserted): oligo-1TGCGCAATCCCXX--XXCTTGAGCACGCCAACATCACCGTATTT, oligo-2GCGGCTAGCAGAGCATTCGGGAXX--XXGACTATGGCTGTATTT, oligo-3GGCGTGCTCACXX--XXTCGGATTGCGCATGCTAGCCGCTATTT, oligo-4CGGTGATGTTCAGCCATAGTAGXX--XXGCCGAATGCTCTATTT, etc.;

[0059] ·protein:

[0060] Self-assembled protein nanoparticles and nanostructures, such as carboxysome shell proteins; metabolosome shell proteins; bacterial microcompartment (BMC) shell proteins BMC-H, BMC-T, and BMC-P; Haliangium ochraceum bacterial microcompartment capsid protein T1 (HO BMC Shell T1); Thermotoga maritima encapsulation protein EncTm; hybrid bacteriophage Qβ virus-like particles; ferritin; synthetic protein nanocages, such as antibody Fc nanocages; synthetic protein self-assembled fibers, such as CC-Di-B–PduA protein; synthetic protein self-assembled two-dimensional structures; synthetic protein self-assembled three-dimensional structures, such as ATC-HL3 protein;

[0061] Intrinsically disordered proteins (IDPs), such as resilin-like peptides (RLPs); elastin-like peptides (ELPs); RNA helicase LAF-1 RGG domain repeats; RNA helicase DDX4; Caulobacter crescentus nuclease E (RNaseE); IDP homologous protein sequence (GRGDSPYS)n, and mutants (GRGDSPYSGRGDSPYSGRGDSPYSGRGDSPVS)n, (GRGDSPYSGRGDSPVS)n, where n is 3-500; ParB protein; FUS protein; IbpA protein; PopZ protein; PodJ protein; conserved nuclear polar protein fibrillarin FIB-1;

[0062] ○ Protein amyloid deposition, such as AEAEAKAKAAEAEAKAK, LELELKLKLELELKLK, and human b-amyloid peptide Ab42 (F19D);

[0063] Other proteins that can aggregate include: Escherichia coli beta-galactosidase; MalE31 maltose binding protein mutant; Clostridium cellulovorans cellulose binding domain (CBD); Clostridium thermocellum endoglucanase D (EGD); Brucella abortus)-derived proteins and fluorescent proteins, PdhS-mCherry, FumC-YFP, DivK-YFP; Escherichia coli (E. coli)-derived proteins and fluorescent proteins, ClpX-sfGFP, ClpP-sfGFP, ClpP-mCherry, ClpX-mCherry, ClpX-mCherry2, ClpX-Venus, LacZ-Dronpa, TetR-Dronpa, P22C2-Dronpa, HKCI-Dronpa; tandem repeat SH3 (polySH3) and tandem repeat PRM (polyPRM); tandem repeat SIM (polySIM) and tandem repeat SUMO (polySUMO); pentameric nuclear polar protein Npm1, etc.

[0064] Nucleic acid protein polymer complex:

[0065] Aggregates of long non-coding RNA (lncRNA) and RNA-binding proteins, including nucleic acid scaffolds such as mammalian nuclear paraspeckle assembly transcript 1 isoform 2 in paraspeckles; intergenic spacer lncRNA in amyloid bodies; human satellite III (SatIII) lncRNA in nuclear stress bodies; Drosophila heat shock RNA (Hsr) ω; fission yeast meiRNA; and RNA-binding proteins such as PTB protein; FUS protein; and histone BRD4.

[0066] ○ Peptide sequences and polynucleotides, such as the peptide RRASLRRASL and polyuridylic acid (polyU) with a molecular weight of 600–1,000 kDa; synthetic peptides RP3, SR8, and polyU, etc.

[0067] Synthetic organelles can be constructed entirely from biological molecules synthesized by the host under the guidance of exogenous DNA constructs, or they can be constructed by combining some exogenous molecules with endogenous molecules of the host, or they can be modified from the original endogenous organelles or cytoskeleton structures in the host. For example, in a method for achieving codon expansion using synthetic organelles disclosed in EP 19157257.7, the synthetic organelles are formed by exogenously expressed PylRS::FUS::KIF16B1-400 fusion protein, MCP::EWSR1::KIF16B1-400 fusion protein and endogenous microtubule cytoskeleton structure.

[0068] It should be noted that, while the synthetic organelles described herein can be constructed using a variety of methods and have no particular requirements for the origin of their components, they must be spatially independent structures capable of being isolated and recovered. For example, in one embodiment, the host is an Escherichia coli cell, and the synthetic organelle is constructed from 46 repeats of the triplet RNA CAG. After cell disruption and centrifugation, the synthetic organelle is located in the precipitate, while impurities such as the cytoplasmic matrix are located in the supernatant. As a counterexample, if the biomacromolecules form a specific spatial distribution in the host but fail to condense into an independent spatial structure, they cannot be separated from the cytoplasmic matrix. For example, the membraneless compartment disclosed in CN112575016A "Construction and Application of Membraneless Organelles in Prokaryotes" is a soluble protein-enriched phase formed by recombinant spider silk protein or arthropod elastic protein. After the host cells are disrupted, the fusion protein composed of spider silk protein or arthropod elastic protein and the target functional protein is mainly present in the supernatant after centrifugation, indicating that the membraneless compartment is not a structure that exists independently of the cytoplasmic matrix. Therefore, although it is also called a "membraneless organelle", it cannot be separated and recovered and does not fall within the scope of the synthetic organelles described in the present invention.

[0069] 2. Collection of target products by synthetic organelles

[0070] Organelles generally possess the properties of selective permeability and biomolecule sorting. Consequently, the biomolecule composition and physicochemical properties within the organelle compartments are significantly different from those of components outside the organelle (e.g., the cytoplasmic matrix), enabling the organelles to perform specialized functions. The present invention designs the properties of synthetic organelles and / or target products to enable the synthetic organelles to collect the target products.

[0071] In the present invention, the collection of the target product in the synthetic organelle can be achieved by non-specific diffusion and adsorption, and preferably, it can also be achieved by specific biomacromolecule interactions, that is, a receptor domain is configured in the constructed synthetic organelle, and a corresponding ligand is connected to the target product. The ligand specifically targets the receptor, and through this action, the synthetic organelle can specifically bind to the target product. Both the receptor and the ligand can be selected as needed. For example, in one embodiment, the recruited ligand is a tandem-dimer MS2 coat protein (tdMCP) and the receptor is an MS2 hairpin RNA aptamer. In another embodiment, the ligand is protein N and the receptor is a BoxB hairpin RNA aptamer. Other ligand / receptor pairs can also be used as needed, for example:

[0072] ● Nucleic acid molecules with complementary sequences;

[0073] RNA-binding proteins and their corresponding RNAs, such as:

[0074] ○ RNA phage capsid protein and translation operon RNA hairpin, including RNA phages MS2, PP7, Qbeta, etc.

[0075] ○ DNA phage protein N and B box (boxB) RNA hairpin, DNA phages include λ, 21, P22, etc.

[0076] CRISPR Cas proteins and CRISPR RNA hairpins, such as Csy4 (Cas6f) and the PA14 RNA hairpin from Pseudomonas aeruginosa PA14 strain;

[0077] ○ Other binding pairs, such as PUF-8 and 5′-UGUANAUA-3′; FBF-2 and 5′-UGURNNAUA-3′; protein A and protein A binding aptamer; archaeal RNA binding protein L7Ae and RNA C / D box, etc.

[0078] DNA-binding proteins and their corresponding DNA, for example: TetR and the tetO operator; cI repressor protein and the cI operator; Gal4 and its corresponding DNA; Zif268 DNA-binding domain and the GATGCTGCA sequence; Gli-1 DNA-binding domain and the GACCACCCAAGACGA sequence; LexA DNA-binding domain and the CTGTATATATATACAG sequence; Transcription activator-like (TAL) domain and its corresponding DNA;

[0079] ●Homodimers or multimers, such as the reversible green fluorescent protein Dronpa;

[0080] Split proteins, for example: split fluorescent proteins, such as green fluorescent proteins GFP1-10 and GFP11; split β-galactosidase; split T7 polymerase; split esterase; split TEV protease; split dihydrofolate reductase; split β-lactamase; split firefly luciferase; split thymidine kinase; split chorismate mutase; split CRISPR-Cas9; split horseradish peroxidase, etc.

[0081] ●Antigens and specific antibodies, such as: His tag and anti-his antibody; flag tag and anti-flag antibody; HA tag and anti-HA antibody; Myc tag and anti-Myc antibody; GST protein and anti-GST antibody;

[0082] Other protein-protein binding pairs, such as the SYNZIP peptide pair; the SZ17 and SZ18 pair; the Fos and Jun pair; and the Arabidopsis thaliana phytochrome B (PhyB) and PIF3 or PIF6 proteins.

[0083] Of course, receptors and ligands do not necessarily have to be paired between two molecules, but can also form complex multi-component complexes between multiple components, such as the quaternary complex of CRISPR-Cas9 protein, crRNA, tracrRNA, and crRNA targeting DNA; and the ternary complex of FKBP protein, FRB protein, and rapamycin.

[0084] In the synthetic organelle, the receptor can be covalently linked to the component of the synthetic organelle structure, for example, in one embodiment, the receptor MS2 hairpin RNA aptamer and the CAG repeat nucleotides of the synthetic organelle structure constitute a fusion RNA molecule, for example, in another embodiment, the receptor dCsy4 and the protein A of the synthetic organelle structure constitute a fusion protein molecule. Of course, the receptor can also be assembled into the synthetic organelle through non-covalent intermolecular interactions. For example, the CAG repeat nucleotides of the synthetic organelle structure are fused to the MS2 hairpin RNA aptamer, and the MS2 hairpin RNA aptamer non-covalently binds to the fusion protein of tdMCP-His tag, and the His tag non-publicly binds to the fusion protein of anti-His antibody and PhyB, then PhyB acts as a receptor, and the synthetic organelle can specifically bind to the protein connected with the ligand PIF3 or PIF6. The synthetic organelle can have one to multiple receptors of different properties.

[0085] The connection between the ligand and the target product can be a covalent connection. For example, in one embodiment, the ligand tdMCP and the target product green fluorescent protein constitute a fusion protein. For example, in another embodiment, the ligand CRISPR RNA hairpin structure and the target product 16S rRNA constitute a fusion RNA molecule. Of course, the ligand can also be connected to the target product through non-covalent intermolecular interactions. For example, through intermolecular interactions, the target product Dronpa145N mutant can form a heterodimer with the ligand tdMCP-Dronpa145K, which can be specifically recruited by the synthetic organelle with MS2 hairpin RNA. The synthetic organelle is then separated and recovered, and the dissociation of Dronpa145N and tdMCP-Dronpa145K is induced by 500nm light to obtain Dronpa145N. The target product can also be connected to one or more ligands.

[0086] In the present invention, during the collection process in step b, the target product can be obtained from outside the synthetic organelle and then collected by the synthetic organelle. For example, in one embodiment, the heterologous green fluorescent protein GFP is expressed in the cytoplasmic matrix; or it can be directly produced in the synthetic organelle. For example, in one embodiment, the biosynthetic small molecule deoxypurpurogenin is directly biosynthesized in the synthetic organelle composed of RNA.

[0087] In the present invention, during the collection process in step b), the rate constant of the target product flowing into the synthetic organelle does not necessarily need to be higher than the rate constant of its outflow from the synthetic organelle. The target product will also be partially distributed in the synthetic organelle, thereby achieving collection of the target product by the synthetic organelle. However, preferably, if the inflow rate constant is higher than the outflow rate constant, the target product will be enriched in the synthetic organelle, thereby achieving a higher yield of the target product. Collection of the target product in the synthetic organelle can be achieved by physicochemical properties. For example, in one embodiment, the biosynthesized small molecule deoxyviolacein is poorly soluble in aqueous phases but readily soluble in organic phases. Therefore, in cells, deoxyviolacein will be enriched in synthetic organelles composed of RNA. It can also be achieved by high-affinity receptors and ligands. For example, in one embodiment, the recruited ligand is a CRISPR RNA hairpin structure and the receptor is the corresponding CRISPR Cas protein Csy4. Step b can be performed in a specific buffer, but more preferably, step b occurs in the host, simultaneously with the production of the target product, to shorten the process time and reduce operational complexity.

[0088] 3. Release of target products by synthetic organelles

[0089] The present invention designs the properties of the synthetic organelles and / or the target product and / or the eluent so that the target product can be released after the synthetic organelles are mixed with the eluent.

[0090] In the present invention, the rate constant at which the target product exits the synthetic organelle in the eluent does not necessarily need to be higher than the rate constant at which it enters the eluent; the target product can also be partially distributed in the eluent, thereby achieving recovery of the target product. However, preferably, if the rate constant at which the target product exits the eluent is higher than the rate constant at which it enters the eluent, the synthetic organelle can be induced to release the target product at an accelerated rate, thereby achieving a higher yield of the target product.

[0091] This property can be achieved by using an eluent with a stronger affinity. For example, in one embodiment, the solubility of Bacillus deoxygenase in the eluent methanol is higher than that of the synthetic organelles, and thus can be released from the synthetic organelles.

[0092] This property can also be achieved by altering the synthetic organelle's affinity for the target product. If the synthetic organelle uses a receptor to specifically recruit the target product attached to a ligand, then altering the affinity between the receptor and the ligand can accelerate the release of the target product. For example, using a receptor and ligand pair that is sensitive to temperature, light signals, pH, etc., can induce the synthetic organelle to release the target product through these signals.

[0093] More preferably, the connection of the target product and the ligand can be destroyed, so that the synthetic organelle loses affinity for the target product, thereby inducing the synthetic organelle to efficiently release the target product without ligand label, for example, in one embodiment, SNAC-tag is used to connect the ligand protein to the target product protein, and nickel ions are used to induce SNAC-tag fracture so that the synthetic organelle releases the target product protein; for example, in another embodiment, the target product 16S rRNA and the ligand are CRISPR repeats hairpin RNA to form a fusion RNA molecule, and the ligand is bound by the receptor dCsy4, and imidazole is used to induce dCsy4 to cut the 3' end of CRISPR repeat hairpin RNA, so that the synthetic organelle releases the target product RNA. Destroying the connection of the target product and the ligand can also be other ways, such as using Xa factor (factor Xa), enterokinase (Enterokinase), dithiothreitol (DTT), thrombin (Thrombin) or TEV protease to cut the corresponding polypeptide sequence, using ribozymes or inteins to catalyze self-cleavage, etc.

[0094] 4. Target product

[0095] The target product involved in the present invention can be any molecule or structure intended to be produced. The target product is not necessarily a biosynthetic molecule. For example, the target product can be a heavy metal ion in industrial wastewater or glucose absorbed by the host cell from the environment.

[0096] Preferably, the target product is a biosynthetic molecule. For example, a biosynthetic small molecule, natural compounds of microbial origin such as violacein, deoxyviolacein, antibiotics, and psilocybin, natural compounds of animal and plant origin such as carotenoids, indigo, artemisinin, 4-methyloctanoic acid, 4-methylnonanoic acid, 8-10 carbon branched unsaturated fatty acids, cochineal carmine, and paclitaxel; or a recombinant polypeptide or protein, such as superfolder green fluorescent protein (sfGFP), red fluorescent protein mKate2, T4 DNA ligase, or artificially designed polypeptides; or a recombinant RNA, such as Escherichia coli 16S rRNA; or a DNA, such as a recombinant plasmid or single-stranded DNA; or a complex formed by a recombinant macromolecule and an endogenous macromolecule, such as the 30S ribosomal subunit formed by the assembly of recombinantly expressed 16S rRNA and endogenous ribosomal proteins; or other cellular structures different from the synthetic organelles, such as the cytoskeleton or other organelles.

[0097] Preferably, the biosynthetic pathway of at least one component of the target product is encoded by heterologous DNA, which facilitates the regulation of the biosynthesis of the target product, the connection of the target product with a suitable ligand, and the optimization of the recovery efficiency of the target product.

[0098] The target product may be a mixture of multiple substances, such as a 1:1 mixture of green fluorescent protein and red fluorescent protein.

[0099] The target product can be biosynthesized in the synthetic organelle or in a matrix outside the synthetic organelle.

[0100] 5. DNA constructs

[0101] The present invention introduces an artificially designed DNA construct into the host. The DNA construct is a polynucleotide containing multiple coding genes, non-coding DNA, regulatory elements, etc.

[0102] The DNA construct can guide the host to construct a synthetic organelle. For example, in one embodiment, the synthetic organelle is constructed from an RNA molecule containing CAG triplet nucleotide repeats. The DNA construct comprises a nucleotide sequence that expresses the RNA molecule, including a CAG triplet nucleotide repeat sequence, a transcription terminator, and a promoter that regulates induced expression.

[0103] The DNA construct may also contain nucleotide sequences that regulate the host's production of the target product. For example, in one embodiment, the DNA construct contains genes encoding the four enzymes VioA, VioB, VioE, and VioC that synthesize deoxyviolacein. For example, the DNA construct may contain synthetic RNA that regulates the host's metabolic pathways to increase the host's tryptophan production.

[0104] The DNA constructs involved in the present invention can be one or more plasmids, cosmids, artificial chromosomes, or can be integrated into a single or multiple sites in the host genome, as well as permutations and combinations of the above. Preferably, the DNA construct is a plasmid, which is composed of the nucleotide sequence that directs the host to construct synthetic organelles and produce the target product, and a plasmid vector. The plasmid vector can be a commercial vector, such as pACYC184, pACYC177, pET28a(+), pET28b(+), pET-5a(+), pET43.1a, pET-37b(+), pCDFDuet-1, pCOLADuet-1, pRSFDuet-1, pETDuet-1, pUC57, pUC19, pBAD, pBluescript II SK(+), pTrcHis C, pTrcHis A, pTrcHis2C, pBV221, pQE-70, pCold III, pRSET-CFP, pRSET-BFP, pGFPuv, pKD46, pKD4, pTYB1, PinPoint Xa-2, pTWIN1 or pRSET C, or a modified structure of a commercial vector, or a non-commercial vector, such as pSB1C3, pSB3C5, pSB4C5, pSB4K5, or other artificially designed nucleotide sequences capable of stably replicating in host cells. For example, in one embodiment, the DNA construct is a two-plasmid system, wherein one plasmid directs the host to synthesize a synthetic organelle constructed by a CAG triplet repeat RNA molecule, and the vector is a variant of pACYC184, and the other plasmid directs the host to express the recombinant protein sfGFP linked to the ligand tdMCP, and the vector is pET28a(+).

[0105] 6. Expression System

[0106] The above-mentioned DNA construct is introduced into the host for expression, guiding the host to construct a synthetic organelle, and / or regulating the host to produce the target product. The expression system can be a cell-free expression system and / or a cell expression system. Wherein the cell expression system includes prokaryotic cells and eukaryotic cells, eukaryotic cells such as yeast, fungal cells, animal cells or plant cells, or prokaryotic cells, such as Escherichia coli, Bacillus subtilis, lactic acid bacteria, Bifidobacterium, Streptomyces. The prokaryotic expression system has the advantages of rapid cell reproduction, low culture cost and high yield, and is preferred, wherein Escherichia coli is more preferred. For example, in one embodiment, the DNA construct is a three-plasmid, and the expression system is an Escherichia coli expression system, and the three plasmids are co-expressed in Escherichia coli, one of which guides the host to construct a synthetic organelle, and the other two guide the host to synthesize deoxypurpurogenin. The expression system may also involve the combination of multiple systems. For example, a cell-free expression system is used to biosynthesize small molecule compounds that are highly toxic to cell growth, such as paclitaxel, and an Escherichia coli expression system is used to construct a synthetic organelle that can recruit paclitaxel. The Escherichia coli is then lysed and mixed with the former cell-free expression system, and the synthetic organelle is then recovered, and finally paclitaxel is recovered from the synthetic organelle.

[0107] 7. Target product recovery method

[0108] The present invention provides a method for recovering a target product based on synthesizing organelles, which comprises the following steps:

[0109] a. Constructing synthetic organelles in the host,

[0110] b. using the synthetic organelles to collect the target product;

[0111] c. recovering the synthetic organelle;

[0112] d. releasing the target product from the synthetic organelle, thereby obtaining the target product.

[0113] More specifically, step a refers to introducing a DNA construct into a host to guide the host to construct a synthetic organelle; step b refers to using the synthetic organelle to collect the target product; step c includes separating, recovering, and purifying the synthetic organelle; and step d includes releasing the target product from the synthetic organelle for separation, recovery, and purification of the target product.

[0114] Preferably, steps a and b are the process of simultaneously constructing synthetic organelles in a single host cell, biosynthesizing the target product, and specifically enriching the target product in the synthetic organelles, step c is the separation, recovery, and purification of the synthetic organelles, and step d is the separation, recovery, and purification of the target product, including:

[0115] c1. Collect and lyse the host;

[0116] c2. separating the precipitate containing the synthetic organelles, preferably, the separation method is centrifugation and / or filtration;

[0117] c3. Optionally, washing the precipitate to remove impurities, thereby obtaining a purer synthetic organelle;

[0118] d1. placing the synthetic organelle in an eluent and inducing the synthetic organelle to release the target product, preferably, the induction method is a cleavage reaction, using a catalyst to cut the connection site between the ligand and the target substance, the catalyst is such as nickel ions, imidazole-induced dCsy4, Xa factor (factor Xa), enterokinase (Enterokinase), dithiothreitol (DTT), thrombin (Thrombin) or TEV protease;

[0119] d2. separating the precipitate containing the synthetic organelles to obtain an eluate containing the target product, preferably, the separation method is centrifugation and / or filtration;

[0120] d3. Optionally, remove impurities in the eluent to obtain the target substance with higher purity.

[0121] Example

[0122] Example 1. Purification of fluorescent protein using nucleic acid phase separation synthesized organelles composed of CAG repeat sequences

[0123] System Design

[0124] In this example, the molecule that constitutes the synthetic organelle is an RNA fragment consisting of 46 CAG repeats, which can interact to produce liquid-liquid phase separation. This example uses the tandem-dimer MS2 coat protein (tdMCP) as a ligand and the MS2 RNA hairpin as a receptor to enrich the superfolder green fluorescent protein (sfGFP). A SNAC tag, which is self-cleavable by divalent nickel ions, serves as a fusion linker and cleavage site between tdMCP and sfGFP. Two plasmids, pGFP and prCAG-MS2, were used to express the tdMCP-SNAC-sfGFP fusion protein and rCAG-MS2 RNA, respectively. The experimental process was performed according to the following protocol.

[0125] Experimental Procedure

[0126] pGFP and prCAG-MS2 were co-transformed into Escherichia coli BL21 (DE3) competent cells (Full Gold). Single clones were picked and cultured at 37°C and 220 rpm for 16 hours. Inducers were added to the flask, including 0.5 mM isopropylthio-β-galactopyranoside (IPTG) (Sangon) and 150 ng / ml tetracycline hydrochloride (aTc) (B&K), and expression was induced and cultured overnight for about 12 hours. The bacterial solution was centrifuged and the supernatant was removed. Lysis buffer (One-step Lysis Kit, Sangon) was added to the precipitate, pipetted to mix, reacted at room temperature for 30 minutes, then centrifuged, the supernatant was discarded, and the precipitate was recovered. A nickel-ion-containing cleavage eluent was added to the precipitate obtained in the previous step, and the precipitate was cleaved on a rotary mixer at room temperature. The sample after the cleavage reaction was centrifuged, and the supernatant, which is the solution containing the target product protein, was recovered.

[0127] Afterwards, protein samples were detected by SDS PAGE electrophoresis (SurePAGE TM , GenScript), was used to assess the size, yield, and purity of the recovered proteins.

[0128] The whole cells / precipitate after the first lysis / supernatant after elution were taken separately to detect the total protein / corresponding fluorescence. After subtracting the background from the data, the three indicators of specific activity (SA), purification efficiency (PF) and yield were calculated. Among them, the specific activity represents the proportion of the target product in the sample of each step relative to the total protein, and the purification efficiency is the ratio of the specific activity in the samples before and after each step, which is used to characterize the efficiency of each step. The yield is calculated as the ratio of the total amount of target product in the sample of each step to the total amount before purification, which is used to evaluate the yield of the final purification.

[0129] result

[0130] The results are shown in Figures 1 and 2. The gel images demonstrate that the final eluted sfGFP is highly pure, with no discernible contaminants. Semi-quantitative analysis revealed that the purification efficiency of the product in the synthetic organelle recovery step was approximately 1.5 times higher, and that in the target product recovery step was approximately 2 times higher. The characteristic activity of the product was significantly increased in both steps, demonstrating that the system combined with the synthetic organelle and the corresponding process in this example can be used for product purification.

[0131] Sequence Details

[0132] The size of sfGFP is 26 kDa, and the protein sequence is shown in SEQ ID NO: 1 below:

[0133] The RNA sequence of rCAG-MS2 is shown in SEQ ID NO: 2 below:

[0134] The protein sequence of tdMCP is shown in SEQ ID NO: 3 below:

[0135] The SNAC-tag protein sequence is shown in SEQ ID NO: 4 below:

[0136] Example 2. Phase separation synthesis of organelles and enzyme purification using nucleic acid composed of CAG repeats

[0137] System Design

[0138] In this example, the molecules that comprise the synthetic organelles, receptors, and ligands, and the mechanism for cleavage and product release, are identical to those in Example 1, except that the target product is T4 DNA ligase. Two plasmids, pT4 and prCAG-MS2, were used to express the tdMCP-SNAC-T4 DNA ligase fusion protein and rCAG-MS2 RNA, respectively. The experiment was conducted using the following workflow.

[0139] Experimental Procedure

[0140] pT4 and prCAG-MS2 were co-transformed into Escherichia coli BL21 (DE3) competent cells (Full Gold). Single clones were picked and cultured at 37°C and 220 rpm for 16 hours. Inducers were added to the flask to 0.5 mM isopropylthio-β-galactopyranoside (IPTG) (Sangon) and 150 ng / ml anhydrotetracycline hydrochloride (aTc) (B&K), and expression was induced for approximately 5 hours. The bacterial solution was centrifuged and the supernatant removed. Lysis buffer (One-step Lysis Kit, Sangon) was added to the precipitate, pipetted to mix, and reacted at room temperature for 30 minutes, i.e., the first lysis. The supernatant and precipitate were then separated by centrifugation. The precipitate obtained in the previous step was added with lysis buffer, pipetted to mix, and reacted at room temperature for 30 minutes, i.e., the second lysis. The supernatant and precipitate were then separated by centrifugation. The precipitate obtained in the previous step was added with 10-fold diluted lysis buffer, pipetted to mix, and centrifuged to separate the supernatant and precipitate, i.e., the first rinse. The precipitate obtained in the previous step was added with the lysis buffer diluted 10 times, pipetted and mixed, and then centrifuged to separate the supernatant and precipitate, i.e., the second wash. The precipitate obtained in the previous step was added with a cutting eluent containing nickel ions and placed on a rotary mixer for cutting at room temperature. The sample after the cutting reaction was centrifuged and the supernatant was recovered, i.e., the solution containing the target product protein. Afterwards, the protein sample was detected by SDS PAGE electrophoresis (SurePAGE TM , GenScript), was used to assess the size, yield, and purity of the recovered proteins.

[0141] result

[0142] The results are shown in Figure 3. The gel image shows that the final eluted T4 DNA ligase is highly pure, with no obvious impurities. Multiple washes can remove small amounts of impurities.

[0143] Sequence Details

[0144] The size of T4 DNA ligase is 55.3 kDa, and its protein sequence is shown in SEQ ID NO: 5 below:

[0145] Example 3. Purification of proteins using phase separation of proteins composed of RLP repeats to synthesize organelles

[0146] System Design

[0147] In this example, the molecules that make up the synthetic organelles are 20 repeating polypeptide segments of resilin-like peptides (RLPs), which can interact to produce liquid-liquid phase separation. In this example, the two halves of split green fluorescent protein (split GFP), GFP1-10 and GFP11, serve as ligand and receptor, respectively, to enrich the target product, the red fluorescent protein mKate2. GFP1-10 and mKate2 are linked using a SNAC-tag. Two plasmids, pET28a-RLP-sfGFP(1-10) and pCDF-sfGFP11-SNAC-mKate2, were used to express the 20xRLP-7xGFP11 fusion protein and the GFP(1-10)-SNAC-mKate2 fusion protein, respectively.

[0148] Experimental operation

[0149] The two plasmids pET28a-RLP-sfGFP (1-10) and pCDF-sfGFP11-SNAC-mKate2 were co-transformed into Escherichia coli BL21 (DE3) competent cells (Full Gold). Single clones were picked and the bacterial solution was cultured at 37°C and 220rpm for 16 hours. Inducers were added to the bottle to 0.5mM IPTG (Sangong) and 150ng / ml aTc (B&K), and cultured overnight for about 12 hours. The bacterial solution was centrifuged and the supernatant was removed. Lysis buffer (one-step lysis kit, Sangon) was added to the precipitate, pipetted to mix, and reacted at room temperature for 30 minutes. A cutting buffer containing nickel ions was added to the precipitate obtained in the previous step, and the elution was carried out on a rotary mixer at room temperature. The sample after the cleavage reaction was centrifuged and the supernatant was recovered, which was the solution containing the target product protein.

[0150] Afterwards, the total protein and corresponding fluorescence levels were detected in the whole cells, the precipitate after the first lysis, and the supernatant after elution. After subtracting the background from the data, the characteristic activity, purification efficiency, and yield were calculated. The characteristic activity represents the ratio of the target product to the total protein in the sample at each step, and the purification efficiency is the ratio of the characteristic activity in the samples before and after each step, which is used to characterize the efficiency of each step. The yield is calculated as the ratio of the total amount of target product in the sample at each step to the total amount before purification, which is used to evaluate the yield of the final purification.

[0151] Result Analysis

[0152] The specific results are shown in Figure 4. Semi-quantitative analysis showed that the purification efficiency of the mKate2 product reached 1.76 for the two steps combined, and the characteristic activity of the product was significantly different from that before purification, proving that when the synthetic organelles are composed of proteins and the interacting proteins are used as receptors / ligands, the system and process can be used for product recovery and purification. In particular, the characteristic activity of the product in the step of recovering the synthetic organelles decreased, and the product purification efficiency was about 0.6 times, indicating that the proportion of mKate2 in the synthetic organelles is actually significantly smaller than its proportion in the total cells. Therefore, this result shows that in the present invention, even if the affinity of the synthetic organelles is not enough to achieve the enrichment of the target product in the synthetic organelles relative to the extracellular cytoplasmic matrix, step b can still be used for the recovery and purification of the target product.

[0153] Sequence Details

[0154] The 7xGFP11 protein sequence size is as shown in the following SEQ ID NO: 6:

[0155] The GFP1-10 protein sequence is shown in SEQ ID NO: 7 below:

[0156] The protein sequence of mKate2 is shown in SEQ ID NO:8 below:

[0157] The 20-repeat RLP has a size of 17 kDa and a protein sequence as shown in SEQ ID NO: 9:

[0158] Example 4. Purification of RNA using synthetic organelles composed of artificially designed binary protein two-dimensional structures

[0159] System Design

[0160] In this example, the molecules that comprise the synthetic organelles are two artificially designed proteins, A and B. Proteins A and B can self-assemble within the cell to form two-dimensional planar nanostructures. The receptor used in this example is a conditionally inactive mutant of the CRISPR Cas protein Csy4, selected from the Pseudomonas aeruginosa strain PA14. The ligand is the corresponding CRISPR RNA hairpin sequence (PA14 RNA). The target product is the 30S ribosomal subunit assembled from recombinantly expressed 16S rRNA from Escherichia coli (E. coli) and endogenous ribosomal proteins. PA14 RNA and 16S rRNA are directly linked to form a fusion RNA molecule. The dCsy4 protein fused to protein A can specifically recognize and bind to PA14 RNA and, under imidazole-induced cleavage, cleaves the 3' end of the PA14 RNA, releasing the target product. Two plasmids were used in this example, expressing protein B, the protein A-dCsy4 fusion protein, and the PA14-16S rRNA, respectively. The experiment was carried out according to the following procedure.

[0161] Experimental Procedure

[0162] The two plasmids were co-transformed into Escherichia coli BL21 (DE3) competent cells (Full Gold). Single clones were picked and the bacterial solution was cultured at 37°C and 220rpm for 16 hours. Inducers were added to the bottle to 0.5mM IPTG (Sangong) and 150ng / ml aTc (B&K) and cultured overnight. The bacterial solution was centrifuged and the supernatant was removed. Lysis buffer (one-step bacterial lysis kit, Sangon) was added to the precipitate and mixed by pipetting. The reaction was allowed to react at room temperature for 30 minutes. An eluent containing 300mM imidazole was added to the precipitate obtained in the previous step and eluted on a rotary mixer at room temperature. The sample after the cleavage reaction was centrifuged to obtain the supernatant after elution, which was the solution containing the target product protein. The whole cells / precipitate after the first lysis / supernatant after elution were taken for agarose electrophoresis gel detection.

[0163] result

[0164] The specific results are shown in Figure 5. In this case, there is a clear and bright band in the elution product, and no obvious miscellaneous bands. The results show that the design and experimental framework can be used for the recovery and purification of RNA and its complexes. There is a clearly migrated band in the precipitate recovered before elution, but the signal is very weak, indicating that there is a small amount of target product free from the synthetic organelles and the complex bound to the protein A-dCsy4 fusion protein before the cleavage reaction.

[0165] Sequence Details

[0166] The RNA sequence corresponding to the 16S rRNA template is shown in SEQ ID NO: 10 below:

[0167] The RNA sequence corresponding to PA14 is shown in SEQ ID NO: 11 below:

[0168] The corresponding protein sequence of dCsy4 is as shown in following SEQ ID NO:12:

[0169] The protein sequence corresponding to Protein B is shown in SEQ ID NO: 13 below:

[0170] The protein sequence corresponding to Protein A is shown in SEQ ID NO: 14 below:

[0171] Example 5. Recovery of deoxypurpurogenin using CAG repeat sequence-based nucleic acid phase separation synthesis organelles

[0172] System Design

[0173] The target product in this case is deoxyviolacein (DV). Four enzymes, VioA, VioB, VioE, and VioC, derived from Chromobacterium violaceum, act sequentially to convert tryptophan (L-tryptophan) into the purple deoxyviolacein, which has antibacterial and anticancer effects and has an absorption peak around 570nm. In this example, strain 1 uses three plasmids and is co-expressed in the host, wherein prCAG-MS2 is used to construct a synthetic organelle composed of CAG repeats and MS2 RNA hairpin repeats, pVioAMBMEM and pVioCM are co-expressed, and VioA, VioB, VioE, and VioC enzymes with tdMCP are respectively connected at the C-terminus; strain 2 uses three plasmids and is co-expressed in the host, wherein prCAG-BoxB is used to construct a synthetic organelle composed of CAG repeats and BoxB RNA hairpin repeats, and pVioAMBMEM and pVioCM co-express the fusion proteins of the above four tdMCPs and enzymes. The sequences of the pVioAMBMEM and pVioCM plasmids are both from the literature Guo, Haotian, et al. "Spatial engineering of E.coli with addressable phase-separated RNAs." Cell 185.20(2022):3823-3837. Due to the high specificity of the BoxB and MS2 systems, the enzymes VioA, VioB, VioE, and VioC are located inside and outside the synthetic organelles in strains 1 and 2, respectively, resulting in DV production in the synthetic organelles and the cytoplasmic matrix. In this case, the synthetic organelles collect DVs without specific receptor / ligand binding, but only through diffusion within the host cell and nonspecific dissolution and adsorption of DVs, distributing them inside and outside the synthetic organelles.

[0174] Experimental Procedure

[0175] The designated plasmid sets were co-transformed into Escherichia coli BL21AI competent cells to obtain strains 1 and 2. Single clones were picked and cultured at 37°C and 150 rpm for 16 hours, then diluted 1:200 into 5 mL of culture medium and cultured at 37°C and 150 rpm for 4 hours until the logarithmic phase. aTc was added to a final concentration of 50 ng / mL and cultured for another 20 hours. The bacterial solution was centrifuged and the supernatant was removed to obtain a pellet containing cells. The cells were resuspended and centrifuged to wash the cells with phosphate buffered saline (PBS), and the cells were washed twice. The cells were resuspended in PBS and lysis buffer (Bugbuster, Sigma-Aldrich) was added, pipetted to mix, and the reaction was shaken at 900 rpm at room temperature for 20 minutes. Then, the supernatant was discarded, the pellet was recovered, methanol was added, and the supernatant was recovered by centrifugation, which was the eluate containing the target product. 200 μl of the eluate was taken and analyzed by thin-layer chromatography on a silica gel thin-layer chromatography plate (TLC Silica gel 60, Merck, Germany) using a 6:1 chloroform-methanol solution.

[0176] result

[0177] The results are shown in Figure 6. Chromatographic color development under visible light indicates that methanol elution recovered the target product DV, along with a small amount of other byproduct impurities, marked by arrows. The target product recovery rates were similar between the two strains. This demonstrates that this design and experimental framework can be used for the recovery of small molecule compounds and is insensitive to the synthesis location of the target product, allowing it to be synthesized both inside and outside organelles.

[0178] Sequence Details

[0179] The RNA sequence corresponding to rCAG-BoxB is shown in SEQ ID NO: 15 below:

[0180] The amino acid sequence corresponding to VioA is shown in SEQ ID NO: 16:

[0181] The amino acid sequence corresponding to VioB is shown in SEQ ID NO: 17:

[0182] The amino acid sequence corresponding to VioE is shown in SEQ ID NO: 18:

[0183] The amino acid sequence corresponding to VioC is shown in SEQ ID NO: 19:

Claims

1. A method for recovering a target product based on synthetic organelles, comprising the following steps: a. Construct synthetic organelles in the host, b. using the synthetic organelle to collect the target product; c. recovering the synthetic organelle containing the target product; d. releasing the target product from the synthetic organelle containing the target product, thereby obtaining the target product.

2. The method according to claim 1, characterized in that The host includes a cell-free expression system and a cell host, preferably a prokaryotic cell host, more preferably Escherichia coli.

3. The method according to claim 1, characterized in that The synthetic organelle refers to an artificially designed compartmentalized structure. Preferably, the synthetic organelle is a membraneless organelle, which is a biomolecular condensate constructed in a host by a polypeptide and / or protein and / or DNA and / or RNA and / or nucleic acid-protein complex. More preferably, the synthetic organelle is constructed by biomacromolecule components selected from the following groups: a nucleotide sequence repeated 10-1000 times continuously, such as triplets CAG, CCUG, GGGAA, GGGGCC, etc.; an amino acid sequence repeated 3-500 times continuously, such as resilin-like peptides (RLP) repetitions; an intrinsic non-structural region, such as FUS protein, ParB protein; multimerization of multiple biomacromolecules, such as PTB protein and UCUCU sequence repetitions, an artificially designed binary protein two-dimensional structure, an artificially designed binary RNA two-dimensional structure.

4. The method according to claim 1, characterized in that: The target product is one or more substances with a diameter ranging from 0.1 to 500 nanometers. Preferably, the target product is biosynthesized, and more preferably, the biosynthetic pathway of at least one component of the target product is encoded by heterologous DNA, including: small molecules synthesized by heterologous biosynthesis, such as deoxyviolacein; recombinantly expressed polypeptides, proteins, RNA and DNA, such as green fluorescent protein, red fluorescent protein, T4 DNA ligase, 16S rRNA; and multi-component complexes, such as 30S ribosomal subunits, CRISPR-Cas and RNA complexes.

5. The method according to any one of claims 1 to 4, characterized in that The collection method in step b is non-specific and / or specific binding, the target product originates from outside the synthetic organelle and / or is generated in the synthetic organelle. Preferably, the synthetic organelle has a receptor, and the target product is connected to a ligand, so that the synthetic organelle can specifically bind to the target product. Preferably, the receptor / ligand pair includes: complementary paired nucleic acid molecules; capsid proteins and translation operon RNA hairpins of RNA phages such as MS2, PP7, Qbeta; protein N and B box (boxB) RNA hairpins of DNA phages such as λ, 21, P22; CRISPR RNA hairpins and Cas6 proteins of bacteria such as Pseudomonas aeruginosa; two segments of a split protein, such as split green fluorescent protein, the alpha fragment and omega fragment of beta-galactosidase, split T7 RNA polymerase; inducible dimerization or polymerization monomers, such as the photoregulated multimeric green fluorescent protein Dronpa.

6. The method according to any one of claims 1 to 5, characterized in that Step c includes separation, recovery and purification of the synthetic organelles, preferably including the following steps: c1. Collect and lyse the host; c2. separating the precipitate containing the synthetic organelles, preferably, the separation method is centrifugation and / or filtration; c3. Optionally, wash the precipitate to remove impurities, thereby obtaining a purer synthetic organelle.

7. The method according to any one of claims 1 to 5, characterized in that The step d includes separation, recovery and purification of the target product, preferably including the following steps: d1. placing the synthetic organelle in an eluent and inducing the synthetic organelle to release the target product, preferably, the induction method is a cleavage reaction, using a catalyst to cleave the connection site between the ligand and the target substance, the catalyst is such as nickel ions, imidazole-induced dCsy4, Xa factor (factor Xa), enterokinase (Enterokinase), dithiothreitol (DTT), thrombin (Thrombin) or TEV protease; d2. separating the precipitate containing the synthetic organelles to obtain an eluate containing the target product, preferably, the separation method is centrifugation and / or filtration; d3. Optionally, remove impurities in the eluent to obtain a target substance with higher purity.

8. A DNA construct comprising a nucleotide sequence 1 that guides a host to construct a synthetic organelle as defined in the method of any one of claims 1 to 7, and / or a nucleotide sequence 2 that guides and regulates the generation of a target product as defined in the method of any one of claims 1 to 7. Preferably, the DNA construct is composed of the nucleotide sequences 1, 2 and a plasmid vector, such as pACYC184, pACYC177, pET28a(+), pET28b(+), pET-5a(+), pET43.1a, pET-37b(+), pCDFDuet-1, pCOLADuet-1, pRSFDuet-1, pETDuet-1, pUC57, pUC19, pBAD, pBluescript II SK(+), pTrcHis C, pTrcHis A, pTrcHis2C, pBV221, pQE-70, pCold III. pRSET-CFP, pRSET-BFP, pGFPuv, pKD46, pKD4, pTYB1, PinPoint Xa-2, pTWIN1, pRSET C, pSB1C3, pSB3C5, pSB4C5, pSB4K5.

9. An expression system comprising the DNA construct as claimed in claim 8, preferably, the expression system refers to a system for simultaneously constructing the synthetic organelle and producing the target product in prokaryotic cells, and more preferably, the expression system is an Escherichia coli expression system.

Images